topics in bio-signal processing...syllabus highlights literature review and project proposal (due...
TRANSCRIPT
![Page 1: Topics in Bio-Signal Processing...Syllabus Highlights Literature Review and Project Proposal (Due Feb. 6) Start thinking about a topic (please feel free to meet with me). Schedule](https://reader034.vdocuments.us/reader034/viewer/2022042115/5e91b44c07f8ad18d5275fa1/html5/thumbnails/1.jpg)
Topics in Bio-Signal Processing
Professor Gail L. Rosen
From an EE perspective
![Page 2: Topics in Bio-Signal Processing...Syllabus Highlights Literature Review and Project Proposal (Due Feb. 6) Start thinking about a topic (please feel free to meet with me). Schedule](https://reader034.vdocuments.us/reader034/viewer/2022042115/5e91b44c07f8ad18d5275fa1/html5/thumbnails/2.jpg)
Course Website
http://www.ece.drexel.edu/gailr/ ECE-S690-503/
![Page 3: Topics in Bio-Signal Processing...Syllabus Highlights Literature Review and Project Proposal (Due Feb. 6) Start thinking about a topic (please feel free to meet with me). Schedule](https://reader034.vdocuments.us/reader034/viewer/2022042115/5e91b44c07f8ad18d5275fa1/html5/thumbnails/3.jpg)
Deliverables
Approx. 5 Homeworks (mini-projects) Literature Review and two-page project
proposals – April 28th (Presentations) 1-page Project Updates: May 19th Final Projects -- June 9th
![Page 4: Topics in Bio-Signal Processing...Syllabus Highlights Literature Review and Project Proposal (Due Feb. 6) Start thinking about a topic (please feel free to meet with me). Schedule](https://reader034.vdocuments.us/reader034/viewer/2022042115/5e91b44c07f8ad18d5275fa1/html5/thumbnails/4.jpg)
April 15th
Dr. Itsik Pe'er | Assistant Professor in the Computer Science, Columbia University
Title: Human Genetics Date: April 15th Time: 5:00 pm Location: CRB Austrian Auditorium
(Once a month - Penn Bioinformatics Forum) http://www.pcbi.upenn.edu/forum.php
![Page 5: Topics in Bio-Signal Processing...Syllabus Highlights Literature Review and Project Proposal (Due Feb. 6) Start thinking about a topic (please feel free to meet with me). Schedule](https://reader034.vdocuments.us/reader034/viewer/2022042115/5e91b44c07f8ad18d5275fa1/html5/thumbnails/5.jpg)
What are bio-signals?
![Page 6: Topics in Bio-Signal Processing...Syllabus Highlights Literature Review and Project Proposal (Due Feb. 6) Start thinking about a topic (please feel free to meet with me). Schedule](https://reader034.vdocuments.us/reader034/viewer/2022042115/5e91b44c07f8ad18d5275fa1/html5/thumbnails/6.jpg)
What is Bio-Signal Processing?
Digital Signal Processing: Processing/Analysis of digitized signals
Genomic Signal Processing: Signals are DNA
Biological Signal Processing: Signals are DNA, protein amounts, protein movement
![Page 7: Topics in Bio-Signal Processing...Syllabus Highlights Literature Review and Project Proposal (Due Feb. 6) Start thinking about a topic (please feel free to meet with me). Schedule](https://reader034.vdocuments.us/reader034/viewer/2022042115/5e91b44c07f8ad18d5275fa1/html5/thumbnails/7.jpg)
Others types of bio-signals, not covered
EEG, ECG
Cell Signaling
![Page 8: Topics in Bio-Signal Processing...Syllabus Highlights Literature Review and Project Proposal (Due Feb. 6) Start thinking about a topic (please feel free to meet with me). Schedule](https://reader034.vdocuments.us/reader034/viewer/2022042115/5e91b44c07f8ad18d5275fa1/html5/thumbnails/8.jpg)
Why electrical engineering for biology?
![Page 9: Topics in Bio-Signal Processing...Syllabus Highlights Literature Review and Project Proposal (Due Feb. 6) Start thinking about a topic (please feel free to meet with me). Schedule](https://reader034.vdocuments.us/reader034/viewer/2022042115/5e91b44c07f8ad18d5275fa1/html5/thumbnails/9.jpg)
Electrical Engineering for Biology?
DNA Protein Pathways Function
Model
Signal Processing
Algorithm System Computation
Performance
Implementation
Engineered System
Biological System
![Page 10: Topics in Bio-Signal Processing...Syllabus Highlights Literature Review and Project Proposal (Due Feb. 6) Start thinking about a topic (please feel free to meet with me). Schedule](https://reader034.vdocuments.us/reader034/viewer/2022042115/5e91b44c07f8ad18d5275fa1/html5/thumbnails/10.jpg)
Classic SP for Biology Applications
Most Popular: Speech Signal Processing
Pattern Recognition / Hidden Markov Models: Aligning sequences, classifying similar genes, gene prediction
Boolean Networks: Modeling Genetic Regulatory Networks
![Page 11: Topics in Bio-Signal Processing...Syllabus Highlights Literature Review and Project Proposal (Due Feb. 6) Start thinking about a topic (please feel free to meet with me). Schedule](https://reader034.vdocuments.us/reader034/viewer/2022042115/5e91b44c07f8ad18d5275fa1/html5/thumbnails/11.jpg)
How have we historically looked at Biology?
![Page 12: Topics in Bio-Signal Processing...Syllabus Highlights Literature Review and Project Proposal (Due Feb. 6) Start thinking about a topic (please feel free to meet with me). Schedule](https://reader034.vdocuments.us/reader034/viewer/2022042115/5e91b44c07f8ad18d5275fa1/html5/thumbnails/12.jpg)
Historical Understanding of Biology
Beginnings of Medicine: 2000 B.C. (Asia), 500 B.C. (Hippocrates)
Discovery of DNA: 1950 (Wilkins and Franklin), 1953 (Watson and Crick)
Function
DNA
Protein Pathways
Feedback Regulation in Metabolism: 1957 (Umbarger, Brown) (Yates, Pardee) 1970’s: major breakthroughs
![Page 13: Topics in Bio-Signal Processing...Syllabus Highlights Literature Review and Project Proposal (Due Feb. 6) Start thinking about a topic (please feel free to meet with me). Schedule](https://reader034.vdocuments.us/reader034/viewer/2022042115/5e91b44c07f8ad18d5275fa1/html5/thumbnails/13.jpg)
Syllabus Highlights
Literature Review and Project Proposal (Due Feb. 6) Start thinking about a topic (please feel free
to meet with me). Schedule meetings with me to check
feasibility of topic. Final Project -- Exploratory research
project for YOU to learn about the State-of-the-Art in the field (Due. March 19th).
![Page 14: Topics in Bio-Signal Processing...Syllabus Highlights Literature Review and Project Proposal (Due Feb. 6) Start thinking about a topic (please feel free to meet with me). Schedule](https://reader034.vdocuments.us/reader034/viewer/2022042115/5e91b44c07f8ad18d5275fa1/html5/thumbnails/14.jpg)
Todayʼs Topics
Introduction to DNA, Molecular Biology, and the challenges
Tools -- Use of Genbank Challenges in the field Hands-on Databases
![Page 15: Topics in Bio-Signal Processing...Syllabus Highlights Literature Review and Project Proposal (Due Feb. 6) Start thinking about a topic (please feel free to meet with me). Schedule](https://reader034.vdocuments.us/reader034/viewer/2022042115/5e91b44c07f8ad18d5275fa1/html5/thumbnails/15.jpg)
DNA Structure
5’ 3’
5’ 3’
G C
A T
4 Nucleotides (bases) 3 Bonds for G-C 2 Bonds for A-T Helical twist
Phosphate Backbone
1953
Base pairs (bp)
![Page 16: Topics in Bio-Signal Processing...Syllabus Highlights Literature Review and Project Proposal (Due Feb. 6) Start thinking about a topic (please feel free to meet with me). Schedule](https://reader034.vdocuments.us/reader034/viewer/2022042115/5e91b44c07f8ad18d5275fa1/html5/thumbnails/16.jpg)
Directional Reading Third (3’) and Fifth(5’) Carbon Atoms in Sugar ring.
![Page 17: Topics in Bio-Signal Processing...Syllabus Highlights Literature Review and Project Proposal (Due Feb. 6) Start thinking about a topic (please feel free to meet with me). Schedule](https://reader034.vdocuments.us/reader034/viewer/2022042115/5e91b44c07f8ad18d5275fa1/html5/thumbnails/17.jpg)
Sequencing
Classic: Radioactive Primer labeling Revolutionary: Shot-gun sequencing
(consensus of random segments) Errors in base-calling! (1 in 10K) Databases have errors!
![Page 18: Topics in Bio-Signal Processing...Syllabus Highlights Literature Review and Project Proposal (Due Feb. 6) Start thinking about a topic (please feel free to meet with me). Schedule](https://reader034.vdocuments.us/reader034/viewer/2022042115/5e91b44c07f8ad18d5275fa1/html5/thumbnails/18.jpg)
Sequencing
Given a set of overlapping sequences, randomly sampled from a target, reconstruct the order and position of those sequences
Can only do small fragments
![Page 19: Topics in Bio-Signal Processing...Syllabus Highlights Literature Review and Project Proposal (Due Feb. 6) Start thinking about a topic (please feel free to meet with me). Schedule](https://reader034.vdocuments.us/reader034/viewer/2022042115/5e91b44c07f8ad18d5275fa1/html5/thumbnails/19.jpg)
Sequencing methods
Electropheresis -- base calling using weights of molecule
Problem: Repetitive DNA
![Page 20: Topics in Bio-Signal Processing...Syllabus Highlights Literature Review and Project Proposal (Due Feb. 6) Start thinking about a topic (please feel free to meet with me). Schedule](https://reader034.vdocuments.us/reader034/viewer/2022042115/5e91b44c07f8ad18d5275fa1/html5/thumbnails/20.jpg)
Consensus: Averaging out the base-calling errors
![Page 21: Topics in Bio-Signal Processing...Syllabus Highlights Literature Review and Project Proposal (Due Feb. 6) Start thinking about a topic (please feel free to meet with me). Schedule](https://reader034.vdocuments.us/reader034/viewer/2022042115/5e91b44c07f8ad18d5275fa1/html5/thumbnails/21.jpg)
Sanger Method
http://www.youtube.com/watch?v=oYpllbI0qF8
![Page 22: Topics in Bio-Signal Processing...Syllabus Highlights Literature Review and Project Proposal (Due Feb. 6) Start thinking about a topic (please feel free to meet with me). Schedule](https://reader034.vdocuments.us/reader034/viewer/2022042115/5e91b44c07f8ad18d5275fa1/html5/thumbnails/22.jpg)
Pyrosequencing
http://www.youtube.com/watch?v=kYAGFrbGl6E
![Page 23: Topics in Bio-Signal Processing...Syllabus Highlights Literature Review and Project Proposal (Due Feb. 6) Start thinking about a topic (please feel free to meet with me). Schedule](https://reader034.vdocuments.us/reader034/viewer/2022042115/5e91b44c07f8ad18d5275fa1/html5/thumbnails/23.jpg)
We have the bases -- now what?
What is a gene?
![Page 24: Topics in Bio-Signal Processing...Syllabus Highlights Literature Review and Project Proposal (Due Feb. 6) Start thinking about a topic (please feel free to meet with me). Schedule](https://reader034.vdocuments.us/reader034/viewer/2022042115/5e91b44c07f8ad18d5275fa1/html5/thumbnails/24.jpg)
Genetic Code
Marshall Nirnberg (60ʼs) discovers the genetic code
3 nucleotides produce one amino acid
![Page 25: Topics in Bio-Signal Processing...Syllabus Highlights Literature Review and Project Proposal (Due Feb. 6) Start thinking about a topic (please feel free to meet with me). Schedule](https://reader034.vdocuments.us/reader034/viewer/2022042115/5e91b44c07f8ad18d5275fa1/html5/thumbnails/25.jpg)
Transcription
![Page 26: Topics in Bio-Signal Processing...Syllabus Highlights Literature Review and Project Proposal (Due Feb. 6) Start thinking about a topic (please feel free to meet with me). Schedule](https://reader034.vdocuments.us/reader034/viewer/2022042115/5e91b44c07f8ad18d5275fa1/html5/thumbnails/26.jpg)
Translation
tRNA
Ribosome
mRNA
Peptide chain
![Page 27: Topics in Bio-Signal Processing...Syllabus Highlights Literature Review and Project Proposal (Due Feb. 6) Start thinking about a topic (please feel free to meet with me). Schedule](https://reader034.vdocuments.us/reader034/viewer/2022042115/5e91b44c07f8ad18d5275fa1/html5/thumbnails/27.jpg)
Standard Genetic Code 64 Codons map to:
20 amino acids and start/stop codons
T ≈ U DNA RNA
Genetic codes can vary among species
![Page 28: Topics in Bio-Signal Processing...Syllabus Highlights Literature Review and Project Proposal (Due Feb. 6) Start thinking about a topic (please feel free to meet with me). Schedule](https://reader034.vdocuments.us/reader034/viewer/2022042115/5e91b44c07f8ad18d5275fa1/html5/thumbnails/28.jpg)
Genetic Code
![Page 29: Topics in Bio-Signal Processing...Syllabus Highlights Literature Review and Project Proposal (Due Feb. 6) Start thinking about a topic (please feel free to meet with me). Schedule](https://reader034.vdocuments.us/reader034/viewer/2022042115/5e91b44c07f8ad18d5275fa1/html5/thumbnails/29.jpg)
Open Reading Frames
Open Reading Frames (ORFs) : Biology Windows/Frames : Signal Processing
Frame Offset
ATGTACACATTTGTAAAATGA
ATGTACACATTTGTAAAATGA
ATGTACACATTTGTAAAATGA
0 1 2
Ribosome “slippage” in gene coding region could mean that a gene may be: 1) Misinterpreted 2) Not stopped 3) Truncated early
codon
base
![Page 30: Topics in Bio-Signal Processing...Syllabus Highlights Literature Review and Project Proposal (Due Feb. 6) Start thinking about a topic (please feel free to meet with me). Schedule](https://reader034.vdocuments.us/reader034/viewer/2022042115/5e91b44c07f8ad18d5275fa1/html5/thumbnails/30.jpg)
Replication / Transcription / Translation
Prokaryotes vs. Eukaryotes
Animation: http://www.johnkyrk.com/DNAtranscription.html http://www.johnkyrk.com/DNAtranslation.html
Cell wall
![Page 31: Topics in Bio-Signal Processing...Syllabus Highlights Literature Review and Project Proposal (Due Feb. 6) Start thinking about a topic (please feel free to meet with me). Schedule](https://reader034.vdocuments.us/reader034/viewer/2022042115/5e91b44c07f8ad18d5275fa1/html5/thumbnails/31.jpg)
Structural DNA differences between Eukaryotic and Prokaryotic Prokaryotes – Cells without a nucleus Eukaryotes – Cells with a nucleus (Eukaryotes engulfed other prokaryotes
into a symbiotic relationship a long time ago)