International Journal of Biological Macromolecules xxx (xxxx) xxx

BIOMAC-17191; No of Pages 8

Contents lists available at ScienceDirect

International Journal of Biological Macromolecules

j ourna l homepage: ht tp : / /www.e lsev ie r .com/ locate / i j b iomac

Transcriptome based functional identification and application of regulator AbrB onalkaline protease synthesis in Bacillus licheniformis 2709

Cuixia Zhou a,b, Huitu Zhang b, Honglei Fang b, Yanqing Sun b, Huiying Zhou b,Guangcheng Yang a,⁎, Fuping Lu b,⁎⁎a School of Biology and Brewing Engineering, Taishan University, Taian 271018, PR Chinab Key Laboratory of Industrial Fermentation Microbiology, Ministry of Education, College of Biotechnology, Tianjin University of Science &Technology, Tianjin 300450, PR China

⁎ Correspondence to: G. Yang, School of Biology andUniversity, No. 525, Dongyue Road, Daiyue District, Taian⁎⁎ Correspondence to: F. Lu, College of Biotechnology,Technology, No. 29, 13th Road, Tianjin Economic-TechTianjin 300457, PR China.

E-mail addresses: yangguangcheng2008@aliyun.com (.

https://doi.org/10.1016/j.ijbiomac.2020.11.0280141-8130/© 2020 Published by Elsevier B.V.

Please cite this article as: C. Zhou, H. Zhang,alkaline protease..., , https://doi.org/10.1016

a b s t r a c t

a r t i c l e i n f o

Article history:Received 5 September 2020Received in revised form 3 November 2020Accepted 5 November 2020Available online xxxx

Keywords:Transcriptome analysisGene regulationAbrBAlkaline proteaseBacillus licheniformis

Bacillus licheniformis 2709 is the major alkaline protease producer, which has great potential value of industrialapplication, but how the high-producer can be regulated rationally is still not completely understood. It's mean-ingful to understand themetabolic processes during alkaline protease production in industrial fermentationme-dium. Here, we collected the transcription database at various enzyme-producing stages (preliminary stage,stable phase and decline phase) to specifically research the synthesized and regulatory mechanism of alkalineprotease in B. licheniformis. The RNA-sequencing analysis showed differential expression of numerous genes re-lated to several processes, among which genes correlated with regulators were concerned, especially the majordifferential gene abrB on enzyme (AprE) synthesis was investigated. It was further verified that AbrB is a repres-sor of AprE by plasmid-mediated over-expression due to the severely descending enzyme activity (11,300 U/mLto 2695 U/mL), but interestingly it is indispensable for alkaline protease production because the enzyme activityof thenull abrBmutantwas just about 2279U/mL. Thus,we investigated the aprE transcription by eliminating thetheoretical binding site (TGGAA) of AbrB protein predicated by computational strategy, which significantly im-proved the enzyme activity by 1.21-fold and gene transcription level by 1.77-fold in the mid-log phase at a cul-tivation time of 18 h. Taken together, it is of great significance to improve the production strategy, control themetabolic process and oriented engineering by rational molecular modification of regulatory network basedon the high throughput sequencing and computational prediction.

© 2020 Published by Elsevier B.V.

1. Introduction

As the most important kind of industrial enzyme preparation, alka-line protease (AprE) has been widely applied in many industries [1,2].Bacillus licheniformis 2709 has been proven as the most potential AprEproducer harboring many advantages such as easy cultivation, GRAS(generally recognized as safe) status and strong capacity to secrete en-zymes into the fermentation medium [3]. Recently more researcherstended to work on organism screening and breeding, fermentationtechnology optimizing, enzymatic property modifying to improve thealkaline protease production [4,5]. However, less work has been per-formed by the research team from the perspective of regulatory

Brewing Engineering, Taishan271018, PR China.Tianjin University of Science &nological Development Area,

G. Yang), lfp@tust.edu.cn (F. Lu)

H. Fang, et al., Transcriptome/j.ijbiomac.2020.11.028

network though transcriptional regulation is the most active and effec-tive strategy.

With the development of bioinformatics more and more potentiallyvaluable mutations were identified and to date, more than 50 genomesof B. licheniformis including ourAprE high-yielding strain are available atNCBI, so the genomic information of them was gradually parsed. Al-though genome is considered the blueprint of life, when the cellconfronting complex environmental changesmuch information regard-ing the physiological or metabolic processes can't be directly accessiblefrom the genome [6]. Alternatively, many omics technologies have beenapplied as complementary steps toward gaining insights into cell phys-iology [7], among which the transcriptomic analysis based on RNA-seqis one of the most powerful methods that not only facilitate identifyfunctional elements of the genome, gene expression patterns and regu-lation [8], but also offers a direct and effective thinking or methods [9].Thus, the RNA-seq-based transcriptomic has been successfully intro-duced to B. licheniformis understand cell physiology in response to var-ious changes [6,10–12]. However, to our knowledge, no transcriptomicanalysis was employed to examine the genes expression changes ofB. licheniformis across various growth stages in industrial fermentation

based functional identification and application of regulator AbrB on

C. Zhou, H. Zhang, H. Fang et al. International Journal of Biological Macromolecules xxx (xxxx) xxx

medium to specifically investigated the efficient synthesis mechanismof AprE.

As we all known, the regulation of gene expression in response to en-vironmental change is crucial for the overall fitness of the bacterial cell[13]. Importantly, the differentially expressed genes (DEGs) involved intranscription factors always can be exploited to observe their effect ontarget product synthesis [10]. AbrB is one of the global regulatory proteinscontrolling many metabolic processes that occur during the transition ofBacillus strains from exponential growth to stationary phase [14]. Therole of AbrB in degradative enzyme production was once reported thatit directly binds the promoter region of Bacillus subtilis [15], or indirectlyregulates aprE by activating ScoC (repressor of aprE) [16,17]. A numberof reports have previously shown the effect of AbrB modification on im-proving target production, such as deletion of the transition state regula-tor AbrB resulted in a 6-fold increased entianin production [18], an 84-fold increased subtilosin production [19], improving the industrial pro-cess of bacitracin production [12]. However, there have been no studiesto explore the effect of AbrB on the aprE transcription in B. licheniformisaccording to specifically physiological processes to furtherly improvethe ability to synthesize protease.

In this study, we combined the transcriptome analysis results acrossthree production stages in industrial fermentation medium and thor-ough experiments to verify the function of AbrB on aprE expression inB. licheniformis. It could provide an understanding of AbrB regulationand alkaline protease biosynthesis through gene expression and offervaluable basis for furtherly investigating the complexed regulatorymechanism to precisely construct engineering strain with high expres-sion of target protein.

2. Materials and methods

2.1. Strains and culture conditions

All the strains used in this study were listed in Table 1. TheB. licheniformis 2709 cultivated in fermentation medium contained

Table 1Strains and plasmids used in the study.

Strains or plasmids Characteristics or purpose Reference

StrainsE. coli EC135 Vectors construction and cloning Chinese

Academy ofScience

E. coli EC135 pM.Bam

Plasmid DNA methylation modification ChineseAcademy ofScience

B. licheniformis 2709 Wild strain CICCB. licheniformis 2709Δupp (BL Δupp)

Parent host [3]

BL Δabr ΔabrB, abrB gene deletion This workBL CA Complementary strain of abrB in genome This workBL ΔA ΔaprE, aprE defective strain in genome [42]BL Δupp-pWHAbr Recombinant strain carrying pWHAbr This workBL ΔA-pWHA aprE defective strain carrying pWHA [42]BL ΔA-pWHAM aprE defective strain carrying pWHAM This work

PlasmidspWH1520 Shuttle expression vector, Ampr (E. coli)

and Tetr (Bacillus): MCSNankaiUniversity

pKSVT Temperature-sensitive shuttle plasmid,Kanar

HubeiUniversity

pTU pKSVT, upp gene [42]pTUA Knockout vector, abrB deletion This workpTUBA Backcrossed vector, abrB integration This workpWHAbr pWH1520 carrying abrB expression

cassetteThis work

pWHA pWH1520 carrying aprE expressioncassette

[42]

pWHAM pWH1520 carrying aprE expressioncassette missing the DNA binding site

This work

2

corn starch (64 g/L), soybean meal (40 g/L), Na2HPO4 (4 g/L), KH2PO4

(0.3 g/L), and thermostable amylase (0.7 g/L) (Biotopped, Beijing,China), pH 7.2 for 12 h, 48 h and 60 h was individually collected to beisolated RNA and high-throughput sequenced by GENEWIZ (Nanjing,China). B. licheniformis strain BL Δupp was used as the parent strain toinvestigate the effect of regulatory protein AbrB; E. coli strain EC135was used to construct vectors and the E. coli strain EC135/pM.Bamwas used for DNA methylation [20]. The shuttle vectors pWH1520were applied to over express abrB and the temperature-sensitive shut-tle vector pKSVT was used to accomplish gene knockout.

Luria Bertani (LB) medium was used for the cultivation of Bacillusand E. coli, with antibiotics (100 mg/L ampicillin, 50 mg/L spectinomy-cin, 20 mg/L tetracycline, 30 mg/L 5-fluorouracil, 50 mg/L kanamycin)when necessary. The E. coli and Bacillus strains grown at 37 °Cwith aer-ation, except for the plasmid integration/excision experiments, whichwere conducted at 45 °C. For the production of alkaline protease, theLB seed culture was grown in 50/250 mL at 37 °C until the OD600

reached ~1.0, and then transferred into 100mLof fermentationmediumwith 2 mL inoculation.

2.2. Plasmid construction

The plasmids used in the studywere listed in Table 1, and the primesused in the studywere presented in the appendix file Table S1. To deletethe gene abrB, the left and right homologous arms (~450 bp, LH and RH)were amplified using the primer pairs Abr-LF/Abr-LR and Abr-RF/Abr-RR, respectively, and were cloned between the BamHI/SacII sites ofpTU by fusion cloning to obtain the knockout vector pTUA. Meanwhile,the abrB backcross vector pTUBA was constructed by similar manipula-tions. For overexpressing the AbrB regulator, the abrB expression cas-sette (including its encoding gene of 285 bp and upstream regulatoryregion of ~250 bp from 5′ to 3′) amplified by PCR using primers OE-F/OE-R from the genome of B. licheniformis was individually cloned be-tween the BamHI/SphI sites of pWH1520 by in-fusion cloning to formpWHAbr. The expression vector pWHAbr was transformed into BLΔupp by electroporation generating the recombinant strain BL Δupp-pWHAbr to accomplish the over-expression of abrB. The aprE expres-sion vector pWHAM lacking the binding site within the aprE promoterregion was constructed by PCR with primers KOD-F/KOD-R usingKOD-Plus-Mutagenesis Kit (TOYOBO, Japan).

2.3. Gene knockout and genetic complementation

To disrupt the abrB gene, the knock-out plasmid pTUA was electro-transferred into BL Δupp after methylated modification in EC135/pM.Bam. The deficient mutant was screened by the gene editing proceduredescribed in the previous study [21]. The primers Abr-VF/T-R were ap-plied to identify single-crossover recombinants by colony PCR, basedon which followed colony PCR reaction was performed to confirm thedouble-cross mutants using the primers Abr-VF/Abr-VR (the genomicsequences flanking the homologous arms) and were further verifiedby sanger dideoxy sequencing. Similarly, the abrB backcrossed strainwas constructed by the backcross vector pTUBA into the abrB deficientmutant using the same gene editing method.

2.4. Enzyme activity measurement of alkaline protease

In the study, the synthesis of alkaline protease in different strainswas investigated at different cultivation times in shake-flask fermenta-tion. Considering the positive correlation between the alkaline proteaseactivity and the expression of aprE, the enzyme activity in fermentationsupernate was determined using the method published by the nationalstandardization administration commission, which was presented insome detail in our previous study [22]. Here, the protease activity unitwas defined as that 1 mL enzyme solutions hydrolyzed casein for

C. Zhou, H. Zhang, H. Fang et al. International Journal of Biological Macromolecules xxx (xxxx) xxx

1 min to produce 1 μg tyrosine at 40 °C and pH 10.5, which wasexpressed in U/mL.

2.5. Analysis of transcriptional levels

In order to analyze the transcriptional level of genes, the strains cul-tured in fermentation medium for different times at 37 °C were col-lected and the total RNA was extracted by TRIzol® Reagent (Promega,USA),whose concentrationwas tested by aNanoDrop 1000 spectropho-tometer (Thermo Scientific, USA). The trace DNA was removed byDNase I purchased from Takara and the cDNA was synthesized usingFastQuant RT Kit (Tiangen, Beijing). The quantitative real-time PCR(qRT-PCR) was performed using TB Green Premix Ex Taq™ II (TaKaRa,Japan) by ABI Stepone Real-Time PCR System (Thermo Scientific,USA). The primers listed in the additional file (Table S1) were used toamplify the related genes from the parent strain or the other mutants.The16S rRNA amplified by primers S-F/S-R ofB. licheniformiswas the in-ternal reference to normalize the results. The transcriptional levels ofthe different genes were investigated and compared using the 2−ΔΔCt

method.

2.6. Bioinformatics analyses

According to the method reported by Yang, the De novo tran-scriptome analysis was performed [23] and the longest transcripts ofevery genewas treated as unigene, all ofwhichwere assigned tofive da-tabases. The levels of each gene expression were assessed by normal-ized FPKM (fragments per kilobase of transcript per million mappedreads) by RSEM (RNA-seq by expectation-maximization) [24].

In total, the abrB gene sequences and regulatory regions of aprE fromB. subtilis (GeneBank number: 30588) and B. licheniformiswere appliedformultiple sequence alignments. The genomic information of B. subtiliscan be available in NCBI (https://www.ncbi.nlm.nih.gov/). The conser-vatism of the conserved region of abrB binding sites deduced from theprevious studies in DBTBs (http://dbtbs.hgc.jp/) was further analyzedby Weblogo in the study.

2.7. Availability of supporting data

The sequences of the aprE expression cassette, the related genes andthe relevant homologous repair sequence in the research have been de-posited in GenBank with an accession number of CP033218. The tran-scriptome data of the original strain has been reserved in the NCBI'sSequence Read Archive (SRA) database under the accession numberSRP178635.

2.8. Statistic method

All experimentswere implemented in triplicate, and the experimen-tal data were expressed as the means ± SD.

3. Results and discussion

3.1. Validation of RNA-seq data by qRT-PCR

Weperformed a transcriptome analysis based on RNA sequencing ofB. licheniformis subjected to three cultivation times in fermentationme-dium. To identify genes with altered transcription levels under differentcultivation times, the overall transcription levels of genes by FPKMmet-rics was quantified. The differential gene expressions of 12 h, 48 h and60 h treatmentswere analyzed, and theDEGswere identified, especiallythose closely related to the transcription of aprE such as Spo0A, DegU,ScoC and SinR. Compared with the 12 h, 233 genes were greatly upreg-ulated at the 48 h treatment, as compared to 160 downregulated genes;similarly, compared with the 48 h, 172 genes were greatly upregulatedat the 60 h treatment, as compared to 19 downregulated genes. The

3

changes of transcription levels of spo0A, degU, scoC and sinR (Hpr) wasthat Spo0A might be the positive regulatory because its transcriptionlevel increased at the first stage (12 h to 48 h) and then decreasedwith the elongation of culture time to 60 h; meanwhile, the scoC andHpr transcription levels showed an opposite character, which mightdemonstrate their negative regulatory effect on the expression of aprE.The deduced conclusion was absolutely consistent with that was re-ported in the B. subtilis, which was summarized by us in previousstudy [22]. However, DegU have been reported that it was a directlypositive activator of aprE in Bacillus by many researches [15], but thechanging trends of its transcriptional level here were similar to the neg-ative regulator, which might be attributed to the possible long intervalfrom 12 h to 48 h.

The qRT-PCR experiment was performed to verify the RNA-seq datain the study. The 16 genes encoding sigma factors involved in sporula-tion and important global transcription regulation were chosen forqRT-PCR validation. The transcription level and dynamic changes ofthe genes encoding sigma factors could more accurately reflect thechanges of the internal and external environment of the cells. Therefore,their qRT-PCR results might more accurately reflect the accuracy of thetranscriptomedata. These genes' expression profiles at different cultiva-tion times (12 h, 48 h and 60 h)were shown in Table 2, which indicatedthat the expression patterns of these sig genes were consistent with theRNA-seq data illustrated in the heat-map of these genes (Fig. 1). Takethe transcription levels of sigA and sigF as example, the FPKM of themwere 634.50, 144.41, 268.91 and 505.82, 438.59, 810.03, respectivelyand the differential were also presented clearly in the heat-map,whose changing trends were particularly compatible with the resultsof qRT-PCR (Table 2), indicating the reliability of the transcriptomeanalysis in the currentwork. The difference of transcription levels of dif-ferent functional genes strictly reflects protein function in cellular pro-cess, for example, SigA was described as the RNA polymerase majorsigma-43, which regulates essential genes' transcriptional initiation[25]; thus it was largely transcribed at the beginning of the growth.While, SigF as RNA polymerase sporulation-specific sigma is synthe-sized shortly after the onset of sporulation but do not become activeuntil after polar division [26], which is corresponding to the tran-scriptome analysis result. There are numerous researches were per-formed to screen strong promoters, identify potential regulators andilluminate synthesis or metabolic mechanism based on the specifictranscriptome data [27–29]. Overall, in order to elucidate the aprE regu-latory molecularmechanism in B. licheniformis under current fermenta-tion condition, the role of the regulatory factor AbrB could be speculatedon the basis of the transcriptome data.

3.2. AbrB-mediated regulation of the aprE in B. licheniformis

According to the transcriptome data, it was found that DEGs relatedto several processes (the supplementary material, Fig. S1), amongwhich genes correlated with regulators were focused on, especiallythe transcription levels of abrB and aprE at different fermentation periodwere obtained, whichwas shown in Fig. 2-A. They both belonged to theDEGs and the transcription level of abrB decreased first and then in-creased, but the transcription level of aprE had a totally different trendsuggesting that the AbrB could be regarded as a negative regulatory fac-tor for aprE transcription in B. licheniformis. The regulatory mechanismand effect of AbrB on the aprE transcription in B. licheniformismight besimilar to that in B. subtilis [30], whichwas further validated by deletionmutation and over-expression of abrB.

Thus, the abrB null mutant strain was constructed usingthe temperature-sensitive plasmid pTUA containing an uppcounter-selectable marker (Fig. 2-B), which was transformed intothe parent strain BL Δupp and the screening procedure of single-cross recombinant and double-cross mutant were shown in Fig. 2-C. A 285 bp DNA fragment was targeted to be deleted from the chro-mosome using a homologous arm (HA) of 880 bp. As presented in

Table 2The relative transcriptional level of different sigma factors at different fermentation times.

Name sigL sigA sigB sigD sigE sigF sigG sigH sigI sigJ sigK sigM sigV sigW sigX sigY ylaC

12 h 40.07 54.29 11.33 13.69 11.15 43.98 17.59 17.02 15.93 6.02 16.00 11.23 4.87 15.86 16.37 9.74 4.8148 h 14.11 11.69 5.41 2.95 2.90 50.91 4.02 4.99 3.42 1.29 4.06 2.68 1.26 12.19 3.85 3.52 1.0060 h 29.96 23.38 23.72 9.87 11.23 246.66 21.41 34.67 11.30 4.49 15.61 10.05 5.91 98.63 18.49 6.69 3.63

Note: The transcriptional level of ylaC at 48 h was set as 1.

C. Zhou, H. Zhang, H. Fang et al. International Journal of Biological Macromolecules xxx (xxxx) xxx

Fig. 2-C, the single-crossover recombinants were identified with aband of 900 bp, and the double-crossover mutants were verified bya PCR product of approximately 920 bp, generating the engineeredstrain called BL Δabr after sequencing confirmation. The enzyme ac-tivity of alkaline protease and aprE transcriptional level were deter-mined to investigate the influence of AbrB on aprE expression aftercultivation in the fermentation medium at 37 °C for 48 h. As shownin Fig. 2-E, the enzyme activity and transcriptional level of the abrBdeficient mutant was 2279 U/mL and 1, respectively, which wereboth lower than 20% of that in the control. Unexpectedly, disruptionof abrB resulted in a dramatically decline of aprE expression, not theenhancement of target protein. Koetje et al has reported that abrBdeficient of B. subtilis could reduce aprE-lacZ expression slightly forunknown reason [31]; besides, Ogura et al. also observed the slightdecrease in aprE-lacZ expression in the abrB null mutant ofB. subtilis [15]. In a word, not like other repressors (SinR and ScoC)whose mutant could efficiently enhance the aprE expression inB. subtilis [32], AbrB as a negative regulator had complicated effect

Fig. 1. Cluster map of the genes encoding sigma

4

on the transcription of aprE because its disruptant remarkably hin-dered the aprE synthesis in B. licheniformis, which drove us to explorethe effect of high-concentration on aprE expression.

The abrB over-expression vector pWHAbr was verified using colonyPCR with a band of 605 bp (Fig. 2-D), then it was transferred into BLΔupp by electro-transformation after Sanger sequencing. Theproduction capacity of AprE in the over-expressed recombinant (BLΔupp-pWHAbr) and the control harboring the pWH1520 (BL Δupp-pWH1520) were determined, which was similar to that of the abrBdisruptant. As shown in Fig. 2-E, the enzyme activity and transcriptionallevel of BLΔupp-pWHAbrwas 2695 U/mL and 1.15, respectively, whichconformed to the function of negative regulators [33]. On the basis of allthe resultsmentioned above,we hypothesized that AbrB as amajor reg-ulator was a repressor for aprE expression, but it's indispensable forAprE synthesis under current transcriptional mechanism condition.Many regulators activate or inhibit the transcription of target genes byDNA-binding with the promoter regions and directly interacting withRNA polymerases to regulate it initiate transcription [34]. So it's an

factors in B. licheniformis at different times.

Fig. 2. Verification of AbrB-mediated regulation of aprE in B. licheniformis. A: The expression levels of aprE and abrB according to the transcriptome data. B: Scheme of the gene editingsystem based on the temperature-sensitive plasmid and counter-selectable marker (upp gene). U and D represented the homologous repair templates. C: Screening process of the abrBnull mutant. M indicates the DNA marker. Lane 1 was the verification of the single-crossover recombinant with a band of about 900 bp approximate to the size of homologous repairtemplate, lane 2 was PCR products of the negative control without the corresponding band, lane 3 was the negative control with a band of about 1200 bp, lane 4 was the correctdouble-crossover mutant with a band of about 900 bp. D: Verification of the transformants with abrB over-expressed vector pWHAbr by colony PCR of abrB expression cassette. Lane 1was the negative control without the corresponding band, lane 2 was the correct vector with a band of 605 bp. E: The enzyme activity and transcription levels of aprE in the abrBmutant, over-expressed recombinant, the backcrossed strain and the control strain. Transcriptional level of aprE in the BL Δabr was defined as 1 and the enzyme activity of alkalineprotease and aprE transcriptional level were determined after cultivation in the fermentation medium at 37 °C for 48 h.

Fig. 3. Verification and characterization of the supplementary strain of abrB. Confirmationof the supplementary strain of abrB by colony PCR. M was DNA marker, Lane 1 was thecorrect single-cross recombinant with a band of 1300 bp, lane 2 was the negativecontrol without band, lane 3 was the negative control of double-cross mutant with aband of 920 bp, lane 4 was the correct double-cross mutant with a band of 1200 bp.

C. Zhou, H. Zhang, H. Fang et al. International Journal of Biological Macromolecules xxx (xxxx) xxx

alternative approach to identify the DNA-binding sites and introducespecific mutation in it to eliminate the regulatory effect instead of directdeletion of the regulator. It is of great significance to identify the AbrB-binding sites of the aprE gene in B. licheniformis for controlling the roleof AbrB in aprE expression.

To prove that the observed phenotypes resulted from the introducedmutations, the backcrossed experiment was carried out, which gener-ated the complementary strain by genomic integrating genes of abrB,called BL CA, which were verified by colony PCR presented Fig. 3. Theenzyme activity and transcriptional level of aprE in the complementarystrain showed no significant differencewith the parent strain in Fig. 2-E,which implied the function of AbrB.

3.3. Identification of AbrB-binding sites of the aprE

The key to regulate genes expression lies in the regulation of tran-scriptional initiation [35]. So identification of the transcription factorbinding sites is extremely vital during the study of transcriptional regu-lation, and the accurate loci of the protein-DNA binding sites can facili-tate us understanding and researching into the spatiotemporalregulation of target genes through different transcription factors [36].To identify the binding site of AbrB to the regulatory region of aprE inB. licheniformis, the binding affinity of them was examined using elec-trophoretic mobility shift assay (EMSA) and DNase I foot-printing byus, which unfortunately failed to find out the protected sequences asshown in the additional files (Fig. S3). However, many reports have sub-stantiated the negative regulatory mechanism of AbrB to target genesby direct binding to the promoters of the genes including aprE inB. subtilis [37]. It's possibly difficult to capture the combination of AbrBand DNA fragment in vitro, which might be attributed to the experi-mental conditions used in the study or the native property of the

5

protein. With the development of bioinformatics and microarray tech-niques, various computational methods have been developed to predictprotein-DNA binding motif according to protein sequence and/or 3Dstructure, which play a crucial part in complementing experimentalstrategies and accelerate the rate of regulon discovery [38].

C. Zhou, H. Zhang, H. Fang et al. International Journal of Biological Macromolecules xxx (xxxx) xxx

First, the alignment of AbrB in B. subtilis and B. licheniformiswas per-formed,which indicated that the amino acid (aa) sequences shared highidentity of 95.74% (90 aa of 94 aa; Fig. 4-A). As Fig. 5-A shown, N-terminal DNA binding domain (AbrBN, 1–52 aa residues) are perfectlyin tune with each other, whose influence is much greater as it is theonly domain currently known to directly contact DNA [39]. So itwas de-duced that the two AbrB ought to have a similar regulatory function.Second, based on the results of wet lab experiments about all the re-ported AbrB binding sites in B. subtilis that was listed in the additionalmaterials (Table S2), we predicted the potential AbrB-DNA-bindingsite of aprE promoter (Fig. 4-B). In accordance with the more than 20identified DNA-binding sites of AbrB [37], the possible consensus se-quence TGG/A/TNA was observed as shown in Fig. 4-B, based onwhich the putative binding sequence of aprE (TGGAA) located down-stream 11–15 bp of the transcription start site (TSS) in B. licheniformiswas obtained (Fig. 4-C). Here, the repression mechanism of AbrBmight like GalR [40], whose promoter was repressed by multiple pro-tein molecules binding to the downstream of promoter, and mightcause repression by DNA looping, which blocked transcription initiationin the looped domain as shown in Fig. 4-D. In view of that althoughAbrBregulated a lot of genes in B. subtilis, it has not recognized a clear conser-vative DNA motif [40], the predicted DNA-binding site should be veri-fied by further mutation experiment.

3.4. Inactivation and application of the AbrB binding site in aprE

To test the accuracy of the binding site, we sought to introducemutations into the putative AbrB-binding site of the aprE gene in

Fig. 4. Identification of AbrB-binding sites of the aprE B. licheniformis. A: The homology of AbrBbinding site of aprE according the reported 20 identified DNA-binding sites of AbrB. C: Finemaptranslational initiation site. The predicted region of AbrB is underlined. D: The possible reprerepression might be caused by DNA looping, which shuts off transcription initiation in the looin RNA polymerase to recruit the polymerase to the promoter. The bigger gray ball representCTD. (For interpretation of the references to color in this figure legend, the reader is referred t

6

B. licheniformis by plasmid. Based on the genome sequence ofB. licheniformis 2709 [41], a recombinant harboring the aprE expressionvector pWHAM lacking the 5-bp binding site within the aprE promoterregion was engineered. We previously constructed the control strain BLΔA-pWHA carrying the expression plasmid pWHA, whose genomicaprE expression cassette was disrupted [21]. A 45-bp region (AATTGGAATAGATTATATTATCCTTCTATTTAAA TTATTCTGAAT) covering the de-duced binding site was removed from the expression vector, whichwas confirmed by colony PCR using the primer Y-F/apr-R (Fig. 5-A).The product of PCR with 1203 bp failed to be obtained using the correctvector as template, which was further confirmed by DNA sequencing(Fig. 5-B). To further determine whether the binding site is crucial foraprE expression in B. licheniformis, the transcriptional level and enzymeactivity of the recombinant BL ΔA-pWHAM with mutation were deter-mined after cultivation for different time in fermentation medium(Fig. 5-C and D). The transcriptional level of aprE in BL ΔA-pWHAMwas higher than that of the control strain from 12 h to 24 h; accordingly,the enzyme activity was also superior to that of the control, which indi-cated that the transcription level of aprEwas improved in the exponen-tial growth period. Though the transcriptional level of aprE and enzymeactivity increased approximately 1.77-fold and 1.21-fold in the mid-logarithmic phase, respectively, there was no significant difference ofthe maximal synthesis level of aprE between the mutated recombinantand the control strain. Themodified regulatory region did not work likethe constitutive promoter p43 [43], but obviously raised the expressioncapacity of aprE in the early growth phase, which implied the signifi-cance of molecularmodification of the host, especially the genetic mod-ification of tuning the regulatory mechanism.

amino acid between B. licheniformis and B. subtilis (90/94 aa 95.74%). B: The predicted DNAping for the aprE promoter. The regions of -35 and -10 are highlighted in red.M representsssion model by AbrB. The AbrB tetramer binds to the aprE promoter-distal sites, and theped domain by preventing the contact of carboxy-terminal domain of α subunit (α-CTD)s amino-terminal domain of α subunit (α-NTD), and the smaller gray ball represents α-o the web version of this article.)

Fig. 5. Inactivation and application of the AbrB binding site in aprE. A: Confirmation of the aprE expression vector withmutation by colony PCR. Lane 1was the negative control with a PCRproduct of 1200 bp; lane 2was the correct vector pWHAMwithout the corresponding PCR band. B: Verification of pWHAMdeleting 45-bp by Sanger sequencing. C: Transcriptional level ofthe recombinants harboring different expression vectors of aprE. D: Enzyme activity of the recombinants harboring different expression vectors of aprE.

C. Zhou, H. Zhang, H. Fang et al. International Journal of Biological Macromolecules xxx (xxxx) xxx

TheAbrB's critical role in survival and protection reflects AbrB is cen-tral in coordinating relative response, which demonstrates that it is vitalto fully understand its molecular mechanisms of action [37,43]. In thestudy, the effect of improving aprE synthesis was not an expectantgreat enhancement suggesting that there might be other AbrB-bindingsite of aprE promoter region such as WAWWTTTWCAAAAAAW, whichmight be attributed to the flexibility of its functional structure [44] orto other repressors regulating aprE expression. However, the produc-tion of the B. licheniformis aprE in early fermentation was enhanced tosome extent demonstrating that the computational approach can rap-idly and cheaply identify DNA-binding sites of one target gene, whichwere of great importance in comprehending its biological functions.Liu et al. estimated the sensitivity and specificity of their predictionsbased on known Spo0A-DNA binding sites by computational identifica-tion of the Spo0A-phosphate regulons being essential for the cellulardifferentiation and sporulation in Gram-positive bacteria, which pro-vided information toward understanding the role of Spo0A-phosphatein the entire genetic network [45]. We have previously identified theSpo0A-DNA binding site of aprE in B. licheniformis by wet lab experi-ments covering the conserved sequences that obtained via differentcomputational algorithms [22],which proved the accuracy and practicalapplications in the topic of protein DNA-binding site prediction. Thus,novel prediction methods should be used to find more precise bindingsite ormorework should be performed to improve experimental condi-tion for identifying the sites.

4. Conclusions

Here, the transcription database of three enzyme-producing stageswas analyzed to specifically explore the potential regulatory mechanismof aprE in B. licheniformis, which showed differential expression of manygenes of several processes, among which genes related to regulatorswere focused on by us, especially the effect of the regulator abrB on en-zyme (AprE) synthesis was investigated. It was verified that AbrB is a re-pressor of AprE by plasmid-mediated over-expression of abrB, but itseemingly is indispensable for AprE production due to the extremely de-creased enzyme activity of null abrBmutant (2279U/mL). Thus,we inves-tigated the aprE transcription by eliminating the theoretical binding site

7

(TGGAA) between AbrB protein and regulatory region, which signifi-cantly improved the enzyme activity by 1.21-fold and gene transcriptionlevel by 1.77-fold in mid-log phase. In summary, it is of great significanceto improve cell performance producing target protein by rational molec-ularmodification of regulatory network based on the high throughput se-quencing and computational prediction.

Funding

This study was mainly supported by the National Science and Tech-nology Major Project (Number: 2019ZX08010004-012) and in part bythe Excellent Doctoral Dissertation Innovation Funding Project of Tian-jin University of Science and Technology (2019006).

CRediT authorship contribution statement

The research was designed and planned by Cuixia Zhou and HuituZhang. Cuixia Zhou, Honglei Fang, Yanqing Sun, and Huiying Zhou con-ducted the experiments. All the authors analyzed the data. Cuixia Zhouand Huitu Zhang mainly wrote the manuscript with input from all au-thors. All authors read and approved the final manuscript.

Declaration of competing interest

The authors declare that there is not any competing interest.

Acknowledgements

We thank Professor Shouwen Chen from Hubei University, ProfessorCunjiang Song from Nankai University and Professor Tingyi Wen fromChinese Academy of Sciences for kindly providing the plasmids pKSVT,pWH1520 and the strains E. coli EC135 and EC135/pM.Bam, respectively.

Appendix A. Supplementary data

Supplementary data to this article can be found online at https://doi.org/10.1016/j.ijbiomac.2020.11.028.

C. Zhou, H. Zhang, H. Fang et al. International Journal of Biological Macromolecules xxx (xxxx) xxx

References

[1] E. Sari, E. Logoglu, A. Oktemer, Purification and characterization of organic solventstable serine alkaline protease from newly isolated Bacillus circulans M34, Biomed.Chromatogr. 29 (2015) 1356–1363, https://doi.org/10.1002/bmc.3431.

[2] A. Hammami, M. Hamdi, O. Abdelhedi, M. Jridi, M. Nasri, A. Bayoudh, Surfactant- andoxidant-stable alkaline proteases from Bacillus invictae: characterization and poten-tial applications in chitin extraction and as a detergent additive, Int. J. Biol.Macromol. 96 (2017) 272–281, https://doi.org/10.1016/j.ijbiomac.2016.12.035.

[3] C.X. Zhou, H. Liu, F.Y. Yuan, H.N. Chai, H.K. Wang, F.F. Liu, Y. Li, H.T. Zhang, F.P. Lu,Development and application of a CRISPR/Cas9 system for Bacillus licheniformis ge-nome editing, Int. J. Biol. Macromol. 122 (2019) 329–337, https://doi.org/10.1016/j.ijbiomac.2018.10.170.

[4] R. Gupta, Q.K. Beg, P. Lorenz, Bacterial alkaline proteases: molecular approaches andindustrial applications, Appl. Microbiol. Biotechnol. 59 (2002) 15–32, https://doi.org/10.1007/s00253-002-0975-y.

[5] G. Banerjee, A.K. Ray, Impact of microbial proteases on biotechnological industries,Biotechnol. Genet. Eng. Rev. 33 (2017) 119–143, https://doi.org/10.1080/02648725.2017.1408256.

[6] S. Wiegand, S. Dietrich, R. Hertel, J. Bongaerts, S. Evers, S. Volland, R. Daniel, H.Liesegang, RNA Seq of Bacillus licheniformis active regulatory RNA featuresexpressed within a productive fermentation, BMC Genomics 667 (2013)https://doi.org/10.1186/1471-2164-14-667.

[7] L.L. Han, H.H. Shao, Y.C. Liu, G. Liu, C.Y. Xie, X.J. Cheng, H.Y. Wang, X.M. Tan, H. Feng,Transcriptome profiling analysis reveals metabolic changes across various growthphases in Bacillus pumilus BA06, BMC Microbiol. 17 (2017) 156, https://doi.org/10.1186/s12866-017-1066-7.

[8] R. Sorek, P. Cossart, Prokaryotic transcriptomics: a new view on regulation, physiol-ogy and pathogenicity, Nat. Rev. Genet. 11 (2010) 9–16, https://doi.org/10.1038/nrg2695.

[9] U. Nagalakshmi, K. Waern, M. Snyder, RNA-Seq: a method for comprehensive tran-scriptome analysis, Curr. Protoc. Mol. Biol. 11 (2010) 11–13, https://doi.org/10.1002/0471142727.mb0411s89.

[10] J. Guo, G. Cheng, X.Y. Gou, F. Xing, S. Li, Y.C. Han, L. Wang, J.M. Song, C.C. Shu, S.W.Chen, L.L. Chen, Comprehensive transcriptome and improved genome annotationof Bacillus licheniformis WX-02, FEBS Lett. 589 (2015) 2372–2381, https://doi.org/10.1016/j.febslet.2015.07.029.

[11] X. Liu, H. Yang, J. Zheng, Y. Ye, L. Pan, Identification of strong promoters based on thetranscriptome of Bacillus licheniformis, Biotechnol. Lett. 39 (2017) 873–881, https://doi.org/10.1007/s10529-017-2304-7.

[12] C.C. Shu, D. Wang, J. Guo, J.M. Song, S.W. Chen, L.L. Chen, J.X. Gao, Analyzing abrB-knockout effects through genome and transcriptome sequencing of Bacilluslicheniformis DW2, Front. Microbiol. 9 (2018) 307, https://doi.org/10.3389/fmicb.2018.00307.

[13] D.F. Browning, S.J. Busby, Local and global regulation of transcription initiation inbacteria, Nat. Rev. Microbiol. 14 (2016) 638–650, https://doi.org/10.1038/nrmicro.2016.103.

[14] M.A. Hamon, N.R. Stanley, R.A. Britton, A.D. Grossman, B.A. Lazazzera, Identificationof AbrB-regulated genes involved in biofilm formation by Bacillus subtilis, Mol.Microbiol. 52 (2004) 847–860, https://doi.org/10.1111/j.1365-2958.2004.04023.x.

[15] M. Ogura, K. Shimane, K. Asai, N. Ogasawara, T. Tanaka, Binding of response regula-tor DegU to the aprE promoter is inhibited by RapG, which is counteracted by extra-cellular PhrG in Bacillus subtilis, Mol. Microbiol. 49 (2003) 1685–1697, https://doi.org/10.1046/j.1365-2958.2003.03665.x.

[16] M.L. Arrieta-Ortiz, C. Hafemeister, A.R. Bate, T. Chu, A. Greenfield, B. Shuster, S.N.Barry, M. Gallitto, B. Liu, T. Kacmarczyk, F. Santoriello, J. Chen, C.D.A. Rodrigues, T.Sato, D.Z. Rudner, A. Driks, R. Bonneau, P. Eichenberger, An experimentally sup-ported model of the Bacillus subtilis global transcriptional regulatory network,Mol. Syst. Biol. 11 (2015) 839, https://doi.org/10.15252/msb.20156236.

[17] G. Barbieri, A.M. Albertini, E. Ferrari, A.L. Sonenshein, B.R. Belitsky, Interplay of CodYand ScoC in the regulation of major extracellular protease genes of Bacillus subtilis, J.Bacteriol. 198 (2016) 907–920, https://doi.org/10.1128/JB.00894-15.

[18] S.M. Bochmann, T. Spiess, P. Kotter, K.D. Entian, Synthesis and succinylation ofsubtilin-like lantibiotics are strongly influenced by glucose and transition state reg-ulator AbrB, Appl. Environ. Microbiol. 81 (2015) 614–622, https://doi.org/10.1128/AEM.02579-14.

[19] T. Stein, Oxygen-limiting growth conditions and deletion of the transition state reg-ulator protein AbrB in bacillus subtilis 6633 result in an increase in subtilosin pro-duction and a decrease in subtilin production, Probiotics. Antimicro. Prot. 12(2020) 725–731, https://doi.org/10.1007/s12602-019-09547-4.

[20] G. Zhang, W.Wang, A. Deng, Z. Sun, Y. Zhang, Y. Liang, Y. Che, T. Wen, A mimicking-of-DNA-methylation-patterns pipeline for overcoming the restriction barrier of bac-teria, PLoS Genet. 8 (2012), e1002987, https://doi.org/10.1371/journal.pgen.1002987.

[21] C.X. Zhou, H.Y. Zhou, D.K. Li, H.T. Zhang, H.B. Wang, F.P. Lu, Optimized expressionand enhanced production of alkaline protease by genetically modified Bacilluslicheniformis 2709, Microb. Cell Factories 19 (2020) 45, https://doi.org/10.1186/s12934-020-01307-2.

[22] C.X. Zhou, H.Y. Zhou, H.L. Fang, Y.Z. Ji, H.B. Wang, F.F. Liu, H.T. Zhang, F.P. Lu, Spo0Acan efficiently enhance the expression of the alkaline protease gene aprE in Bacillus

8

licheniformis by specifically binding to its regulatory region, Int. J. Biol. Macromol.159 (2020) 444–454, https://doi.org/10.1016/j.ijbiomac.2020.05.035.

[23] M. Yang, L. Lu, S. Li, J. Zhang, Z. Li, S. Wu, C. Wang, Transcriptomic insights intobenzenamine effects on the development, aflatoxin biosynthesis, and virulence ofAspergillus flavus, Toxins 11 (2019) 70, https://doi.org/10.3390/toxins11020070.

[24] Y.J. Zhu, J. Xu, C. Sun, S.G. Zhou, H.B. Xu, D.R. Nelson, J. Qian, J.Y. Song, H.M. Luo, L.Xiang, Y. Li, Z.C. Xu, A.J. Ji, L.Z. Wang, S.F. Lu, A. Hayward, W. Sun, X.W. Li, D.C.Schwartz, Y.T. Wang, S.L. Chen, Chromosome-level genome map provides insightsinto diverse defense mechanisms in the medicinal fungus Ganoderma sinense, Sci.Rep. 5 (2015) 11087, https://doi.org/10.1038/srep11087.

[25] E.F. Ruff, M.T. Record, I. Artsimovitch, Initial events in bacterial transcription initia-tion, Biomolecules 5 (2015) 1035–1062, https://doi.org/10.3390/biom50210351035-1062.

[26] C.X. Zhou, H.Y. Zhou, H.T. Zhang, F.P. Lu, Optimization of alkaline protease produc-tion by rational deletion of sporulation related genes in Bacillus licheniformis,Microb. Cell Factories 18 (2019) 127, https://doi.org/10.1186/s12934-019-1174-1.

[27] S. Jiao, X. Li, H. Yu, H. Yang, X. Li, Z. Shen, In situ enhancement of surfactin biosynthe-sis in Bacillus subtilis using novel artificial inducible promoters, Biotechnol. Bioeng.114 (2017) 832–842, https://doi.org/10.1002/bit.26197.

[28] G. Wang, T. Shi, T. Chen, X. Wang, Y. Wang, D. Liu, X. Zhao, Integrated whole-genome and transcriptome sequence analysis reveals the genetic characteristics ofa riboflavin-overproducing Bacillus subtilis, Metab. Eng. 48 (2018) 138–149,https://doi.org/10.1016/j.ymben.2018.05.022.

[29] D. Bassi, F. Colla, S. Gazzola, E. Puglisi, M. Delledonne, P.S. Cocconcelli, Transcriptomeanalysis of Bacillus thuringiensis spore life, germination and cell outgrowth in avegetable-based food model, Food Microbiol. 55 (2016) 73–85, https://doi.org/10.1016/j.fm.2015.11.006.

[30] M.A. Strauch, J.A. Hoch, Transition state regulators sentinels of Bacillus subtilis post-exponential gene expression, Mol. Microbial. 7 (1993) 337–442, https://doi.org/10.1111/j.1365-2958.1993.tb01125.x.

[31] E.J. Koetje, A. Hajdo-Milasinovic, R. Kiewiet, S. Bron, H. Tjalsma, A plasmid-borneRap-Phr system of Bacillus subtilis can mediate cell-density controlled productionof extracellular proteases, Microbiology 149 (2003) 19–28, https://doi.org/10.1099/mic.0.25737-0.

[32] A. Derouiche, L. Shi, V. Bidnenko, M. Ventroux, N. Pigonneau, M. Franz-Wachtel, A.Kalantari, S. Nessler, M.F. Noirot-Gros, I. Mijakovic, Bacillus subtilis SalA is aphosphorylation-dependent transcription regulator that represses scoC and acti-vates the production of the exoprotease AprE, Mol. Microbiol. 97 (2015)1195–1208, https://doi.org/10.1111/mmi.13098.

[33] D. Cao, H. Xu, Y. Zhao, X. Deng, Y. Liu, W.J.J. Soppe, J. Lin, Transcriptome anddegradome sequencing reveals dormancy mechanisms of Cunninghamia lanceolataseeds, Plant Physiol. 172 (2016) 2347–2362, https://doi.org/10.1104/pp.16.00384.

[34] S. Guiziou, V. Sauveplane, H.J. Chang, C. Clerté, N. Declerck, M. Jules, J. Bonnet, A parttoolbox to tune genetic expression in Bacillus subtilis, Nucleic Acids Res. 44 (2016)7495–7508, https://doi.org/10.1093/nar/gkw624.

[35] D.F. Browning, S.J. Busby, The regulation of bacterial transcription initiation, Nat.Rev. Microbiol. 2 (2004) 57–65, https://doi.org/10.1038/nrmicro787.

[36] G.D. Stormo, DNA binding sites: representation and discovery, Bioinformatics 16(2000) 16–23, https://doi.org/10.1093/bioinformatics/16.1.16.

[37] N. Sierro, Y. Makita, M. de Hoon, K. Nakai, DBTBS: a database of transcriptional reg-ulation in Bacillus subtilis containing upstream intergenic conservation information,Nucleic Acids Res. 36 (2008) D93–D96, https://doi.org/10.1093/nar/gkm910.

[38] J. Si, R. Zhao, R. Wu, An overview of the prediction of protein DNA-binding sites, Int.J. Mol. Sci. 16 (2015) 5194–5215, https://doi.org/10.3390/ijms16035194.

[39] B.G. Bobay, A. Andreeva, G.A. Mueller, J. Cavanagh, A.G. Murzin, Revised structure ofthe AbrB N-terminal domain unifies a diverse superfamily of putative DNA-bindingproteins, FEBS Lett. 579 (2005) 5669–5674, https://doi.org/10.1016/j.febslet.2005.09.045.

[40] H. Choy, S. Adhya, Escherichia coli and Salmonella: Cellular and Molecular Biology,Washington 1996 1287–1299, https://doi.org/10.1016/0300-9084(88)90119-8.

[41] F. Yuan, K. Li, C. Zhou, H. Zhou, H. Liu, H. Chai, F. Lu, H. Zhang, Identification of twonovel highly inducible promoters from Bacillus licheniformis by screeningtranscriptomic data, Genomics 112 (2020) 1866–1871, https://doi.org/10.1016/j.ygeno.2019.10.021.

[42] R.Q. Ye, J.H. Kim, B.G. Kim, S. Szarka, E. Sihota, High-level secretory production of in-tact, biologically active staphylokinase from Bacillus subtilis, Biotechnol. Bioeng. 62(1999) 87–96.

[43] M. Coles, S. Djuranovic, J. Söding, T. Frickey, K. Koretke, V. Truffault, J. Martin, A.N.Lupas, AbrB-like transcription factors assume a swapped hairpin fold that is evolu-tionarily related to double-psi β-barrels, Structure 13 (2005) 919–928, https://doi.org/10.1016/j.str.2005.03.017.

[44] T. Ishii, K. Yoshida, G. Terai, Y. Fujita, K. Nakai, DBTBS: a database of Bacillus subtilispromoters and transcription factors, Nucleic Acids Res. 29 (2001) 278–280, https://doi.org/10.1093/nar/29.1.278.

[45] J. Liu, K. Tan, G.D. Stormo, Computational identification of the Spo0A-phosphateregulon that is essential for the cellular differentiation and development in Gram-positive spore-forming bacteria, Nucleic Acids Res. 31 (2003) 6891–6903, https://doi.org/10.1093/nar/gkg879.

本文献由“学霸图书馆-文献云下载”收集自网络，仅供学习交流使用。

学霸图书馆（www.xuebalib.com）是一个“整合众多图书馆数据库资源，

提供一站式文献检索和下载服务”的24 小时在线不限IP

图书馆。

图书馆致力于便利、促进学习与科研，提供最强文献下载服务。

图书馆导航：

图书馆首页 文献云下载 图书馆入口 外文数据库大全 疑难文献辅助工具