today is monday, january 26 th, 2015 pre-class: we learned what dna is. we learned what dna does....

Today is Monday, January 26 th, 2015 Pre-Class: We learned what DNA is. We learned what DNA does. What can we do with DNA? In This Lesson: DNA Technology (Lesson 3 of 3)

Todays Agenda DNA Technology Transformation PCR Gel Electrophoresis Restriction mapping Where is this in my book? Chapter 20.

By the end of this lesson You should be able to describe several uses for modern DNA technology in todays society. You should be able to run a gel electrophoresis. You should be able to direct bacterial transformation.

So whats with the glowing animals? Youve heard it before in one of those TED talks we listened to weve entered the genetic engineering era. Now that were getting pigs and rodents to express bioluminescent genes from jellyfish, we clearly have made some advances in the technology realm, too.

It begins with bacteria... because it always begins with bacteria. Here are the things you need to know: They grow rapidly. Like, a new generation every 20 minutes rapidly. Like, a 100,000,000 bacteria colony overnight rapidly. They are the most dominant form of life on Earth. They reproduce by binary fission its mitosis. Even more important to DNA tech istheir DNA.

Bacterial DNA Bacterial DNA takes the form of a single, circular chromosome. They are therefore haploid one chromosome total. There are no histone proteins, so they have naked DNA. They have approximately 4 million base pairs, making up about 4300 genes. This is around 0.1% of eukaryotic DNA.

Bacterial DNA Despite being asexual reproducers, bacteria also engage in three different forms of pseudo-sex whereby they exchange DNA: Conjugation DNA is transferred between two bacteria. Transduction Viral infection by a bacteriophage virus. Transformation Bacteria take up DNA in the environment. Remember the Griffith experiment? http://www.ncbi.nlm.nih.gov/books/NBK7908/

Transformation Transformation allows bacteria to take up other bacterial genes. They import it through specialized membrane transport proteins. The DNA they pick up is then integrated with their own DNA, allowing them to express new genes. This is a good reason for avoiding the overuse of antibiotics... and Purell.

Plasmids Independent of the chromosome are plasmids. These are small, circular loops of DNA that are generally not essential to the bacteriums existence. They are self-replicating and carry additional genes. Between 2-30. Many are genes for antibiotic resistance. Key: Plasmids are the DNA bits exchanged in conjugation and transformation.

Uh-huh. So? So where does DNA technology come in? The key is in the plasmids. Technology allows us to insert a new gene into a plasmid, then put that plasmid into another bacterium. A recombinant plasmid inserted into another bacterium is called a vector. The host bacterium will then express those new genes.

Bacterial Transformation Transformed bacteria. Get a gene from another organism. Plasmid Cut a DNA plasmid. Recombinant plasmid. Vector Glue the DNA

Bacterial Transformation Cut a gene out. Splice it into a plasmid. You now have a vector.

Bacterial Transformation And uhhow exactly do we cut DNA? With restriction enzymes. Officially known as restriction endonucleases. Why endo-? Because the cuts are made within the DNA strand, not from the end like an exonuclease. Youve seen nuclease enzymes before where? Jog your memory with your partner. This will make a lot of sense.

Flashback: Unit 6 Lesson 1 DNA Structure and Replication Another enzyme, called a nuclease, literally cuts the erroneous nucleotides out. Pol I then replaces the DNA with appropriate nucleotides. Ligase, as usual, steps in to seal up the strand. Fun fact: Pol II appears to be involved in error checking in prokaryotes.

Back to Restriction Enzymes Restriction enzymes were discovered in the 1960s. They evolved in bacteria as a means of cutting up foreign DNA. Thus, they restrict the activity of a possible predatory bacterium or virus. How do the restriction enzymes not cut the bacteriums own DNA? The local DNA doesnt have any of the nucleotide sequences recognized by the restriction enzymes.

So what do we do with them? Restriction enzymes cut DNA at specific sequences known as restriction sites. These are palindromic sections of DNA. For example, suppose we have the following sequence: CTGAATTCCG GACTTAAGGC A restriction enzyme makes a cut: CTGAATTCCG GACTTAAGGC The results are two palindromic ends: CT GAATTCCG GACTTAAG GC

Palindromic DNA Sequences This is a little bit different from palindromes in language. A palindromic DNA strand reads the same 5 to 3 as its complementary strand reads 5 to 3. Heres what I mean: GAATTC CTTAAG The strand reads the same in this direction as the complementary strand does in this direction.

Restriction Sites One well-known enzyme makes its cuts at this sequence: CCCGGG GGGCCC Another, like we saw, cuts here: GAATTC CTTAAG The cuts they make are different for each enzyme, but they always cut at the same restriction site.

Other Restriction Enzymes http://en.wikipedia.org/wiki/Palindromic_sequence

Ends Some restriction enzymes cut across restriction site sequences. The cut leaves what look like staggered ends of telomeres. We call them sticky ends. Unlike telomeres, they are capable of bonding CT GAATTCCG GACTTAAG GC Sticky End

Ends Some restriction enzymes cut straight through restriction site sequences. Not as useful for transformation but good for DNA fingerprinting. This kind of cut produces blunt ends. CCC GGG GGG CCC Blunt Ends

Creating Vectors So lets say you have a gene that you want to use: Use a restriction enzyme to slice it out. Use the same enzyme to slice open a circular bacterial plasmid. Add the target gene to the plasmid. CT GACTTAAG GAATTCCGAGGATCCGGCAACAGTCT GCTCCTAGGCCGTTGTCAGACTTAAG GAATTCCGAGGATCCCT GA GCTCCTAGGGACT Target Gene ACCAGATTGCCTCT TGGTCTAACGGAGACTTAA G GAATTCCGAGGATCCCTGAGGCATACGATTC CCAG GCTCCTAGGGACTCCGTATGCTAAGGGTC

Vocabulary and Concepts Digestion is the process by which restriction enzymes slice open existing DNA. Annealing is the process by which sliced DNA is recombined. As in, the add the target gene to the chromosome step. The sticky ends are used to bring the pieces together. DNA ligase, as usual, seals up the pieces.

Why bother? Okay, its a neat trick, we can give bacteria DNA. So what? How does that help me? Do you know where insulin for diabetics comes from? Wanna guess? If you guessed insulin fairy, youre wrong. If you guessed we grow it in bacteria by adding human insulin vectors, youre right. Key: There is a major catch with adding eukaryotic DNA to prokaryotes. They cant cut out the introns.

Transformation: The Overall Process Insert recombinant plasmid into bacterium. Culture (grow) bacteria in agar. The bacteria keep copying the plasmid. Eventually, the phenotype will be transformed and the new protein will be produced. You can also insert genes in this way into other cells. Wanna see?

Transformation in Other Organisms E. Coli C. elegans

Transformation in Other Organisms

Other Uses of Transformation GMO (genetically-modified organisms) We can take advantageous genes from other organisms and insert them into valuable crops (and maybe animals?) to make them hardier or improve quality. For example: BT Corn: Add a bacterial toxin that kills corn borer caterpillars to make corn pest-resistant. Fishberries: Add an anti-freezing gene from flounder to strawberries to extend the growing season. Golden Rice: Add genes to produce Vitamin A and enrich the nutritional value.

Other Uses of Transformation Or for something a little more in- depthcausing GFP (green fluorescent proteins) to be expressed in fish brains to read their thoughts. Cue the video!

A Way Around Transformation Transformation allows for some pretty cool stuff. However, its a bit of a pain in that you still need that grow the bacteria step. Is there a way to avoid using bacteria as miniature gene factories? Yep, and its called PCR.

PCR PCR is short for Polymerase Chain Reaction. So its aptly named for a process designed to make DNA. Sure enough, PCR can make lots of DNA and needs only one cell to start.

PCR Ingredients To perform PCR, you need the following: A DNA sample to be amplified. DNA polymerase enzymes. Free nucleotides. In the form of ATP, GTP, CTP, and TTP. Primers. Short strands of synthetic DNA. A thermocycler, which gradually raises and lowers the temperature of the sample. http://surgerydept.wustl.edu/uploadedImages/Deeken_Biomaterials_Lab/PCR_Eppendorf.jpg?n=3263

PCR How Does it Work? 1.When the temperature rises to 90C, the strands separate, producing two template strands. The denaturation phase. 2.When the temperature cools to 55C, DNA fragments (those primers) join the template strands, much like the RNA primers made by primase. The joining of the primers is called annealing. 3.When the temperature rises to 70C, DNA polymerase copies the rest of the strand. This is the extension part of the PCR cycle. Repeat the process for 20-30 cycles, with each cycle taking around 1.5 minutes (30 seconds/step). The amount of DNA made grows exponentially higher.

PCR In One Image

About Primers Primers define the section to be polymerized, since DNA polymerase only starts working there they are. Because they must be added to the PCR process, the user must know some of the strands sequence. Bookend the sequence of DNA you want amplified using the primers.

About DNA Polymerase Did you catch something strange about the temperature of PCR? The DNA polymerase enzyme is exposed to 90C temperatures during the elongation phase. How does it not denature? 90C = 194F Wed have to add new enzymes every cycle, which is kind of a pain in the genes

About DNA Polymerase We use taq polymerase its a DNA polymerase found in thermophilic bacteria living in hot springs! The enzyme name comes from the bacterias Latin name: Thermus aquaticus.

Who Invented PCR? Kary Mullis, avid surfer and now a Nobel Prize winner, invented the procedure in 1983. Hes also author to an exceedingly awkwardly- named book: http://fridge.gr/wp-content/uploads/2011/05/mullis.jpg http://1.bp.blogspot.com/-iFylSW_BFEA/Ur2ZNyH5flI/AAAAAAAAAEE/hrZ9gCd584w/s1600/kary+mullis.JPG

Other Uses of Restriction Enzymes What if we digest DNA samples but dont recombine them in plasmids? Is it any good? Yep. If we cut up DNA from different organisms or people and compare, we can use it for: Forensics Medical diagnostics Paternity Evolutionary relationships Other?

Comparing DNA DNA is best compared by fragment size. We separate the fragments by running them through an agarose gel (made from algae). This is called gel electrophoresis.

Gel Electrophoresis So how does DNA run through the gel? Why, electricity, of course! DNA is negatively charged as a result of its phosphate groups. If you pass an electric current through the gel, DNA moves to the positive side. - - - -

Gel Electrophoresis So all DNA moves toward the positive sidehow do we tell the fragments apart? Key: The size of the DNA fragment determines how far it travels. Small pieces electrophorese (travel) longer distances. Large pieces electrophorese (travel) shorter distances. Lets take a look at what I mean

Gel Electrophoresis Digest DNA into pieces using restriction enzymes. Load the DNA into wells in the gel. Connect each end to a power source. Larger pieces. Smaller pieces. Note: Gel electrophoresis usually runs horizontally across a table, not up and down.

Gel Electrophoresis So we all have our differences, right? Waitwhat differences? As you know, all humans have 99%+ the same DNA. The differences lie in the sections of junk DNA between genes. Im not talking about introns. This is a DNA thing. These junk sections, which could be segments of viral DNA from ancient infections, vestigial DNA, or just plain ol junk. Its usually repeated patterns of CAT, GCC, or others. People have different numbers of repeats.

Gel Electrophoresis As a result, restriction enzymes will cut the DNA in different locations, making different size fragments and potentially different numbers of bands: Restriction Sites Sample 1 Sample 2 (one nucleotide difference) Sample 3 (sequence duplication) The differences in restriction sites are known as restriction fragment length polymorphism s.

Gel Electrophoresis: Uses Suppose the leftmost well in the gel to the left is loaded with a DNA sample from a crime scene. The others are loaded with DNA samples from criminals. Whodunit? I always knew Gladys couldnt be trusted. Unknown DNA from scene SylvesterHorace Maurice Gladys

A Little History In 1987, Tommie Lee Andrews became the first person convicted of a crime as using DNA evidence/analysis. In his case, he had raped over 23 women and was convicted of raping two using DNA. Fun fact: He may soon be released. The gel: http://offender.fdle.state.fl.us/offender/CallImage?imgID=1501088 Tommie Lee Andrews

A Little History: Another Case Guilty? FYI, the standard is a sample with known fragment sizes for perspective. Who are these people anyway? Its the OJ Simpson murder case (1994). Blood Sample 1 [Standard] Suspect Blood Sample 2 Blood Sample 3 Victim 1 Victim 2 Victim 3 [Standard]

Gel Electrophoresis: Uses Similarly, blood found on various locations can be electrophoresed to determine the source of the sample. In this example, it appears as though the victims blood is found on all three clothes samples by matching the bands. Thats what we call those stripes.

Gel Electrophoresis: Uses So the point is that you can identify unknown DNA since it will have the same size fragments. Some other details: DNA is usually dyed to it appears in the gel, sometimes under a black light. Ethidium bromide binds to DNA and fluoresces.

Gel Electrophoresis: Uses Besides forensics, you can also determine approximate evolutionary relationships using relative fragment sizes: 13245 12345 TurtleSnakeRatSquirrel Fruit Fly

Gel Electrophoresis: Uses You can also can test for genetic diseases by comparing normal allele samples with disease alleles: For example, this is used to detect Huntingtons disease. Caused by a dominant allele, too. Normal Allele Disease Allele

Gel Electrophoresis: Uses And you can test paternity this way too. Key: Every band in the child must match one in either of its parents. http://rarerborealis.com/wordpressblog/tag/maury/ Child Mom F1F2 Father Not the Father

Paternity Testing Animation Paternity Testing

Restriction Mapping Using gel electrophoresis with bacterial DNA, we can also create a restriction map. This is good for keeping track of plasmids with inserts (genes inserted into the circle of DNA), and for identifying exactly how many fragments well get of varying lengths after a digest. Heres what I mean

Restriction Mapping Suppose I show you the following plasmid: So its 20 kb (kilobases) long. Lets add the restriction sites for enzyme EcoRI. p401D 20 kb p401D 20 kb

Restriction Mapping There. EcoRI cuts this plasmid in two places, creating two DNA fragments (one 4 kb, the other 20 kb). p401D 20 kb p401D 20 kb EcoRI 4 kb15 kb

Restriction Mapping Thats a basic restriction map, but sometimes they get more complicated. Lets try the Restriction Mapping worksheet. Note: #5 is challenging. Ill solve #6 next slide. p401D 20 kb p401D 20 kb EcoRI 4 kb15 kb

Restriction Mapping Worksheet #6 pDA102 4.35 kb pDA102 4.35 kb SalI 1.80 kb 0.25 kb SalI 2.30 kb pDA102 4.35 kb pDA102 4.35 kb SalI DigestHhaIII Digest 0.70 kb 1.55 kb 2.10 kb HhaIII Solve each digest independently.

Restriction Mapping Worksheet #6 1.80 kb 0.25 kb pDA102 4.35 kb pDA102 4.35 kb SalI 2.30 kb SalI DigestHhaIII Digest 0.70 kb 1.55 kb 2.10 kb pDA102 4.35 kb pDA102 4.35 kb HhaIII Combine them.

Restriction Mapping Worksheet #6 pDA102 4.35 kb pDA102 4.35 kb SalI pDA102 4.35 kb pDA102 4.35 kb HhaIII Using the single digest lengths, fill in the known fragment lengths, making sure they make sense. SalI 1.80 kb SalI 0.25 kb SalI 2.30 kb HhaIII 0.70 kb HhaIII 1.55 kb HhaIII 2.10 kb

Restriction Mapping Worksheet #6 pDA102 4.35 kb pDA102 4.35 kb SalI pDA102 4.35 kb pDA102 4.35 kb HhaIII 0.35 kb 0.70 kb 0.75 kb 0.25 kb 1.10 kb 1.20 kb A general hint is to find numbers in the double digest that add up to numbers in the single digest.

Closure NOVA Cracking Your Genetic Code

today is monday, january 26 th, 2015 pre-class: we learned what dna is. we learned what dna does....

Documents

dna slide

bacterial dna bacterial

dna plasmid

conjugation dna

dna bits

dna tech istheir dna

naked dna

eukaryotic dna