The Role of Vaccines to Combat Antimicrobial Resistance (AMR)Leonard Friedland, MD, FAAPVice President and Director, Scientific Affairs and Public Health GSK Vaccines
Immunize Nebraska
August 7, 2020
Disclosure
Employed by GSK where I am a vaccine research physician scientist
Presentation at the invitation of Dr. Meera Varman, Professor, Pediatric Infectious Diseases, Creighton University School of Medicine
Presentation is for educational purposes only; this is not a sales, marketing or promotional presentation
Content of presentation will not include unapproved or investigational uses of products or devices
The value of vaccines
Sources: 1. WHO, UNICEF, World Bank. State of the world’s vaccines and immunization, 3rd ed. Geneva, World Health Organization, 2009., p.12; 2. Ehreth J, “The global value of vaccination” in Vaccine 2003 Jan 30; 21 (7-8):596-600. 3. Stack et al, ‘Estimated Economic Benefits During The ‘Decade of Vaccines’ Include Treatment Savings, Gains in LaborProductivity’, Health Affairs, 30, 6 (2011): 1021-1028 4. Ozawa S. et al, “Return on investment from childhood immunisation in low- and Middle-Income countries, 2011-20”, in Health Affairs, 35, 2 (2016): 199-207
2-3m²deaths prevented every year by vaccination
750,000²children saved from disability every year
$150bn³the benefit of vaccines to lowand middle-income countries over the next 10 years
x444
is the estimated return on Investment of the cost of immunization
Only clean drinking water rivals vaccination in its ability to save lives1
3
Scientific knowledge advances and modern vaccine technologies offer great potential for new vaccine development:
• uncommon and/or emerging diseases imparting significant morbidity & mortality• patient populations small in number yet at risk of clinically important medical
and healthcare-associated infections• personalized vaccines based on subpopulation or individual genetic information• AMR-relevant vaccines aimed at preventing target pathogens likely to drive
antimicrobial use and resistanceNew vaccines need to be discovered, developed through to commercialization, and implemented through evidence-based vaccination policy recommendations
Driving the potential of new vaccines to transform human health
4
Discovering innovative technologies and developing new vaccines: time, human, capital resource intensive, risky
Formulating vaccine policy decisions: broad view, beyond direct health and economic benefits
Evaluate:– Moral, social, ethical impact of vaccines, integrated alongside other societal
health interventions and programmatic synergies– Health equity, justice, community health gains, improved healthcare system
function, societal economic health– Impacts related to reduced antibiotic use and antibiotic resistance.
Need for comprehensive approach to realize full potential and impact
5
6Sapiens-A Brief History of Humankind. Yuval Noah Harari. Harper Collins 2015, pp. 3, 50-51, 268-269
For 99.9% of the history of mankind, life expectancy was <40 yearsAverage life expectancy of early Homo sapiens was apparently 25-40 years
Improved health and increased life expectancy: an achievement of civilization In the last 2 centuries things have changed beyond recognition. Pills, injections and sophisticated operations save us from a spate of illnesses that once dealt an inescapable death sentence. The average life expectancy jumped from around 25-40 years, to 67 in the entire world, and to around 80 in the developed world.
Top 10 Causes of Death 1900 2010
7NEJM 2012:366;2333-2338
Data are from the Centers for Disease Control and Prevention
Etiology No deaths/100,000 Etiology No deaths/100,000
Pneumonia or influenza 202.2 Heart disease 192.9
TB 194.4 Cancer 185.9
GI infections 142.7 Noninfectious airway dis 44.6
Heart disease 137.4 Cerebrovascular dis 41.8
Cerebrovascular dis 106.9 Accidents 38.2
Nephropathies 88.6 Alzheimer’s dis 27.0
Accidents 72.3 Diabetes 22.3
Cancer 64.0 Nephropathies 16.3
Senility 50.2 Pneumonia or influenza 16.2
Diphtheria 40.3 Suicide 12.2
Antibiotics
The discovery of antibiotics is one of the greatest medical advances of the 20th
century
Modern medicine is made possible by our ability to treat, and prevent, infection: transplantation, neonatal care, complex surgeries, joint replacement, caesarian sections, oncology treatment, …
8
Antibiotics
Unfortunately, their use has created an evolutionary response from microbes, and these gains in healthcare are under threat from AMR
9
Timeline: some key events of antibiotic resistance development
10Adapted from Ventola CL. P&T 2015; 40: 277-83
1943 Penicillin1940Penicillin-R Staphylococcus
1960
1985
2010
1962
1987
1998
2011
1950 Tetracycline
Methicillin
Imipenem & Ceftazidime
Ceftaroline
1959Tetracycline-R Shigella
Methicillin-R Staphylococcus
Ceftazidime-R Enterobacteriaceae
Imipenem-R Enterobacteriaceae
Ceftaroline-R Staphylococcus
Antibiotic introducedAntibiotic resistance identified
These events were predicted
11
Stanley Falkow (1934-2018) discovered the molecular mechanisms through which bacteria cause disease and predicted the rise of multidrug-resistant bacteria
By the 1970s he predicted that overuse of antibiotics would soon lead to drug resistance and the loss of their utility
Falkow already had plenty of evidence to base his predictions on
His recommendation to stop the use of antibiotics in animals was not implemented by the US authorities
Science 08 Jun 2018:Vol. 360, Issue 6393, pp. 1077 http://science.sciencemag.org/content/360/6393/1077
– Multidrug resistant organisms increasingly common, extremely difficult to treat
– Now encountering infections that are untreatable
– Major contributor: over-prescription of current antibiotics in animals and humans
The IssueAntimicrobial Resistance (AMR)
12
13
Overuse of antibiotics is prevalent1
14
Even when access to antibiotics is restricted by a prescription system, much of the use is unnecessary
Partly, this is because it is hard to know what’s necessary at the time prescribing happens
1. O'Neill, J. (2016). The Review on Antimicrobial Resistance. Final Report and Recommendations. London: Wellcome Trust on behalf of HM Government. https://amr-review.org/sites/default/files/160525_Final%20paper_with%20cover.pdf (page 39)
Misuse of antibiotics is also prevalent1
151. O'Neill, J. (2016). The Review on Antimicrobial Resistance. Final Report and Recommendations. London: Wellcome Trust on behalf of HMGovernment. https://amr-review.org/sites/default/files/160525_Final%20paper_with%20cover.pdf (page 54)
But it is important to understand that even if used appropriately, antibiotic resistance will arise
It is a natural and predictable consequence of actually using antibiotics
All we can do is slow it down
Serious, growing threat to public health and economy
AMR: an imperative for all stakeholders
16O’Neill J. The review on antimicrobial resistance (2016). https://amr-review.org/sites/default/files/160518_Final%20paper_with%20cover.pdf
If current trend holds:
by 2050, ~10 million AMR deaths globally, world GDP reduced up to 2-3.5%
0
1000000
2000000
3000000
4000000
5000000
6000000
7000000
8000000
9000000
Tetanus(60.000)
Cholera(120.000)
Measles(130.000)
Roadaccidents
(1.2M)
Diarrhealdis (1.4M)
Diabetes(1.5M)
Cancer(8.2M)
Drugresistantinfections(700.000)
Deaths annually global, current: Drug resistant infections:
▪ 50,000 US/EU▪ globally >700,000
“A problem so serious that it threatens the achievements of modern medicine” – WHO
International travel has created new opportunities for antimicrobial-resistant diseases to be spread globally2
Antimicrobial use is rising across the world, with global consumption of antibiotics increasing by nearly 40% between 2000 and 2010
Predictions of possible future risks
Antibiotics are “the bedrock of modern medicine” since widespread use in the 1940s
“We have reached a critical point and must act now on a global scale to slow down antimicrobial resistance” –Professor Dame Sally Davies, UK Chief Medical Officer
1
2
2
2
1. WHO:http://apps.who.int/iris/bitstream/handle/10665/112642/9789241564748_eng.pdf;jsessionid=40BECF8DD7E6DA5F7BB23C7585D88E2A?sequence=1
2. https://amr-review.org
– Problem attracting global attention– Most proposed solutions focus on development of new technologies:
• Antibiotics• Rapid diagnostic tests• Vaccines
Worst case scenario: “post antimicrobial era”
18
19
AMR is difficult for antibiotics alone
Bloom, Black Salisbury and Rappuoli. PNAS 2018:115;12869
The number of new antibiotics developed and approved has decreased over the past decades
20Adapted from Ventola CL. P&T 2015; 40: 277-83
0
2
4
6
8
10
12
14
16
18
20
1980-1984 1985-1989 1990-1994 1995-1999 2000-2004 2005-2009 2010-2014 2015-2019
19
11 11 11
43
7
12
number of new antibiotics
WHO list of bacteria for which new antibiotics are urgently needed (2017)WHO priority pathogens list for R&D of new antibiotics. Geneva 2017. http://www.who.int/mediacentre/news/releases/2017/bacteria-tianbiotics-needed/en/
WHO priority pathogens list for R&D of new antibiotics. Geneva 2017. http://www.who.int/mediacentre/news/releases/2017/bacteria-tianbiotics-needed/en/ [accessed 5 May 2019].
21
CDC - Antibiotic resistance threats in the United States (2019)CDC. Antibiotic resistance threats in the United States. 2019. Atlanta. GA: US Department of Health and Human Services, CDC; 2019.https://www.cdc.gov/drugresistance/biggest-threats.html
– Problem attracting global attention; most proposed solutions focus on development of new technologies: antibiotics, rapid diagnostic tests, and vaccines
– Role of vaccination in controlling AMR frequently acknowledged, yet not led to concrete changes in policy or resourcing
Worst case scenario: “post antimicrobial era”
22
23
Bloom, Black Salisbury and Rappuoli. PNAS 2018:115;12869
Vaccines combat AMR in two ways
Vaccine
Antibiotic use
Antibiotic resistant infection
2INDIRECT
1DIRECT
1. Prevent infection, carriage and spread
of resistant organisms
2. Reduce antibiotic use and therefore
selective pressure
Bacterial infections are major drivers of antibiotic prescribingVaccines to prevent bacterial infections reduce antibiotic use– vaccines for diphtheria, meningitis, pneumonia and pertussis have protected tens of
millions of individuals from these bacterial infections
Non-bacterial infections can trigger inappropriate use of antibiotics – vaccines for non-bacterial infections, such as influenza and rotavirus, avoid diseases that
can trigger inappropriate use of antibiotics
Preventing infections to reduce society’s dependence on ABX
25
26
Before Hib introduction
After Hib introduction
Global incidence of disease: 3.5-601 cases/100,000 children ≤5 yo 1
Canada: 2.6 cases/100,000 (1987-88) 2
Global prevalence of β-lactamase positive strains: 16.6 % 3
Type of study
1. Peltola H et al. Rev Infect Dis 1990; 12: 708-715. 2, Public Health Agency of Canada, 2017. https://www.canada.ca/en/public-health/services/publications/healthy-living/vaccine-preventable-disease-surveillance-report-december-31-2015.html?wbdisable=true [accessed 17 Feb. 2018] 3. Hoban D & Felmingham D. J Antimicrob Chemother 2002; 50: 49-59,. 4. Jansen KU et al. Nature Med 2018; 24: 10-20 5, Heilmann KP et al. Antimicrob Agents Chemother 2005; 49: 2561-4.
Haemophilus influenzae type b vaccines (Hib)
Decrease of global incidence of disease and of nasopharyngeal carriage 4
Canada: 0.08 cases/100,000 (2011-15) 2
Rapid decrease of β-lactamase positive strains 5
Hib: Haemophilus influenzae type b
Impact of pneumococcal conjugate vaccine on incidence of Penicillin-nonsusceptible IPD (USA)
27
Hampton LM et al. J Infect Dis 2012; 205: 401-11. 2. Kyaw MH et al. N Engl J Med 2006; 354: 1455-63
0
2
4
6
8
10
12
14
< 5 yo 5-17 yo 18-49 yo ≥ 65 yo
Incidence of penicillin-nonsusceptible S. pneumoniae strainsassociated with invasive pneumococcal disease by age group,
USA
1998-1999 2008
IPD: invasive pneumococcal disease. PCV7 vaccine was introduced in 2000.
Cas
es p
er 1
00,0
00 p
opul
atio
n -64%
-45%
-50%-17%
81%Reduction on penicillin nonsusceptible
IPD in children < 2 years 2
28
Impact of pneumococcal conjugate vaccine on antibioticprescription in USA
35% Reduction of
antibiotic use after PCV
introduction1 1.4 millionantibiotic
prescriptions/year are preventable with PCV in
USA 1
1. Fireman B et al. Pediatr Infect Dis J 2003; 22: 10-16.
29
Impact of universal influenza vaccination on antibiotic prescription
1. Neuzil KM et al. N Engl J Med 2000; 342: 225-31. 2. Kwong JC et al. Clin Infect Dis 2009; 49: 750-6.
3-9% of antibioticcourses are
attributable to influenza#1
64%decrease in influenza-associated respiratory
antibiotic prescriptions after
UIIP* in Ontario2
# Children, USA. * UIIP: universal influenza immunization program (offered to everyone ≥ 6 months of age). Overall vaccine uptake in Ontario: 38%.
“Vaccines are evolution proof, drugs are not.”*
Drugs– One target– Work on a big bacterial
population with highnumbers to generatediversity and resistance
Vaccines– Many targets /epitopes– Control a small
bacterial population– Prevent infections
quickly and over time
Source: Kennedy DA and Read A. Why the evolution of vaccine resistance is less of a concern than the evolution of drug resistance. PNAS 2018 115:51 12879. Adapted with permission of the authors. *Quote from Andrew Reed.
Requires collaborative global response from all stakeholders: – scientific community– pharmaceutical sector– policy-makers– healthcare funders
Increase awareness of role of vaccines in addressing AMR
31
Develop innovative AMR-relevant vaccines aimed at preventing infections where target pathogens are likely to drive antimicrobial use and resistance (e.g. Shigellosis, Tuberculosis, Malaria, Meningococcus, Pneumococcus, COPD, RSV, Flu Universal, MRSA, Gonorrhea, HSV, candidiasis, C. difficile, Klebsiella,
Pseudomonas)
New, global initiatives for R&D of new drugs and vaccines being deployed
Developing innovative AMR-relevant vaccines
32
1950-70 golden period for antibiotics 1980-today golden period for vaccines
33Bloom, Black Salisbury and Rappuoli. PNAS 2018:115;12870
Vaccine technology has been revolutionised in the past 30 years
Rappuoli R et al. Nat Rev Immunol 2011;11:865–872
Adapted by permission from Macmillan Publishers Ltd: Nat Rev Immunol, Rappuoli R et al., Nov 4;11(12):865-72. doi: 10.1038/nri3085, copyright 2011
Waves of new technologies have enabled the development of vaccines that were previously not possible
and led to improvements invaccine safety
Next-generation technologies
New/improved adjuvants, structural vaccinology, synthetic biology
Recombinant DNA
Glycoconjugation
Reverse vaccinology
Empirical approach
34
Potential vaccine game-changing technology
35
Reverse vaccinology
ATTTATACATGAGACAGACAGACCCCCAGAGACAGACCCCTAGACACAGAGAGAGTATGCAGGACAGGGTTTTTGCCCAGGGTGCAGTATG
Adjuvant Systems
Platform Technologies
Synthetic vaccines
(DNA/RNA) Adenoviral
vectors
Structural vaccinology
Research / Preclinical Phase I Phase II Phase III Marketed Total
Path
ogen
nam
e
Acinetobacter baumannii 0 0 0 0 0 0
Campylobacter 3 1 0 0 0 4
Enterobacteriaceae 0 0 0 0 0 0
Enterococcusfaecium 0 0 0 0 0 0
Escherichia coli (enteric) 11 2 3 1 1 18
Escherichia coli (urinary) 1 1 1 0 0 3
Haemophilus influenzae 8 1 2 3 46 60
Helicobacter pylori 9 1 0 0 0 10
Klebsiella pneumoniae 3 0 0 0 0 3
Mycobacterium tuberculosis 25 4 8 2 13 52
Neisseria gonorrhoeae 4 0 0 0 0 4
Pseudomonas aeruginosa 4 0 0 0 0 4
Salmonella (non-typhoidal) 5 0 0 0 0 5
Salmonella Paratyphi 2 1 0 1 0 4
Salmonella Typhi 6 2 2 2 20 32
Shigella 15 2 2 0 0 19
Staphylococcus aureus 23 2 2 0 0 27
Streptococcus pneumoniae 31 7 8 3 7 56
36https://vaccinesforamr.org/review-of-pathogens/vaccine-pipeline-information/ accessed May 5, 2019 - vaccines for AMR.org
The pipeline for AMR vaccines is thinInnovation
Technologies to develop vaccines for AMR:
Sustainability of vaccine development for AMR:
Not the major challenge
The major challenge
37
Call to action:
38
• Increase funding, broaden points of access • Encourage greater use existing vaccines • Increase AMR education, awareness
Increase Uptake of Today’s Vaccines
• Attribute AMR-related value in regulatory submissions • Consider market-based incentives where needed
Incentivize Development of New
AMR Vaccines
• Surveillance, research inform policy maker decision-making• AMR-sensitive economic models for vaccines
Build the Evidence Base
The role of vaccines to combat AMR
‒ AMR is difficult for antibiotics alone
– Vaccines and Antibioticstogether have a betterchance to control AMR
‒ By joining forces we can control AMR
Source: Bloom et al, Antimicrobial resistance and the role of vaccines. PNAS 2018 115:51 12869. Adapted with permission of the authors.
The Role of Vaccines to Combat Antimicrobial Resistance (AMR)Leonard Friedland, MD, FAAPVice President and Director, Scientific Affairs and Public Health GSK Vaccines
Immunize Nebraska
August 7, 2020
Discussion