The Role of Vaccines to Combat Antimicrobial Resistance (AMR)Leonard Friedland, MD, FAAPVice President and Director, Scientific Affairs and Public Health GSK Vaccines

Immunize Nebraska

August 7, 2020

Disclosure

Employed by GSK where I am a vaccine research physician scientist

Presentation at the invitation of Dr. Meera Varman, Professor, Pediatric Infectious Diseases, Creighton University School of Medicine

Presentation is for educational purposes only; this is not a sales, marketing or promotional presentation

Content of presentation will not include unapproved or investigational uses of products or devices

The value of vaccines

Sources: 1. WHO, UNICEF, World Bank. State of the world’s vaccines and immunization, 3rd ed. Geneva, World Health Organization, 2009., p.12; 2. Ehreth J, “The global value of vaccination” in Vaccine 2003 Jan 30; 21 (7-8):596-600. 3. Stack et al, ‘Estimated Economic Benefits During The ‘Decade of Vaccines’ Include Treatment Savings, Gains in LaborProductivity’, Health Affairs, 30, 6 (2011): 1021-1028 4. Ozawa S. et al, “Return on investment from childhood immunisation in low- and Middle-Income countries, 2011-20”, in Health Affairs, 35, 2 (2016): 199-207

2-3m²deaths prevented every year by vaccination

750,000²children saved from disability every year

$150bn³the benefit of vaccines to lowand middle-income countries over the next 10 years

x444

is the estimated return on Investment of the cost of immunization

Only clean drinking water rivals vaccination in its ability to save lives1

3

Scientific knowledge advances and modern vaccine technologies offer great potential for new vaccine development:

• uncommon and/or emerging diseases imparting significant morbidity & mortality• patient populations small in number yet at risk of clinically important medical

and healthcare-associated infections• personalized vaccines based on subpopulation or individual genetic information• AMR-relevant vaccines aimed at preventing target pathogens likely to drive

antimicrobial use and resistanceNew vaccines need to be discovered, developed through to commercialization, and implemented through evidence-based vaccination policy recommendations

Driving the potential of new vaccines to transform human health

4

Discovering innovative technologies and developing new vaccines: time, human, capital resource intensive, risky

Formulating vaccine policy decisions: broad view, beyond direct health and economic benefits

Evaluate:– Moral, social, ethical impact of vaccines, integrated alongside other societal

health interventions and programmatic synergies– Health equity, justice, community health gains, improved healthcare system

function, societal economic health– Impacts related to reduced antibiotic use and antibiotic resistance.

Need for comprehensive approach to realize full potential and impact

5

6Sapiens-A Brief History of Humankind. Yuval Noah Harari. Harper Collins 2015, pp. 3, 50-51, 268-269

For 99.9% of the history of mankind, life expectancy was <40 yearsAverage life expectancy of early Homo sapiens was apparently 25-40 years

Improved health and increased life expectancy: an achievement of civilization In the last 2 centuries things have changed beyond recognition. Pills, injections and sophisticated operations save us from a spate of illnesses that once dealt an inescapable death sentence. The average life expectancy jumped from around 25-40 years, to 67 in the entire world, and to around 80 in the developed world.

Top 10 Causes of Death 1900 2010

7NEJM 2012:366;2333-2338

Data are from the Centers for Disease Control and Prevention

Etiology No deaths/100,000 Etiology No deaths/100,000

Pneumonia or influenza 202.2 Heart disease 192.9

TB 194.4 Cancer 185.9

GI infections 142.7 Noninfectious airway dis 44.6

Heart disease 137.4 Cerebrovascular dis 41.8

Cerebrovascular dis 106.9 Accidents 38.2

Nephropathies 88.6 Alzheimer’s dis 27.0

Accidents 72.3 Diabetes 22.3

Cancer 64.0 Nephropathies 16.3

Senility 50.2 Pneumonia or influenza 16.2

Diphtheria 40.3 Suicide 12.2

Antibiotics

The discovery of antibiotics is one of the greatest medical advances of the 20th

century

Modern medicine is made possible by our ability to treat, and prevent, infection: transplantation, neonatal care, complex surgeries, joint replacement, caesarian sections, oncology treatment, …

8

Antibiotics

Unfortunately, their use has created an evolutionary response from microbes, and these gains in healthcare are under threat from AMR

9

Timeline: some key events of antibiotic resistance development

10Adapted from Ventola CL. P&T 2015; 40: 277-83

1943 Penicillin1940Penicillin-R Staphylococcus

1960

1985

2010

1962

1987

1998

2011

1950 Tetracycline

Methicillin

Imipenem & Ceftazidime

Ceftaroline

1959Tetracycline-R Shigella

Methicillin-R Staphylococcus

Ceftazidime-R Enterobacteriaceae

Imipenem-R Enterobacteriaceae

Ceftaroline-R Staphylococcus

Antibiotic introducedAntibiotic resistance identified

These events were predicted

11

Stanley Falkow (1934-2018) discovered the molecular mechanisms through which bacteria cause disease and predicted the rise of multidrug-resistant bacteria

By the 1970s he predicted that overuse of antibiotics would soon lead to drug resistance and the loss of their utility

Falkow already had plenty of evidence to base his predictions on

His recommendation to stop the use of antibiotics in animals was not implemented by the US authorities

Science 08 Jun 2018:Vol. 360, Issue 6393, pp. 1077 http://science.sciencemag.org/content/360/6393/1077

– Multidrug resistant organisms increasingly common, extremely difficult to treat

– Now encountering infections that are untreatable

– Major contributor: over-prescription of current antibiotics in animals and humans

The IssueAntimicrobial Resistance (AMR)

12

13

Overuse of antibiotics is prevalent1

14

Even when access to antibiotics is restricted by a prescription system, much of the use is unnecessary

Partly, this is because it is hard to know what’s necessary at the time prescribing happens

1. O'Neill, J. (2016). The Review on Antimicrobial Resistance. Final Report and Recommendations. London: Wellcome Trust on behalf of HM Government. https://amr-review.org/sites/default/files/160525_Final%20paper_with%20cover.pdf (page 39)

Misuse of antibiotics is also prevalent1

151. O'Neill, J. (2016). The Review on Antimicrobial Resistance. Final Report and Recommendations. London: Wellcome Trust on behalf of HMGovernment. https://amr-review.org/sites/default/files/160525_Final%20paper_with%20cover.pdf (page 54)

But it is important to understand that even if used appropriately, antibiotic resistance will arise

It is a natural and predictable consequence of actually using antibiotics

All we can do is slow it down

Serious, growing threat to public health and economy

AMR: an imperative for all stakeholders

16O’Neill J. The review on antimicrobial resistance (2016). https://amr-review.org/sites/default/files/160518_Final%20paper_with%20cover.pdf

If current trend holds:

by 2050, ~10 million AMR deaths globally, world GDP reduced up to 2-3.5%

0

1000000

2000000

3000000

4000000

5000000

6000000

7000000

8000000

9000000

Tetanus(60.000)

Cholera(120.000)

Measles(130.000)

Roadaccidents

(1.2M)

Diarrhealdis (1.4M)

Diabetes(1.5M)

Cancer(8.2M)

Drugresistantinfections(700.000)

Deaths annually global, current: Drug resistant infections:

▪ 50,000 US/EU▪ globally >700,000

“A problem so serious that it threatens the achievements of modern medicine” – WHO

International travel has created new opportunities for antimicrobial-resistant diseases to be spread globally2

Antimicrobial use is rising across the world, with global consumption of antibiotics increasing by nearly 40% between 2000 and 2010

Predictions of possible future risks

Antibiotics are “the bedrock of modern medicine” since widespread use in the 1940s

“We have reached a critical point and must act now on a global scale to slow down antimicrobial resistance” –Professor Dame Sally Davies, UK Chief Medical Officer

1

2

2

2

1. WHO:http://apps.who.int/iris/bitstream/handle/10665/112642/9789241564748_eng.pdf;jsessionid=40BECF8DD7E6DA5F7BB23C7585D88E2A?sequence=1

2. https://amr-review.org

– Problem attracting global attention– Most proposed solutions focus on development of new technologies:

• Antibiotics• Rapid diagnostic tests• Vaccines

Worst case scenario: “post antimicrobial era”

18

19

AMR is difficult for antibiotics alone

Bloom, Black Salisbury and Rappuoli. PNAS 2018:115;12869

The number of new antibiotics developed and approved has decreased over the past decades

20Adapted from Ventola CL. P&T 2015; 40: 277-83

0

2

4

6

8

10

12

14

16

18

20

1980-1984 1985-1989 1990-1994 1995-1999 2000-2004 2005-2009 2010-2014 2015-2019

19

11 11 11

43

7

12

number of new antibiotics

WHO list of bacteria for which new antibiotics are urgently needed (2017)WHO priority pathogens list for R&D of new antibiotics. Geneva 2017. http://www.who.int/mediacentre/news/releases/2017/bacteria-tianbiotics-needed/en/

WHO priority pathogens list for R&D of new antibiotics. Geneva 2017. http://www.who.int/mediacentre/news/releases/2017/bacteria-tianbiotics-needed/en/ [accessed 5 May 2019].

21

CDC - Antibiotic resistance threats in the United States (2019)CDC. Antibiotic resistance threats in the United States. 2019. Atlanta. GA: US Department of Health and Human Services, CDC; 2019.https://www.cdc.gov/drugresistance/biggest-threats.html

– Problem attracting global attention; most proposed solutions focus on development of new technologies: antibiotics, rapid diagnostic tests, and vaccines

– Role of vaccination in controlling AMR frequently acknowledged, yet not led to concrete changes in policy or resourcing

Worst case scenario: “post antimicrobial era”

22

23

Bloom, Black Salisbury and Rappuoli. PNAS 2018:115;12869

Vaccines combat AMR in two ways

Vaccine

Antibiotic use

Antibiotic resistant infection

2INDIRECT

1DIRECT

1. Prevent infection, carriage and spread

of resistant organisms

2. Reduce antibiotic use and therefore

selective pressure

Bacterial infections are major drivers of antibiotic prescribingVaccines to prevent bacterial infections reduce antibiotic use– vaccines for diphtheria, meningitis, pneumonia and pertussis have protected tens of

millions of individuals from these bacterial infections

Non-bacterial infections can trigger inappropriate use of antibiotics – vaccines for non-bacterial infections, such as influenza and rotavirus, avoid diseases that

can trigger inappropriate use of antibiotics

Preventing infections to reduce society’s dependence on ABX

25

26

Before Hib introduction

After Hib introduction

Global incidence of disease: 3.5-601 cases/100,000 children ≤5 yo 1

Canada: 2.6 cases/100,000 (1987-88) 2

Global prevalence of β-lactamase positive strains: 16.6 % 3

Type of study

1. Peltola H et al. Rev Infect Dis 1990; 12: 708-715. 2, Public Health Agency of Canada, 2017. https://www.canada.ca/en/public-health/services/publications/healthy-living/vaccine-preventable-disease-surveillance-report-december-31-2015.html?wbdisable=true [accessed 17 Feb. 2018] 3. Hoban D & Felmingham D. J Antimicrob Chemother 2002; 50: 49-59,. 4. Jansen KU et al. Nature Med 2018; 24: 10-20 5, Heilmann KP et al. Antimicrob Agents Chemother 2005; 49: 2561-4.

Haemophilus influenzae type b vaccines (Hib)

Decrease of global incidence of disease and of nasopharyngeal carriage 4

Canada: 0.08 cases/100,000 (2011-15) 2

Rapid decrease of β-lactamase positive strains 5

Hib: Haemophilus influenzae type b

Impact of pneumococcal conjugate vaccine on incidence of Penicillin-nonsusceptible IPD (USA)

27

Hampton LM et al. J Infect Dis 2012; 205: 401-11. 2. Kyaw MH et al. N Engl J Med 2006; 354: 1455-63

0

2

4

6

8

10

12

14

< 5 yo 5-17 yo 18-49 yo ≥ 65 yo

Incidence of penicillin-nonsusceptible S. pneumoniae strainsassociated with invasive pneumococcal disease by age group,

USA

1998-1999 2008

IPD: invasive pneumococcal disease. PCV7 vaccine was introduced in 2000.

Cas

es p

er 1

00,0

00 p

opul

atio

n -64%

-45%

-50%-17%

81%Reduction on penicillin nonsusceptible

IPD in children < 2 years 2

28

Impact of pneumococcal conjugate vaccine on antibioticprescription in USA

35% Reduction of

antibiotic use after PCV

introduction1 1.4 millionantibiotic

prescriptions/year are preventable with PCV in

USA 1

1. Fireman B et al. Pediatr Infect Dis J 2003; 22: 10-16.

29

Impact of universal influenza vaccination on antibiotic prescription

1. Neuzil KM et al. N Engl J Med 2000; 342: 225-31. 2. Kwong JC et al. Clin Infect Dis 2009; 49: 750-6.

3-9% of antibioticcourses are

attributable to influenza#1

64%decrease in influenza-associated respiratory

antibiotic prescriptions after

UIIP* in Ontario2

# Children, USA. * UIIP: universal influenza immunization program (offered to everyone ≥ 6 months of age). Overall vaccine uptake in Ontario: 38%.

“Vaccines are evolution proof, drugs are not.”*

Drugs– One target– Work on a big bacterial

population with highnumbers to generatediversity and resistance

Vaccines– Many targets /epitopes– Control a small

bacterial population– Prevent infections

quickly and over time

Source: Kennedy DA and Read A. Why the evolution of vaccine resistance is less of a concern than the evolution of drug resistance. PNAS 2018 115:51 12879. Adapted with permission of the authors. *Quote from Andrew Reed.

Requires collaborative global response from all stakeholders: – scientific community– pharmaceutical sector– policy-makers– healthcare funders

Increase awareness of role of vaccines in addressing AMR

31

Develop innovative AMR-relevant vaccines aimed at preventing infections where target pathogens are likely to drive antimicrobial use and resistance (e.g. Shigellosis, Tuberculosis, Malaria, Meningococcus, Pneumococcus, COPD, RSV, Flu Universal, MRSA, Gonorrhea, HSV, candidiasis, C. difficile, Klebsiella,

Pseudomonas)

New, global initiatives for R&D of new drugs and vaccines being deployed

Developing innovative AMR-relevant vaccines

32

1950-70 golden period for antibiotics 1980-today golden period for vaccines

33Bloom, Black Salisbury and Rappuoli. PNAS 2018:115;12870

Vaccine technology has been revolutionised in the past 30 years

Rappuoli R et al. Nat Rev Immunol 2011;11:865–872

Adapted by permission from Macmillan Publishers Ltd: Nat Rev Immunol, Rappuoli R et al., Nov 4;11(12):865-72. doi: 10.1038/nri3085, copyright 2011

Waves of new technologies have enabled the development of vaccines that were previously not possible

and led to improvements invaccine safety

Next-generation technologies

New/improved adjuvants, structural vaccinology, synthetic biology

Recombinant DNA

Glycoconjugation

Reverse vaccinology

Empirical approach

34

Potential vaccine game-changing technology

35

Reverse vaccinology

ATTTATACATGAGACAGACAGACCCCCAGAGACAGACCCCTAGACACAGAGAGAGTATGCAGGACAGGGTTTTTGCCCAGGGTGCAGTATG

Adjuvant Systems

Platform Technologies

Synthetic vaccines

(DNA/RNA) Adenoviral

vectors

Structural vaccinology

Research / Preclinical Phase I Phase II Phase III Marketed Total

Path

ogen

nam

e

Acinetobacter baumannii 0 0 0 0 0 0

Campylobacter 3 1 0 0 0 4

Enterobacteriaceae 0 0 0 0 0 0

Enterococcusfaecium 0 0 0 0 0 0

Escherichia coli (enteric) 11 2 3 1 1 18

Escherichia coli (urinary) 1 1 1 0 0 3

Haemophilus influenzae 8 1 2 3 46 60

Helicobacter pylori 9 1 0 0 0 10

Klebsiella pneumoniae 3 0 0 0 0 3

Mycobacterium tuberculosis 25 4 8 2 13 52

Neisseria gonorrhoeae 4 0 0 0 0 4

Pseudomonas aeruginosa 4 0 0 0 0 4

Salmonella (non-typhoidal) 5 0 0 0 0 5

Salmonella Paratyphi 2 1 0 1 0 4

Salmonella Typhi 6 2 2 2 20 32

Shigella 15 2 2 0 0 19

Staphylococcus aureus 23 2 2 0 0 27

Streptococcus pneumoniae 31 7 8 3 7 56

36https://vaccinesforamr.org/review-of-pathogens/vaccine-pipeline-information/ accessed May 5, 2019 - vaccines for AMR.org

The pipeline for AMR vaccines is thinInnovation

Technologies to develop vaccines for AMR:

Sustainability of vaccine development for AMR:

Not the major challenge

The major challenge

37

Call to action:

38

• Increase funding, broaden points of access • Encourage greater use existing vaccines • Increase AMR education, awareness

Increase Uptake of Today’s Vaccines

• Attribute AMR-related value in regulatory submissions • Consider market-based incentives where needed

Incentivize Development of New

AMR Vaccines

• Surveillance, research inform policy maker decision-making• AMR-sensitive economic models for vaccines

Build the Evidence Base

The role of vaccines to combat AMR

‒ AMR is difficult for antibiotics alone

– Vaccines and Antibioticstogether have a betterchance to control AMR

‒ By joining forces we can control AMR

Source: Bloom et al, Antimicrobial resistance and the role of vaccines. PNAS 2018 115:51 12869. Adapted with permission of the authors.

The Role of Vaccines to Combat Antimicrobial Resistance (AMR)Leonard Friedland, MD, FAAPVice President and Director, Scientific Affairs and Public Health GSK Vaccines

Immunize Nebraska

August 7, 2020

Discussion