thermo scientiﬁ c particle technology product catalog and ...libvolume2.xyz ›...

Magnetic Particles

NIST Traceable Size Standards

Flow Cytometry

Dyed and Fluorescent Particles

Plain Particles for Clinical Diagnostics and Specialty Applications

Thermo Scientifi c Particle TechnologyProduct Catalog and Technical Reference Guide

Seradyn and Duke Scientifi c have combined under

the Thermo Scientifi c brand to offer customers

one place for all the particles they need. We are

pleased to announce the ability to leverage our

individual strengths under this new brand name.

Engineers, physicists, chemists, bio-chemists and

other scientists use particles for molecular biology

applications, as reference standards for size

measurement, for nucleic acid isolation and cell

separation, as unique markers for biomolecules,

as fl ow tracing devices, as reactive surfaces to

transport diagnostic reagents and for a variety of

other applications.

As a trusted supplier to the scientifi c community

with more than 35 years of particle technology

experience, we are proud of our reputation as the

world leader in the design and manufacture of high

quality synthetic polymer particles.

Our experienced technical staff comes from many

scientifi c disciplines, which are integrated to

provide powerful solutions to problems and support

for you.

Thermo Scientifi c Product CategoriesMagnetic Particles• Sera-Mag® SpeedBeads™• Sera-Mag Magnetic Particles

NIST Traceable Size Standards• NIST Traceable Metrology Particles• Duke Standards™ • BCR Quartz Certifi ed Particles• Certifi ed Count Particles

Flow Cytometry Particles• Cyto-Cal™ Calibrators, Alignment Beads and Count Control• Cyto-Plex™ Carboxylate-modifi ed particles and Carboxylated Kits for Multiplex Assays

Fluorescent and Dyed Particles• Fluoro-Max™ Fluorescent• Color-Rich™ Dyed • ChromoSphere™ Dyed

Particles for Clinical Diagnosticsand Specialized Applications• Opti-Bind® • Opti-Link® • Turbi-BindTM

• Turbi-LinkTM

• Power-BindTM Streptavidin-coated• Undyed Sulfate Particles with Modifi ed Surfaces• Polymer Particle Suspensions• Spherical Polymer Particles• Spherical Glass Materials• Spherical Pollen and Spores• Metal and Mineral Particles• Filter and Smoke Detector Particles• Cleanroom Particles• Non-polymer particles

Thermo Scientifi c particles are manufactured in our

ISO regulated facilities, assuring a superior product.

Our particles feature high precision and excel-

lent reproduceability, high binding capacity while

keeping nonspecifi c binding low and maintaining

long-term stability.

Because we manufacture the particles, exten-

sive information about their characteristics and

functionallity is made available to you. We provide

concrete data, backed by years of clinical applica-

tions research, which will take the mystery out of

working with the particles.

You can learn more by logging on to www.thermo.

com/particletechnology. We are also available

by phone to answer technical questions, fulfi ll

product catalog requests and to give pricing

information.

For for size standards and fl ow cytometry particle

products, call 1-800-232-3342.

For magnetic and all other particle products,

call 1-866-737-2396.

Thermo Scientifi c Particle Technology We have particles for all your diagnostic, calibration and molecular biology needs.

Did you know...

that approximately 85% of the US blood supply

is tested by assays that utilize our particles.

1

Table of Contents

Particle Application Chart ......................................................................................... 2-3

Magnetic Particles .........................................................................................................4

Magnetic SpeedBeads...................................................................................................5

Magnetic particles .....................................................................................................6–9

Technical Supplement: Particle Reagent Optimization ....................................10–13

NIST Traceable Size Standards .................................................................................14

Calibration and Validation ......................................................................................15-23

Count Controls ........................................................................................................24-27

Technical Supplement: Working with Particles ......................................................28

Flow Cytometry..............................................................................................................29

Instrument Performance ..........................................................................................30-32

Multiplex Assay Products ........................................................................................33-34

Technical Supplement: Differences in beads for fl ow cytometry ........................35

Dyed and Fluorescent Particles ............................................................................36-37

Dyed Particles .........................................................................................................38-41

Fluorescent Particles...............................................................................................42-49

Technical Supplement: Particle sonication and mixing ................................... 50-52

Particles for Clinical Diagnostics and Specialty Applications .............................53

Particles for Clinical Diagnostics............................................................................54-59

Non-Polymer Particles ............................................................................................60-66

Cleanroom Particles .....................................................................................................67

Technical Supplement: Selecting particle surface properties .............................68

Striving to Meet Your Needs.......................................................................................69

Ordering Information ....................................................................................................69

MSDS...........................................................................................................................69

Technical Support ........................................................................................................69

Payment Information ....................................................................................................69

2

Applications MG SB CM

MG SB SA

MG SB NA MG-CM MG-SA MG-OL

NIST Size Std.

BCR Std.

Count Controls

Cyto-Cal

Cyto-Plex

Fluoro- SF GR, RD, BL

Fluoro-CM-Eu

FluorSA-E

Air sampling smoke detectors

Affi nity purifi cation

Analytical, Sedimentation, Seperation

Biotinylated PCR isolation

Biosensors

cDNA synthesis

Cell/DNA/mRNA isolation

Cell labeling

Cell sorting

Cell surface markers

Chemiluminescent assays

Chemical engineering studies

Clinical diagnostics

Contamination control/ fl ow tracing

Cycle sequencing cleanup

Dispersion studies

Filter checking and testing/ challenge

Filtration systems

Fluid mechanics

Fluorescent-based assays

Flow cell focusing

Flow cytometry

Gene expression analysis/ genotyping

Genomics

High sensitivity assays

Instrument precision monitoring

Laser particle counter calibration

Lateral fl ow assays

Light scattering

Membrane-based assays

Molecular diagnostics

Multiallurgical studies

Nephelometric assays

Northern analysis

Nucleic acid sample prep

Optical alignment

Particle counting measurement

Phagocytosis studies

Purify PCR product

Pore size determination

Proteomics

Rapid assays

RT-PCR

Size standards

Slide agglutination assays

Suspension array analysis

Time-resolved fl uorescent assays

Traceability of analytical methods

Turbidimetric assays

Applicat ion

AAAAAAAAAAAAAAAApAAppAApApApAppppppppppppppppppppplppppppplppllppplpll iippl ipl il iiil il il iiicciiciiciccccccccaaccaccacaaaaaaaataataatat i

aataat iat iitt it iioioioioooooonooononn

ro-Eu

Modifi ed Fluoro-

GR, RD, DR

Color-Rich Blue

Color-Rich Red

Color Rich

Black

Chromo Sphere RD,BLK

Opti-Bind SF

Opti-Link CM

Turbi-Bind SF

Turbi-Link CM

Modified Undyed

SF

Power-Bind SA

Particle Supsen-

sions

Polymer Materials

Smoke/ Hepa Check

SF: Sulfate CM: Carboxylate-modifi edSA: Streptavidin coatedOL: Oligo(dT)NA: NeutrAvidin coatedRD: RedBL: BlueBLK: BlackGR: GreenEu: Europium ChelateMG: MagneticSB: SpeedBeadSize Std.: Size StandardsFluoro: Fluoro-Max

AbbreviationKey

on Chart

ooooooonononononononnnn CCnn Cn CCCCCCCCChhCChCChChhhCChCChChhhhhhhhaahhahhahaaaaaaaaraaraarartaarartr ttrr tr tttttt

Thermo Scientifi c Sera-Mag Magnetic Particles

Sera-Mag Magnetic SpeedBeads Sera-Mag Magnetic SpeedBeads Carboxylate-Modifi ed

Sera-Mag Magnetic SpeedBeads NeutrAvidin

Sera-Mag Magnetic SpeedBeads Streptavidin

Sera-Mag Magnetic Particles Sera-Mag Magnetic Carboxylate-Modifi ed Particles

Sera-Mag Magnetic Oligo(dT) Particles

Sera-Mag Magnetic Streptavidin Particles

5

The Sera-Mag SpeedBeads are the newest

entry in the Sera-Mag line of magnetic

particles. These particles respond twice

as fast in a magnetic fi eld as our original

Sera-Mag magnetic particles, and are

available in carboxylate-modifi ed, NeutrAvidin

and Streptavidin coated versions. They are

especially useful in clinical immunoassays

where speed of magnetic response is impor-

tant, or for isolation from viscous solutions

in molecular biology applications.

All SpeedBeads have improved magnetic

response time, but retain the original

Sera-Mag properties including:

• Sensitivity

• Stability

• Physical integrity

• Colloidal stability

• Reproducibility

• High binding capacity

• Very slow settling rate in the absence of a

magnetic fi eld

• Unaffected in conditions such as sonica-

tion, drying, freezing and pH extremes

• Effective in a wide variety of clinical and

molecular applications

• Cost effective

• Long shelf-life

SpeedBeads Carboxylate-Modifi ed

• Double speed Sera-Mag base magnetic

particle

• Fast magnetic response time for clinical

diagnostic assays

• Excellent for a variety of nucleic acid

isolation applications

SpeedBeads Streptavidin

• Use in demanding applications that require

high binding capacity

• Much quicker isolation from viscous cell

lysates

• Universal streptavidin-biotin isolation

systems

SpeedBeads NeutrAvidin

• Broad utility for a variety of high binding

capacity needs

• Much quicker isolation from viscous cell

lysates

• Potential lower non-specifi c binding

characteristics

To order Thermo Scientifi c Sera-Mag Speed-

Beads, call the Indianapolis, IN offi ce at

1-866-737-2396 or at 1-317-610-3800.

Thermo Scientifi c Sera-Mag SpeedBeads

One of the newest additions to the Sera-Mag product line are SpeedBeads. These magnetic particles respond twice as fast in a magnetic field as ouroriginal Sera-Mag magnetic particles,and are great for clinical and moleculardiagnostics.

Sera-Mag SpeedBeads

6

World-Class TechnologyThe Sera-Mag family of magnetic particles

is based on the patented (5,648,124) nominal

1 μm magnetic carboxylate-modifi ed base

particles (MG-CM) which are made by a core-

shell process. Sera-Mag particles are used in

a wide variety of molecular biology, nucleic

acid isolation, research and clinical diagnostic

immunoassay applications. These super-

paramagnetic particles combine a fast

magnetic response time with a large surface

area and fast reaction kinetics.

Molecular Biology ApplicationsPlasmid DNA isolation

Genomic DNA isolation

mRNA and PNA isolation

Cell isolation

Cycle sequence reaction cleanup

Isolate biotinylated PCR product

RT-PCR

cDNA library construction

Genotyping

Subtractive hybridization

Northern analysis

Gene expression analysis

Clinical Diagnostics ApplicationsColorimetric assays

Heterogeneous assays

Chemiluminescent assays

Thermo Scientifi c Sera-Mag Magnetic Particles

Sera-Mag Unique Properties• Low, non-specifi c binding of serum proteins

and other interfering substances

• Non-leaching, encapsulated magnetite

• Surfactant-free, no washing or pre-cleaning

steps required

• High surface area per unit mass, high ligand

binding capacity and slow settling rate in

absence of a magnetic fi eld

• Tight size distribution provides for simulta-

neous magnetic separation rate, effi cient

coating of biological reagents, and excel-

lent lot-to-lot reproducibility

• GMP manufacturing in our ISO certifi ed

facilities

• Covalently bound ligands do not leach

• High yield

• Pure preparations

• Rapid isolation in viscous solutions

Compatibility/StabilityCompatible in pH 4 to 12

Compatible in guanidinium thiocyanate

Compatible in DMF and DMSO

Compatible in sonication environments

Compatible in PCR temperature cycling

60 month shelf-life stability

Patented Sera-Mag Magnetic Core-Shell Design

Magnetite

Carboxylate-modified sulfate core

Layer of magnetitesurface coating

Non-styrenepolymer surfaceencapsulation

Encapsulation

L

L

L

COOH C

OO

H

COOH

COOH

COOH

COOH

7

Sera-Mag Magnetic Streptavidin Particles

The Sera-Mag Magnetic Streptavidin (MG-SA)

particles contain covalently bound strepta-

vidin. Three levels of biotin-binding capacity

supplied as low (2500 to 3500 pmol/mg),

medium (3500 to 4500 pmol/mg) and high

(4500 to 5500 pmol/mg) binding capacities are

available (measured in picomoles of biotin-

fl uorescein bound per milligram of particle).

The multiple levels allow you to choose the

biotin-binding capacity needed to optimize

your application. MG-SA can be used as a

universal base particle for coating biotinylated

proteins, oligos or other ligands to the particle

surface. MG-SA have a shelf life stability of

60 months.

Sera-Mag Magnetic Carboxylate Particles

Sera-Mag Magnetic Carboxylate-Modifi ed

particles feature low non-specifi c binding of

serum proteins, high protein binding capacity,

tight size distribution, and are stable in deter-

gents and in a variety of lysis buffer system

pH 5 to 12. These particles also improve assay

accuracy, have a high surface area per unit

mass, good lot-to-lot reproductibility, are ver-

satile in process and in reagent preparation,

and are ready to use with no washing.

These particles are colloidally stable in the

absence of a magnetic fi eld. When a magnetic

force is applied, the particles are separated

rapidly and completely from suspensions.

Covalent coupling (of proteins, nucleic acids,

etc.) to carboxyl groups on the surface is

easily accomplished using our standard

coupling technology. To learn more about this

procedure, read our Recommended Adsorption

and covalent Coupling Procedures protocol

that is located on pages 10-13.

Sera-Mag Magnetic Oligo(dT) Particles

The 1 μm Sera-Mag Magnetic Oligo(dT)

(MG-OL) particles contain covalently bound

oligo(dT)14

and have excellent shelf life stabil-

ity at 48 months. The MG-OL particles are

colloidally stable in the absence of a magnetic

fi eld and will remain in suspension for extend-

ed periods of time during use. MG-OL are used

to capture or isolate mRNA from a variety of

sources. Once isolated, further applications

like RT-PCR, cDNA library construction or

subtractive hybridization can be performed.

The approximate mRNA binding-capacity is

11μg of mRNA per mg of particles (dependent

upon sample and message length).

The MG-OL particles can also be used as

a universal base particle for coupling your

unique oligo sequences. Simply synthesize

your oligo with a poly-A tail for easy attach-

ment to the oligo(dT) particles.

For technical notes, visit us at

www.thermo.com/particletechnology,

and navigate to particle technology and click

on magnetic particles.

To order Thermo Scientifi c Sera-Mag Mag-

netic particles, call the Indianapolis, IN offi ce

at 1-866-737-2396 or at 1-317-610-3800.

Sera-Mag SpeedBeads

Carboxylate-modifi edBottleSize Application

BindingCapacity Type/ Parking Area Cat. Number

Packaged in 15mL, 100 mL, 15 mL Hydrophilic High SpeedBeads, 7 EDAC/PA5 4515-2105-050250

and 1000 mL 100 mL Hydrophilic High SpeedBeads, 7 EDAC/PA5 4515-2105-050350

5% solids, 50 mg/mL 1000 mL Hydrophilic High SpeedBeads, 7 EDAC/PA5 4515-2105-050450

Magnetic articles are ~1 μm 15 mL Hydrophilic High SpeedBeads, 3 EDAC/PA5 6515-2105-050250

100 mL Hydrophilic High SpeedBeads, 3 EDAC/PA5 6515-2105-050350

1000 mL Hydrophilic High SpeedBeads, 3 EDAC/PA5 6515-2105-050450

Sera-Mag SpeedBeads

NeutrAvidin-coatedBottleSize Application

BindingCapacity Type Cat. Number

Packaged in 1 mL, 5 mL, 100 mL 1 mL Clinical/Molecular High SpeedBeads, NA coated 7815-2104-011150

1% solids, 10 mg/mL 5 mL Clinical/Molecular High SpeedBeads, NA coated 7815-2104-010150

Magnetic particles are ~1 μm 100 mL Clinical/Molecular High SpeedBeads, NA coated 7815-2104-010350

Sera-Mag SpeedBeads

Streptavidin-coatedBottleSize Application


Packaged in 1 mL, 5 mL, 1 mL Clinical/Molecular Medium SpeedBeads, Strep 6615-2104-011150

and 100 mL 5 mL Clinical/Molecular Medium SpeedBeads, Strep 6615-2104-010150

1% solids 100 mL Clinical/Molecular Medium SpeedBeads, Strep 6615-2104-010350

Sera-Mag Magnetic

Carboxylate-modifi edBottleSize Application

BindingCapacity Type/ Parking Area Cat. Number

Packaged in 15mL, 100 mL, 15 mL Clinical/Molecular High Sera-Mag, 7 EDAC/PA5 2415-2105-050250

and 1000 mL 100 mL Clinical/Molecular High Sera-Mag, 7 EDAC/PA5 2415-2105-050350

5% solids, 50 mg/mL 1000 mL Clinical/Molecular High Sera-Mag, 7 EDAC/PA5 2415-2105-050450

Magnetic particles are ~1 μm 15 mL Clinical/Molecular High Sera-Mag, 3 EDAC/PA5 4415-2105-050250

100 mL Clinical/Molecular High Sera-Mag, 3 EDAC/PA5 4415-2105-050350

1000 mL Clinical/Molecular High Sera-Mag, 3 EDAC/PA5 4415-2105-050450

Sera-Mag Magnetic

Oligo(dT)14

BottleSize Application


Packaged in 1 mL, 5 mL, 100 mL 1 mL Molecular Medium Sera-Mag, Oligo 2815-2103-011150

1% solids 5 mL Molecular Medium Sera-Mag, Oligo 2815-2103-010150

Magnetic particles are ~1 μm 100 mL Molecular Medium Sera-Mag, Oligo 2815-2103-010350

Sera-Mag Magnetic

Streptavidin-coatedBottleSize Application


Packaged in 1 mL, 5 mL, 1 mL Clinical/Molecular Low Sera-Mag, Strep 3015-2103-011150

and 100 mL 5 mL Clinical/Molecular Low Sera-Mag, Strep 3015-2103-010150

1% solids 100 mL Clinical/Molecular Low Sera-Mag, Strep 3015-2103-010350

Magnetic particles are ~1 μm 1 mL Clinical/Molecular Medium Sera-Mag, Strep 3015-2104-011150

5 mL Clinical/Molecular Medium Sera-Mag, Strep 3015-2104-010150

Level 3 = Low Binding 100 mL Clinical/Molecular Medium Sera-Mag, Strep 3015-2104-010350

Level 4 = Medium Binding 1 mL Clinical/Molecular High Sera-Mag, Strep 3015-2105-011150

Level 5 = High Binding 5 mL Clinical/Molecular High Sera-Mag, Strep 3015-2105-010150

100 mL Clinical/Molecular High Sera-Mag, Strep 3015-2105-010350

8

Cat. Number

Package Size Application Sample Pack Includes:

Sera-Mag SpeedBead

Carboxylate-modifi edS4565 2 x 15 mL

Clinical/

Molecular

4515-210-5050250

6515-2105-050250

Sera-Mag SpeedBead

NeutrAvidin-coatedS6678 2 x 1mL

Clinical/

Molecular

6615-2104-011150

7815-2104-011150

Sera-Mag Magnetic

Carboxylate-modifi edS2444 2 x 15 mL

Clinical/

Molecular

2415-2105-050250

4415-2105-050250

Sera-Mag Magnetic

Streptavidin-coatedS30345 3 x 1 mL

Clinical/

Molecular

3015-2103-011150 (low binding)

3015-2104-011150 (medium binding)

3015-2105-011150 (high binding)

Thermo Scientifi c Sera-Mag Magnetic Particle Sample Packs

The above illustration shows the three stages of making a Sera-Mag magnetic particle. The largest portion of the particle, the core, consistof a carboxylate-modifi ed particle. Above the core is the magnetite, and the last layer is the encapsulation, which seals it all together.

The following sample packs are available for the Sera-Mag magnetic particle product lines.

Differences in EDAC Levels for Sera-Mag Carboxylate-modifi ed Particles

Customers often ask us what the difference is

between the Sera-Mag Carboxylate-modifi ed

particles that have an EDAC level of seven

versus those with an EDAC level of three. The

differences in these products during produc-

tion are minimal.

The amount of cross linking may differ, yet the

charateristics i.e. PA, diameter, are the same.

Some performance feedback has indicated

that the 6515 and 4415 beads, which have

lower EDAC than the 4515 and 2415 particles,

work better with nucleic acid isolation. Also,

the 6515 and 4415 beads are more hydropho-

bic-like, where as the 4515 and 2415 particles

are hydrophyllic.

In order to decide which is ideal for your

application, we suggest purchasing both as

samples and perform an experiment to verify

if there is a difference for your application.

9

Inside a Sera-Mag Magnetic Particle

p

We give you simple particle protocols forcoupling proteins to particles (particles).We take the mystery out of working with particles by giving you concrete data,backed by years of applications researchin our own labs. These recommendedcoupling procedures are designed for:

• Optimal adsorption of proteins to particles

• Optimal covalent coupling of proteinsto particles

• Choice of two protocols for covalent coupling

• Siparticlelicity, effi ciency, and confi -dence

We offer a coparticlerehensive laboratoryreference manual entitled, Microparticle Reagent Optimization, on particle sensiti-zation and optimization.

Principle of Protein Binding

Proteins bind to sulfate (S) or carboxylate-modifi ed (Carboxylate-modifi ed) particles (magnetic and nonmagnetic) by adsorp-tion. Adsorption is mediated by hydropho-bic and ionic interactions between the protein and the surface of the particles.Adsorption of proteins to particles occursrapidly due to the microparticle surfacefree energy. Proteins may also be cova-lently attached to the surface of Carboxyl-ate-modifi ed particles. Carboxyl groups on the particles, activated by the water-soluble carbodiimide 1-ethyl-3-(3-dimeth-ylaminopropyl) carbodiimide (EDAC), reactwith free amino groups of the adsorbedprotein to form amide bonds. For mag-netic particles, we recommend followinga covalent coupling procedure. Perform-ing covalent coupling with the directEDAC procedure is universally useful.If exposure of a protein to EDAC is discov-ered to be harmful to the protein, then a pre-activation (active ester) step prior to introducing the protein is an alternativefor successful covalent coupling.

Here we give the protocols for both adsorption and covalent coupling whichhave proven useful for many of our cus-tomers. These protocols are written for 1.0 mL “optimization series” reactions. For larger reactions, all volumes may bescaled up proportionally.

Technical Supplement

Microparticle Reagent Optimization:Recommended Adsorption andCovalent Coupling Procedures

Materials and Methods

1. Particles

• Sulfate particles (Polystyrenepar-ticles): Thermo Scientifi c Polystyrene particles for immunoassays are avail-able in standard sizes ranging from0.05 μm to 2.0 μm. Larger particles are also available. These Polystyrenepar-ticles are manufactured by emulsion polymerization using an anionicsurfactant and have surface sulfate groups which arise from the polym-erization initiator. Thermo Scientifi cPolystyreneparticles are formulatedto have low free surfactant and,generally, the surfactant used does not interfere with protein binding. Forthis reason, it is recommended that Thermo Scientifi c Polystyreneparticles be used without any preliminaryclean-up.

• Carboxylate Modifi ed particles(Carboxylate-modifi ed particles),Nonmagnetic and Magnetic: ThermoScientifi c Carboxylate-modifi ed particles (nonmagnetic) are availablein sizes ranging from 0.05 μm to 1.5μm. These Carboxylate-modifi edparticles are manufactured by theco-polymerization of styrene andacrylic acid using emulsion polymer-ization methods. Carboxylate-modi-fi ed particles are available in a widerange of carboxyl densities. Titrationvalues in milliequivalents of carboxyl per gram of particles (mmoles/g, orμmoles/mg) are provided with eachlot. In addition, the calculated parkingarea (area per carboxyl group) is pro-vided with each lot. Thermo Scientifi cCarboxylate-modifi ed particles are formulated to have low free detergent.The detergent used does not gener-ally interfere with protein binding.Carboxylate-modifi ed particles maybe rigorously cleaned by ion exchangewith mixed bed resin or by tangentialfl ow fi ltration (TFF). Such cleaningremoves various ionic byproducts,including detergent, soluble polymers,and buffer salts, which may affect coupling chemistry. The need for preliminary clean-up of Carboxylate-modifi ed particles must be establishedon a case-by-case basis.

Sera-Mag particles are available ina nominal 1 μm size. Our magnetic particles are encapsulated with acarboxylated polymer surface. The amount of acid on the surface of Sera-Mag particles is typically higher than our nonmagnetic particles

Note: Parking area (PA) is a parameterthat allows coparticlearison of Carbox-ylate-modifi ed particles of differentdiameters and titration values (mEq/g). It is an area-normalized density ofcarboxyl groups, given in

Å2/COOH. If

two particles have the same PA, a par-ticular protein molecule will “park on”the same number of carboxyl groupson the surface of either particle, andhave an equivalent opportunity for covalent coupling (assuming all thecarboxyls are activated.)

2. BCA (Bicinchoninic Acid ) Protein Assay for particles: See our Techni-cal Supplement,, BCA Assay for particles, for materials & methods, which is located on our Web site atwww.thermo.com/particletechnology.

3. Reaction Buffer: MES Buffer 2-(N-morpholino)ethanesulfonic acid: Prepare10X stock buffer at 500 mM, pH 6.1. The pH will not change signifi cantlyon dilution. Store at 4°C and discardif yellowed or contaminated.

4. EDAC 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride 52μmol/mL: Just before use, weigh approximately 10 mg of EDAC on an analytical balance: for each 10.0 mgweighed add 1.0 mL deionized water.

Note: EDAC is very sensitive to mois-ture and undergoes rapid hydrolysisin aqueous solutions. EDAC shouldbe stored in a desiccator at -5°C andbrought to room teparticleerature before weighing.

5. NHS, N-hydroxysuccinimide (ActiveEster-Two-step Coupling Procedureonly): 50 mg/mL in water (verysoluble)

6. Protein StocksTypically, a protein stock in the range of 1-10 mg/mL isrecommended. Note: The protein tobe coated onto particles should becoparticleletely dissolved and not too concentrated.

10

Microparticle Reagent OptimizationTechnical Supplement

7. DI water

Appropriate labware including:

• Pipettes and Tips (10 μL – 5 mL)

• Mixing Wheel or Other Device

• Appropriate Magnetic separation device for Sera-Mag particles

• Microcentrifuge tubes

• Microcentrifuge

• Tangential fl ow fi ltration: Smaller particles may require tangential fl ow fi ltration or ultra-centrif gation forwashing.

Note: Tangential fl ow membrane devices are available from severalsuppliers such as Spectrum Labs in sizes suitable for processingparticles in milliliter to liter quanti-ties. particles as small as 0.05 μm may be reliably processed with TFFmembranes.

• Probe-type Ultrasonicator: Probe-type ultrasonicator with microtipshould be used for resuspendingpellets during washing. Sonica-tion is also helpful for redispersingcluparticleed particles in a stabiliz-ing buffer. An immersible ultrasonicprobe is the ideal tool for effi cientresuspension of Particle pellets.For 1.0 mL reactions a few seconds of sonication is suffi cient. Alter-natively, pellets may be stirred or resuspended by repeated aspiration with a fi ne pipette tip. Note: Vortex mixing and bath-type sonicators are not effective for resuspending most pellets.

Adsorption

Before You Begin:

• The optimal amount of protein to use depends on several factors:

(1) Surface area available: surfacearea per mg of Particle increases linearly with decreasing Particle diameter.

(2) Colloidal stability: proteins canhave stabilizing or destabilizing effects on particles.

(3) Immunoreactivity: the optimal

amount of bound sensitizing pro-tein must ultimately be determinedby functional assay.

• When the protein is added to theparticles, rapid mixing is critical foreven coating. When working at a 1mL scale, pipette the protein stockdirectly into the buffered particles,and using the same pipette tip, “sy-ringe” the solution (mix up and down quickly.) When working at a larger scale, have the particles in a beakerwith a stir bar, mixing well, and add the protein stock quickly into the middle of the vortex.

• Performing a protein titration or binding isotherm is a good fi rst experiment.

• For a 0.3 μm diameter Particle (nonmagnetic), a reasonable startingrange would be 10-200 μg protein/mg Particle.

• Adsorbed proteins may elute from theParticle surface if the wash/storage buffers are different from the adsorp-tion buffer.

• Many detergents will elute adsorbed proteins and should not be used with the adsorption protocol.

Procedure:

1. Calculate the amount of each copar-ticleonent needed.

Note: The Coupling Procedure MSExcel Calculation Sheet may be utilized by placing “0” in the fi elds for EDAC:COOH.

2. Prepare and check all stock coparticleo-nents required.

3. Once the amount of each coparticleo-nent is prepared, set up the bindingreaction by pipetting the following into microcentrifuge tubes in the order given:

a. 50 μL 500 mM stock MES buffer: 25mM fi nal

b. DI Water to make 1.0 mL fi nalvolume

c. 100 μL of 10.0% solids stock particles: 1.0% solids fi nal

d. Protein stock solution: (the protein should be added last and mixed very rapidly into the reaction mix-ture by syringing repeatedly withthe pipettor)

Note: Improper mixing can yield unevenlycoated particles.

4. Mix tubes at room teparticleerature on a mixing wheel or other device forone hour.

Note: Gentle, constant mixing is ipar-ticleortant for microparticle reactions.

5. Remove unbound protein: pellet particles by centrifugation and decant the supernatant.

6. Perform two washes with your buffer(this may be the MES buffer). Pellet particles by centrifugation and decant the supernatant. Resuspend pelletsbetween washes using ultrasonica-tion.

7. Resuspend fi nal pellet to desired % solids with the same buffer. Forexaparticlele: If the target % solidsis 1.0%, then one would add 0.97 mLof the same buffer, given that some liquid remains after pellet formation.

8. Perform the Thermo Scientifi c BCA As-say for particles as an analytical tool to assess the amount of protein bound on the particles.

Covalent Coupling

Before You Begin:

• To determine the optimal amount of EDAC Concentration (EDAC:COOH) inone step covalent coupling, an EDACtitration (holding the protein constant)is performed.

Note: The Coupling Procedure MSExcel Calculation Sheet may be utilized by placing ranges of concen-trations in the “EDAC:COOH” fi eldsand a constant value for the “Proteinadded” fi elds. It is recommended thatapproximately a 0.5 to 2.5 fold molarexcess over microparticle carboxyl concentration be used. For Sera-Mag particles, the following ratios ofEDAC:COOH – 0, 0.5, 1, 2.5, 5 and 10

11

12

are suggested for optimization.

• For Active Ester (two step coupling)the concentration of EDAC:COOH maybe varied, however the recommendedmolar ratio is 2.5 to 1 and for NHS:COOH the molar ratio is 20 to 1.

• Once an optimal EDAC concentrationis determined, the optimal amount ofprotein to be added for meeting theapplication performance criteria isto be determined. To determine the optimal protein amount to be added,perform a protein titration holdingthe determined EDAC concentration fi xed.

Note: The Coupling Procedure MS Ex-cel Calculation Sheet may be utilizedby placing ranges of concentrations in the “Protein added” fi eld and thedetermined optimal EDAC:COOHconcentration in the “EDAC:COOH”fi elds.

• The optimal amount of protein to use depends on several factors:

(1) Surface area available: surfacearea per mg of Particle increases linearly with decreasing Particle diameter.

(2) Colloidal stability: proteins canhave stabilizing or destabilizing ef-fects on particles.

(3) Immunoreactivity: the optimalamount of bound sensitizing protein must ultimately be determined by functional assay.

Performing a protein titration or bind-ing isotherm is a good fi rst experi-ment. For a 0.3 μm diameter Particle (nonmagnetic), a reasonable startingrange would be 10-200 μg protein/mg Particle. For Sera-Mag particles, wewould suggest starting with protein concentrations of 0, 25, 50, 75, 100 and 150 or 200 (μg/mg of particle.)

• When the protein is added to theparticles, rapid mixing is critical foreven coating. When working at a 1mL scale, pipette the protein stockdirectly into the buffered particles,

and using the same pipette tip,“syringe” the solution (mix up anddown quickly.) When working at a larger scale, have the particles in a beaker with a stir bar, mixing well,and add the protein stock quickly into the middle of the vortex.

• For optimization scale, it is con-venient to run coupling reactionsin microcentrifuge tubes. Withconventional microcentrifuges suchas Eppendorf, coated particles of 0.150 μm or greater diameter arepelleted in 10-30 minutes. For smallerparticles (<0.150 μm diameter), lon-ger centrifugation times are neededand the pellets are more diffi cult toresuspend.

• Smaller particles may require tangen-tial fl ow fi ltration or ultracentrifuga-tion for washing.

• Colloidal stability problems increase with decreasing Particle diameter.Lowering the percent solids in the coupling step to 0.5% instead of 1% will help prevent cluparticleing during coupling.

• The particles may cluparticle duringcoupling due to the electrostatic effect of the positively charged EDACmolecules, the effect of the proteinitself, or consuparticletion of nega-tive charge by amide bond formation.Washing into fresh buffer to remove EDAC and unbound protein, followed by sonication, generally reverses thecluparticleing. Long term colloidal stability of coated particles requires development of the right storage buffer.

• The selection of storage buffer andpH is critical in achieving optimum microparticle performance. Zwitter-ionic buffers, such as MOPSO, block-ing proteins, such as bovine serumalbumin (BSA), and fi sh skin gelatin (FSG), higher pH, detergents and sodium salicylate have all proven to be useful for stabilizing microparticlepreparations while permitting specifi c agglutination reactions to occur.

• Blocking proteins with high negative charge, such as BSA and FSG, may be used to add colloidal stability, as well as block the surface against non-specifi c saparticlele adsorption. FSGworks especially well with antibody-coated particles.

One Step Coupling Procedure:

1. Calculate the amount of EDACrequired.

Note: The Coupling Procedure MSExcel Calculation Sheet may be utilizedto perform the calculations.

Given Equations:

(Particle acid content) meq/g is equiva-lent to μmole/mg

Note: 1 mL of 1% Particle contains 10mg Particle

(Acid content, μmol/mg) (10 mgparticles) (desired ratio) = μmol EDAC required (μmol EDAC required)/(52 μmol/mL) = mL EDAC stock per mL ofreaction

2. Set up binding reaction by pipettinginto microcentrifuge tubes in the order given:

a. 500 mM stock MES buffer: 25 mM fi nal

b. Water to make 1.0 mL fi nal volume

c. 10.0% solids stock particles: 1.0%solids fi nal

d. Protein stock solution (add last)

3. Mix the tubes for approximately 15minutes on a mixing wheel at roomteparticleerature.

Note: Gentle, constant mixing is iparti-cleortant for microparticle reactions.

4. Prepare the EDAC solution immedi-ately before use and mix the calculated volume rapidly into the reaction by syringing repeatedly with the pipettor.

5. Mix tubes at room teparticleerature ona mixing wheel or other device for one


13

hour. particles may cluparticle duringthis time, but this is not unusual orharmful.

6. Remove unbound protein: pellet par-ticles by centrifugation for Carboxyl-ate-modifi ed Particle, or magnet for Sera-Mag Particle, and decant the supernatant.

7. Perform two washes with your buffer.(This may be the MES buffer or a higher pH buffer of your choice.) Pelletparticles by use of a centrifuge for Carboxylate-modifi ed Particle, or mag-net for Sera-Mag Particle, and decantthe supernatant. Resuspend pellets between washes by ultrasonication.

8. Resuspend fi nal pellet to desired %solids with buffer that does not contain blocking proteins. (This may be the MES buffer or a higher pH buffer of your choice. For example: If the target % solids is 1.0%, then one wouldadd 0.97 mL of the same buffer, given that some liquid remains after pellet formation.

9. Perform the Thermo Scientifi c BCA Assay for particles as an analytical tool to assess the amount of protein boundon the particles.

10. For long term colloidal stability, a sta-bilizing storage buffer will be needed.After performing the protein analysis,coated particles can be pelleted andresuspended in a variety of storage buffers, and the colloidal stability and reactivity optimized.

Note: Covalently bound protein will not elute when subjected todetergent washes or buffer changes;thus, covalently coupled reagents arecompatible with a wider variety ofbuffer additives than reagents wherethe proteins are only adsorbed to the particles.

Active Ester Two Step Coupling Procedure:

Step One: Preactivation

1. Pipette into microcentrifuge tubes in the order given:

a. 100 μL of 500 mM MES buffer:50mM fi nal


c. 100 μL of 10.0% solids stock par-ticles: 1.0% solids fi nal

d. 230 μL NHS solution: 100 mM fi nal

e. EDAC solution, calculated amount

2. Mix tubes at room temperature on amixing wheel or other device for 30minutes.

Note: Gentle, constant mixing is impor-tant for microparticle reactions.

3. Pellet particles by centrifugation for Carboxylate-modifi ed particles, or magnet for Sera-Mag particles anddecant the supernatant.

4. Resuspend particles with 1 mL 50 mMMES buffer, pH 6.1. Pellet particles by centrifugation for Carboxylate-modi-fi ed particles, or magnet for Sera-Magparticles, and decant the supernatant.

5. Resuspend the pellet by adding the following and sonicating:

a. 100 μL 500 mM MES buffer: 50mM fi nal


Step Two: Protein Coupling

6. Add the protein stock solution.

7. Mix tubes at room temperature on amixing wheel or other device for 1hour.

Note: Gentle, constant mixing is impor-tant for microparticle reactions.

8. Remove unbound protein: pellet par-ticles by centrifugation for Carboxyl-ate-modifi ed particles or magnet forSera-Mag particles and decant the supernatant.

9. Perform two washes with your 50mMbuffer. (This may be the MES buffer or a higher pH buffer of your choice.)Pellet microparticle by centrifugation for Carboxylate-modifi ed particles or magnet for Sera-Mag particles anddecant the supernatant. Resuspend pellets between washes by ultrasoni-cation.

10. Resuspend fi nal pellet to desired% solids with buffer that does notcontain blocking proteins. (This may be the MES buffer or a higher pHbuffer of your choice.) For example: If the target % solids is 1.0%, then onewould add 0.97 mL of the same buffer,given that some liquid remains after pellet formation.

11. Perform the Thermo Scientifi c BCA Assay for particles as an analyticaltool to assess the amount of protein bound on the particles.

12. For long-term colloidal stability, a sta-bilizing storage buffer will be needed.After performing the protein analysis,coated particles can be centrifuged and resuspended in a variety of stor-age buffers, and the colloidal stabilityand reactivity optimized. Note:Covalently bound protein will notelute when subjected to detergent washes or buffer changes; thus,covalently coupled reagents are compatible with a wider variety ofbuffer additives than reagents where the proteins are merely adsorbed tothe particles.

View our technical notes at www.thermo.com/particletechnology.


Thermo Scientifi c NIST Traceable Size Standards

Calibration and Validation Duke Standards™ - 2000 Series Uniform Polymers

Nanosphere™ Size Standards - 3000 Series

Duke Standards - 4000 Series Monosized Polymer Particles

Duke Standards - 8000 Series Silica Particles

Duke Standards - 9000 Series Glass Particles

Chromosphere - T™ Certifi ed Size Standards

DRI-CAL™ Particle Size Standards

SURF-CAL™ Particle Size Standards

BCR Quartz Reference Particles

Count Controls Duke Standards - 3K-4K Series Particle Counter

COUNT-CAL™ Count Precision Standards

PHARM-TROL™ Count Precision Standards

Validex™ - Count Precision Standards

EZY-CAL™ Count Precision Standards

The Standard of Particle Technology Providing the world with size standards for over 30 years

Thermo Scientifi c NIST traceable particles are

designed and synthesized to be used in the devel-

opment, standardization and validation of most

particle counting and sizing instruments. When

these instruments are called on to solve real-world

analytical problems, customers depend on Thermo

Scientifi c particles for reference standards to

validate their results.

By using Thermo Scientifi c NIST Traceable

particles, you will now have third party

traceability to national and international

agencies through an unbroken chain of

measurements with specifi ed uncertainties.

For Size Standards products, call our Fremont, CA

offi ce at 1-800-232-3342 or at 1-510-979-5000.

Did you know...

that pharmaceutical companies depend on NIST traceable particles for particle con-

tamination monitoring.

Validate your product performance, enhance your product development

15

These polymer spheres meet the need for NIST

traceable size standards that have slightly wider

distributions than our monodisperse 3000/4000 se-

ries size standards. These products are suitable for

laser diffraction and other methods for analyzing

wide size range materials. The wider distribution

provides light scatter across a range of detectors

resulting in a more repeatable measurement.

The material is composed of sulfate cross-linked

with divinylbenzene. This gives the particle good

durability and chemical stability.

CatalogNumber

NominalDiameter

Certifi ed MeanDiameter

Size DistributionStd. Dev & CV

Aqueous Suspensions, Calibrated by Optical Microscopy

2005A 5 μm 5.0 μm ± 0.3 μm 0.6 μm (12%)

2006A 6 μm 6.1 μm ± 0.3 μm 0.6 μm (9.8%)

2007A 7 μm 7.0 μm ± 0.2 μm 0.4 μm (5.7%)

2008A 8 μm 7.7 μm ± 0.3 μm 0.6 μm (7.8%)

2009A 9 μm 9.0 μm ± 0.3 μm 0.9 μm (10%)

2010A 10 μm 9.7 μm ± 0.3 μm 0.9 μm (9.3%)

2011A 11 μm 10.9 μm ± 0.3 μm 1.0 μm (9.2%)

2014A 14 μm 14.3 μm ± 0.4 μm 1.4 μm (9.8%)

2015A 15 μm 14.6 μm ± 0.4 μm 1.1 μm (7.5%)

2020A 20 μm 20.9 μm ± 0.6 μm 1.4 μm (6.7%)

2025A 25 μm 26.4 μm ± 0.8 μm 1.9 μm (7.2%)

2030A 30 μm 30.2 μm ± 0.6 μm 2.2 μm (7.3%)

2040A 40 μm 39.6 μm ± 0.8 μm 3.6 μm (9.1%)

Your trusted partner in particle science

Product SpecificationsParticle Composition: Polystyrene divinylbenzene (PSDVB)

Particle Density: 1.05 g/cm3

Index of Refraction: 1.59 @ 589 nm (25°C)

Additives: Contains trace amount of surfactant

Package In: 15 mL, 1% solids

This graph shows a comparison between our 4205A and 2005A products. Both products have anominal diameter of 5 micrometer, but the 2005A product shows more of a distribution of particles while our 4205A product has a very narrow distribution. The 2000 series standard often gives morerepeatable results on some types of laser diffreaction instruments.

Thermo Scientifi c Duke Standards 2000 Series Uniform Polymers

16

A New Standard

Thermo Scientifi c Certifi ed Particle Size Standards are traceable to the Standard Meter through the National Institute of Standards and Technology (NIST). This feature enables laboratories to demonstrate the traceability of their analytical methods as required by ISO, ANSI/NCSL Z540, GMP/GLP and other standards and regulations. The products are also used to develop and test new analytical instruments for particle size characterization of materials.

Each package of standards contains a Certifi cate of Calibration and Traceability to NIST which includes a description of the calibration method and its uncertainty. Also included is a table of chemical and physical properties and a Material Safety Data Sheet (MSDS) with handling and disposal instructions.

17

Nanosphere Size Standards are highly uniform

sulfate particles calibrated in billionths of a meter

(nanometers) with NIST traceable methodology.

One nanometer is 0.001 micrometer (μm) or 10

Angstroms.

Nanosphere Size Standards are ideal for the cali-

bration of electron and atomic force microscopes.

They are also used in light scattering studies and

colloidal systems research. The 20 to 900 nm

range of diameters is convenient for checking the

sizes of bacterial, viral, ribosomal and sub-cellular

components.

Nanospheres are packaged as aqueous suspen-

sions in 15 milliliter (mL) dropper-tipped bottles.

The concentrations are optimized for ease of

dispersion and colloidal stability. The spheres have

a density of 1.05 g/cm3 and an index of refraction of

1.59 @ 589 nm (25 °C)

CatalogNumber

NominalDiameter



Aqueous Suspensions, Calibrated by Photon Correlation Spectroscopy (PCS)

3020A 20 nm 21 nm ± 1.5 nm Not determined



Aqueous Suspensions, Calibrated by Transmission Electron Microscopy (TEM)

3050A 50 nm 46 nm ± 2.0 nm 7.2 nm (15.7%)

3060A 60 nm 59 nm ± 2.5 nm 9.9 nm (16.8%)

3070A 70 nm 73 nm ± 2.6 nm 5.7 nm (7.8%)

3080A 80 nm 81 nm ± 2.7 nm 5.8 nm (7.2%)

3090A 90 nm 92 nm ± 3.7 nm 7.0 nm (7.6%)

3100A 100 nm 97 nm ± 3 nm 4.5 nm (4.6%)

3125A 125 nm 125 nm ± 4 nm 5.4 nm (4.3%)

3150A 150 nm 151 nm ± 4 nm 5.1 nm (3.4%)

3200A 200 nm 200 nm ± 6 nm 3.4 nm (1.7%)

3220A 220 nm 220 nm ± 6 nm 4.6 nm (2.1%)

3240A 240 nm 240 nm ± 6 nm 3.7 nm (1.5%)

3269A 270 nm 269 nm ± 6 nm 4.2 nm (1.6%)

3300A 300 nm 300 nm ± 6 nm 5.1 nm (1.7%)

3350A 350 nm 350 nm ± 7 nm 4.7 nm (1.3%)

3400A 400 nm 400 nm ± 5 nm 7.3 nm (1.8%)

3450A 450 nm 453 nm ± 4 nm 6.3 nm (1.4%)

3495A 500 nm 491 nm ± 4 nm 6.3 nm (1.3%)

3500A 500 nm 498 nm ± 5 nm 7.9 nm (1.6%)

3560A 560 nm 565 nm ± 6 nm 8.6 nm (1.5%)

3600A 600 nm 596 nm ± 6 nm 7.7 nm (1.3%)

3700A 700 nm 707 nm ± 6 nm 8.5 nm (1.2%)

3800A 800 nm 799 nm ± 9 nm 8.3 nm (1.0%)

3900A 900 nm 903 nm ± 9 nm 9.3 nm (1.0%)

Thermo Scientific Nanosphere Size Standards 3000 Series

Product SpecificationsParticle Composition: Polystyrene




Packaged in: 15 mL, 1% solids

Due to minor variations between batches, size ranges may change slightly frombatch to batch. Please see our Web site for additional product and ordering infor-mation or to contact customer service.

CatalogNumber

NominalDiameter



SolidsContent


4009A 1.0 μm 0.994 μm ± 0.021 μm 0.010 μm (1.0%) 1.0%

4010A 1.0 μm 1.020 μm ± 0.022 μm 0.011 μm (1.1%) 1.0%

4011A 1.1 μm 1.101 μm ± 0.023 μm 0.012 μm (1.1%) 1.0%

4013A 1.3 μm 1.361 μm ± 0.024 μm 0.021 μm (1.5%) 1.0%

4016A 1.6 μm 1.587 μm ± 0.025 μm 0.021 μm (1.3%) 1.0%

4018A 1.8 μm 1.745 μm ± 0.025 μm 0.019 μm (1.1%) 1.0%

4202A 2.0 μm 1.998 μm ± 0.022 μm 0.020 μm (1.0%) 0.4%

4025A 2.5 μm 2.504 μm ± 0.025 μm 0.025 μm (1.0%) 0.5%

4203A 3.0 μm 3.005 μm ± 0.027 μm 0.03 μm (1.1%) 0.5%

4204A 4.0 μm 4.000 μm ± 0.033 μm 0.04 μm (1.0%) 0.4%

4205A 5.0 μm 5.003 μm ± 0.040 μm 0.05 μm (1.0%) 0.3%

4206A 6.0 μm 5.990 μm ± 0.045 μm 0.07 μm (1.2%) 0.3%

4207A 7.0 μm 7.028 μm ± 0.055 μm 0.07 μm (1.0%) 0.3%

4208A 8.0 μm 7.979 μm ± 0.055 μm 0.09 μm (1.1%) 0.3%

4209A 9.0 μm 8.956 μm ± 0.056 μm 0.09 μm (1.0%) 0.3%

4210A 10 μm 10.00 μm ± 0.05 μm 0.09 μm (0.9%) 0.2%

4212A 12 μm 12.01 μm ± 0.07 μm 0.12 μm (1.0%) 0.2%

4215A 15 μm 15.02 μm ± 0.08 μm 0.15 μm (1.0%) 0.3%

4220A 20 μm 20.00 μm ± 0.10 μm 0.20 μm (1.0%) 0.3%

4225A 25 μm 25.09 μm ± 0.12 μm 0.38 μm (1.5%) 0.5%

4230A 30 μm 30.10 μm ± 0.22 μm 0.45 μm (1.5%) 0.6%

4240A 40 μm 39.82 μm ± 0.32 μm 0.44 μm (1.1%) 0.7%

4250A 50 μm 50.2 μm ± 0.7 μm 0.5 μm (1.0%) 1.4%

4260A 60 μm 59.1 μm ± 0.9 μm 0.9 μm (1.5%) 1.2%

4270A 70 μm 72.3 μm ± 0.9 μm 0.9 μm (1.2%) 2.0%

4280A 80 μm 79.4 μm ± 1.0 μm 0.9 μm (1.1%) 1.8%

4310A 100 μm 100 μm ± 1.5 μm 1.5 μm (1.5%) 2.1%

4311A 115 μm 113 μm ± 1.6 μm 1.6 μm (1.4%) 2.6%

4314A 140 μm 138 μm ± 2.0 μm 2.5 μm (1.8%) 4.0%

4316A 160 μm 158 μm ± 2.2 μm 3.5 μm (2.2%) 4.8%

Uniform Dry Spheres, Calibrated by Optical Microscopy - PSDVB

4320A 200 μm 201 μm ± 4.0 μm 7.8 μm (3.9%) 2.2 x 105 #/g

4324A 240 μm 235 μm ± 4.8 μm 7.3 μm (3.1%) 1.4 x 105 #/g

4328A 280 μm 279 μm ± 5.6 μm 13.5 μm (4.8%) 8.3 x 104 #/g

4330A 300 μm 300 μm ± 6.0 μm 11.9 μm (4.0%) 6.7 x 104 #/g

4340A 400 μm 398 μm ± 8.0 μm 13.5 μm (3.4%) 2.9 x 104 #/g

4350A 500 μm 494 μm ± 10 μm 25.2 μm (5.1%) 1.5 x 104 #/g

4355A 550 μm 552 μm ± 11 μm 27.0 μm (4.9%) 1.1 x 104 #/g

4365A 650 μm 644 μm ± 13 μm 24.8 μm (3.9%) 6.8 x 103 #/g

Uniform Dry Spheres, Calibrated by Optical Microscopy - PMMA

4375A 750 μm 773 μm ± 15 μm 33.3 μm (4.3%) 3.5 x 103 #/g

4400A 1000 μm 1007 μm ± 20 μm 48.3 μm (4.8%) 1.8 x 103 #/g

Thermo Scientific Duke Standards - 4000 Series Monosized Polymer Particles

The mean diameters of these products have been

calibrated with our NIST traceable microscopy

methods. Their size distribution and uniformity

were measured by electrical resistance analysis or

optical microscopy.

The 4000 Series products from 1 to 160 μm are

made from polystyrene. They are packaged as

aqueous suspensions in 15 mL dropper-tipped

bottles at an optimum concentration for dispersion,

handling and dilution.

18




Additives: Trace amount of surfactant

Product SpecificationsParticle Composition: PSDVB and PMMA

Particle Density: 1.05 g/cm3 (PSDVB)1.19 g/cm3 (PMMA)

Index of Refraction: 1.59 @ 589 nm (25°C)1.49 @ 589 nm (25°C)

Additives: Trace amount of surfactant

Products with diameters of > 200 μm are packagedas dry spheres. They are made from polystyrenecrosslinked with divi-nylbenzene (PSDVB) except for the two largest products, which are made from polymethylmethacrylate.

This series is designed for applications requiring

monodisperse inorganic spheres. Like glass, silica

has a much higher density than sulfate and the

opaque spheres provide more contrast than polymer

particles in optical and electron beams. They are

Cat.Number

NominalDiameter



8050 0.5 μm 0.49 μm ± 0.02 μm 0.02 μm (4.1%)

8070 0.7 μm 0.73 μm ± 0.02 μm 0.03 μm (4.1%)

8100 1.0 μm 0.99 μm ± 0.02 μm 0.02 μm (2.0%)

8150 1.6 μm 1.57 μm ± 0.02 μm 0.04 μm (2.5%)

Thermo Scientific Duke Standards - 8000 Series Silica Particles

Product SpecificationsParticle Composition: Amorphous Silica

Particle Density: 1.8 to 2.2 g/cm3

Index of Refraction: 1.40 to 1.46 @ 589 nm (25°C)

Additives: None

Packaged in: 15 mL, 2% solids

calibrated and certifi ed with NIST traceable mean

diameters and are suitable for a wide variety of

particle measurement applications. The particles

are packaged in pure, deionized water without any

surfactants.

This series is available as uniform spheres of

borosilicate or soda lime glass in a range of

discrete sizes from 2 micron to 2000 micron. They

are calibrated and certifi ed with NIST traceable

mean diameters and are suitable for a wide variety

Cat.No.

NominalDiameter



CountPer Gram

Uniform Borosilicate Glass Dry Spheres - Calibrated by Optical Microscopy

9002 2 μm 2.0 μm ± 0.5μm 0.7 μm (35%) 9.5 x 1010

9005 5 μm 5.1 μm ± 0.5 μm 0.6 μm (12%) 5.8 x 109

9008 8 μm 8.0 μm ± 0.8 μm 1.0 μm (13%) 1.5 x 109

9010 10 μm 9.6 μm ± 1.0 μm 1.5 μm (16%) 8.5 x 108

9015 15 μm 15.9 μm ± 1.1 μm 1.8 μm (11%) 1.9 x 108

9020 20 μm 17.3 μm ± 1.4 μm 2.0 μm (12%) 1.5 x 108

Uniform Soda Lime Glass Dry Spheres - Calibrated by Optical Microscopy

9030 30 μm 30.1 μm ± 2.1 μm 2.3 μm (7.6%) 2.9 x 107

9040 40 μm 40.6 μm ± 2.8 μm 2.2 μm (5.4%) 1.1 x 107

9050 50 μm 49.9 μm ± 3.0 μm 2.2 μm (4.4%) 6.3 x 106

9060 60 μm 60.0 μm ± 3.6 μm 2.3 μm (3.8%) 3.6 x 106

9070 70 μm 71.0 μm ± 3.4 μm 2.9 μm (4.1%) 2.2 x 106

9080 80 μm 79.1 μm ± 4.0 μm 2.8 μm (3.5%) 1.6 x 106

9090 90 μm 90.3 μm ± 4.5 μm 3.9 μm (4.3%) 1.1 x 106

9100 100 μm 97.6 μm ± 4.9 μm 3.6 μm (3.7%) 8.3 x 105

9110 110 μm 111 μm ± 5.5 μm 4.2 μm (3.8%) 5.8 x 105

9120 120 μm 120 μm ± 6.0 μm 5.2 μm (4.3%) 4.5 x 105

9140 140 μm 139 μm ± 7.0 μm 2.9 μm (2.1%) 2.9 x 105

9170 170 μm 167 μm ± 8.4 μm 6.3 μm (3.8%) 1.6 x 105

9200 200 μm 196 μm ± 5..9 μm 5.7 μm (2.9%) 1.0 x 105

9230 230 μm 231 μm ± 6.9 μm 9.0 μm (3.9%) 6.2 x 104

9280 280 μm 279 μm ± 8.4 μm 9.3 μm (3.3%) 3.5 x 104

9330 330 μm 324 μm ± 10 μm 16.0 μm (4.9%) 2.2 x 104

9400 400 μm 391 μm ± 12 μm 10.1 μm (2.6%) 1.3 x 104

9480 480 μm 480 μm ± 14 μm 17.8 μm (3.7%) 7.1 x 103

9550 550 μm 553 μm ± 17 μm 29.0 μm (5.2%) 4600

9650 650 μm 655 μm ± 20 μm 29.0 μm (4.4%) 2800

9750 750 μm 749 μm ± 22 μm 19.4 μm (2.6%) 1825

9950 950 μm 940 μm ± 28 μm 39.7 μm (4.2%) 950

91000 1000 μm 1106 μm ± 33 μm 28.6 μm (2.6%) 560

92000 2000 μm 2007 μm ± 40 μm 50.9 μm (2.5%) 95

Thermo Scientific Duke Standards - 9000 Series Glass Particles

Product SpecificationsParticle Composition: Borosilicate Glass

Particle Density: 2.5 - 2.55 g/cm3


Additives: None

Packaged in: 1g, dry

of particle measurement applications. They also

have a better tolerance to chemicals and solvents

in addition to higher mechanical and thermal stabil-

ity. The spheres have been processed to remove

non-spherical and broken particles.

Product SpecificationsParticle Composition: Soda Lime Glass

Particle Density: 2.4 - 2.6 g/cm3

Index of Refraction: 1.50 - 1.52 @ 589 nm (25°C)

Additives: None

Packaged in: 1g, dry

Mechanical/ Electrical/ Thermal Properties

Units: Glass Glass

Young’s Modulus [106 psi] 10.5 10.0

Hardness [Moh] 6.5 6-7

Dielectric Constant: [22°C, 106 Hz] 5.8 6.9

Softening Point [°C] 846 700

The following properties are typical values for bulk borosilicate and soda lime glass. These valueshave not been measured and are not assay valuesfor a specifi c batch of particles. The data is for information only and should not be used as calibra-tion values.

Typical CompositionSiO

252.5% 60 - 72.5%

Na2O 0.3% 13.7 - 17%

CaO 22.5% 9.8 - 18%

MgO 1.2% 1 - 3%

Al2O

314.5% 0.4 - 4%

FeO/ Fe2O

30.2% 0 - 0.2%

K2O 0.2% 0 - 0.1%

B2O

38.6% 0.0%

19

CatalogNumber

NominalDiameter

Color Certifi ed MeanDiameter


ApproximateCount per

Gram

Dry Dyed Particles, Calibrated by Optical Microscopy

RD050T 50 μm Red 49.1 μm ± 1.5 μm 3.8 μm (7.8%) 1.6 x 107

BK050T 50 μm Black 49.3 μm ± 1.5 μm 4.1 μm (8.4%) 1.5 x 107

RD100T 100 μm Red 96.0 μm ± 3.2 μm 7.5 μm (7.8%) 2.0 x 106

BK100T 100 μm Black 94.8 μm ± 2.8 μm 7.1 μm (7.5%) 2.1 x 106

RD150T 150 μm Red 149 μm ± 3.6 μm 9.0 μm (6.0%) 5.5 x 105

BK150T 150 μm Black 148 μm ± 4.1 μm 11 μm (7.1%) 5.6 x 105

RD200T 200 μm Red 202 μm ± 3.8 μm 9.5 μm (4.7%) 2.2 x 105


RD300T 300 μm Red 301 μm ± 4.0 μm 10 μm (3.3%) 6.6 x 104






Thermo Scientific ChromoSphere-T Certified Size Standards

Product SpecificationsParticle Composition: Polystyrene Divinylbenzene (PS-DVB)



Additives: None

Packaged in: 1 g, dry

ChromoSphere-T polymer particles are internally

dyed with deeply colored red or black dyes. The

intense colors result in very high contrast and vis-

ibility relative to most background materials. They

are available as dry powders and can easily be

suspended in aqueous media if desired. The mean

diameters of ChromoSphere-T Certifi ed Size Stan-

dards are traceable to the standard meter through

the National Institute of Standards and Technology

(NIST) and are calibrated by optical microscopy.

ChromoSphere-T Size Standards were developed

for use as reference or calibration materials in

applications where a high visual contrast is desired.

The product line consists of a large assortment

of uniform particle sizes between 50 and 500

microns in either red or black color. The particles

are made from cross-linked polystyrene divinyl-

benzene (PS-DVB) copolymer and should be stored

at room temperature. They can be dispersed in

aqueous media with the aid of a small amount of

surfactant or in lower alcohols, such as methanol or

ethanol. Some dye extraction will result when the

particles are suspended in pure alcohols, but will

be minimal. Other organic solvents, such as ethers

or chlorinated hydrocarbons, should be avoided be-

cause they will swell the particles and completely

extract the dye.

Rinse Water Wash Studies/Particulate Decontamination Studies

Colored and fl uorescent particles can be used to evaluate the cleaning capability of vial washers.

Some Helpful Tips

• The naked eye can resolve down to about 50 μm

See: ChromoSphere Polymer Particles (Dry) on page 40

• Need even higher contrast? Fluorescent particles really stand out on a dark background.

See: FluorescentPolymer Particles (Aqueous) and FluorescentPolymer Particles on page 45

Important Considerations

• What is the smallest particle contaminant you are looking for?

Choose a test particle which is the same size or smaller. 20

21

These products are provided for calibrating particle

sizing and counting instrumentation that require dry

particles.

DRI-CAL Particle Size Standards are conveniently

packaged in dropper-tipped vials in 1 gram quanti-

ties, enabling the user to dispense the particles

directly into the sampling chamber. They are not

suitable for dispersion in liquid media.

Each package of standards contains a Certifi -

cate of Calibration and Traceability to NIST

which includes a description of the calibration

method and its uncertainty, and a table of

chemical and physical properties. A Material

Safety Data Sheet with handling and disposal

instructions is also included. Packages are

lot-numbered for technical service and support

after the sale.

To order Thermo Scientifi c DRI-CAL

products, call our Fremont, CA offi ce at

1-800-232-3342 or at 1-510-979-5000.

CatalogNumber

NominalDiameter



Approx. Count per Gram

Uniform PSDVB Dry Spheres - Calibrated by Optical Microscopy

DC-05 5 μm 5.0 μm ± 0.4 μm 0.5 μm (10%) 1.4 x 1010

DC-06 6 μm 6.0 μm ± 0.4 μm 0.9 μm (15%) 8.4 x 1010

DC-07 7 μm 6.9 μm ± 0.4 μm 0.7 μm (10%) 5.5 x 109

DC-08 8 μm 7.5 μm ± 0.5 μm 0.8 nm (11%) 4.3 x 109

DC-10 10 μm 10.0 μm ± 0.5 μm 1.0 nm (10%) 1.8 x 109

DC-15 15 μm 16.2 μm ± 0.8 μm 1.8 nm (11%) 4.3 x 108

DC-20 20 μm 20.8 μm ± 0.7 μm 1.9 nm (9.5%) 2.3 x 108

DC-25 25 μm 25.6 μm ± 1.5 μm 3.3 nm (13%) 1.1 x 108

DC-50 50 μm 50.7 μm ± 2.0 μm 4.4 nm (8.7%) 1.4 x 107

DC-70 70 μm 68.2 μm ± 3.0 μm 3.7 nm (5.4%) 5.7 x 106

DC100 100 μm 97 μm ± 4 μm 5.6 nm (5.8%) 2.0 x 106

Thermo Scientific DRI-CAL Particle Size Standards

Product SpecificationsParticle Composition: Polystyrene Divinylbenzene (PSDVB)



Additives: Trace flow agent may be present


SURF-CAL is designed to simplify the job of prepar-

ing calibration wafers in your facility. Available

particle sizes correspond to the calibration point

sizes required by instrument manufacturers.

Along with the Semiconductor Industry, we have

established specifi c particle sizes to be used when

calibrating Scanning Surface Inspection Systems.

Working with instrument manufacturers the

SURF-CAL product line was created to meet SEMI

standard guidelines. Available are sizes considered

to be critical sizing nodes as defi ned by the

International Technology Roadmap for Semiconduc-

tors (ITRS)1.

By depositing SURF-CAL NIST traceable sulfate

latex spheres (PSL) on specially selected wafers,

you can perform periodic calibration checks and

compare your scanner with scanners at other

locations. You can also assess the performance of

your SSIS at critical stages in the manufacturing

process.

All products are suspended in deionized, fi ltered

water in 50 mL bottles at a concentration of 3

x108 particles per mL. Products, PD1100 and

smaller are also available at 1010 particles per

mL for applications using the aid of a Differential

Mobility Analyzer (DMA) or other size exclusionary

techniques.

Measurement Methodology

To assure direct traceability to NIST, the certifi ed

diameters of these products were transferred by

transmission electron or optical microscopy from

NIST standard reference materials2. The uncertainty

was calculated per the NIST Technical Note 1297,

1994 Edition “Guidelines for Evaluating and

Expressing the Uncertainty of NIST Measurement

Catalog Number(Particles per mL)

Certifi ed PeakDiameter

ExpandedUncertainty

Size Distribution

3 x 108 1010 (of peak diameter) Std. Dev. CV% FWHM%

PD-047 PD-047B 0.047 μm 0.002 μm 0.004 μm 7.5% 17.4%

PD-064 PD-064B 0.064 μm 0.002 μm 0.003 μm 5.4% 10.9%

PD-070 PD-070B 0.072 μm 0.002 μm 0.005 μm 7.2% 16.2%

PD-080 PD-080B 0.080 μm 0.005 μm 0.006 μm 7.0% 12.8%

PD-083 PD-083B 0.083 μm 0.002 μm 0.004 μm 4.2% 9.6%

PD-090 PD-090B 0.089 μm 0.004 μm 0.005 μm 5.7% 9.6%

PD-092 PD-092B 0.092 μm 0.004 μm 0.004 μm 4.6% 9.1%

PD-100 PD-100B 0.100 μm 0.005 μm 0.003 μm 2.6% 5.2%

PD-110 PD-110B 0.114 μm 0.005 μm 0.004 μm 3.3% 6.3%

PD-125 PD-125B 0.126 μm 0.006 μm 0.003 μm 2.4% 4.8%

PD-155 PD-155B 0.155 μm 0.003 μm 0.003 μm 1.6% 3.7%

PD-180 PD-180B 0.184 μm 0.003 μm 0.004 μm 2.2% 3.9%

PD-200 PD-200B 0.202 μm 0.007 μm 0.004 μm 1.8% 4.0%

PD-204 PD-204B 0.204 μm 0.008 μm 0.004 μm 1.8% 3.7%

PD-215 PD-215B 0.220 μm 0.007 μm 0.003 μm 1.6% 3.3%

PD-305 PD-305B 0.304 μm 0.005 μm 0.004 μm 1.4% 3.4%

PD-365 PD-365B 0.360 μm 0.013 μm 0.005 μm 1.3% 2.8%

PD-500 PD-500B 0.494 μm 0.010 μm 0.006 μm 1.1% 2.5%

PD-800 PD-800B 0.809 μm 0.014 μm 0.006 μm 0.8% 1.8%

PD-802 PD-802B 0.802 μm 0.011 μm 0.009 μm 1.1% 2.4%

PD1100 PD1100B 1.112 μm 0.018 μm 0.011 μm 1.0% 2.5%

PD1600 1.57 μm 0.02 μm 0.016 μm 1.0% 2.2%

PD2000 2.01 μm 0.04 μm 0.019 μm 1.0% 3.3%

PD2500 2.50 μm 0.05 μm 0.025 μm 1.0% 2.9%

PD3000 3.04 μm 0.06 μm 0.026 μm 0.9% 2.7%

Thermo Scientific SURF-CAL Particle Size Standards




Additives: None

Packaged in:L 50 mL

22

Results”3. The uncertainty listed is the expanded

uncertainty with a coverage factor of two (K=2). The

peak diameter was calculated using approximately

the ± 2s range of the particle size distribution. The

size distribution was calculated as the standard

deviation of the whole peak. The Coeffi cient of

Variation is one standard deviation expressed as

a percentage of the peak diameter. The FWHM

distribution was calculated as the distribution at

half of the peak height expressed as a percentage

of the peak diameter.

1. “The National Technology Roadmap for Semiconductors”, SemiconductorIndustry Association (1999)

2. S.D. Duke and E.B. Layendecker, “Internal Standard Methodfor Size Calibration of Sub-MicronSpherical Particles by Electron Microscopy”, Fine Particle Society (1988)

3. Barry N. Taylor and Chris E. Kuyatt, “Guidelines for Evaluating and Expressing the Uncertainty of NIST Measurement Results”. NIST Technical Note 1297, 1994 edition, September 1994.

23

Quartz Reference Particles from The Institute for

Reference Materials and Measurement (IRMM) are

non-spherical, certifi ed materials used for evaluat-

ing particle size analysis instruments or sieves

requiring samples with a wide size distribution.

They are also useful for evaluating laser diffraction

spectrometers and electrical resistance analyzers.

The reference particles were prepared, charac-

terized and certifi ed under the sponsorship of

the Community Bureau of Reference (BCR) the

standards bureau of the European Common Market.

They were analyzed by laboratories in Germany,

Italy and the United Kingdom.

NOTE: This material has been certifi ed by BCR,

the former reference materials program of the Eu-

ropean Commission. The product certifi cates have

been revised under the responsibility if IRMM.

Product Detail

Mined in Frechen, Germany, the quartz is mostly

silicon dioxide with trace amounts of iron (Fe),

titanium (Ti), sodium (Na) and calcium (Ca). The

chemical composition was characterized using

hydrofl uoric acid dissolution, the resulting residue

was analyzed. Sodium and calcium content were

determined by fl ame photometry. Iron and titanium

content were determined using spectrophotometric

techniques.

BCR 66, 67, 69 and 70 were calibrated by gravimet-

ric sedimentation and BCR 68 and 130 by a sieving

technique by the BCR. The samples were also ana-

lyzed by TEM, electrical sensing zone, sieving and

several sedimentation methods. A continuum of

the weight distribution is provided for each sample.

The density was determined by pyknometer and is

approximately 2.6 g/cm3.

Results and methods are summarized in two

detailed reports:

Certifi cation Report on Reference Materials of

Defi ned Particle Size, for BCR 66 through 70.

Certifi cation Report on Reference Materials of

Defi ned Particle Size, for BCR 130.

Both reports are included with the kit.*

Each individual bottle of quartz reference particles

is accompanied by a Certifi cate of Measurement,

which outlines measurement methods, chemical

analysis data and instructions for use.

*The appropriate report will be included with orders of six or more

kits (any combination) at no charge.

To order Thermo Scientifi c BCR-Quartz

Reference particles, call our Fremont, CA offi ce

at 1-800-232-3342 or at 1-510-979-5000.

Catalog Number Size Range Density QuantityBCR 66 0.35 - 3.5 μm 2.62 g/cm2 10 grams

BCR 70 1.2 - 20 μm 2.64 g/cm2 10 grams

BCR 67 2.4 - 32 μm 2.65 g/cm2 10 grams

BCR 69 14 - 90 μm 2.65 g/cm2 10 grams

BCR 130 50 - 220 μm 2.64 g/cm2 50 grams

BCR 68 160 - 630 μm 2.65 g/cm2 100 grams

BCR RPT1 Certification Report BCR 66 - BDR 70

BDR RPT2 Certification Report BCR 130

BCR Kit Quartz Reference Particle Kit - Contains 1 vial of each product and both reports

Thermo Scientific BCR Quartz Reference Particles

Product SpecificationsParticle Composition: Quartz


Index of Refraction: Unknown

Additives: None

Packaged as: Dry particles

24

Thermo Scientifi c Count Control particles are used for

the count validation of most particle counting instru-

ments. When these instruments are called on to solve

real-world analytical problems, customers call on

Thermo Scientifi c brand particles for reference

standards to validate their results.

Did you know...Thermo Scientifi c Count Controls have rapidly become an indespensible technology for optimizing

drinking water quality.

Thermo Scientifi c Count Controls

Validate Performance

This series of NIST traceable size standards provide an accurate and convenient method for calibrating or checking the performance of laser particle counters used in cleanrooms and other contamination monitoring applications.

These particle size standards provide third party traceability of calibration procedures to national and international agencies through an unbroken chain of measurements with specifi ed uncertainties. The products are also used to develop and test new analytical instruments for particle size characterization of materials.

They are available as uniform spheres in a range of discrete sizes from 100 nanometers (nm) to 100 micrometers (μm or microns). The spherical diameters are calibrated with linear dimensions transferred from NIST Standard Reference Materials (SRM). Spheres are used instead of irregularly shaped particles to minimize the response of analytical systems to shape effects.

Each package of standards contains a Certifi cate of Calibration and Traceability to NIST which includes a description of the calibration method and its uncertainty, a specifi ed count and a table of chemical and physical properties. A Material Safety Data Sheet (MSDS) with disposal instructions is also included. Packages are lot numbered for convenient technical service and support after the purchase.

25

This series of NIST traceable size standards

provides an accurate and convenient method for

calibrating or checking the performance of laser

particle counters used in cleanrooms and other con-

tamination monitoring applications. The products

are suspensions of monodisperse sulfate spheres

for use in airborne or liquid particle dispersion

systems. The particle diameters are traceable to

the standard meter through the National Institute of

Standards and Technology (NIST).

The particles are prepared as low residue aqueous

suspensions for minimal background interference.

This product line is precisely diluted for immediate

use in laser particle counters with minimal time-

consuming adjustments of concentration.

To order Thermo Scientifi c Duke Standards,

call our Fremont, CA offi ce at 1-800-232-3342

or at 1-510-979-5000.

CatalogNumber

NominalDiameter



Approximate#/mL

Aqueous Suspensions, Calibrated by Transmission Electron Microscopy (TEM)

3K-100 0.1 μm 0.102 μm ± 0.003 μm 0.0076 μm (7.5%) 109

3K-150 0.15 μm 0.151 μm ± 0.004 μm 0.0051 μm (3.4%) 109

3K-200 0.2 μm 0.200 μm ± 0.006 μm 0.0034 μm (1.7%) 109

3K-220 0.22 μm 0.220 μm ± 0.006 μm 0.0046 μm (2.1%) 109

3K-269 0.27 μm 0.269 μm ± 0.006 μm 0.0042 μm (1.6%) 109

3K-300 0.3 μm 0.300 μm ± 0.006 μm 0.0051 μm (1.7%) 109

3K-350 0.35 μm 0.350 μm ± 0.007 μm 0.0047 μm (1.6%) 109

3K-400 0.4 μm 0.400 μm ± 0.005 μm 0.0073 μm (1.8%) 109

3K-500 0.5 μm 0.499 μm ± 0.005 μm 0.0065 μm (1.3%) 109

3K-600 0.6 μm 0.596 μm ± 0.006 μm 0.0077 μm (1.3%) 109

3K-700 0.7 μm 0.707 μm ± 0.006 μm 0.0085 μm (1.2%) 109

3K-800 0.8 μm 0.799 μm ± 0.009 μm 0.0083 μm (1.0%) 109

3K-900 0.9 μm 0.903 μm ± 0.009 μm 0.0093 μm (1.0%) 109


3K-990 1.0 μm 0.994 μm ± 0.021 μm 0.010 μm (1.0%) 109

3K1000 1.0 μm 1.020 μm ± 0.022 μm 0.011 μm (1.1%) 109

3K1600 1.6 μm 1.587 μm ± 0.025 μm 0.021 μm (1.3%) 109

4K-02 2.0 μm 1.998 μm ± 0.022 μm 0.020 μm (1.0%) 5 x 108

4K-03 3.0 μm 3.005 μm ± 0.027 μm 0.03 μm (1.1%) 5 x 107

4K-04 4.0 μm 4.000 μm ± 0.033 μm 0.04 μm (1.0%) 5 x 107

4K-05 5.0 μm 5.003 μm ± 0.040 μm 0.05 μm (1.0%) 107

4K-06 6.0 μm 5.990 μm ± 0.045 μm 0.07 μm (1.2%) 107

4K-07 7.0 μm 7.028 μm ± 0.055 μm 0.07 μm (1.0%) 107

4K-10 10 μm 10.00 μm ± 0.05 μm 0.09 μm (0.9%) 106

4K-15 15 μm 15.02 μm ± 0.08 μm 0.15 μm (1.0%) 106

4K-20 20 μm 20.00 μm ± 0.10 μm 0.20 μm (1.0%) 3 x105

4K-25 25 μm 25.09 μm ± 0.12 μm 0.38 μm (1.5%) 3 x105

4K-30 30 μm 30.10 μm ± 0.22 μm 0.45 μm (1.5%) 3 x105

4K-40 40 μm 39.82 μm ± 0.32 μm 0.44 μm (1.1%) 8 x104

4K-50 50 μm 50.2 μm ± 0.7 μm 0.5 μm (1.0%) 8 x104

4K-60 60 μm 59.1 μm ± 0.9 μm 0.9 μm (1.5%) 8 x104

4K-70 70 μm 72.3 μm ± 0.9 μm 0.9 μm (1.2%) 8 x104

4K-80 80 μm 79.4 μm ± 1.0 μm 0.9 μm (1.1%) 3 x104

4K100 100 μm 100 μm ± 1.5 μm 1.5 μm (1.5%) 3 x104

Thermo Scientific Duke Standards 3K/4K Series - Particle Counter Size Standards





Packaged in: 15 mL

26

Application Specifi c Count Control Products

CatalogNumber

NominalDiameter


Quantity


CS-PK 15 μm 15.02 μm ± 0.08 μm 6 bottles

CS-BX 15 μm 15.02 μm ± 0.08 μm 20 bottles

Thermo Scientific PHARM-TROL - Count Precision Standards


Concentration 3800 particles / mL ± 15%




Packaged in: 25 mL

PHARM-TROL is a product containing NIST trace-

able size standards with a measured particle count.

The product was developed for manufactures of

parenteral drugs and ophthalmic solutions seeking

interim verifi cation of USP <788> and <789> (Par-

ticulate Matter in Injections and Particulate Matter

in Ophthalmic Solutions). The particle diameters

are traceable to the standard meter through NIST.

PHARM-TROL is prepared with the same exacting

procedures as the USP Count Reference Standard

and provides process control data for particle

counting consistency and verifi cation of size

calibration.

The ready-to-use precision standard is designed for

regular use in liquid particle counters. This docu-

ments the reproducibility of the particle counter

by permitting a continuous record of its perfor-

CatalogNumber

NominalDiameter




CRS-05 5 μm 5.0 μm ± 0.1 μm 0.1 μm (2%)

CRS-10 10 μm 10.2 μm ± 0.1 μm 0.1 μm (2%)

Thermo Scientific Validex Count Precision Standards






Packaged in: 500 mL

Particle counting in the drinking water industry has

rapidly become an indispensable technology for

optimizing water quality. The majority of particle

counters used in the drinking water industry

operate on the principle of single particle light

obscuration.

Validex contains NIST traceable polymer particles

packaged in ultrapure water at concentrations

ideal for use in validating the performance of liquid

particle counters. The composition of the suspen-

sion has been optimized to promote dispersion

of the particles. Each bottle contains 500 mL of

suspension at a nominal concentration of 1000

particles per mL. A stir bar is included in the bottle

to aid dispersion.

Thermo Scientifi c PHARM-TROL Count Precision StandardsExcellent for:• USP <788> and <789> interum verifi cation

• Liquid particle counting and calibration

Benefi ts:• Certifi ed concentration

• Ultraclean diluent

• No dilution required

• Sample directly from bottle to avoid

contamination

Thermo Scientifi c Validex Count Precision StandardsExcellent for:• Instrument calibration and verifi cation in

the drinking water industry

• Low level liquid particle counting and

calibration

Benefi ts:• Certifi ed concentration

• Ultraclean diluent

• No dilution required

• Sample directly from bottle to avoid

contamination

• Larger volume for appropriate testing

mance using a particle suspension with a known

concentration. The data provides documentation

for internal or customer quality audits.

27

CatalogNumber

NominalDiameter



Quantity


CC02-PK 2 μm 1.998 μm ± 0.022 μm 0.020 μm (1.0%) 6 Bottles









Thermo Scientific COUNT-CAL Count Precision Standards






Packaged in: 6 x 25 mL packs

COUNT-CAL is a cost effective and convenient

product for validating liquid particle counters.

Packaged in single-use bottles and intended to

be sampled directly from the bottle, it eliminates

the need for serial dilutions and extensive sample

handling, thereby minimizing contamination. It

was developed for manufactures of parenteral

drugs and ophthalmic solutions seeking interim

verifi cation of USP <788> and <789> (Particulate

Matter in Injections and Particulate Matter in

Ophthalmic Solutions).

The particles are suspended in an ultraclean

diluent and the concentration is optimized for use

in light obscuration particle counters and other low

concentration counting applications. The particle

diameters are traceable to the Standards Meter

through NIST.

To order Thermo Scientifi c COUNT-CAL


1-800-232-3342 or at 1-510-979-5000.

CatalogNumber

NominalDiameter




6002 2 μm 1.998 μm ± 0.022 μm 0.020 μm (1.0%)

6005 5 μm 5.010 μm ± 0.035 μm 0.05 μm (1.1%)

6010 10 μm 10.00 μm ± 0.05 μm 0.09 μm (0.9%)

6015 15 μm 15.02 μm ± 0.08 μm 0.15 μm (1.0%)

6020 20 μm 20.00 μm ± 0.10 μm 0.020 μm (1.0%)

6025 25 μm 25.09 μm ± 0.12 μm 0.038 μm (1.5%)

6030 30 μm 30.10 μm ± 0.22 μm 0.045 μm (1.5%)

6050 50 μm 49.7 μm ± 0.7 μm 0.8 μm (1.6%)

6070 70 μm 72.3 μm ± 0.9 μm 0.9 μm (1.2%)

Thermo Scientific EZY-CAL Count Precision Standards






Packaged in: 100 mL

EZY-CAL is a series of ready-to-use size standards

for validating optical particle counters. A magnetic

stir bar is included in each bottle for clean, con-

venient and direct sampling by instruments. The

aqueous suspension medium contains a combina-

tion of dispersing agents, which help to keep the

particles from clumping or sticking to fl ow surfaces

in the particle counter. The particle diameters are

traceable to the standard meter through NIST.

This series of size standards is provided for setting

or checking the calibration of channel thresholds

or for checking the count precision of liquid borne

particle counters.

PARTICLE HANDLING TIPS

Listed below are helpful tips when usingour particles. These are general guide-lines and should be used accordingly.Please read the literature that accom-panies your product for special handlingnotes (if any). If you have a critical ap-plication or are looking for a product thatcan be used without additional process-ing, please contact our technical service department.

Note: For most applications, it is impera-tive to ensure the cleanliness ofdiluents, sampling implements, and any other component that willmake contact with the particles.

RESUSPENSION

Polymer particles ≥ 0.5 μm in suspension will sediment out over time. To resuspend the particles, simply invert the bottle sev-eral times avoiding rigorous agitation asbubbles formed may result in statistical artifacts. Sonication after resuspension is recommended to de-gas and break uptemporary agglomerates. For applications that require the particles to be suspendedfor an extended period of time, a clean magnetic stir bar may be used.

DILUTION

Most particle suspensions are suitable for dilution and do not require additional sur-factant/dispersant, however, the diluted suspensions should be used immediatelyas the stability may be affected.

1. Calculate the quantity of particlesneeded based on desired fi nal concen-tration and quantity.

2. Resuspend the original particlesuspension.

3. Sample immediately into clean container.

4. Add fi ltered deionized water to desiredamount.

SUSPENDING DRY PARTICLES

This procedure outlines the steps neces-sary to put a dry powder into suspension.

Working with Particles

1. Wet the dry particles with a1% surfactant solution (anionic or non-ionic, i.e., Tween 20 or Triton X100) or an alcohol such asmethanol or ethanol.

2. Add fi ltered water to the desired amount. (Alternatively, let the resin settle and pour off the sus-pension into another clean bottle.)

DRYING A SUSPENSION

Drying a suspension to achieve a dry powder is not recommended. The par-ticles may form permanent aggregates and may be aerosolized creating aninhalation hazard.

DISSOLVING POLYSTYRENE PARTICLES

In general, aromatic hydrocarbons willdissolve polystyrene. Some commonlyused solvents for this application are:

Benzene

Methyl Ethyl Ketone (MEK)

Toluene

Note: *MEK and toluene will dissolve polystyrene divinylbenzene(PSDVB) over time.

REMOVING/REDUCING ADDITIVESBY ION EXCHANGE OR DIALYSIS

These procedures are used to achieve low or surfactant-free suspensions for applications such asaerosol and biotechnology applica-tions. However, removing the surfac-tant from a suspension may compro-mise the stability of the product and should be performed immediatelyprior to use. Please contact us if youare looking for a low or surfactant-free product.

ION EXCHANGE

This procedure is recommended for removing ionic surfactants from the sus-pension and surface of the particles:

1. Obtain mixed bed ion-exchange resin(i.e., Bio-Rad AG501-X8).

2. For a 15 mL bottle of particles at 1%solids use 3 to 4 grams of resin.

3. Wash the resin thoroughly to removepotential contaminants.

a. Wash resin with approximately 200mL deionized water fi ve times.

b. Allow the resin to settle, and pouroff the water.

4. Add the particle suspension to theresin in a small bottle. Add extra water if needed.

5. Roll the mixture for 4 to 6 hours andfi lter through washed glass wool to remove the resin.

DIALYSIS

This procedure is recommended forremoving surfactants from the suspension(but not from the particle surface.)

1. Wash the dialysis tubing (i.e.,Spectrapor 12,000-14,000 molecu-lar weight cut-off) thoroughly withdeionized water and place it in a container of deionized water, sub-merged.

2. Keep refrigerated for storage.

3. When ready to use, cut off the desired length of tubing.

4. Place a clamp on one end or tie it off.

5. Fill about half full with the particlesuspension.

6. Clamp or tie the top end and placein the container of deionized water with at least 10 to 20 times the volume of the latex.

7. Roll or stir the contents of the con-tainer.

8. Allow to dialyze for at least 4 hours.

9. Repeat dialysis three times with fresh water.


28


Thermo Scientifi c Flow Cytometry Products

Flow Cytometry Instrument Performance Cyto-Cal Multifl uor fl uorescence Intensity Calibrator

Cyto-Cal Alignment Beads

Cyto-Cal Count Control

Cyto-Cal Low Intensity Calibrator

Flow Cytometry Multiplex Assay Products Cyto-Plex Carboxylated Particles

30

Flow CytometryFlow cytometry is a technique for counting, examining, and sorting microscopic particles suspended in a fl uid stream. It allows simultaneous multiparametric analysis of the physical and/or chemical characteristics of single cells fl owing through an optical and/or electronic detection apparatus.

Modern fl ow cytometers are able to analyze several thousand particles every second and can actively separate and isolate particles having specifi ed properties. A fl ow cytometer is similar to a microscope, except that instead of producing an image of the cell, fl ow cytometry offers automated quantifi cation of set parameters.

Thermo Scientifi c Flow cytometry beads provide a third party supplier of controls. We have created an open platform of products to provide data for different instruments and laboratories without bias to any particular instrument brand.

Thermo Scientifi c Flow Cytometry Instrument Performance

Through optical measurements, fl ow cytom-

eters distinguish cells on the basis of size and

shape in addition to the presence of many

different molecules inside and on the surface

of the cells. The appeal of fl ow cytometry

arises from the fl exibility and sensitivity of

fl uorescence technology combined with the

technique’s high speed and powerful data

integration capabilities.

By being a third party supplier of controls we

have created an open platform of products

to provide data for different instruments and

laboratories without bias to any particular

instrument brand.

To order Thermo Scientifi c Flow Cytometry


1-800-232-3342 or at 1-510-979-5000.

Did you know...hospitals depend on calibration particles for monitoring CD4 counts in

blood samples of AIDS patients and did you know that clinical instru-

ment manufactures use particles to perform the primary calibration and

set-up of commercially available fl ow cytometers.

31

CatalogNumber

Description Quantity


FC3M Cyto-Cal Multifl uor 3 mL (50 tests)

Thermo Scientific Cyto-Cal Multifluor Fluorescence Intensity Calibrator

Product SpecificationsParticle Composition: Polystyrene particles containing encapsulated dyes

Dyes Firefli™ Fluorescent Green (488/510 nm), Orange (488/575 nm) and Red (488,633, 635/700 nm)

Concentration 1.5 x 107 particles / mL


Additives: 0.05% tween-20 dispersant / Surfactant with 2mMSoidum Azide Preservative

Packaged in: 3 mL

The Cyto-Cal Multifl uor Fluorescence Intensity Cali-

brator is designed to simultaneously monitor fl ow

cytometer stability as well as provide a check of

instrument sensitivity and performance. Although

the product can provide relative fl uorescence esti-

mations of labeled cells (MEFL), it is not designed

for quantitation of fl uorochromes on cells.

The calibrator is a uniform mixture of 3 μm particles

with three dyes in seven different fl uorescent inten-

sities. Due to the high uniformity of the particles,

singlet gating is not required. The calibrator con-

sists of a single vial of fl uorescent beads precisely

stained with fl uorescent dyes that have optimized

intensity and broad emission in multiple channels

(FITC, PE, PE-Cy5, PE-Texas Red, APC, APC-Cy7).

Each intensity level has an MEFL (mean equivalent

fl uorochrome)* value for estimation of relative

fl uorescence intensities of labeled cells.

*MEFL is also referred to as Molecules of Equivalent Soluble Fluorochrome

(MESF). The MEFL values provided are not traceable to a standard reference

material.

CatalogNumber



FA3O 488 nm alignment beads 3 mL (50 tests)

FA3R 633 nm alignment beads 3 mL (50 tests)

Thermo Scientific Cyto-Cal Alignment Beads

Superior bead size and uniform dye intensity

provide exceptional accuracy when performing the

alignment of the fl ow cytometer optics to give a

high level of confi dence in the instrument results.

Cyto-Cal Alignment Beads provide a superior

method for optical alignment and fl ow cell focusing

of fl ow cytometers. The 3 μm particles are of the

highest quality in size and fl uorescence uniformity

to permit the best possible optimization of each

parameter being measured. Cyto-Cal Alignment

beads are internally dyed with chemically stable

dyes and therefore have excellent signal stability.

The Cyto-Cal 488 Alignment beads are excited by

the 488nm spectral line of the argon laser and have

broad emission, allowing then to be used to align

the FL1 (FITC), FL2 (PE) and FL3 (PE-Cy5) channels

simultaneously.

The Cyto-Cal Multifl uorescence Intensity Calibrator contains particles with dyes that excite and emit at the spectral ranges commonly used in fl ow cytometry.


Dyes Firefli Fluorescent Orange (488/575 nm) or Red(488,633, 635/700 nm)

Concentration 5 x 106 particles / mL


Additives: 0.05% tween-20 dispersant / Surfactant with 2mMSoidum Azide Preservative

Packaged in: 3 mL

CatalogNumber



FL6 Cyto-Cal Low Intensity Calibrator 3 mL (50 tests)

Thermo Scientific Cyto-Cal Low Intensity Calibrator


Dyes Firefli Fluorescent Green (488/510 nm), Orange(488/575 nm) and Red (488,633, 635/700 nm)

Concentration 4 x 106 particles / mL


Additives: 0.05% tween-20 dispersant / Surfactant with 2mM Soidum Azide Preservative

Packaged in: 3 mL

In many fl ow cytometry applications, it is critical

to be able to separate dimly labeled cells from

unlabeled (autofl uorescent) cells. Cyto-Cal Low In-

tensity Calibrator enables simultaneous monitoring

of FL1 (FITC), FL2 (PE), FL3 (PE-Cy5) and FL4 (APC)

channels for adequate fl uorescence sensitivity and

discrimination.

The calibrator contains an equal mixture of 6 mi-

crometer (μm) undyed particles and particles dimly

labeled with green, orange and red fl uorescent

dyes which are designed to imitate a mixture of

unlabeled and dim labeled cells. The dyes are

incorporated within the polymer matrix (hard-dyed)

for long term stability using a proprietary Firefl i

process.

CatalogNumber



FC7 Cyto-Cal Count Control 10 mL

Thermo Scientific Cyto-Cal Count Control

The Cyto-Cal Count Control is designed for absolute

cell counting on fl ow cytometers.

This product contains uniform 7 μm particles

containing two encapsulated dyes. The single vial

contains fl uorescent beads which are precisely

stained with fl uorescent dyes that have optimized

intensity and broad emission in multiple channels

(FITC, PE, PE-Cy5).

The hydrophilic bead surface eliminates particle

doublets ensuring an accurate count, verifi ed by

analytical procedures, providing confi dence in

absolute counting on fl ow cytometers.


Dyes Firefli Fluorescent Green (488/510 nm) and Red (570/600 nm)

Concentration 1,000,000 particles / mL ± 5%



Packaged in: 10 mL

32

Suspension array analysis is a powerful

technique enabling the simultaneous detec-

tion and quantitation of multiple analytes with

a single sample. Using color coded particles

with the appropriate dyes, these tests can

now be carried out using commonly available

fl ow cytometers.

Did you know...Multiplex bead assays are more sensitive than traditional immunoassays, have a high through-

put capacity and can replace any available ELISA assay saving the user both time and money.

Thermo Scientifi c Flow Cytometry Multiplex Assay Products

Open Platform Particles for Suspension Array Analysis

33

Cyto-Plex Carboxylated Particles provide different

sizes and levels of fl uorescent intensities for analy-

sis of multiple analytes. The Cyto-Plex particles

consist of a highly uniform polystyrene carboxyl-

ate-modifi ed particle with fl uorescent intensities

which are completely separated from each other.

The use of a single diameter particle for all dye

levels saves time by only requiring the development

and optimization of one bead chemistry. Multiple

diameters can be combined to increase the number

of analytes measured in one test. High-density

binding sites and low non-specifi c binding enable

coupling with a wide variety of antibodies, nucleic

acids and other biomolecules.

Cyto-Plex Carboxylated Particles have a maximum

emission at 700 nm and can be excited with either

488 nm or 633 nm lasers. Emission can be col-

lected in either the PE-Cy5 or APC channels. Since

there is little or no emission in the FITC and PE

channels, probes utilizing either of these dyes can

be effectively used as reporters.

Catalog Number IntensityLevel

Surface Functionality


1 mL 5 mL

FM4CR01 FM4CR01B Level 1 (low) Carboxylate-modified

FM4CR02 FM4CR02B Level 2 Carboxylate-modified










FM4CR12 FM4CR12B Level 12 (high) Carboxylate-modified

Thermo Scientific Cyto-Plex Carboxylated Particles


Dyes Firefli Fluorescent Red

Concentration 0.5% solids



Packaged in: 15 mL

4 μm mean diameter

C.V. < 2%

Concentration approximately1.4 x 108 particles/mL

Catalog Number IntensityLevel

Surface Functionality


1 mL 5 mL

FM5CR01 FM5CR01B Level 1 (low) Carboxylate-modified











FM5CR12 FM5CR12B Level 12 (high) Carboxylate-modified

5 μm mean diameter

C.V. < 2%

Concentration approximately7.3 x 107 particles/mL

3434

Differences in beads for fl ow cytometry QC and quantitation

Particle or bead standards are used in a variety of applications in fl ow cytometry and their selection for specifi c applica-tions based on physical characteristics has been discussed in the literature.

Instrument Quality Control

Instrument quality control, which includes verifi cation of the sensitivity and perfor-mance of the fl uorescence detectors and PMTs, should be monitored frequently to ensure instrument consistency over time and to detect changes in performance that may compromise data. The idealproduct for this application would feature dyes that are thermally and photolyticallystable for at least one year.

Thermo Scientifi c Cyto-Cal Multifl uorparticles are hard-dyed polymer beads that utilize the Thermo Scientifi c Firefl iprocess to incorporate the dye throughoutthe polymer matrix. These beads arestable for at least two years. The com-bination of a stable dye in a hard-dyed bead creates an ideal reference particlefor those seeking long-term, inter/intralab instrument performance monitoring.These beads will test and defi ne the con-dition of the optics and fl ow stream andensure the ability of the instrument to re-solve different cell populations. The dyes in Cyto-Cal Multifl uor beads have similar optical properties, but are not spectrallyequivalent, to the common dyes used in fl ow cytometry. Therefore, Cyto-Cal beadsshould not be used to obtain absolute

35

quantitation of fl uorophores on cells.

Quantitation of Fluorescent Labeled Cells

Fluorescence quantitation is used to determine the amount of fl uorphorebound per cell and ultimately the amount of antibody bound per cell. This requiresspectrally equivalent particle standardsthat feature distinct populations of beads with the same dyes that are used to labelthe cells. These Surface-dyed particles simulate dye attachment to the cell mem-brane. Users are then able to estimate the number of dye molecules boundper cell by comparing against a bead ofknown Molecules of Equivalent SolubleFluorochrome (MESF) or Mean EquivalentFluorochrome (MEFL) to describe the intensity level.

For years, bead calibration standardshave been recommended and used toperform both fl uorophore quantitation andto “calibrate” the response of the instru-ment (confi rm linearity/quality control).Surface-dyed beads have often been usedfor both applications, however, users need to keep in mind that all surface-dyedbeads are thermally and photolyticallyunstable and require refrigeration. Theyalso suffer from a short shelf life. Bothinstrument manufacturers and bead ven-dors have perpetuated this single-beadconcept. And while it may seem moreconvenient and economical from a user’sstandpoint, the use of stable calibratorsfor instrument QC will provide better

results and will be more economical.

We recommend the use of surface-dyed beads for fl uorophore quantitation (featur-ing the common fl ow cytometry dyes)and hard-dyed beads, such as ThermoScientifi c Cyto-Cal Multifl uor particles,for instrument quality control. See pages 30- 32 for product information.

For more technical notes, visit our Web site at www.thermo.com/parti-cletechnology.


Thermo Scientifi c Dyed and Fluorescent Particles

Dyed Particles Color-Rich Dyed Sulfate Particles

Color-Rich Dyed Carboxylate -modifi ed Particles

Color-Rich Dyed Sulfate, Carboxyl, Aldehyde-modifi ed and Carboxylate-modifi ed Particles

ChromoSphere Dyed Particles

Fluorescent Particles Fluoro-Max Fluorescent Sulfate Particles

Fluoro-Max Fluorescent Carboxylate-modifed

Fluoro-Max Fluorescent Streptavidin-coated

Fluoro-Max Green and Red Fluorescent Particles with Different Surface Coatings

37

Thermo Scientifi c Color-Rich Dyed and Fluoro-Max Fluorescent Particles

Higher intensity dyed particles provide

superior test sensitivity in qualitative and

quantitative lateral fl ow tests.

These dyed and fl uorescent particles are inter-

nally dyed using the Thermo Scientifi c Color-

Rich internal dyeing method or by utilizing the

propreitary Firefl i dyeing process. Color-Rich

dyeing methods provide exceptional color

saturation, prevent dye leaching in aqueous

media, and leave the surface free for covalent

coupling and optimal immunological reactivity.

Color-Rich Dyed and Fluoro-Max fl uorescent

particles have been specifi cally designed for

diagnostic lateral-fl ow rapid assay (membrane-

based) applications. However, these particles

can also be used in other applications such

as clinical diagnostics, immuno/histological

studies and molecular biology.

The 0.4 μm nominal diameter is the opti-

mal size for most latex-based lateral fl ow

tests. The coeffi cient of variation (CV) of the

diameter is less than 5% ensuring uniform

migration through membranes.

Available colored dyes Available fl uorescent dyes

Colored and fl uorescent activated surfaces for lateral fl ow diagnostics.

Catalog Number Color Parking AreaA2 / group

SolidsContent

Surface Modification

15 mL 100 mLDB1040PA DB1040PB Blue N/A 4% Sulfate

DR1040PA DR1040PB Red N/A 4% Sulfate

DBK1040PA DBK1040PB Black N/A 4% Sulfate

DB1040HA DB1040HB Blue 107 4% Carboxyl

DR1040HA DR1040HB Red 109 4% Carboxyl

DBK1040HA DBK1040HB Black 106 4% Carboxyl

DB1040LA DB1040LB Blue 99 4% Aldehyde-modifi ed

DR1040LA DR1040LB Red 79 4% Aldehyde-modifi ed

DBK1040LA DBK1040LB Black 129 4% Aldehyde-modifi ed

DB1040CA DB1040CB Blue 56 4% Carboxylate-modifi ed

DR1040CA DR1040CB Red 44 4% Carboxylate-modifi ed

DBK1040CA DBK1040CB Black 55 4% Carboxylate-modifi ed

Product SpecificationsParticle Composition: Polystyrene or Polystyrene with Copolymer Grafted Surface

Surface Functionalities Sulfate, Carboxyl, Aldehyde-modified, Carboxylate-modified

Dyes Colored (Blue, Red, Black)

Size 0.4 μm nominal diameter

Uniformity < 5% CV

Concentration Colored 4% solids by weight


Additives: None

Thermo Scientifi c Color-Rich Dyed Various Surface Coatings

38

Maximum Color and BrillianceImmunologically Reactive Surfaces

Thermo Scientifi c Color-Rich Dyed Carboxylate-modifi ed and Sulfate Particles

Color-Rich Benefi ts

• Bind ligands without dye interference

• Dye-free surface for coupling

• High protein binding capacity

• Hydrophobic—readily adsorbs proteins

• Optimize assays by controlling sensitivity,

specifi city and stability

• Optimized acid content

• Fast coupling and processing reactions

• Easy one-step covalent coupling protocols

• Optimized two-step coupling protocols

• Assure reproducibility with our own

manufactured particles

• GMP manufacturing in our ISO certifi ed

facilities

ParticleDiameter

BottleSize Color Cat. Number

0.3 μm 15 mL Blue 8310-0750-020250

0.3 μm 100 mL Blue 8310-0750-020350

0.3 μm 1000 mL Blue 8310-0750-020450

0.3 μm 15 mL Blue 8310-0720-020250

0.3 μm 100 mL Blue 8310-0720-020350

0.3 μm 1000 mL Blue 8310-0720-020450

0.85 μm 15 mL Blue 9310-1870-020250

0.85 μm 100 mL Blue 9310-1870-020350

0.85 μm 1000 mL Blue 9310-1870-020450

0.3 μm 15 mL Red 8320-0720-020250

0.3 μm 100 mL Red 8320-0720-020350

0.3 μm 1000 mL Red 8320-0720-020450

Color-Rich Dyed Sulfate Available in: 15 mL, 100 mL, 1000 mL, 2.5% solids concentration

25 mg/mL

Color-Rich Dyed Carboxylate-Modified Available in: 15 mL, 100 mL, 1000 mL, 2.5% solids concentration

25 mg/mL

ParticleDiameter

BottleSize Color Cat. Number

0.3 μm 15 mL Blue 8110-0797-020250

0.3 μm 100 mL Blue 8110-0797-020350

0.3 μm 1000 mL Blue 8110-0797-020450

0.85 μm 15 mL Blue 8110-1897-020250

0.85 μm 100 mL Blue 8110-1897-020350

0.85 μm 1000 mL Blue 8110-1897-020450

39

To order Thermo Scientifi c Color-Rich

products,call our Indianapolis, IN offi ce at

1-866-737-2396 or at 1-317-610-3800.

Thermo Scientifi c ChromoSphere Dyed Particles for Specialized Applications

CatalogNumber

NominalDiameter

Color MeanDiameter

ApproximateCount per

Gram

Dry Dyed Particles, Calibrated by Optical Microscopy

RD050 50 μm Red 49 μm 1.6 x 107

BK050 50 μm Black 49 μm 1.5 x 107

RD100 100 μm Red 93 μm 2.2 x 106

BK100 100 μm Black 95 μm 2.1 x 106

RD150 150 μm Red 149 μm 5.5 x 105

BK150 150 μm Black 148 μm 5.6 x 105

RD200 200 μm Red 202 μm 2.2 x 105

BK200 200 μm Black 200 μm 2.3 x 105

RD300 300 μm Red 301 μm 6.6 x 104

BK300 300 μm Black 301 μm 6.6 x 104

RD400 400 μm Red 402 μm 2.8 x 104

BK400 400 μm Black 402 μm 2.8 x 104

RD500 500 μm Red 500 μm 1.4 x 104

BK500 500 μm Black 502 μm 1.4 x 104

Product SpecificationsParticle Composition: Polystyrene Divinylbenzene

(PS-DVB)


Additives: None


ChromoSphere polymer particles are internally dyed

with deeply colored red or black dyes. The intense

colors result in very high contrast and visibility

relative to most background materials. They are

available as dry powders and can be easily be

suspended in aqueous media if desired.

The product line consists of a large assortment

of uniform particle sizes between 50 and 500

microns in either red or black color. The particles

are made from cross-linked polystyrene divinyl-

benzene (PS-DVB) copolymer and should be stored

at room temperature. They can be dispersed in

aqueous media with the aid of a small amount of

surfactant or in lower alcohols, such as methanol or

ethanol. Some dye extraction will result when the

particles are suspended in pure alcohols, but will

be minimal. Other organic solvents, such as ethers

or chlorinated hydrocarbons, should be avoided be-

cause they will swell the particles and completely

extract the dye.

40

Catalog Number Dye SolidsContent

Surface ModificationTrial Kit Fill Volume

DB1040K 4 x 5 mL Blue 4% Four surface coatings of blue particles

DR1040K 4 x 5 mL Red 4% Four surface coatings of red particles

DBK1040K 4 x 5 mL Black 4% Four surface coatings of black particles



Dyes Colored (Blue, Red, Black)


Uniformity < 5% CV

Concentration Colored 4% solids by weight


Additives: None

Thermo Scientifi c Sample Packs For Color-Rich Dyed Sulfate, Carboxyl, Carboxylate-modifi ed and Aldehyde Particles

Sulfate (hydrophobic) Particles.

Also called plain sulfate particles, the

particles are stabilized by sulfate groups.

The sulfate groups are not reactive and

therefore protein attachment is carried out by

hydrophobic adsorption methods. The particles

are available in a wide range of sizes. Many

applications are possible, including develop-

ment of rapid diagnostic tests.

Carboxylate-modifi ed (CML) Particles.

These products are prepared using a copoly-

merization process that results in negatively

charged polymer particles with a reactive

carboxylated surface. Typically, the carboxyl

group density ranges from about 10 to 125 Å2

per carboxyl group. The particles are relatively

hydrophilic and the carboxyl groups can be

activated using water soluble carbodimide

reagents and reacted with amines to form

stable covalent amide bonds. This method of

conjugation is widely used to attach antibod-

ies to the particles for use in diagnostic tests.

41

Carboxyl (hydrophobic) Particles.

These products consist of uniform surfactant-

free sulfate particles with surface carboxyl

groups for charge stabilization. The particles

are hydrophobic with carboxyl groups that are

close to the surface of the particle. Although

covalent coupling of substances to the particle

surface is possible, these particles are typi-

cally used to physically adsorb proteins.

Aldehyde-modifi ed Particles.

The aldehyde modifi ed particles are designed

for coupling of molecules containing amine

groups under very mild conditions (neutral pH)

in a one-step process. The particles contain

surface aldehyde groups with a density range

of approximately 100 to 230 Å2 per aldehyde

group. The net surface charge is negative.

These particles can be used for many of the

same applications as the carboxylate-modifi ed

products, and provide an alternate method for

attaching proteins to the particle surface.

Descriptions of the surface modifi cations

To order Thermo Scientifi c Chromosphere particles or these sample packs,call our Fremont, CA

offi ce at 1-800-232-3342 or at 1-510-979-5000.

The Fluoro-Max Fluorescent particles are

made by dyeing Opti-Link CM particles

with europium chelate and are available

in standard 0.1 μm, 0.2 μm, and 0.3 μm

diameters. They are dyed internally to prevent

dye leaching and to assure maximum surface

immunoreactivity. These particles have been

specifi cally designed for membrane or auto-

mated fl uorometric-based applications.

Excitation Emission

333 nm 613 nm

With an extremely broad Stokes shift,

Fluoro-Max europium chelate particles help

prevent nonspecifi c fl uorescence interference.

Fluoro-Max particles may be used in a variety

of applications such as clinical diagnostics,

immuno/histological studies and reserach ap-

plications. Fluoro-Max particles are available

in both carboxylate-modifi ed and streptavidin

coated.

Thermo Scientifi c Fluoro-Max Fluorescent Carboxylate-modified and Streptavidin-coated Europium Chelate Particles

Fluoro-Max Fluorescent Benefi ts

• Bind ligands without dye interference

• Dye-free surface for coupling

• High protein binding capacity

• Readily adsorbs proteins

• Optimize assays by controlling sensitivity,

specifi city and stability

• Optimized acid content

Excellent for:

Quantitative membrane-based rapid assays

Heterogeneous assays

Luminescent assays

Research applications

Phagocytosis studies

Cell surface markers

Pore size determination

ParticleDiameter

BottleSize

BindingCapacity

Type/ Parking Area/ Post Process Cat. Number

0.1 μm 1 mL HIgh Europium Chelate/PA50/0.05% Az 9347-0350-011150



0.2 μm 1 mL High Europium Chelate/PA20/0.05% Az 9347-0520-011150



0.3 μm 1 mL High Europium Chelate/PA20/0.05% Az 9347-0720-011150



Fluoro-Max Carboxylate-modified Packaged in 1 mL, 5 mL, 100 ml. 1% solids, 10 mg/mL

ParticleDiameter

BottleSize

BindingCapacity

Type/ Parking Area/ Post Process Cat. Number

0.3 μm 1 mL Low Europium Chelate Strep/0.05% Az 2947-0701-011150



42

Fluoro-Max Streptavidin-coated Packaged in 1 mL, 5 mL, 100 ml. 1% solids, 10 mg/mL

Thermo Scientifi c Fluoro-Max Fluorescent Green and Red Particles with Various Surface Coatings

Higher intensity dyed particles provide superior

test sensitivity in qualitative and quantitative

lateral fl ow tests.

The particles are designed for researchers who

are developing lateral fl ow diagnostic tests,

and for other investigations in diagnostics and

biotechnology, where labeling and detection of

very low concentrations is required.

The 0.4 μm nominal diameter is an excel-

lent size for most latex-based lateral fl ow

tests. The coeffi cient of variation (CV) of the

diameter is less than 5% ensuring uniform

migration through membranes.



Dyes Firefli FluorescentGreen UV (360/530 nm), Green Vis (470/510 nm)Red (570/600 nm), Dark Red (640/660 nm)


Uniformity < 5% CV

Concentration Fluorescent 2% solids by weight


Additives: None

Catalog Number Color Parking AreaA2 / group

SolidsContent


15 mL 100 mL

FG1040PA FG1040PB Green(360ex/530em) N/A 2% Sulfate

FG2040PA GF2040PB Green(470ex/510em) N/A 2% Sulfate

FR2040PA FR2040PB Red(570ex/600em) N/A 2% Sulfate

FR3040PA FR3040PB Red(640ex/660em) N/A 2% Sulfate

FG1040HA FG1040HB Green(360ex/530em) 99 2% Carboxyl

FG2040HA GF2040HB Green(470ex/510em) 132 2% Carboxyl

FR2040HA FR2040HB Red(570ex/600em) 99 2% Carboxyl

FR3040HA FR3040HB Red(640ex/660em) 99 2% Carboxyl

FG1040LA FG1040LB Green(360ex/530em) 110 2% Aldehyde-modifi ed

FG2040LA GF2040LB Green(470ex/510em) 110 2% Aldehyde-modifi ed

FR2040LA FR2040LB Red(570ex/600em) 110 2% Aldehyde-modifi ed

FR3040LA FR3040LB Red(640ex/660em) 110 2% Aldehyde-modifi ed

FG1040CA FG1040CB Green(360ex/530em) 44 2% Carboxylate-modifi ed

FG2040CA GF2040CB Green(470ex/510em) 56 2% Carboxylate-modifi ed

FR2040CA FR2040CB Red(570ex/600em) 44 2% Carboxylate-modifi ed

FR3040CA FR3040CB Red(640ex/660em) 44 2% Carboxylate-modifi ed

43

Thermo Scientifi c Fluoro-Max Fluorescent Application Specifi c Products

CatalogNumber

Diameter Quantity


34-1 1 - 10 μm 1 gram

34-1B 1 - 10 μm 5 grams

For marking the risk zone in heart tissue for myocardial infarction studies.

Product SpecificationsParticle Composition: Polystyrene Divinylbenzene (PS-DVB)

Dyes Friefli Fluorescent Green UV (360/530 nm)


Additives: Contains trace amount of dispersant

Packaged in 1 and 5 g bottles

Various dyes and particulate markers have

been used to mark the “risk zone” in evaluat-

ing regional ischemia. Markers that have

been used include Evans Blue, India Ink and

Fluorescein; however, these dyes tend to

rapidly migrate throughout the tissue making

the risk zone diffi cult to identify. Fluorescent

particulate markers are effective because

they lodge in the capillaries and can be easily

visualized under illumination.

The fl uorescent marker beads are made of

polymer containing a special fl uorescent dye

that excites effi ciently with a hand held UV

lamp (Wood’s Lamp). The fl uorescence is a

brilliant yellow-green color. The particles are

spherical, 1-10 micrometers in diameter, and

have a density of 1.05 g/cm3. This makes

them easy to suspend in an aqueous medium.

The particles are heavily loaded with dye,

resulting in a very strong fl uorescence that

can easily be seen visually. They are invisible

under white light, allowing the non-risk tissue

to be examined for infarction. Since the dye

is embedded in the interior of the particles,

it does not leach out or cause indiscriminate

staining.

Spectral information is approximate and for reference only. The spectral properties of the dye is independedt on their concentration and physical environment. the exact excitation and emission maxima may vary, depending on the size and composition of the particles.

44

For contamination control and fl ow tracing

Thermo Scientifi c Fluoro-Max Fluorescent Dyed Green, Red, and Blue Aqueous Particles

Fluorescent particles emit bright and distinct colors

when illuminated by light of shorter wavelengths

than the emission wavelength. This improves

their contrast and visibility relative to background

materials. In addition to the features of conven-

tional microscopes, the fl uorescent products offer

improved sensitivity and detectability for analytical

methods.

Fluorescent particles are hard-dyed (internally-dyed)

polymer beads which utilize the Firefl i process to

incorporate the dye throughout the polymer matrix.

This method produces bright fl uorescent colors,

minimizes photobleaching and prevents dye leach-

ing into aqueous media. The particles are made of

polystyrene (PS), which has a density of 1.05 g/cm3

and a refractive index of 1.59 @ 589nm (25°C). The

aqueous suspensions are packaged as 1% solids.

These particles can be detected with an epi-

fl uorescence microscope, confocal microscope,

fl uorometer, fl uorescence spectrophotometer, or

fl uorescence activated cell sorter. In addition, all of

these fl uorescent particles can be detected using a

mineral light or black light (UV).

Spectral information is approximate and for

reference only. The spectral properties of the dyes

are dependent on their concentration and physical

environment. The exact excitation and emission

maxima may vary, depending on the size and

composition of the particles.

To order Fluoro-Max products, call our

Indianapolis, IN offi ce at 1-866-737-2396 or at

1-317-610-3800.


Dyes Firefl i Fluorescent Green (468/508nm)Red (542/612nm)Blue (365, 388, 412 / 445, 445, 473




CatalogNumber

NominalDiameter

Measured Mean Diameter

SizeUniformity

FluorescentColor

FillVol-ume


G25 0.03 μm 0.025 μm < 20% Green 15 mL

G25B 0.03 μm 0.025 μm < 20% Green 90 mL

G40 0.04 μm 0.038 μm < 15% Green 15 mL

G40B 0.04 μm 0.038 μm < 15% Green 90 mL

G50 0.05 μm 0.051 μm < 15% Green 15 mL

G50B 0.05 μm 0.051 μm < 15% Green 90 mL

G75 0.07 μm 0.075 μm < 10% Green 15 mL

G75B 0.07 μm 0.075 μm < 10% Green 90 mL

G85 0.09 μm 0.088 μm < 10% Green 15 mL

G85B 0.09 μm 0.088 μm < 10% Green 90 mL

G100 0.10 μm 0.10 μm < 10% Green 15 mL

G100B 0.10 μm 0.10 μm < 10% Green 90 mL

G140 0.14 μm 0.14 μm < 10% Green 15 mL

G140B 0.14 μm 0.14 μm < 10% Green 90 mL

G200 0.20 μm 0.20 μm < 10% Green 15 mL

G200B 0.20 μm 0.20 μm < 10% Green 90 mL

45

CatalogNumber

NominalDiameter


SizeUniformity

FluorescentColor

FillVolume


G250 0.25 μm 0.25 μm < 5% Green 15 mL

G250B 0.25 μm 0.25 μm < 5% Green 90 mL

G300 0.30 μm 0.29 μm < 5% Green 15 mL

G300B 0.30 μm 0.29 μm < 5% Green 90 mL

G400 0.40 μm 0.39 μm < 5% Green 15 mL

G400B 0.40 μm 0.39 μm < 5% Green 90 mL

G450 0.45 μm 0.43 μm < 5% Green 15 mL

G450B 0.45 μm 0.43 μm < 5% Green 90 mL

G500 0.50 μm 0.50 μm < 5% Green 15 mL

G500B 0.50 μm 0.50 μm < 5% Green 90 mL

G600 0.60 μm 0.59 μm < 5% Green 15 mL

G600B 0.60 μm 0.59 μm < 5% Green 90 mL

G700 0.70 μm 0.72 μm < 3% Green 15 mL

G700B 0.70 μm 0.72 μm < 3% Green 90 mL

G830 0.83 μm 0.83 μm < 3% Green 15 mL

G830B 0.83 μm 0.83 μm < 3% Green 90 mL

G900 0.90 μm 0.92 μm < 3% Green 15 mL

G900B 0.90 μm 0.92 μm < 3% Green 90 mL

G0100 1 μm 1.0 μm < 5% Green 10 mL

G0100B 1 μm 1.0 μm < 5% Green 60 mL

G0200 2 μm 1.9 μm < 5% Green 10 mL

G0200B 2 μm 1.9 μm < 5% Green 60 mL

G0220 2 μm 2.2 μm < 5% Green 10 mL

G0220B 2 μm 2.2 μm < 5% Green 60 mL

G0300 3 μm 3.1 μm < 5% Green 10 mL

G0300B 3 μm 3.1 μm < 5% Green 60 mL

G0500 5 μm 4.8 μm < 5% Green 10 mL

G0500B 5 μm 4.8 μm < 5% Green 60 mL

G1000 10 μm 9.9 μm < 5% Green 10 mL

G1000B 10 μm 9.9 μm < 5% Green 60 mL

R25 0.03 μm 0.022 μm < 20% Red 15 mL

R25B 0.03 μm 0.022 μm < 20% Red 90 mL

R50 0.05 μm 0.048 μm < 15% Red 15 mL

R50B 0.05 μm 0.048 μm < 15% Red 90 mL

R60 0.06 μm 0.063 μm < 10% Red 15 mL

R60B 0.06 μm 0.063 μm < 10% Red 90 mL

R100 0.10 μm 0.10 μm < 10% Red 15 mL

R100B 0.10 μm 0.10 μm < 10% Red 90 mL

R160 0.16 μm 0.16 μm < 10% Red 15 mL

R160B 0.16 μm 0.16 μm < 10% Red 90 mL

R200 0.20 μm 0.21 μm < 5% Red 15 mL

R200B 0.20 μm 0.21 μm < 5% Red 90 mL

R300 0.30 μm 0.30 μm < 5% Red 15 mL

R300B 0.30 μm 0.30 μm < 5% Red 90 mL

R400 0.40 μm 0.40 μm < 5% Red 15 mL

R400B 0.40 μm 0.40 μm < 5% Red 90 mL

R500 0.50 μm 0.52 μm < 3% Red 15 mL

R500B 0.50 μm 0.52 μm < 3% Red 90 mL

R600 0.60 μm 0.60 μm < 3% Red 15 mL

R600B 0.60 μm 0.60 μm < 3% Red 90 mL

46

CatalogNumber

NominalDiameter


SizeUniformity

FluorescentColor

FillVolume


R700 0.70 μm 0.71 μm < 3% Red 15 mL

R700B 0.70 μm 0.71 μm < 3% Red 90 mL

R800 0.80 μm 0.79 μm < 3% Red 15 mL

R800B 0.80 μm 0.79 μm < 3% Red 90 mL

R900 0.90 μm 0.86 μm < 3% Red 15 mL

R900B 0.90 μm 0.86 μm < 3% Red 90 mL

R0100 1 μm 1.0 μm < 5% Red 10 mL

R0100B 1 μm 1.0 μm < 5% Red 60 mL

R0200 2 μm 2.0 μm < 5% Red 10 mL

R0200B 2 μm 2.0 μm < 5% Red 60 mL

R0300 3 μm 3.0 μm < 5% Red 10 mL

R0300B 3 μm 3.0 μm < 5% Red 60 mL

B50 0.05 μm 0.049 μm < 15% Blue 15 mL

B50B 0.05 μm 0.049 μm < 15% Blue 90 mL

B100 0.10 μm 0.10 μm < 10% Blue 15 mL

B100B 0.10 μm 0.10 μm < 10% Blue 90 mL

B150 0.15 μm 0.15 μm < 10% Blue 15 mL

B150B 0.15 μm 0.15 μm < 10% Blue 90 mL

B200 0.20 μm 0.20 μm < 5% Blue 15 mL

B200B 0.20 μm 0.20 μm < 5% Blue 90 mL

B300 0.30 μm 0.31 μm < 5% Blue 15 mL

B300B 0.30 μm 0.31 μm < 5% Blue 90 mL

B400 0.40 μm 0.41 μm < 5% Blue 15 mL

B400B 0.40 μm 0.41 μm < 5% Blue 90 mL

B500 0.50 μm 0.48 μm < 3% Blue 15 mL

B500B 0.50 μm 0.48 μm < 3% Blue 90 mL

B520 0.52 μm 0.52 μm < 3% Blue 15 mL

B520B 0.52 μm 0.52 μm < 3% Blue 90 mL

B600 0.60 μm 0.62 μm < 3% Blue 15 mL

B600B 0.60 μm 0.62 μm < 3% Blue 90 mL

B700 0.70 μm 0.70 μm < 3% Blue 15 mL

B700B 0.70 μm 0.70 μm < 3% Blue 90 mL

B800 0.80 μm 0.80 μm < 3% Blue 15 mL

B800B 0.80 μm 0.80 μm < 3% Blue 90 mL

B900 0.90 μm 0.91 μm < 3% Blue 15 mL

B900B 0.90 μm 0.91 μm < 3% Blue 90 mL

B0100 1 μm 1.0 μm < 5% Blue 10 mL

B0100B 1 μm 1.0 μm < 5% Blue 60 mL

B0200 2 μm 2.0 μm < 5% Blue 10 mL

B0200B 2 μm 2.0 μm < 5% Blue 60 mL

47

Improved sensibility and detectibility for analytical methods

Thermo Scientifi c Fluoro-Max Fluorescent Dyed Green and Red Dry Particles

Fluorescent particles emit bright and distinct colors

when illuminated by light of shorter wavelengths

than the emission wavelength. This improves

their contrast and visibility relative to background

materials. In addition to the features of conven-

tional microscopes, the fl uorescent products offer

improved sensitivity and detectability for analytical

methods.

Fluorescent particles are internally dyed polymer

beads which utilize the Firefl i™ process to

incorporate the dye throughout the polymer matrix.

This method produces bright fl uorescent colors,

minimizes photobleaching and prevents dye leach-

ing into aqueous media. The particles are made of

polystyrene divinylbenzene (PS-DVB), which has a

density of 1.05 g/cm3 and a refractive index of 1.59

@ 589nm (25°C).

These particles can be detected with an epi-

fl uorescence microscope, confocal microscope,

fl uorometer, fl uorescence spectrophotometer, or

fl uorescence activated cell sorter. In addition, all of

these fl uorescent particles can be detected using a

mineral light or black light (UV).

Spectral information is approximate and for

reference only. The spectral properties of the dyes

are dependent on their concentration and physical

environment. The exact excitation and emission

maxima may vary, depending on the size and

composition of the particles.


Dyes Firefl i Fluorescent Green (468/508nm)Red (542/612nm)




CatalogNumber

NominalDiameter


SizeUniformity

FluorescentColor

Quantity


35-2 5 μm 7 μm < 18% Green 1 g

35-2B 5 μm 7 μm < 18% Green 5 g

35-3 10 μm 8 μm < 18% Green 1 g

35-3B 10 μm 8 μm < 18% Green 5 g

35-4 15 μm 16 μm < 12% Green 1 g

35-4B 15 μm 16 μm < 12% Green 5 g

35-5 25 μm 24 μm < 12% Green 1 g

35-5B 25 μm 24 μm < 12% Green 5 g

35-6 30 μm 32 μm < 13% Green 1 g

35-6B 30 μm 32 μm < 13% Green 5 g

35-7 40 μm 39 μm < 9% Green 1 g

35-7B 40 μm 39 μm < 9% Green 5 g

35-8 50 μm 51 μm < 12% Green 1 g

35-8B 50 μm 51 μm < 12% Green 5 g

35-9 70 μm 68 μm < 7% Green 1 g

35-9B 70 μm 68 μm < 7% Green 5 g

35-10 80 μm 80 μm < 6% Green 1 g

35-10B 80 μm 80 μm < 6% Green 5 g

35-11 100 μm 90 μm < 7% Green 1 g

35-11B 100 μm 90 μm < 7% Green 5 g

35-12 120 μm 116 μm < 6% Green 1 g

35-12B 120 μm 116 μm < 6% Green 5 g

48

Cat. NoPackage

Size Application Sample Pack Includes:

FG1040K

FG2040K

FR2040K

FR3040K

4 x 5 mL

4 x 5 mL

4 x 5 mL

4 x 5 mL

Lateral Flow/ Diagnostics

Four surface coatings of green fl uorescent,UV excitation

Four surface coatings of green fl uorescent,visible excitation

Four surface coatings of red fl uorescent

Four surface coatings of dark red fl uorescent

Cat. NoPackage

Size Application Sample Pack Includes:

S9347 3 x 1 mL Lateral Flow/Aglutination

9347-032001-1150 (0.1 μm)

9347-052001-1150 (0.2 μm)

9347-072001-1150 (0.3 μm)

Fluoro-Max Green and Red Fluorescent Particles with Different Surface Coatings

Flouro-Max Fluorescent Carboxylate-modifi ed Europium Chelate

Thermo Scientifi c Fluoro-Max Sample Packs

CatalogNumber

NominalDiameter


SizeUniformity

FluorescentColor

Quantity

35-13 140 μm 143 μm < 6% Green 1 g

35-13B 140 μm 143 μm < 6% Green 5 g

35-14 160 μm 157 μm < 5% Green 1 g

35-14B 160 μm 157 μm < 5% Green 5 g

36-2 5 μm 7 μm < 18% Red 1 g

36-2B 5 μm 7 μm < 18% Red 5 g

36-3 10 μm 8 μm < 18% Red 1 g

36-3B 10 μm 8 μm < 18% Red 5 g

36-4 15 μm 15 μm < 14% Red 1 g

36-4B 15 μm 15 μm < 14% Red 5 g

36-5 25 μm 24 μm < 12% Red 1 g

36-5B 25 μm 24 μm < 12% Red 5 g

36-6 30 μm 31 μm < 11% Red 1 g

36-6B 30 μm 31 μm < 11% Red 5 g

36-11 100 μm 107 μm < 7% Red 1 g

36-11B 100 μm 107 μm < 7% Red 5 g

49

Introduction

Processing particles is one of the mostcritical phases in particle technology. Guidance on use of sonication will make your life easier. We offer you a completeparticle technology and give you particlevalidated protocols for coupling proteinsand processing the particles. We take the mystery out of working with particlesby giving you concrete data, backed byyears of applications research in our ownlabs. Use our experience, read our com-munications and save yourself months of aggravation. We have benefi cial new ways to utilize our particle products and services. They have all been designed and engineered to meet the productivity re-quirements of multiple industries such asdiagnostics, genomics, and proteomics.

Sonication

Sonication provides a way to re-suspendthe particles thoroughly and effi ciently without harm to the reagents. Aftercentrifugation, processing steps, andcoupling reactions, diffi culties that arise from iparticleroper particle resuspension can be avoided by using sonication. Weroutinely sonicate our protein-coatedparticle preparations with a probe-type ultrasonicator to re-suspend pellets after centrifugation, and to reversemild aggregation induced by couplingproteins. We have not found this to be detrimental to sensitized Particles in anyway, and have even seen iparticlerove-ment in agglutination sensitivity aftersonication. It is advised to guard against teparticleerature rise during sonication in sensitive systems. Using HSA/anti-HSA as a model system, we tested whethersonication caused desorption of pro-teins or loss of functional activity. We subjected particle reagents to full power sonication. Prolonged sonication did not result in measurable loss of HSA from theparticle surface. From our experience ithas proven iparticleossible to damage our plain Sulfate (S) and magnetic beads withsonication or heat. In certain instances we take the plain PS to boiling with no illeffect. This is not true if you have ligandsbound to the surface of the particle.

Particle Sonication & Mixing

50

The particle will survive, but surfaceligands may be lost. In the process ofoptimization of the following procedure,one should consider the characteristics of one’s ligand and adjust the time andhandling to ensure ligand activity.

Materials

1. Probe sonicator: An immersibleultrasonic probe is the ideal tool for ef-fi cient resuspension of Particle pellets.Vortex mixing and bath-type sonicatorsare not effective for resuspending most pellets.

Note: proper performance of the soni-cator is ensured when one performsappropriate maintenance of the probe.

2. Appropriate sonicator probes: A keyfactor that affects optimal performance of sonication is the sonication probe.The volume to be sonicated is consid-ered when selecting the proper probe:i.e. for saparticleles with volumes of500 mL or less, or saparticleles in a 1Liter (L) narrow-mouth container we typically use a tapered micro-tip (diam-eter 1/8 inch) and use a “macro”-tipprobe (diameter 1/2 inch) for saparti-cleles greater than 500 mL that are not in a narrow mouth container.

3. Container for sonication: If the volume of material is 1 L or less, then the material may be sonicated in thebottle or transferred to a beaker. If asaparticlele is larger than 1 L and in a narrow-mouth container, it will have tobe transferred to an appropriate-size beaker before sonication. Typically, sonication is more effective in glasscontainer than plastic.

4. Optical microscope and necessary sup-plies: Capable of use at 400X magnifi -cation

Procedure

1. Handling particles before sonication:For effi ciency, the material should be thoroughly mixed before sonicationbegins. This can be done by rolling the

bottles of material using a mechanical roller or with an overhead mixer forbulk material.

2. Select sonication intensity: Forvolumes using the micro-tip probe, the intensity is set between 30% and 40%, or a setting from 3 to 4 on a scale of10. For volumes using the “macro”- tipprobe, the intensity is set to 50%, or 5 on a scale of 10.

3. Select sonication time: Material being sonicated with the micro-tip probe isexposed for the followintimes accord-ing to fl uid volume:

Up to 10 mL 15-20 seconds

10 to 50 mL 20-30 seconds

50 to 100 mL 30-45 seconds

100 to 1000 mL minimum 60-90 sec.

NOTE: When sonicating smaller sapar-ticleles the solution heats more quickly due to less volume available to disperse the heat. Material being sonicated with the “macro”tip probe is exposed for the following times according to fl uid volume:

1L 5 minutes

3L 5 to 10 minutes

Greater than 3 L Up to 20 minutes

4. Mixing particles during sonicationprocess: It may be necessary eitherto mix the larger saparticleles as theysonicate or to sonicate them using more repetitions of shorter times, if the material tends to settle out of solutionquickly. For exaparticlele, when work-ing with large particles (greater than 1micron) or if the material is excessively cluparticleed:

• If sonication of material is in a 1L bottle, in between sonication incre-ments of 10 minutes, the bottle withmaterial is rolled for fi ve minutes.

• If sonication of nonmagnetic material is performed in a beaker, a magneticstirrer is recommended to keep anyaggregates in solution during sonica-tion.


5. Observe dispersity of particles: After a set amount of sonication time, the material should be mixed thoroughlyand observed under a microscope at400X. When in focus, one should notsee cluparticles but a nice uniformfi eld. If you see aggregates, then thematerial is not monodispersed. Repeat sonication and observation until you do not see cluparticles.

Mixing

When handling particles it is best to mixthe material to ensure the material is monodispersed and uniformly distributed.Particles may be mixed according to the type of particle and volumes by the use of various equipment including overheadmixer, magnetic stirrer, vortex mixer androller mixer. An overhead mixer is typical-ly used for pooling, diluting, and handlinglarge batches. The use of a vortex mixercan be used for mixing product stored insmall containers such as 15 mL bottles,or other applications where the containeris of similar size. The roller mixer is usedto re-suspend if necessary and mix uni-formly the particles. Magnetic stirrers are used for the purpose of making a uniform mixture rather than re-suspending.

Before you Begin

• If higher than normal levels of surfactant are in the solution or ifexcessive foaming is observed in anyof the mixing techniques, reduce thespeed and time of mixing accordinglyto minimize the iparticleact on theproduct.

• When resuspending material, visuallyconfi rm if possible that re-suspensionis coparticlelete by checking the bot-tom of the container for unsuspended material.

• Magnetic material can be mixedusing all of the above methods except for the magnetic stirrers. Rolling and/or mixing times are the same forthe magnetic particles as they are for any other particle of similar size andpercent solids.

51

Particle Sonication & Mixing

Mixing by Roller

Roller Mixer

The roller mixer has a motor-drivenhorizontal cylinder adjacent to a free-turn-ing horizontal cylinder that together forma cradle on which containers of product can be placed. The placement of thefree-turning cylinder can be adjusted asnecessary to accommodate different-size containers. Use a roller mixer of suffi cientsize and speed for the container beingmixed. The roller for smaller bottles suchas 100 mL can be found in general smalllab supply catalogs.

Mixing Time

Since the speed of the mixer is con-stant, mixing time is the way to controlsuffi cient mixing. This mixing time can also vary based on the diameter of the container; smaller diameter containersrotate faster than large diameter contain-ers, therefore mixing is accomplishedmore quickly. Mixing time can also varybased on the size of the particles; largerparticles may take more time to re-sus-pend. Higher concentrations of particles also require more mixing time.

Note: Containers must be at least 50%and less than 90% full to have enough material covering the bottom of the container when rolling, yet not too full to prevent insuffi cient mixing. Extending the mixing time is acceptable, howevernothing should need to mix for longer than 72 hours.

The following guidance is for minimum mixing time according to microparticle and container size.

MINIMUM MIXING TIMES USINGTHE ROLLER MIXER

Container Size Particle Size (μm)

≤ 0.4μm > 0.4

≤1 L 10 min 40 min

>1 L 30 min 60 min

Mixing by Vortex

Vortex Mixer

A mixer used for mixing small volumes byholding the container of solution in a rub-ber holder and allowing a motor to rotate the shaft in an oscillating motion causing the solution to be mixed.

Different models of vortex mixers have different methods of being activated.Most have a continuous action and amanual pressure activated system. Either may be used as is convenient with thecontinuous mode preferred for longervortexing times and the manual modepreferred for shorter mixing times. A vor-tex mixer with adjustable speed setting ispreferred.

Mixing Speed

Using the controller on the mixer, adjustthe speed of the mixer to a speed suf-fi cient to cause good mixing (usuallyaround 80% of full speed). Going too fast makes the container diffi cult to control.

Mixing Time

Mixing usually can be completed in 30seconds, however larger particles such as 0.8 and 1.0 μm require longer mixing tore-suspend, at least one minute or longer,especially if the product has been storedfor an extended period of time.

Verifi cation of Mixing

Visually verify mixing is completed byobserving the product during mixing to ensure adequate agitation. After mixing,make sure no product remains settled on the bottom of the container. Clumps should not be observed in the suspensionunder a microscope at 400X.


52

Mixing by Overhead Mixer

Overhead Mixer

An overhead mixer consists of anelectrical or air-driven motor whosespeed can be controlled, to which an agitator blade and shaft is attached.Choose an overhead mixer of suf-fi cient capability to mix the volumerequired. The range of volumes isdependent on the proper agita-tor (use short-shafted agitator for smaller volumes).

• Ensure that the container is such that the blade will be covered withenough product to prevent splash-ing.

• Position the blade high enoughon a stand to allow clearance ofthe container but not so high as to prevent suffi cient submersion of the agitator. Best results are usually ob-tained when the agitator blade can be placed at a position in the lowerone-third of the container.

Mixing Speed

The proper mixing speed can be determined by observing the action of the solution. If there is no visible movement of the product, increase the speed of the mixer until there is visible movement. In most circum-stances, overhead stirring is used to achieve or maintain a uniformmixture; therefore mixing speed is not critical as long as it maintainssuffi cient motion. If one is remov-ing aliquots from the mixture, then care should be taken to monitor the level of product being mixed, in orderto periodically reduce the speed ofthe mixing so that product does notsplash on the side of the container as the volume changes.

Mixing Time

If mixing is for the purpose of re-suspension, then follow the Table forMinimum Mixing Times Using a RollerMixer.

Mixing by Magnetic Stirrer

Magnetic Stirrer

A mixer that consists of a variable speed motor with an attached mag-netic rotor encased in a platform.The rotor causes a magnetic stir bar placed in the solution to spin,thereby causing mixing. Select a stirrer that has suffi cient power tomove the volume of solution andhold the container on the stirrer.

NOTE: Magnetic stirrers are not usedfor the mixing of magneticparticles.

• Container: Effective mixing requiresmatching the size of the containerwith the volume of the solution andselecting a suitable stir bar that will be large enough to effectively move the solution but not so large as tocause splashing. The size of the con-tainer is determined by the size ofthe batch taking into considerationseveral factors. Too large a container may cause splashing and loss ofyield due to increased surface area.Containers should have a volumetricworking range of 20 to 80%; use a fl at bottom in order for the stir bar tospin freely.

• Select an appropriate sized magneticstir bar which will fi t the containerand thoroughly move the volume to be stirred.

Mixing Speed

Adjust the speed of the stirring to create enough movement of the suspension to adequately mix. Suffi cient movementranges from creating a “dimple” ¼ inchinto the surface to a funnel shape extend-ing approximately one-fourth of the way into the suspension. Because the purposeof the mixing is to evenly distributethe material in the suspension, it is not necessary to rapidly mix the suspension;however, slightly faster mixing may berequired for large particles. Avoid splash-

ing the material. If the volume decreases, then mixing is to decrease; slow the speed of the mixing as the volume decreases to reduce splashing.

Mixing Time

The length of time for mixing will varywith the size of the batch; the larger thebatch the longer the mixing time. How-ever, mixing should not require longer than 30 minutes unless re-suspension isthe purpose of the mixing. If mixing is forthe purpose of re-suspension, then followthe Table for Minimum Mixing Times Us-ing a Roller Mixer.


Particle Sonication & MixingTechnical Supplement

Thermo Scientifi c Particles for Clinical Diagnostics and Specialty Applications

Plain Particles Undyed Sulfate, Carboxyl, Carboxylate-modifi ed and Aldehyde particles

Opti-Bind and Turbi-Bind Sulfate particles

Opti-Link and Turbi-Link Carboxylate-modifi ed particles

Power-Bind Streptavidin-coated particles

5000 Series - Latex Particle Suspensions

7000 Series - Copolymer Particle Suspensions

Spherical Polymer Materials (Dry)

Non-Polymer Particles Glass Materials (Dry)

Pollens and Spores

Metal and Mineral Particles

Laser Diffraction Conrol

Cleanroom Particles HEPA-Check™ Filter Challenge Particles

SMOKE-Check™ Smoke Detector Challenge

Thermo Scientifi c Undyed Particles Sulfate, Carboxyl, Carboxylate-modifi ed and Aldehyde

These beads are available in many sizes with

a variety of surface chemistries to accommo-

date a wide range of coupling strategies.

These particles were developed with surfaces

designed for attaching biological molecules. A

variety of sizes and surface functionalities are

available providing researchers with a wide

choice of products for applications in diagnos-

Catalog Number MeanDiameter

Parking AreaA2 / group


15 mL 100 mLW010PA W010PB 0.10 μm N/A Sulfate

W020PA W020PB 0.18 μm N/A Sulfate







W010HA W010HB 0.10 μm 175 Carboxyl




W010LA W010LB 0.10 μm 107 Aldehyde-modifi ed





W004CA W004CB 0.04 μm 100 Carboxylate-modifi ed











W500CA W500CB 4.6 μm 5.3 Carboxylate-modifi ed



Uniformity < 15% CV

Concentration 4% solids by weight


Additives: None

tics, genomics, cell labeling/sorting, and other

functions. Most of the particles are prepared

without surfactants and have surfaces

optimized for either hydrophobic adsorption or

covalent attachment of biological molecules.

To order Thermo Scientifi c undyed particle


1-800-232-3342 or at 1-510-979-5000.

54

Thermo Scientifi c Opti-Link and Turbi-LinkCarboxylate-modifi ed Particles

Opti-Link Carboxylate-modifi ed (CM) particles

contain carboxylic acid groups for covalent

coupling and can be used in a variety of ap-

plications. The multiple acid contents within

the Opti-Link product line allow you to control

important parameters such as sensitivity,

specifi city and stability. For most applications,

Opti-Link particles can be used direct from

the bottle without any pre-cleaning. Our pro-

prietary anionic surfactant does not interfere

with the binding of proteins nor cause proteins

to desorb from microparticle surfaces. Various

surface acid concentrations are available

to help optimize your reagent development

efforts.

In addition, we have created a series of

specially treated 0.1 to 0.3 μm carboxylate-

modifi ed particles, designed exclusively for

turbidimetric immunoassay applications.

These new Turbi-Link particles have been

treated to enhance turbidimetric assay

performance.

Thermo Scientifi c Opti-Bind and Turbi-Bind Sulfate Particles

Opti-Bind sulfate particles can be used direct

from the bottle, without any pre-cleaning, for

most applications. Our production does not

utilize common surfactants (like SDS, Tween

20, Triton X-100) that can interfere with

protein binding to particle surfaces. Our pro-

prietary anionic surfactant does not interfere

with the binding of proteins nor cause proteins

to desorb from microparticle surfaces. Opti-

Bind particles are available in a wide range of

diameters (from 0.1 μm to 2.5 μm) for a variety

of applications. The Turbi-Bind particles, very

similar to the Opti-Bind product line, are spe-

cifi cally designed for turbidimetric assays.

Sulfate surfaces are very hydrophobic and

adsorb proteins almost instantaneously.

Opti-Bind particles have been optimized for

maximum reactivity in many diagnostic ap-

plications.

To order Thermo Scientifi c Opti-Bind or Opti-

Link products, call our Indianapolis, IN offi ce

at 1-866-737-2396 or at 1-317-610-3800.

55

From clinical immunoassays to molecular biology sample preparation to researchapplications, Thermo Scientific particles are critical components used by many ofthe world’s leading diagnostic and molecular biology companies.

Thermo Scientifi c Opti-Bind and Opti-Link Particle Product Listing

Opti-BindSulfate Particles

ParticleDiameter

BottleSize

Surface Acid Load-ing/ Post Process Cat. Number

Packaged in 15 mL, 15 mL Low SO4/Pasteurized 8100-0397-100290

100 mL and 1000 mL 0.1 μm 100 mL Low SO4/Pasteurized 8100-0397-100390

10% solids, 100 mg/mL 0.1 μm 1000 mL Low SO4/Pasteurized 8100-0397-100490

0.2 μm 15 mL Low SO4/Pasteurized 8100-0597-100290





















2.5 μm 15 mL Low SO4/0.05% Az 7100-3497-100250

2.5 μm 100 mL Low SO4/0.05% Az 7100-3497-100350

2.5 μm 1000 mL Low SO4/0.05% Az 7100-3497-100450

Opti-Link Carboxylate-modifi ed Particle

DiameterBottleSize

Surface Acid Loading Cat. Number

Packaged in 15 mL, 0.2 μm 15 mL PA70, Low Acid 8300-03701-00290

100 mL and 1000 mL 0.2 μm 100 mL PA70, Low Acid 8300-037010-0390

10% solids, 100 mg/mL 0.2 μm 1000 mL PA70, Low Acid 8300-037010-0490

0.2 μm 15 mL PA50, Med. Acid 8300-03501-00290

0.2 μm 100 mL PA50, Med. Acid 8300-035010-0390

0.2 μm 1000 mL PA50, Med. Acid 8300-035010-0490

56

57

ParticleDiameter

BottleSize

Surface Acid Loading Cat. Number

Opti-Link 0.2 μm 15 mL PA20, High Acid 8300-0320-100290

Carboxylate-modifi ed 0.2 μm 100 mL PA20, High Acid 8300-0320-100390

0.2 μm 1000 mL PA20, High Acid 8300-0320-100490

0.3 μm 15 mL PA70, Low Acid 8300-0570-100290

0.3 μm 100 mL PA70, Low Acid 8300-0570-100390

0.3 μm 1000 mL PA70, Low Acid 8300-0570-100490

0.3 μm 15 mL PA50, Med. Acid 8300-0550-100290

0.3 μm 100 mL PA50, Med. Acid 8300-0550-100390

0.3 μm 1000 mL PA50, Med. Acid 8300-0550-100490

0.3 μm 15 mL PA20, High Acid 8300-0520-100290

0.3 μm 100 mL PA20, High Acid 8300-0520-100390

0.3 μm 1000 mL PA20, High Acid 8300-0520-100490

0.4 μm 15 mL PA70, Low Acid 8300-0770-100290

0.4 μm 100 mL PA70, Low Acid 8300-0770-100390

0.4 μm 1000 mL PA70, Low Acid 8300-0770-100490

0.4 μm 15 mL PA50, Med. Acid 8300-0750-100290

0.4 μm 100 mL PA50, Med. Acid 8300-0750-100390

0.4 μm 1000 mL PA50, Med. Acid 8300-0750-100490

0.4 μm 15 mL PA20, High Acid 8300-0720-100290

0.4 μm 100 mL PA20, High Acid 8300-0720-100390

0.4 μm 1000 mL PA20, High Acid 8300-0720-100490

2.0 μm 15 mL PA5, High Acid 7300-3305-100250

2.0 μm 100 mL PA5, High Acid 7300-3305-100350

2.0 μm 1000 mL PA5, High Acid 7300-3305-100450

3.0 μm 15 mL PA20, High Acid 7300-3420-100250

3.0 μm 100 mL PA20, High Acid 7300-3420-100350

3.0 μm 1000 mL PA20, High Acid 7300-3420-100450

Parking Area InformationThe surface area per gram of a particle varies inversely with the particle diameter. Acid content refers to

the titrated milliequivalents per gram (mEq/g) and is weight-based. Parking area combines surface area

and acid content to give you the surface acid distribution that is useful for assay optimization. Refer to

the chart below.

Acid Content Parking Area Properties

Low 60 - 100 Hydrophobic surface, more colloidally stable than plain polystrene

Medium 35 - 59 Hydrophobic and hydrophilic areas; good colloidal stability and good covalent coupling

High 10 - 34 Hydrophilic surface; excellent colloidal stability; excellent covalentcoupling

Thermo Scientifi c Opti-Bind and Opti-LinkParticle Product Listing (continued)

Turbi-Link

Carboxylate-modifi ed

ParticlesParticle

DiameterBottleSize

Parking Area/ Post Process Cat. Number

Packaged in 15 mL, 0.10 μm 15 mL PA20/Pasteurized 100-153-100240

100 mL and 1000 mL 0.10 μm 100 mL PA20/Pasteurized 100-153-100340

10% solids, 100 mg/mL 0.10 μm 1000 mL PA20/Pasteurized 100-153-100440

0.15 μm 15 mL PA20/Pasteurized 100-204-100240






0.3 μm 15 mL PA20/ Pasteurized 100-311-100290



Turbi-Bind

Sulfate Particles ParticleDiameter

BottleSize

Surface Acid Loading/ Post

Process Cat. Number

Packaged in 15 mL, 0.1 μm 15 mL Low SO4/0.05% Az 6100-0397-100250

100 mL and 1000 mL 0.1 μm 100 mL Low SO4/0.05% Az 6100-0397-100350

10% solids, 100 mg/mL 0.1 μm 1000 mL Low SO4/0.05% Az 6100-0397-100450

0.2 μm 15 mL Low SO4/0.05% Az 6100-0597-100250

0.2 μm 100 mL Low SO4/0.05% Az 6100-0597-100350

0.2 μm 1000 mL Low SO4/0.05% Az 6100-0597-100450

0.3 μm 15 mL Low SO4/0.05% Az 6100-0797-100250

0.3 μm 100 mL Low SO4/0.05% Az 6100-0797-100350

0.3 μm 1000 mL Low SO4/0.05% Az 6100-0797-100450

0.4 μm 15 mL Low SO4/0.05% Az 6100-0997-100250

0.4 μm 100 mL Low SO4/0.05% Az 6100-0997-100350

0.4 μm 1000 mL Low SO4/0.05% Az 6100-0997-100450

Thermo Scientifi c Turbi-Bind and Turbi-Link Particle Product Listing

58

We covalently coat our Opti-Link Carboxylate-

Modifi ed Particles with Streptavidin. This

results in high biotin-binding capacity and long

shelf life.

We have developed a series of non-magnetic

Streptavidin coated particles (Power-Bind

Streptavidin particles) to improve and simplify

the binding of ligands to particles. Power-Bind

Streptavidin particles combine the advantages

of high surface area and easy, high affi nity,

high specifi c activity binding. They can also

be used in a variety of diagnostic and molecu-

lar biology applications.

Power-Bind Streptavidin-coated particles are

monodisperse particle suspensions with

Streptavidin covalently bound to the surface

(of Opti-Link carboxylate-modifi ed particles) in

a highly active form. The use of particles as a

solid phase support in various immunoassays

and affi nity purifi cations has been known for

some time. Achieving high activity and stable

binding of solid phase ligands has been a

major diffi culty. Biotinylated compounds

become stably bound to Power-Bind

Streptavidin particles after simple incubation

in buffer. This is due to the high affi nity of the

biotin-Streptavidin interaction. Power-Bind

Streptavidin particles also functions as a

spacer, which improves the specifi c activity of

the bound ligand.

Power-Bind Streptavidin particles addresses

the concerns of diagnostic test kit manufactur-

ers and nucleic acid researchers. With well-

known biotin-streptavidin reactions, scientists

can now easily bind ligands to microparticle

surfaces.

Power-Bind Benefi ts• Dissociation constant (Kd 10-15 Molar)

• Stably bound ligands

• Easy one-step binding protocols for biotinyl-

ated ligands

• High activity of surface bound ligands

• Easily solve diffi cult coupling problems

• Simple aqueous biotinylation reactions

• Low nonspecifi c interactions

• Highly mobile particles for membrane-

based applications

• Can be used in EIA formats with biotin/en-

zyme detection systems

• Benefi cial spacer effect of SA molecule

• Choice of 0.3 μm or 0.8 μm diameters for

different application requirements

• High biotin-binding capacity for molecular

biology applications

Compounds which are diffi cult to attach to

particle surfaces by conventional means may

be amenable to biotinylation. This includes

compounds for which activation reactions

must be performed in organic solvent. In this

instance, biotinylation may be carried out in

organic solvent; then the biotin derivative is

simply mixed with the Power-Bind Strepta-

vidin particles. Nucleic acids, which adsorb

poorly to particle surfaces, are readily bound

to Power-Bind Streptavidin particles after

biotinylation.

To order Thermo Scientifi c PowerBind

products, call our Indianapolis, IN offi ce at

1-866-737-2396 or at 1-317-610-3800.

Thermo Scientifi c Power-BindStreptavidin Coated Particles

Power-Bind Streptavidin

ParticleDiameter

BottleSize

BindingCapacity Cat. Number

Packaged in 1 mL, 5 mL, 100 mL 0.3 μm 1 mL ~1000 pmol/mg 2900-0701-011150

1% solids 0.3 μm 5 mL ~1000 pmol/mg 2900-0701-010150

0.3 μm 100 mL ~1000 pmol/mg 2900-0701-010350

0.85 μm 1 mL ~1000 pmol/mg 2900-1801-011150

0.85 μm 5 mL ~1000 pmol/mg 2900-1801-010150

0.85 μm 100 mL ~1000 pmol/mg 2900-1801-010350

59

Thermo Scientifi c 5000 Series:Polymer Particle Supsensions

They are useful for applications such as

fi lter evaluation and testing, fl uid mechanics

research, dispersion studies and many other

research and development projects.

This group of products is designed to meet

the need for particulate materials with a vari-

ety of particle sizes and properties. They are

useful for applications such as fi lter evaluation

and testing, fl uid mechanics research, disper-

sion studies and many other research and

development projects. They are not intended

for use in instrument calibration or diagnostic

reagents because they lack the exacting speci-

fi cations needed for those applications.

Particles of this series are of special interest

for research in light scattering, microporous

fi lter checking and aerosol particle genera-

tion. The polystyrene particles have a density

of 1.05 g/ cm3 and a refractive index of 1.59

@ 589 nm. Particle diameters are measured

by optical microscopy, photon correlation

spectroscopy or light scattering. They are

packaged as aqueous suspensions at 10%

solids by weight.

The 5000 Series particles sizes are up to 3.2

microns in size. If you require larger particles,

please refer to our Copolymer Microsphere

Suspensions - 7000 Series particles.

* 15 mL (“A” bottles) listed below are avail-

able for immediate purchase. 100 mL (“B”

bottles) and 1000 mL (“C” bottles) are pack-

aged to order; example (5003B and 5003C).

Please allow 3-7 working days when ordering

these fi ll volumes.

CatalogNumber

MeanDiameter

SizeUniformity

5003A 0.03 μm ≤ 30%

5006A 0.06 μm ≤ 18%

5008A 0.08 μm ≤ 18%

5009A 0.09 μm ≤ 15%

5010A 0.10 μm ≤ 15%

5011A 0.11 μm ≤ 12%

5012A 0.12 μm ≤ 12%

5014A 0.14 μm ≤ 6%

5016A 0.16 μm ≤ 6%

5017A 0.17 μm ≤ 5%

5020A 0.20 μm ≤ 5%

5022A 0.22 μm ≤ 3%

5024A 0.24 μm ≤ 3%

5026A 0.26 μm ≤ 3%

5030A 0.30 μm ≤ 3%

5031A 0.31 μm ≤ 3%

5033A 0.32 μm ≤ 3%

5036A 0.36 μm ≤ 3%




Index of Refraction 1.59 @ 589 nm (25°C)


CatalogNumber

MeanDiameter

SizeUniformity

5043A 0.43 μm ≤ 3%

5045A 0.45 μm ≤ 3%

5049A 0.49 μm ≤ 3%

5050A 0.50 μm ≤ 3%

5051A 0.51 μm ≤ 3%

5052A 0.52 μm ≤ 3%

5060A 0.60 μm ≤ 3%

5065A 0.65 μm ≤ 3%

5067A 0.67 μm ≤ 3%

5077A 0.77 μm ≤ 3%

5081A 0.82 μm ≤ 3%

5088A 0.87 μm ≤ 3%

5093A 0.93 μm ≤ 3%

5100A 1.0 μm ≤ 3%

5130A 1.3 μm ≤ 5%

5153A 1.5 μm ≤ 4%

5200A 2.0 μm ≤ 4%

5300A 2.9 μm ≤ 5%

5320A 3.2 μm ≤ 5%

60

61

Suspensions of large copolymer particles are

useful as model systems for fl uid mechanics

experiments and as challenge particles for

large pore fi ltration systems.

These products are designed to meet the need

for particulate materials with a variety of

particle sizes and properties. They are useful

for applications such as fi lter evaluation, fi lter

testing, fl uid mechanics research, disper-

sion studies and many other research and

development projects. They are not intended

for use in instrument calibration or diagnostic

reagents because they lack the exacting speci-

fi cations needed for those applications.

Suspensions of large copolymer particles are

useful as model systems for fl uid mechanics

experiments and as challenge particles for

large pore fi ltration systems.

They are also useful as experimental particles

for acoustical and optical analytical systems.

They are composed of polystyrene polymer,

cross-linked with 4-8% divinylbenzene (DVB).

The particles are chemically inert. They can

be washed with alcohol, vacuum or air dried.

The polymer density is 1.05 g/cm3 and the

index of refraction is 1.59 @ 589 nm. They

are packaged as aqueous suspensions at 10%

solids by weight.

* 15 mL (“A” bottles) listed are available for

immediate purchase. 100 mL (“B” bottles)

and 1000 mL (“C” bottles) are packaged to

order; example (7503B and 7503C). Please

allow 3-7 working days when ordering these

fi ll volumes.

To order Thermo Scientifi c 5000 or 7000 Series

particle products, call our Fremont, CA offi ce

at 1-800-232-3342 or at 1-510-979-5000.

Thermo Scientifi c 7000 SeriesCopolymer Particle Suspensions

CatalogNumber

MeanDiameter

SizeUniformity

7503A 3.2 μm ≤ 45%

7505A 4.3 μm ≤ 25%

7508A 7.9 μm ≤ 20%

7510A 11 μm ≤ 18%

7516A 17 μm ≤ 16%

7520A 19 μm ≤ 16%

7525A 25 μm ≤ 15%

7545A 45 μm ≤ 15%

7550A 55 μm ≤ 16%

7575A 71 μm ≤ 15%

7590A 85 μm ≤ 16%

7602A 97 μm ≤ 12%

7640A 134 μm ≤ 16%

7725A 222 μm ≤ 12%

Product SpecificationsParticle Composition: Polystyrene crossed linked with divinylbenzene (DVB)





Stable in a wide variety of organic solvents,

these particles can be used in chemical

engineering and contamination control stud-

ies. They can also be used as preparations of

special sizes for sieve analysis.

These spherical polymer particles have the

same physical and chemical properties as

the general purpose 7000 Series - Copolymer

Particle Suspensions, except these particles

are more economical and have a wide size

distribution.

Thermo Scientifi c Polymer Materials (Dry)For Chemical Engineering Studies

Product SpecificationsParticle Composition: Polystyrene crossed linked with divinylbenzene (DVB)

Content Dry Polystyrene DVB particles



Additives: May contains trace amount of dry dispersant

CatalogNumber

Size Range Quantity

434 100-500 μm 100 g

62

63

Glass beads are useful as models for analyti-

cal, sedimentation and separation applica-

tions. Other uses for glass beads are as spac-

ers, insulators and refl ectors. The products

are packaged as dry materials.

Good quality research glass beads with fewer

inclusions, scratches, non-spherical material

and broken glass fragments than other com-

mercial products.

To order Thermo Scientifi c Polymer or Glass

Material, call our Fremont, CA offi ce at

1-800-232-3342 or at 1-510-979-5000.

Thermo Scientifi c Glass Material (Dry)For Analytical, Sedimentation and Seperation

Product SpecificationsParticle Composition: Soda Lime Glass

Appearance White powder



Softening Temperature 720 °C

Dialectric Constant 7.3 @ 1 kHz and 20 °C


CatalogNumber

Size Range Quantity

414 1-40 μm 2 g

414B 1-40 μm 10 g

424 5-50 μm 100 g

424B 5-50 μm 500 g

443 70-105 μm 2 g

443B 70-105 μm 10 g

428 140-165 μm 10 g

428B 140-165 μm 50 g

429 180-210 μm 10 g

429B 180-210 μm 50 g

The pollens are useful for applications such as

fl uid mechanics research, dispersion studies,

fi lter evaluation and testing, and many other

research projects.

This selection of products provides model

specimens for analyzing and controlling

pollens, a common industrial contaminant.

Pollens can also be used as controls for test

systems, or as models of biological cells when

stained with cytochemical dyes. Packaged as

dry powder, the pollens will swell to a spheri-

cal shape after immersion in aqueous solu-

tions. The size data pertains to the hydrated

spherical condition.

Spherical Pollen and Spores (Dry)Fluid Mechanics/ Dispersion Studies

CatalogNumber

Description Size Range Quantity

213 Paper Mulberry Pollen 11-17 μm 1 g

213B Paper Mulberry Pollen 11-17 μm 5 g

214 Ragweed Pollen 17-21 μm 1 g

214B Ragweed Pollen 17-21 μm 5 g

215 Lycopodium Spores 25-35 μm 10 mL

215B Lycopodium Spores 25-35 μm 50 mL

217 Pecan Pollen 43-53 μm 1 g

217B Pecan Pollen 43-53 μm 5 g

395 Bermuda Grass Pollen 21-29 μm 1 g

395B Bermuda Grass Pollen 21-29 μm 5 g

396 Black Walnut Pollen 29-41 μm 1 g

396B Black Walnut Pollen 29-41 μm 5 g

397 Corn Pollen 79-97 μm 2 g

397B Corn Pollen 79-97 μm 10 g

419 Bermuda Grass Smut Spores 6-8 μm 1 g

419B Bermuda Grass Smut Spores 6-8 μm 5 g

420 Johnson Grass Smut Spores 6-9 μm 1 g

420B Johnson Grass Smut Spores 6-9 μm 5 g

Product SpecificationsParticle Composition: Spherical Pollen and Spores

Appearance Yellow to brown powder

Content Naturally occurring botanical materials (dry)


64

65

Cat. Number Package Application Sample Pack Includes:

Opti-Bind Sulfate Particles S81123 3 x 15 mLClinical/

Molecular

8100-0397-100290 (0.1 μm)

8100-0597-100290 (0.2 μm)

8100-0797-100290 (0.3 μm)

Opti-Link Carboxylate-

modifi ed Sulfate Particles

0.2 μm Sample Pack

S8302 3 x 15 mLClinical/

Molecular

8300-0370-100290 (Low Acid)

8300-0350-100290 (Medium Acid)

8300-0320-100290 (High Acid)



0.3 μm Sample Pack


Molecular

8300-0570-100290 (Low Acid)

8300-0550-100290 (Medium Acid)

8300-0520-100290 (High Acid)



0.4 μm Sample Pack


Molecular

8300-0770-100290 (Low Acid)

8300-0750-100290 (Medium Acid)

8300-0720-100290 (High Acid)

Turbi-Link

Carboxylate-modifi ed

Particles

S100 4 x 15 mL Turbidimetric

1001-531-00240 (0.10 μm)

1002-041-00240 (0.15 μm)

1002-551-00240 (0.2 μm)

1003-311-00290 (0.3 μm)

Turbi-Bind

Sulfate ParticlesS61 4 x 15 mL Turbidimetric

6100-0397-100250 (0.1 μm)

6100-0597-100250 (0.2 μm)

6100-0797-100250 (0.3 μm)

6100-0997-100250 (0.4 μm)

Thermo Scientifi c Plain Particles Sample Packs

To order these Thermo Scientifi c Sample Packs, call our Indianapolis, IN offi ce at 1-866-737-2396 or at 1-317-610-3800.

66

Thermo Scientifi c Metal and Mineral ParticlesReal world particulates and particles for chemical,

engineering and metallurgical studies.

This series of particles meets the need for an

assortment of materials for chemical, engineering

and metallurgical studies. They are also useful

as particles for fi ltration testing and air particle

counters. The stainless steel and nickel

particles are paramagnetic.

To order Thermo Scientifi c pollen and spores,

metal and minerals or SMOKE-CHECK prod-

ucts, call our Fremont, CA offi ce at 1-800-232-

3342 or at 1-510-979-5000.

CatalogNumber

Description Size Range Quantity Density (g/cm3)

415 AC Fine Test Dust 1-80 μm 50 g 2.6

416 AC Coarse Test Dust 1-200 μm 50 g 2.6

347 Aluminum Oxide Particles 0.6-6.0 μm 5 g 3.9

421 Aluminum Oxide Particles 0.3-20 μm 5 g 3.9

423 Aluminum Oxide Particles 0.5-20 μm 5 g 3.9

235 Aluminum Silicate Particles 0.2-8.0 μm 20 g 2.6

437 Calcium Carbonate Particles 0.1-8.0 μm 20 g 2.7

136 Nickel Spheres 2-10 μm 20 g 8.9

358 Nickel Particles 40-80 μm 5 g 8.9

359 Nickel Particles 75-90 μm 10 g 8.9

435 Stainless Steel Spheres, Type 316 24-65 μm 25 g 8



356 Walnut Shell Particles 3-30 μm 25 g 1.35

Product SpecificationsMiscellaneous Metals and Minerals


Thermo Scientifi c SMOKE-CHECK Smoke Detector Challenge Particles

We have developed a complete testing kit to

check the transport time of air sampling smoke

detectors as required by the United States

NFPA Standard 72. A suspension of polystyrene

particles in high purity water is nebulized using a

hand held ultrasonic atomizer to create a mimic of

natural smoke, thus eliminating residues caused

by traditional oil-based sprays or real smoke.

This makes SMOKE-CHECK especially useful in

cleanrooms and other critical environments. The

particle size and concentration have been opti-

mized to consistently trigger the smoke detector.

In addition, the particles will not pass through

HEPA fi lters, ensuring the integrity of the

cleanroom environment.

The Smoke Detector Challenge Kit includes a

battery powered portable ultrasonic nebulizer,

a draft shield and a 10 mL bottle of particles.

Instructions for operating and cleaning the

nebulizer are included. Additional bottles of

SMOKE-CHECK may be purchased separately.


Particle Density 1.05 g/cm3

Refractive Index 1.59 @ 589 nm (25° C)

Additives: Trace surfactant to inhibit agglomeration

CatalogNumber

Description

SD-01 Smoke Detector Challenge Particles (10 mL)

SD-02 Smoke Detector Challenge Kit

Thermo Scientifi c HEPA-CHECK

Filter Challenge Particles

There is a worldwide growing demand for

polystyrene latex* particles (PS) by fi lter

manufacturers, end-users and third-party

testing services. PS’s are listed as suitable test

materials when using particle counters by both

the Institute of Environmental Sciences (IEST)

and European Norm (EN) standards.

HEPA-CHECK™ Filter Challenge Particles are

polystyrene latex particles optimized for per-

formance, aerosolization, safety and economy

for both HEPA and ULPA fi lter testing. Unlike

traditional oil-based fi lter test materials such

as dioctylphthalate (DOP), HEPA-CHECK does

not carry the health risks associated with

atomized oils such as dioctylphthalate (DOP) or

other oil-based fi lter test materials. Due to the

clean oil-free nature of this ultra-pure water

suspension, HEPA-CHECK is ideal for leak

testing in-situ fi lters where the highest degree

of cleanliness is required.

Our polystyrene particles, for HEPA and ULPA

fi lter testing, are manufactured so you are en-

sured a consistently controllable and repeat-

able supply of highly uniform, monodisperse

particles which meet or exceed effi ciency test-

ing requirements. Each 25 mL bottle is to be

diluted in one US gallon (3.79 liters) of clean

water and then nebulized. Nebulizing can be

accomplished by using commercially available

ultrasonic humidifi ers. Single use bottles

ensure reproducible test conditions from site

to site. The product is available in particle

sizes traditionally associated with testing and

is sold individually or in convenient packs of 6

or 20 bottles.

To order Thermo Scientifi c HEPA-CHECK

products, call our Fremont, CA offi ce at 1-800-

232-3342 or at 1-510-979-5000.


Concentration 7.5 x 1012 particles per mL

Particle Density 1.05 g/cm3

Refractive Index 1.59 @ 589 nm (25° C)

Additives: Trace surfactant to inhibit agglomeration

Catalog Number MeanDiameter

SizeUniformity

Bottle Pack (6) Box (20)

HF12 HF12-PK HF12-BX 0.12 μm ≤ 5%

HF14 HF14-PK HF14-BX 0.14 μm ≤ 5%

HF17 HF17-PK HF17-BX 0.17 μm ≤ 5%

HF20 HF20-PK HF20-BX 0.20 μm ≤ 5%

HF22 HF22-PK HF22-BX 0.22 μm ≤ 5%

HF26 HF26-PK HF26-BX 0.26 μm ≤ 5%

HF30 HF30-PK HF30-BX 0.30 μm ≤ 5%

6767

Selecting Particle Surface Properties For Diagnostic Applications

Polymer particles are used in diagnostics for lateral fl ow chromatographic striptests, latex agglutination assays, suspen-sion array tests and nephelometric as-says. When changes in particle properties are suspected as a root cause of reagent batch failures, it is important to gain a better understanding of the particle selec-tion process. There are wide variations in particle composition, surface properties and size control that can affect the perfor-mance of a diagnostic reagent.

The importance of particle surface properties

The surface of particles is one of the most important properties for particles usedin diagnostic tests and other applica-tions where proteins and other biomol-ecules are bound to particles. Residual surfactants, monomers and microbialcontamination can interfere with the successful conjugation to the particles.These contaminants are often the cause of batch-to-batch non-reproducibilityof the conjugation reactions, and thesevariations can interfere with the produc-tion process for diagnostic tests. Carefulcontrol of particle diameter is also veryimportant since the surface area changes exponentially with changing diameter.Variations in surface area can causeapparent changes in sensitivity and can contribute to false positive and negativeresults. These potential problems can re-sult in a manufacturing dilemma—should a new batch of particles that doesn’t passincoming product tests be used and riskan assay that doesn’t work. Consistencyin particle manufacturing and qualitycontrol assures that these problems will not occur.

The functional groups available on the surface of the particles control the chem-istry of the conjugation process. Selectingparticles with the appropriate surface and quality characteristics is the key todeveloping stable, reproducible diag-nostic tests. Following is a discussion ofhow surface properties effect two broadcategories of biomolecular conjugation.

Properties affecting hydrophobic adsorption

Particles with sulfate and carboxyl groups are designed for hydrophobic

68

(passive) adsorption. The particle surface is very hydrophobic, with a low density of negatively charged surface ions to provide charge stabilization. These par-ticles will bind to any molecules that arecharacteristically hydrophobic, includingproteins, peptides and small hydrophobicmolecules.

The binding affi nity tends to increase as molecular weight increases, and can result in the preferential binding of higher molecular weight proteins in mixtures.Specifi c adsorption of substances such asantibodies is easily accomplished by mix-ing the particles and the protein together at an optimal pH and then separating theunbound protein from the solid phase,usually by centrifugation or cross-fl owfi ltration. The charge groups on theseparticles are derived from the initiatorsused in the synthesis of the particles,resulting in either sulfate or carboxyl ionicgroups on the particle surface. The main difference between these two types ofhydrophobic particles is their pH stability.Sulfate particles are stable above pH 3,while carboxyl particles are stable abovepH 6. There are other, more subtle differ-ences, and these come into play when one or the other particle types give asuperior result when antibody is bound to its surface. These differences are not well understood and are not predictable, so it is necessary to experiment to determinewhich of the two hydrophobic surfaces is best for a particular application.

Properties affecting covalent coupling

Carboxylate-modifi ed (CML) and alde-hyde-modifi ed particles are designed for covalent attachment by reactionwith amines. The modifi ed particles are made from sulfate particles by grafting acopolymer containing the desired chemi-cal group onto the surface, producing a thin, relatively hydrophilic polymeric layer. This results in a high density of carboxyl or aldehyde surface groups that can be chemically activated to give a reactive intermediate that will couple with amineson proteins and other biomolecules.Carboxylate-modifi ed particles differfrom the hydrophobic carboxyl particlesin that the surface is somewhat porous,more hydrophilic and has a relatively highcharge density of 10-125 Å2 /carboxyl.

y p y

They are more stable in the presence ofhigh concentrations of electrolytes (up to

1 M univalent salt). Unlike the hydropho-bic carboxyl particles, the high densityand better availability of the carboxylgroups on these particles facilitate reac-tion with protein amines after activationwith carbodiimide reagents. Alternatively, one can convert to the active esters ina two-step process. Aldehyde-modifi edparticles have aldehyde groups graftedto the surface and can react with proteinamines through Schiff base formation.Since the aldehyde-modifi ed particlesdo not require chemical activation andthus offer a convenient one-step methodof covalent attachment, they should beconsidered as a simpler alternative tocarboxylate-modifi ed particles. Amine-modifi ed particles are prepared from carboxylate-modifi ed particles by convert-ing some of the carboxyl groups to aminegroups. The resulting aminemodifi ed particles still retain a net negative chargeto ensure good charge stability, and can easily be coupled to antibodies and otherproteins using a variety of bi-functionallinkers. This conjugation approach offersa different way of attaching molecules to the particle surface, and often results inbetter activity of the conjugate.

Particle manufacturing quality

With so many particle variables affecting the reagent-making process, it is es-sential that all phases of particle designand production be tightly controlled in areproducible environment. This is a strongcontribution to reagent batch repeat-ability.



Placing an OrderFor faster service when placing an order, please

provide the following information to our Customer

Relations Department:

• Account Number

• Quote Number

• Order Number

• Catalog Number

• Quantity

• Shipping Requirements. If you have special require-

ments for

shipping, please indicate this clearly in your order

Product ReturnsNo returns accepted without prior authorization.

Please contact Customer Service for assistance.

Payment InformationThermo Fisher Scientifi c sales terms are net 30 days from the date of invoice for companies that

have established a credit account with us.

To establish a credit account, please complete our

New Account form. If you have any questions, please

feel free to contact our Customer Relations Depart-

ment.

Customer Service Department

Our Customer Service Department can be reached by

telephone, fax or email.

For Size Standards and Flow Cytometry products,

call our Fremont, CA offi ce at 1-800-232-3342 or at

1-510-979-5000.

Hours: 8 a.m. - 5 p.m. Pacifi c

Email: info.particles@thermofi sher.com

For magnetic and all other particle products, call the

Indianapolis, IN offi ce at 1-866-737-2396 or at 1-317-

610-3800.

Hours: 8 a.m. - 5 p.m. Eastern

Fax: 1-317-610-3888

Email: info.particles@thermofi sher.com

Web site: www.thermo.com/particletechnology

Ordering Information

When ordering samples or evaluation packs, please

specify product volume and catalog numbers. When

reordering (“approved”) bulk material, please advise

us of specifi c manufacturing lot numbers and volume.

Nominal diameters, surface acid content and binding

capacities are listed in the product tables. Exact

parameters and other technical information is listed

on package inserts and certifi cates of analysis.

Not all particles are available at all times. For specifi c

product and lot availability, please email Customer

Relations at info.particles@thermofi sher.com.

Although we can manufacture up to 300 liter batch

sizes, please advise us of your particle usage require-

ments so that we can confi rm suffi cient inventory

quantities for your application.

Sample Evaluation Packs

Some of our particle products are sold in economi-

cal sample evaluation pack form. These evaluation

packs allow you to buy small samples from among our

standard inventory of different surfaces, colors, sizes

and binding capacities at greatly reduced prices. You

can fi nd sample pack information at the end of each

product section in this catalog.

MSDS

Material Safety Data Sheets are available for all

Thermo Scientifi c products. Please contact our

Customer Service Department if you need more

information or visit our Web site at www.thermo.

com/particletechnology.

Technical Support

Our Technical Service personnel are trained to answer

your questions. Our technical notes can also be a

helpful resource for whatever project you are working

on. Just log on to www.thermo.com/particletechnol-

ogy and click on technical notes.

Quality Commitment

We provide high quality manufacturing in our

ISO certifi ed facilities. We are FDA registered as an

in vitro diagnostic device manufacturer and are cGMP

compliant.

Striving To Meet Your Needs

69

Particle Products 7998 Georgetown Rd.

Indianapolis, IN 46268

1-866-737-2396

1-317-610-3888 fax

46360 Fremont Blvd.

Fremont, CA 94538

1-800-232-3342

www.thermo.com/particletechnology

[email protected]

DCR 11210

Indianapolis, IN

USAISO Certified

Fremont, CA

USA

thermo scientiﬁ c particle technology product catalog and ...libvolume2.xyz ›...

Documents