the c terminus of hepatitis c virus ns4a encodes an ...jvi.asm.org/content/81/17/8905.full.pdf ·...

JOURNAL OF VIROLOGY, Sept. 2007, p. 8905–8918 Vol. 81, No. 170022-538X/07/$08.00�0 doi:10.1128/JVI.00937-07Copyright © 2007, American Society for Microbiology. All Rights Reserved.

The C Terminus of Hepatitis C Virus NS4A Encodes an ElectrostaticSwitch That Regulates NS5A Hyperphosphorylation and

Viral Replication�

Brett D. Lindenbach,1†* Bela M. Pragai,1‡ Roland Montserret,2 Rudolf K. F. Beran,3 Anna M. Pyle,3Francois Penin,2 and Charles M. Rice1*

Center for the Study of Hepatitis C, The Rockefeller University, 1230 York Ave., New York, New York 100211; Institut de Biologie etChimie des Proteines, CNRS-UMR 5086, IFR128 BioSciences Gerland-Lyon Sud, University of Lyon, 7 Passage de Vercors,

Lyon F-69367, Cedex 07, France2; and Department of Molecular Biophysics and Biochemistry,Yale University, New Haven, Connecticut 065203

Received 1 May 2007/Accepted 14 June 2007

Hepatitis C virus (HCV) nonstructural protein 4A (NS4A) is only 54 amino acids (aa) in length, yet it is akey regulator of the essential serine protease and RNA helicase activities of the NS3-4A complex, as well as adeterminant of NS5A phosphorylation. Here we examine the structure and function of the C-terminal acidicregion of NS4A through site-directed mutagenesis of a Con1 subgenomic replicon and through biophysicalcharacterization of a synthetic peptide corresponding to this region. Our genetic studies revealed that in 8 ofthe 15 C-terminal residues of NS4A, individual Ala substitutions or charge reversal substitutions led to severereplication phenotypes, as well as decreased NS5A hyperphosphorylation. By selecting for replication-compe-tent mutants, several second-site changes in NS3 were identified and shown to suppress these defects inreplication and NS5A hyperphosphorylation. Circular-dichroism spectroscopy and nuclear magnetic reso-nance spectroscopy on a peptide corresponding to the C-terminal 19 aa of NS4A revealed that this region canadopt an alpha-helical conformation, but that this folding requires neutralization of a cluster of acidicresidues. Taken together, these data suggest that the C terminus of NS4A acts as a dynamic regulator ofNS3-4A interaction, NS5A hyperphosphorylation, and HCV replicase activity.

Hepatitis C virus (HCV) is an enveloped, positive-strandRNA virus in the family Flaviviridae. The viral genome is anuncapped, nonpolyadenylated, 9.6-kb RNA that encodes along open reading frame of �3,011 codons (reviewed in ref-erences 2 and 43). This translation product is processed by viraland host proteases into at least 10 distinct products. The N-terminal one-third of the genome encodes the viral structuralproteins (C, E1, and E2), followed by a small ion channelprotein, p7, and the nonstructural (NS) proteins NS2, NS3,NS4A, NS4B, NS5A, and NS5B (Fig. 1A). In addition, a smallprotein of unknown function, F for frame shift, may be trans-lated from an alternative reading frame within the C gene(reviewed in reference 9).

HCV encodes two essential proteases, i.e., the NS2 cysteineautoprotease, which cleaves at the NS2/3 junction, and theNS3-4A serine protease, which is responsible for cleavage atthe NS3/4A, NS4A/4B, NS4B/NS5A, and NS5A/NS5B junc-

tions (reviewed in references 2 and 43). In addition to its rolein viral polyprotein processing, the NS3-4A serine protease candownregulate the host innate antiviral response (22) by cleav-ing the cellular proteins TRIF (37) and IPS-1 (also known asMAVS, VISA, or Cardif) (38, 41, 45, 47). Additional cellularsubstrates of the NS3-4A serine protease have not been de-scribed.

NS3-4A is a bifunctional enzyme; the N-terminal one-thirdof NS3 encodes the serine protease domain, while the C-terminal region of NS3 encodes an RNA helicase/nucleosidetriphosphatase domain (reviewed in reference 54). Full activityof both enzymes requires interaction between the serine pro-tease domain and the viral NS4A protein, which contributesone strand of the first �-barrel in the chymotrypsin-like fold (4,19, 30, 39, 53, 70).

At 54 amino acids (aa), NS4A is the smallest NS protein, yetit has multiple functions in the viral life cycle. The hydrophobicN-terminal region of NS4A is responsible for anchoring theNS3-4A complex to the endoplasmic reticulum and mitochon-drial outer membrane (50, 52, 64, 68). As mentioned, thecentral region of NS4A serves as the serine protease cofactor(4, 19, 39). NS4A also augments NS3 RNA helicase activity,perhaps via interactions between the helicase and serine pro-tease domains (23, 35, 53). Although it is unclear whetherNS4A is found outside of the NS3-4A complex in HCV-in-fected cells, overexpression of free NS4A inhibits translation(21, 29, 34) and can lead to mitochondrial damage (52). Fur-thermore, the hyperphosphorylation of NS5A is dependent onNS4A expression (3, 28, 64), and mutations in NS3, NS4A, orNS4B can alter NS5A hyperphosphorylation (31). The mech-

* Corresponding author. Mailing address for Brett Lindenbach: Sec-tion of Microbial Pathogenesis, Yale University School of Medicine,354C BCMM, 295 Congress Ave., New Haven, CT 06536. Phone: (203)785-4705. Fax: (203) 737-2630. E-mail: [email protected] address for Charles M. Rice: Center for the Study of HepatitisC, The Rockefeller University, 1230 York Ave., New York, NY 10021.Phone: (212) 327-7054. Fax: (212) 327-7048. E-mail: [email protected].

† Present address: Section of Microbial Pathogenesis, Yale Univer-sity School of Medicine, New Haven, CT 06536.

‡ Permanent address: Department of Microbiology, Albert Szent-Gyorgyi Medical University, Szeged, Hungary.

� Published ahead of print on 20 June 2007.

8905

on April 16, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

anisms of these additional NS4A activities are unknown butmay involve interactions between NS4A and NS4B, NS5A,NS5B, and uncleaved NS4B-5A (15, 26, 40).

While the membrane-anchoring and serine protease cofac-tor activities are encoded within the first 34 aa of NS4A, verylittle is known about the downstream region of this protein. Tofurther clarify the role of the C-terminal acidic region ofNS4A, we examined its function through site-directed mu-tagenesis of an HCV genotype 1b subgenomic replicon andshow that the C-terminal region of NS4A has an important rolein HCV RNA replication. Further analysis of these mutantsrevealed additional genetic interactions between NS4A andNS3. To understand the structural basis of these effects, theC-terminal 19 aa of NS4A was examined through circular-dichroism (CD) spectroscopy and nuclear magnetic resonance(NMR) spectroscopy. These data indicated that the C terminusof NS4A can undergo pH-dependent folding into an alphahelix, suggesting that its folding may be induced by interactionwith a positively charged surface in the context of the viralreplicase.

MATERIALS AND METHODS

Abbreviations used in this report. The following abbreviations are used in thisreport: Bsd, blasticidin S deaminase; DM, n-dodecyl-�-D-maltoside; DPC, dode-cyl phosphocholine; HPLC, high-performance liquid chromatography; NOE,nuclear Overhauser enhancement; HSQC, heteronuclear single-quantum corre-

lation; NOESY, NOE spectroscopy; SDS, sodium dodecyl sulfate; TFE, 2,2,2-trifluoroethanol; TOCSY, total correlation spectroscopy.

Replicon constructs. Standard molecular biology methods were used through-out (60). Plasmid sequences were verified by dye-labeled DNA sequencing atThe Rockefeller DNA Sequencing Facility. Con1b/SG-Bsd(I) and Con1b/SG-Bsd(T) are subgenomic replicons that express the blasticidin S resistance gene(Bsd) and contain the cell culture-adaptive mutations S2204I and A2199T, re-spectively (7). These replicons (and their derivatives) were transcribed fromScaI-linearized plasmids pBDL429P�S�/BBvii and pBDL429P�S�/BBix, re-spectively. Both plasmids were derived from the Bsd-expressing, S2204I-contain-ing Con1 replicon plasmid previously described (17). However, to facilitatecloning, these constructs were engineered to contain useful restriction sites bysilent mutagenesis. Specifically, a unique SacII site was introduced near thebeginning of the NS3 gene by silent mutation of codon 1036 (numbered accord-ing to the Con1 genome, GenBank accession no. AJ238799) from ACG to ACCand codon 1037 from CGA to CGC. Similarly, a unique PmeI site was introducedinto the middle of the NS3 gene by mutating codons 1411 to 1413 from GGACTC AAT to GGT TTA AAC, and a unique SpeI site was introduced at thebeginning of the NS4A gene in two steps. First, unique SpeI and XbaI sites in thevector backbone were sequentially destroyed by cleavage with each enzyme,filling in with the Klenow fragment of DNA polymerase I, and religation. Codon1661 was then mutated from GTG to GTA, and codon 1662 was mutated fromCTG to CTA. Finally, a unique AflII site was introduced into the variable regionof the 3� noncoding region by mutating nucleotide 9392 from C to T andnucleotide 9393 from C to A (G. Randall and C. M. Rice, unpublished data).These alterations had no discernible effects on HCV RNA replication or blas-ticidin S-resistant colony formation. Con1b/SG-Bsd(Pol�) was derived frompBDL429P�S�(I) by subcloning the polymerase active-site mutations GDD toAAG (7).

Mutations were introduced into NS4A as follows. First, an intermediate con-struct, pSLH1b3453-6534PX, was constructed by subcloning the 3,407-bp SstII/

FIG. 1. Overview of NS4A. (A) HCV genome and polyprotein-processing strategy. Structural genes are light gray, and NS proteins are white.Cleavage sites are indicated by an open bullet (signal peptide peptidase), closed bullets (signal peptidase), an open arrow (NS2 cysteine protease[CYS PROT]), and closed arrows (NS3-4A serine protease [SER PROT]). HEL, RNA helicase; RdRP, RNA-dependent RNA polymerase.(B) Sequence alignment of NS4A from several HCV isolates. The isolate name and genotype are indicated to the left and right of each sequence,respectively. Numbers above the alignment indicate positions within the polyprotein of the Con1 strain. Within the alignment, periods indicatepositions with identity to Con1. (C) Secondary-structure predictions of NS4A are indicated as extended (E), helical (H), or undetermined (blank).Numbers above the predictions indicate positions within the NS4A protein. Predictions were made by using the web-based algorithms PHD (58),PSI-PRED (10), JPred (14), and PROF (59).

8906 LINDENBACH ET AL. J. VIROL.


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

MluI fragment of pBSL429P�S�/BBvii into similarly digested pSL1180 (Phar-macia, Piscataway, NJ). pSLH1b3453-6534PX was then used as a template forsite-directed mutagenesis of the corresponding NS4A residues in QuikChangereactions according to the manufacturer’s suggestions (Stratagene, La Jolla, CA)with appropriate primer pairs (Table 1). After sequence confirmation, the mu-tations were subcloned back into pBSL429P�S�/BBvii or pBSL429P�S�/BBixby using SstII and MluI as described above.

Cell culture and RNA transfection. Huh-7.5 cells (8) were maintained inDulbecco’s modified Eagle medium containing 10% fetal calf serum and 1 mMnonessential amino acids (all from Invitrogen [Carlsbad, CA]). Cells were trans-fected by electroporation as previously described (42). To monitor Bsd trans-duction efficiency, replicon-transfected cells were serially diluted into cells thathad been transfected with the replication-defective control replicon Con1b/SG-Bsd(Pol�). Cells were then seeded at a density of 6 � 105/10-cm dish. Four daysafter transfection, the medium was changed to the above medium containing 3�g/ml blasticidin S (Invivogen, San Diego, CA) and cells were maintained bychanging the blasticidin S-containing medium every third or fourth day. Colony-forming activity was assessed after 3 weeks of selection by fixing the cells informalin, staining them with crystal violet (1% [wt/vol] in 20% ethanol), andcalculating the efficiency of colony formation.

Identification of suppressor mutations. Blasticidin S-resistant colonies wereisolated by trypsinization in cloning cylinders and expanded in blasticidin S-containing medium. Total RNA was extracted by using 0.75 ml TRIzol (Invitro-gen, Carlsbad, CA) per 9.4-cm2 well on a six-well plate, according to the man-ufacturer’s instructions. RNA was resuspended to 250 ng/�l in 2 mM sodiumcitrate, pH 6.5. Random-primed cDNAs were synthesized by using randomhexamers and Superscript II (Invitrogen) at 50°C for 1 h, followed by a 15-mindigestion at 37°C with RNase H. cDNAs were cleaned up by using QIAquickPCR spin columns and eluted into 50 �l elution buffer (QIAGEN, Valencia,CA). DNA was amplified with Klentaq LA (DNA Polymerase Technology, Inc.,St. Louis, MO), 5 �l of purified cDNA, 400 nM each primer, and 200 nM eachdeoxynucleoside triphosphate, according to the manufacturer’s instructions. Theprimers used for each PCR are listed in Table 2. PCR products were purifiedwith QIAquick as described above and adjusted to 8.5 ng/�l. Population sequenc-ing was performed on the PCR products with region-specific primers at TheRockefeller University DNA Sequencing Core Facility. To reconstruct repliconscontaining second-site mutations, PCR products were cloned into pCR2.1-TOPO (Invitrogen), their sequences were verified, and the corresponding re-gions were subcloned back into pBSL429P�S�/BBvii or pBSL429P�S�/BBixby using common restriction sites.

Protein expression. Huh-7.5 cells were seeded in six-well plates and infectedfor 1 h at a multiplicity of infection of 10 with the T7 RNA polymerase-express-ing vaccinia virus vTF7-3 (24). The medium was changed to OptiMEM (Invitro-gen), and cells were transfected with 1 �g of EcoRI-linearized, replicon-contain-ing plasmids and 8 �l FuGENE 6 (Roche, Indianapolis, IN), according to themanufacturer’s recommendations. Eight to 12 h later, the cells were lysed in 0.2ml sample buffer (100 mM Tris [pH 6.8], 20 mM dithiothreitol, 4% [wt/vol] SDS,20% [vol/vol] glycerol, 0.2% [wt/vol] bromophenol blue) and homogenized byfive passes through a 22-gauge needle. Samples (10 �l each) were denatured byboiling, resolved on SDS-polyacrylamide gels, and transferred to Immobilon Pmembranes (Millipore, Bedford, MA). Membranes were blocked with TBS-T (20mM Tris [pH 7.4], 150 mM NaCl, 0.1% [vol/vol] Tween 20 [polyoxyethylenesorbitan monolaurate]) containing 5% (wt/vol) dry milk and probed with thisblocking buffer containing primary monoclonal antibodies against NS3 (7019from Maine Biotech; now available as 1878 from ViroStat, Portland, ME), NS4B(4B-52) (25), NS5A (9E10) (42), NS5B (3B1.5.3) (49), or �-actin (AC-15; Sigma,St. Louis, MO). Following several washes with TBS-T, membranes were probedwith horseradish peroxidase-conjugated secondary antibodies and washed re-peatedly, and antigens were detected with SuperSignal West Pico Chemilumi-nescent Substrate (Pierce, Rockford, IL).

NS4A[36-54] peptide. A peptide corresponding to NS4A residues 36 to 54(Con1 strain residues 1693 to 1711), AIIPDREVLYREFDEMEEC, was synthe-sized at The Rockefeller University Protein Resource Center. This peptidecontained an N-terminal biotin group and a C-terminal amide group, the latterto help stabilize the terminal Cys. The peptide was purified by HPLC with agradient of 1 to 60% acetonitrile, and its mass was confirmed by mass spectrom-etry at the Protein Resource Center.

CD. CD spectra were recorded on a Jobin Yvon CD6 spectrometer calibratedwith 1S-(�)-10-camphorsulfonic acid. Measurements were carried out at roomtemperature in a 0.1-cm path length quartz cuvette (Hellma, Mullheim, Ger-many), with peptide concentrations ranging from 35 to 60 �M. Spectra wererecorded in the 190- to 250-nm wavelength range with a 0.2-nm increment and a2-s integration time. Spectra were processed with CD6 software, baseline cor-

rected, and smoothed by using a third-order least-square polynomial fit. Spectralunits were expressed as the molar ellipticity per residue by using peptide con-centrations determined by measuring the UV light absorbance of tyrosine at 280nm (molar extinction coefficient of 1,536 M�1 � cm�1). The alpha-helical con-tent was estimated at 222 nm by using the empirical equation of Chen et al. (13)as detailed previously (48) with a calculated theoretical molar ellipticity of�34,160° � cm2 � dmol�1 for 100% helical conformation for the peptide in thevarious media.

NMR spectroscopy. Three milligrams of the peptide was dissolved in 50%TFE-d2 (2,2,2-trifluoroethyl-1,1-d2 alcohol, �99% isotopic enrichment). Thefinal peptide concentration was 1.3 mM at pH 3.8. Sodium 2,2-dimethyl-2-silapentane-5-sulfonate was added as an internal reference. Spectra were ac-quired under nonspinning conditions at temperatures of 288 and 298 K. Multi-dimensional NMR experiments were performed on a Varian Unity Plus 500MHz equipped with a triple-resonance 5-mm probe with a self-shielded z gra-dient coil. NOESY (mixing times between 100 and 250 ms), clean-TOCSY(isotropic mixing time of 80 ms), and 1H-13C HSQC experiments were performedwith conventional optimized pulse sequences as detailed previously (20, 48, 55,and references therein). Varian VNMR software was used to collect and processall data, and Sparky (kindly provided by T. D. Goddard and D. G. Kneller,University of California, San Francisco) was used for spectral analysis. Intraresi-due backbone resonances and aliphatic side chains were identified from two-dimensional 1H TOCSY and 1H-13C HSQC. Sequential assignments were de-termined by correlating intraresidue assignments with interresidue cross peaksobserved in two-dimensional 1H NOESY. NMR-derived 1H and 13C chemicalshifts are reported relative to the random coil chemical shifts in TFE (46, 66).

NMR-derived distance constraints and structure calculations. NOE distancesused as input for structure calculations were obtained from the NOESY spec-trum recorded at 288 K with a 150-ms mixing time. NOE intensities werepartitioned into three categories that were converted into distances ranging froma common lower limit of 1.8 Å to upper limits of 2.8 Å, 3.9 Å, and 5.0 Å forstrong, medium, and weak intensities, respectively. The cross-peak intensity ofthe vicinal methylene proton pair of the residue D49 side chain was used as adistance reference (1.7 Å). Because of the lack of resolution mainly due tooverlap of glutamic acid residues, 23 canonical helical distance constraints in theregion from R41 to D49 were added to the 111 distance constraints extractedfrom the NOESY spectrum. No hydrogen bond or dihedral-angle restraints wereintroduced. Protons without stereospecific assignments were treated as pseudo-atoms, and correction factors were added to the upper and lower distanceconstraints (69). Three-dimensional structures were generated from NOE dis-tances by the dynamical simulated annealing protocol with the Xplor-NIH 2.9.7program (61) by using the standard force fields and default parameter sets. A setof 50 structures was initially calculated, from which 47 structures were selectedon the basis of low energy and absence of NOE violations and used to calculatethe average peptide structure.

RESULTS

Mutagenesis of the NS4A C-terminal acidic domain. The Cterminus of NS4A contains a short acidic region that is highlyconserved among diverse HCV isolates (Fig. 1B) and is pre-dicted to form an alpha helix (Fig. 1C). Similar acidic regionsare also found at the NS4A C termini of pestiviruses and GBvirus B (not shown). To examine whether this region isimportant in HCV RNA replication, residues 1697 to 1710(numbered according to the Con1 genome) were individuallymutated to Ala in the context of Con1b/SG-Bsd(I) or Con1b/SG-Bsd(T), Con1-derived subgenomic replicons that expressthe blasticidin S resistance gene (Bsd). These replicons alsocontained cell culture-adaptive mutations in NS5A (S2204I orA2199T, respectively) that permit efficient RNA replication intransfected Huh-7 and Huh-7.5 cells. The C-terminal Cys res-idue of NS4A was not targeted for mutagenesis because thisposition is necessary for NS4A/NS4B cleavage (5, 32, 33, 36,63). Upon transfection into Huh-7.5 cells, several mutantsdemonstrated significant decreases in Bsd transduction effi-ciency (Fig. 2A and B) and HCV RNA accumulation (notshown). The most severe effects were seen with Y1702A,

VOL. 81, 2007 HCV NS4A STRUCTURE AND FUNCTION 8907


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

TABLE 1. Primers used for site-directed mutagenesis of NS4A

Mutation Orientationa Primer Sequenceb

D1697A Fwd RU-O-3389 5�-GCCATCATTCCCGCCAGGGAAGTCCTTTACCG-3�Rev RU-O-3398 5�-CGGTAAAGGACTTCCCTGGCGGGAATGATGGC-3�

R1698A Fwd RU-O-3390 5�-GCCATCATTCCCGACGCCGAAGTCCTTTACCG-3�Rev RU-O-3399 5�-CGGTAAAGGACTTCGGCGTCGGGAATGATGGC-3�

E1699A Fwd RU-O-3391 5�-GCCATCATTCCCGACAGGGCCGTCCTTTACCG-3�Rev RU-O-3400 5�-CGGTAAAGGACGGCCCTGTCGGGAATGATGGC-3�

V1700A Fwd RU-O-4145 5�-TTCCCGACAGGGAAGCCCTTTACCGGGAGTTCGAT-3�Rev RU-O-4159 5�-ATCGAACTCCCGGTAAAGGGCTTCCCTGTCGGGAA-3�

L1701A Fwd RU-O-4146 5�-TTCCCGACAGGGAAGTCGCCTACCGGGAGTTCGAT-3�Rev RU-O-4160 5�-ATCGAACTCCCGGTAGGCGACTTCCCTGTCGGGAA-3�

Y1702A Fwd RU-O-4147 5�-CGACAGGGAAGTCCTTGCCCGGGAGTTCGAT-3�Rev RU-O-4161 5�-ATCGAACTCCCGGGCAAGGACTTCCCTGTCG-3�

R1703A Fwd RU-O-3392 5�-AGGGAAGTCCTTTACGCCGAGTTCGATGAGATGG-3�Rev RU-O-3401 5�-CCATCTCATCGAACTCGGCGTAAAGGACTTCCCT-3�

E1704A Fwd RU-O-3393 5�-AGGGAAGTCCTTTACCGGGCCTTCGATGAGATGG-3�Rev RU-O-3402 5�-CCATCTCATCGAAGGCCCGGTAAAGGACTTCCCT-3�

F1705A Fwd RU-O-4148 5�-ACAGGGAAGTCCTTTACCGGGAGGCCGATGAGATGGAAGAGT-3�Rev RU-O-4162 5�-ACTCTTCCATCTCATCGGCCTCCCGGTAAAGGACTTCCCTGT-3�

D1706A Fwd RU-O-3394 5�-CTTTACCGGGAGTTCGCCGAGATGGAAGAGTGCGCCTCACAC-3�Rev RU-O-3403 5�-GTGTGAGGCGCACTCTTCCATCTCGGCGAACTCCCGGTAAAG-3�

E1707A Fwd RU-O-3395 5�-CTTTACCGGGAGTTCGATGCCATGGAAGAGTGCGCCTCACAC-3�Rev RU-O-3404 5�-GTGTGAGGCGCACTCTTCCATGGCATCGAACTCCCGGTAAAG-3�

M1708A Fwd RU-O-4149 5�-CTTTACCGGGAGTTCGATGAGGCCGAAGAGTGCGCCTCACA-3�Rev RU-O-4163 5�-TGTGAGGCGCACTCTTCGGCCTCATCGAACTCCCGGTAAAG-3�

E1709A Fwd RU-O-3396 5�-GGAGTTCGATGAGATGGCCGAGTGCGCCTCACACCTCCC-3�Rev RU-O-3405 5�-GGGAGGTGTGAGGCGCACTCGGCCATCTCATCGAACTCC-3�

E1710A Fwd RU-O-3397 5�-GGAGTTCGATGAGATGGAAGCCTGCGCCTCACACCTCCC-3�Rev RU-O-3406 5�-GGGAGGTGTGAGGCGCAGGCTTCCATCTCATCGAACTCC-3�

D1697R Fwd RU-O-4136 5�-GCCATCATTCCCCGCAGGGAAGTCCTTTACCG-3�Rev RU-O-4150 5�-CGGTAAAGGACTTCCCTGCGGGGAATGATGGC-3�

R1698D Fwd RU-O-4137 5�-GCCATCATTCCCGACGACGAAGTCCTTTACCG-3�Rev RU-O-4151 5�-CGGTAAAGGACTTCGTCGTCGGGAATGATGGC-3�

E1699R Fwd RU-O-4138 5�-GCCATCATTCCCGACAGGCGCGTCCTTTACCG-3�Rev RU-O-4152 5�-CGGTAAAGGACGCGCCTGTCGGGAATGATGGC-3�

R1703D Fwd RU-O-4139 5�-AGGGAAGTCCTTTACGACGAGTTCGATGAGATGG-3�Rev RU-O-4153 5�-CCATCTCATCGAACTCGTCGTAAAGGACTTCCCT-3�

E1704R Fwd RU-O-4140 5�-AGGGAAGTCCTTTACCGGCGCTTCGATGAGATGG-3�Rev RU-O-4154 5�-CCATCTCATCGAAGCGCCGGTAAAGGACTTCCCT-3�

D1706R Fwd RU-O-4141 5�-CTTTACCGGGAGTTCCGCGAGATGGAAGAGTGCGCCTCACAC-3�Rev RU-O-4155 5�-GTGTGAGGCGCACTCTTCCATCTCGCGGAACTCCCGGTAAAG-3�

E1707R Fwd RU-O-4142 5�-CTTTACCGGGAGTTCGATCGCATGGAAGAGTGCGCCTCACAC-3�Rev RU-O-4156 5�-GTGTGAGGCGCACTCTTCCATGCGATCGAACTCCCGGTAAAG-3�

E1709R Fwd RU-O-4143 5�-GGAGTTCGATGAGATGCGCGAGTGCGCCTCACACCTCCC-3�Rev RU-O-4157 5�-GGGAGGTGTGAGGCGCACTCGCGCATCTCATCGAACTCC-3�

E1710R Fwd RU-O-4144 5�-GGAGTTCGATGAGATGGAACGCTGCGCCTCACACCTCCC-3�Rev RU-O-4158 5�-GGGAGGTGTGAGGCGCAGCGTTCCATCTCATCGAACTCC-3�

a Fwd, forward; Rev, reverse.b The codon targeted for mutagenesis in each sequence is underlined.



http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

R1703A, and F1705A mutants, which were unable to formdetectable colonies (detection limit, 10 CFU/�g). In contrast,conserved residues 1699 to 1701, 1709, and 1710 were tolerantof the Ala substitutions. Taken together, these data indicatedthat residues 1697, 1698, 1702, 1703, 1705, 1706, 1707, and1708 are important determinants of HCV replication. In addi-tion, a panel of charge reversal mutations, substituting Arg foracidic residues and Asp for basic residues, was constructed inCon1b/SG-Bsd(I). These mutants confirmed the importance ofresidues 1697, 1698, 1703 1706, and 1707 and revealed a pref-erence for an acidic residue at position 1699 (Fig. 2C).

Identification of suppressor mutants. We hypothesized thatNS4A mutants with reduced replication would be under selec-tive pressure to accumulate compensatory second-site changes.We therefore amplified HCV cDNA by reverse transcription-PCR from several Bsd-expressing colonies and directly se-quenced these products (Table 3). Nine of the 10 selectedD1697A clones reverted back to the wild-type residue at posi-tion 1697. However, a single D1697A clone was found to retainthe engineered mutation and contained additional changes inNS3 (R1187L) and NS5A (Q2153P). Several R1698A,Y1702A, and M1708A clones also retained the original muta-tion in NS4A and contained additional mutations at positionsQ1112 and P1115 of NS3, most commonly to basic residues.Furthermore, a single M1708A clone contained a change ofS1369R in NS3. We also detected reversion to the originalNS4A codons in nine of the D1706A-derived colonies. In twocases, M1708A had mutated to A1708V, suggesting a prefer-ence for large hydrophobic residues at this position.

We tested whether the detected second-site changes couldsuppress NS4A-mediated defects in HCV replication by sub-cloning them back into replicons containing the original NS4A

FIG. 2. Replication phenotypes of NS4A mutants. (A) The efficiencyof Bsd-resistant colony formation was determined for each Con1b/SG-Bsd(I) Ala scanning mutant. Plotted values represent the average of at leastthree experiments; error bars indicate the standard deviation of the mean. Nocolonies were detected for the Y1702A, R1703A, and F1705A mutants (limitof detection, 10 CFU/�g RNA). Asterisks indicate statistically significantdifferences (P � 0.01 [Student’s t test]) from the wild-type (WT) Con1b/SG-Bsd(I) parent. (B) The efficiency of Bsd-resistant colony formation was de-termined for each Con1b/SG-Bsd(T) Ala scanning mutant as in panel A andcompared to the wild-type Con1b/SG-Bsd(T) parent. (C) The efficiency ofBsd-resistant colony formation was determined for each Con1b/SG-Bsd(I) charge-flipping mutant. The wild-type Con1b/SG-Bsd(T) parent isreproduced from panel A for comparison.

TABLE 2. PCR primers used to amplify the HCV NS genes

PCR no. Primera Sequence

1 3841 (F) CTCTCCTCAAGCGTATTCAAC3842 (R) GTGGCGGCGACGGACGGGTTC

2 3843 (F) TTCCAGGTGGCCCATCTACAC3844 (R) GGTAAAGCCCGTCATTAGAGC

3 3845 (F) GGCCTTGATGTATCCGTCATA3846 (R) GGGAGGTGTGAGGCGCACTCT

4 3847 (F) GACAACAGGCAGCGTGGTCAT3848 (R) CGTGCTGCAGCGTCGCTCTCA

5 3849 (F) GGATGAACCGGCTGATAGCGT3850 (R) TTAGCCGTCTCCGCCGTAATG

6.2 3851 (F) GTCGGGCTCAATCAATACCTG3854 (R) TCTGCCCTTTAGAATTAGTCA

7 3853 (F) GCTAGTGAGGACGTCGTCTGC3854 (R) TCTGCCCTTTAGAATTAGTCA

8 3855 (F) ACAGGCCATAAGGTCGCTCAC3856 (R) ACTGGGACGCAGCCGGGATTG

9 3857 (F) CTCCATGGCCTTAGCGCATTT3902 (R) AAAAACAAGGATGGCCTATTGG

a F, forward; R, reverse.



http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

mutations. As shown in Fig. 3A, the R1187L mutation fullyrestored the replication of the D1697A mutant while Q2153Pdid not. As expected, the combination of these two mutationsalso fully restored replication. Furthermore, Q1112R,Q1112K, and P1115R all fully restored the replication of theR1698A mutant. Similarly, the Q1112R and S1369R mutationssuppressed the M1708A defect. Although we did not recon-struct the P1115L mutation in the M1708A background, we didtest the effect of P1115R on this mutant, and it also fullyrestored replication (not shown). To test whether these muta-tions in NS3 simply had a general positive effect on HCVreplication, these changes were engineered into Con1b/SG-Bsd, which lacks cell culture-adaptive changes or mutations inNS4A. As shown in Fig. 3B, Q1112R and S1369R conferred amild (10-fold) improvement in replication while P1115R andR1187L did not. Taken together, these data show that second-site mutations in NS3 suppress replication defects caused bymutations in the NS4A C-terminal acidic domain.

It was interesting that mutations at NS3 residues Q1112 and

P1115 arose multiple times and could suppress replicationdefects caused by different NS4A mutations. The Q1112R andP1115R mutations were therefore tested for the ability to sup-press defects caused by additional NS4A mutations. Interest-ingly, two of the most severe NS4A defects, R1703A andF1705A, were partially suppressed by these changes in NS3(Fig. 3C). In contrast, the replication of the Y1702A andD1706A mutants was not improved by either Q1112R orP1115R (data not shown).

Since the R1703A and F1705A mutants containing Q1112Ror P1115R showed a modest improvement in Bsd transductionefficiency, we expanded several of these colonies and se-quenced the NS3-to-NS5A regions contained within them (Ta-ble 4). In all cases, the original mutations in NS4A and second-site mutations in NS3 were retained. These data also revealedseveral additional mutations in NS3, i.e., I1097T, A1218D, andA1226D. In a few cases, additional changes in NS4A werefound near the original mutation. We therefore recon-structed triple mutants containing F1705A, Q1112R, and ei-

TABLE 3. Sequence analysis of replicons in selected blasticidin S-resistant cell clones

Polyproteinposition Original codon Mutant codon No. of

clones Consensus codon Additional mutation(s) detected(gene in which it occurs)

1697 Asp (GAC) Ala (GCC) 9 Asp (GAC) R1187L (NS3), Q2153P (NS5A)1 Ala (GCC)

1698 Arg (AGG) Ala (GCC) 2 Ala (GCC) Q1112R (NS3)1 Ala (GCC) Q1112K (NS3)1 Ala (GCC) P1115R (NS3)

1702 Tyr (UAC) Ala (GCC) 2 Ala (GCC) P1115R (NS3)

1706 Asp (GAU) Ala (GCC) 9 Asp (GAC)

1708 Met (AUG) Ala (GCC) 2 Val (GUC)1 Ala (GCC) Q1112R (NS3)1 Ala (GCC) P1115L (NS3)1 Ala (GCC) S1369R (NS3)

FIG. 3. Second-site mutations in NS3 suppress defects caused by mutations in the NS4A acidic region. Data are presented as described in thelegend to Fig. 2. (A) The indicated single, double, and triple mutations were tested in the context of Con1b/SG-Bsd(I). The replication phenotypesof D1697A, R1698A, M1708, and the wild type (WT) are reproduced from Fig. 1A for comparison. (B) The effects of each NS3 mutation weretested in the context of wild-type Con1b/SG-Bsd, which lacks cell culture-adaptive mutations. Asterisks indicate statistically significant differences(P � 0.01 [Student’s t test]) from the wild type. (C) The indicated single, double, and triple mutations were tested in the context of Con1b/SG-Bsd(I). The replication phenotypes of R1703A, F1705A, and the wild type are reproduced from Fig. 1A for comparison.



http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

ther A1218D or A1226D. As shown in Fig. 3C, both “third-site” mutations in NS3 strongly contributed to the suppressionof the replication defect caused by the F1705A mutation inNS4A.

Polyprotein processing and NS5A hyperphosphorylation ofmutant NS4A proteins. Since NS4A is an important cofactorfor HCV serine protease activity, we wondered whether thereplication defects of our mutant proteins could simply be dueto defective polyprotein processing. In addition, mutations atpositions 1706 and 1707 could have directly interfered withNS4A/4B cleavage since the NS3-4A serine protease prefers anacidic residue at substrate position P5 or P6 relative to theprotease cleavage site (5, 32, 33, 36, 63). Processing of thewild-type and mutant polyproteins was therefore studied intransfected cells. To alleviate differences in protein expressionarising from the inability of some mutants to replicate, Huh-7.5cells were infected with vTF7-3, a vaccinia virus that expressesT7 RNA polymerase, and transfected with the T7-drivencDNA clone of each Con1b/SG-Bsd(I) mutant replicon. Asshown by Western blotting, we did not detect major differencesin the expression of NS3, NS4B, NS5A, or NS5B by Con1b/SG-Bsd(I) replicons containing Ala substitutions in the NS4AC-terminal acidic domain (Fig. 4A). We were unable to di-rectly examine NS4A expression in our mutant panel becauseall of the available NS4A-specific antibodies recognize theregion that we had mutated (12, 73, 74). Nevertheless, thesedata indicate that mutations in the NS4A C-terminal acidicdomain do not strongly inhibit polyprotein processing and thatmutations at positions P5 and P6 of the NS4A/4B cleavage site(residues 1706 and 1707) are individually tolerated.

Mutations in the C-terminal region of NS4A were previouslyshown to affect NS5A hyperphosphorylation (31). We there-fore examined the phosphorylation status of NS5A expressedby our panel of Ala substitutions through vTF7-3 infection andcDNA transfection. Preliminary studies confirmed that thebasal (56-kDa) and hyperphosphorylated (58-kDa) forms ofNS5A could be resolved by SDS-polyacrylamide gel electro-phoresis and that these forms could be melded into an �55-kDa form by treatment with calf intestine alkaline phosphatase(not shown). Consistent with previous results (7), NS5A con-taining the S2204I adaptive mutation was not hyperphospho-rylated, regardless of the mutations in NS4A (Fig. 4A). Incontrast, several NS4A mutants containing the A2199T adap-tive mutation exhibited decreased hyperphosphorylation ofNS5A (Fig. 4B). For those replicons that were able to formcolonies, replication fitness (as measured by colony-formingefficiency) correlated with the level of NS5A hyperphosphory-

lation (Fig. 4C). Among the three mutants that were unable toform colonies, two of them (Y1702A and F1705A) also exhib-ited greatly reduced NS5A hyperphosphorylation, while NS5Ahyperphosphorylation was only slightly reduced in the R1703Amutant (Fig. 4C).

Given the correlation between replication and NS5A hyper-phosphorylation, we went on to test whether second-site sup-pressor mutations found in NS3 had effects on the phosphor-

FIG. 4. Polyprotein processing and NS5A phosphorylation statusof NS4A Ala scanning mutants. (A) Huh-7.5 cells were infected withvTF7-3 and transfected with T7-driven cDNAs of each Con1b/SG-Bsd(I) Ala scanning mutant, the wild-type (WT) replicon, or an irrel-evant control plasmid (MOCK). The indicated proteins were detectedby Western blotting as described in Materials and Methods. (B) NS5Aexpressed by each Con1b/SG-Bsd(T) Ala scanning mutant or wild-typereplicon was analyzed as for panel A. (C) The replication phenotype ofeach mutant (closed diamonds) was plotted against the fraction ofhyperphosphorylated NS5A, which was calculated from Western blotassays by digital scanning and image processing with NIH Image. TheY1702A, R1703A, and F1705A mutants, which did not produce de-tectable colonies, are indicated by open diamonds. (D) NS5A ex-pressed by wild-type Con1b/SG-Bsd(T) or the indicated single or dou-ble mutant, as analyzed for panel B.

TABLE 4. Sequence analysis of replicons in selected blasticidinS-resistant cell clones

NS4A mutation NS3 mutation No. ofclones

Additional mutation detected(gene in which it occurs)

R1703A Q1112R 1 I1097T (NS3)3 Y1702F (NS4A)

P1115R 1 F1705L (NS4A)

F1705A Q1112R 3 A1226D (NS3)P1115R 2 A1226D (NS3)

2 A1218D (NS3)



http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

ylation status of NS5A. The R1187L mutation, which restoredthe replication of the D1697A mutant, also restored NS5Ahyperphosphorylation (Fig. 4D). Similarly, the Q1112R andP1115R mutations, which fully restored the replication of theD1698A mutant, also restored NS5A hyperphosphorylation. Incontrast, Q1112R and P1115R conferred no improvement ofY1702A and D1706A replication and only modest improve-ment of F1705A replication and had no effect on NS5A phos-phorylation in the Y1702A, F1705A, and D1706A mutants(Fig. 4D). Taken together, these data indicate that mutationsin the C terminus of NS4A and compensatory changes in NS3coordinately affect NS5A hyperphosphorylation and RNA rep-lication.

Suppressing mutations map to surface residues of NS3.Suppressor mutations reside on discontinuous surfaces of NS3,distal from the serine protease and RNA helicase/nucleosidetriphosphatase active sites (Fig. 5). Several of these sites couldbe involved in interactions between the serine protease andhelicase domains; R1187 lies on the serine protease domainand is closely apposed to RNA helicase subdomain 3, andA1218 and A1226 map to the start of the RNA helicase do-main, near the peptide that links the serine protease and he-licase domains. S1369, which lies in RNA helicase subdomain2, faces the serine protease domain at a distance of around 20Å. Interestingly, suppressor mutations Q1112, P1115, andI1097 reside on a common surface near where the NS4A co-factor exits the serine protease fold. We therefore wonderedwhether NS4A might fold back and interact with one or moreof these NS3 surface residues. Indeed, crystal structures of thedengue and West Nile virus NS2B-3 serine protease indicatethat the C terminus of NS2B, which performs a cofactor func-tion similar to that of NS4A, can fold back to interact with thesubstrate-bound serine protease domain (16). Nevertheless,structural data on the C terminus of HCV NS4A are lacking.

Conformation analysis of the NS4A C-terminal region byCD. To gain insight into the structure of the NS4A C-terminalregion, we synthesized a peptide corresponding to the C-ter-minal 19 residues of NS4A (polyprotein residues 1693 to 1711).To be consistent with standard protein chemistry nomencla-ture, this peptide will be referred to as NS4A[36-54] and res-idues within this peptide will be numbered from the start of theNS4A protein. The secondary structure of this peptide wasanalyzed by CD spectroscopy under various stabilizing condi-tions with cosolvents (TFE) or detergents (SDS, DM, DPC)that mimic the environment found in the hydrophobic core ofglobular proteins and membranes. TFE is well known to in-duce folding of peptides that have an intrinsic propensity toadopt an alpha-helical structure by stabilizing short-range hy-drogen bonds (for an overview of TFE, see references 11 and48). In the presence of 50% TFE at an acidic pH (3.8), thepeptide exhibited a CD spectrum typical of alpha-helical fold-ing, with minima at 208 and 222 nm and a maximum at 192 nm(Fig. 6A). Peptide folding was titrated with increasing concen-trations of TFE, yielding spectra that were typical for alphahelices above 20% TFE (Fig. 6C). Maximal amplitude wasreached at 35% TFE, and no change was found at higher TFEconcentrations. These results were consistent with the sugges-tion that, for a peptide with a helical propensity, helicity isgenerally evident at 20 to 30% TFE and folding is complete by50% TFE (27). In the presence of the various detergents testedunder acidic conditions (SDS, DM, and DPC), CD spectra ofthe peptide again showed the typical spectrum of alpha-helicalfolding with an amplitude minimum at 222 nm, very similar tothat observed in 50% TFE (Fig. 6A and B). Quantitatively,about 55% helical content was estimated at 222 nm by themethod of Chen et al. (13) at pH 3.8 in 50% TFE or 100 mMSDS and dropped to about 50% helical content in 100 mM DMor 100 mM DPC. Interestingly, the typical spectral shape of

FIG. 5. Suppressor mutations map to the surface of NS3. The surface structure of single-chain NS3-4A is shown (PDB accession code 1CU1chain A). In this rendering, the serine protease domain of NS3 is white and NS3 helicase domains 1, 2, and 3 are purple, cyan, and pink,respectively. The cofactor peptide of NS4A (polyprotein residues 1678 to 1690) is green, and the synthetic linker between NS4A and NS3 has beenremoved. The locations of second- and third-site suppressor mutations are black or blue, respectively. The approximate locations of the serineprotease and helicase/nucleoside triphosphatase active sites are indicated by dashed lines. This rendering was prepared with PyMOL(http://pymol.sourceforge.net/).



http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

helical folding disappeared at a neutral pH, both in TFE and indetergents (Fig. 6A and B). Indeed, the spectra recorded in thevarious detergents exhibit a large negative band at around 200nm and a shoulder at about 220 nm, indicating a mixture ofrandom coil configuration and some residual structure, respec-tively. In contrast, the CD spectrum observed in 50% TFEsuggests the presence of some residual alpha-helical structure(about 22%, assuming that the ellipticity at 222 nm is only dueto an alpha helix). The pH dependency of the helical fold wasfurther analyzed by recording the CD spectra of the peptidedissolved in the nonionic detergent DM at various pHs. Figure6D shows that the peptide is mainly alpha helical below pH 4.0and essentially unstructured above this pH. The helix-to-ran-dom-coil transition occurs in a very narrow range of 0.1 to 0.2pH unit. The apparent pK of this transition is about 4.0, a valuethat is slightly below the pKas of the acidic side chains of Gluand Asp (4.5 and 4.6, respectively). As the peptide contains fiveGlu and one Asp acid residues, it appears that protonation of

these residues is required for the peptide to adopt an alpha-helical fold. In other words, the repulsive electrostatic interac-tions between the negatively charged groups of Glu and Aspprevent alpha-helical folding of the peptide. Furthermore, thevery narrow pH range of the transition suggests a stringentlycooperative process, whereby almost all of the acidic groupsmust be protonated to allow the helix to form.

NMR structure of the NS4A C-terminal region. We usedNMR spectroscopy to further investigate the conformation ofthe NS4A[36-54] peptide. Fifty percent TFE appeared to be anappropriate medium since a similar alpha-helical content wasobserved for the peptide in TFE or in detergents at an acidicpH. The two-dimensional homo- and heteronuclear NMRanalyses of the peptide in 50% TFE-d2 yielded rather well-resolved spectra, as illustrated by the extract of the NOESYspectrum (Fig. 7A). Sequential attribution of all spin systemswas complete despite the overlap of NMR signals, especiallyfor the five Glu residues exhibiting close chemical shifts. An

FIG. 6. pH-dependent folding of NS4A[36-54]. (A and B) CD spectra of the peptide in 10 mM sodium phosphate buffer (pH 3.8 or 7.4)containing 50% TFE or 100 mM SDS (A) or 100 mM DM or DPC (B). (C and D) The alpha-helical content of the peptide, as described in thetext, is plotted as a function of percent TFE (C) or pH (D).



http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

overview of the sequential and medium-range NOE connec-tivities is shown in Fig. 7B. Despite the lack of numerousconnectivities caused by overlapping cross-peaks, the NOEconnectivity patterns clearly show that the main body of thepeptide (D40 to M51) displays typical characteristics of analpha helix, including strong dNN(i,i�1) and mediumdN(i,i�1) sequential connectivities, weak dN(i,i�2), me-dium dN(i,i�3), medium or strong d� (i,i�3), and weakdN(i,i�4) medium-range connectivities. C-terminal residues52 to 54 also exhibit some NOEs characteristic of an alphahelix with fewer medium-range connectivities, suggestive of afraying helix terminus. In contrast, the residues flanking theN-terminal end of the helix remain unstructured with almostno medium-range connectivities. Differences of 1H and 13Cchemical shifts from those found in a random coil conforma-tion are additional indicators of secondary structure (67). Thelong series of negative 1H (1H � �0.1 ppm) and positive13C chemical shift differences (13C � 0.7 ppm) observed inFig. 7C for residues 41 to 51 (R1698 to M1708) are typical ofan alpha-helical conformation. These data are in close agree-ment with the NOE connectivities described above.

Because of the overlapping NMRs described above, thenumber of NOE-derived interproton distance constraints wasinsufficient for calculating the peptide structure by using onlythe experimentally identified distance constraints. As the NOEconnectivities and chemical shift differences unambiguouslyshowed that residues 41 to 51 (polyprotein residues R1698 toM1708) are folded as an alpha helix, we introduced 23 canon-ical helical distance constraints in the region from 41 to 49(R1698 to D1706) in addition to the 111 distance constraintsextracted from the NOESY spectrum to calculate a semiex-perimental average NS4A[36-54] structure that fully satisfiedthe experimental NMR data. The structural model shown inFig. 8 illustrates the amphipathic nature of the alpha-helixsegment with the hydrophobic and aromatic residues forminga narrow hydrophobic groove while the charged and polarresidues are exposed on the hydrophilic side. It should benoted that the structure of full-length NS4A might be some-what different in the context of NS3-4A, where additionalcontacts are likely to occur.

Despite the preliminary nature of this structural model, itprovides a useful framework for understanding our prior re-sults. Remarkably, peptide residues 47 (E1704), 49 (D1706), 50(E1707), 52 (E1709), and 53 (E1710) form an acidic cluster atthe alpha-helix surface (Fig. 8A and B). From an electrostaticpoint of view, such a cluster would not be stable at neutral pHbecause of repulsions between the acidic side groups. Con-versely, the abolition of these electrostatic repulsions by pro-tonation of these acidic groups at a low pH allows the alphahelix to fold. Alternatively, attractive electrostatic interactionsbetween this acidic cluster and a positively charged targetcould also induce the alpha-helix folding by neutralizing the

FIG. 7. NMR analysis of NS4A[36-54]. (A) Extract of the amide-aliphatic region of the NOESY spectrum recorded with the peptide at

pH 3.8 in 50% TFE. (B) Summary of sequential (i,i�1) and medium-range (i,i�2 to i�4) NOEs. Intensities of NOEs are indicated by barthickness; asterisks indicate that the presence of a NOE is not con-firmed because of resonance overlap. (C) Chemical shift differencesfor 1H and 13C at each position.



http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

repulsive negative charges of the acidic residues. Furthermore,this structural model also suggests that several residues that hadstrong-to-severe replication phenotypes (Y1702, R1703, F1705,and D1707) may form a cluster on the surface of the NS4A[36-54]peptide (Fig. 8C). Future work will address whether this hypo-thetical surface is responsible for mediating critical interactions ofNS4A in the context of the HCV replicase.

DISCUSSION

NS4A is known to mediate NS3-4A membrane associationand enzyme activity, yet it also appears to control other aspectsof the viral life cycle through unknown mechanisms. We there-fore examined the structure and function of the NS4A C-terminal acidic region. An important aspect of our structuralmodel of the NS4A C-terminal region is that several acidicresidues must be neutralized in order for it to fold as an alphahelix. While this was conveniently performed in our CD anal-ysis by altering the pH, interaction with a positively chargedsurface of another protein will likely induce a similar shift inthe conformation of NS4A. The identity of this putative bind-ing partner remains unknown, although it should be noted that

NS5A contains several basic surfaces, including a suspectedRNA binding groove (65), as well as a region previously pro-posed to be involved in mediating interaction with NS4A (3).

We found that several mutations in the NS4A C-terminalregion reduced the replication fitness of HCV. The most se-vere phenotypes were exhibited by Y1702A, R1703A, R1703D,and F1705A, each of which abolished colony formation (Fig.2). It is notable that two of these sites, Y1702 and F1705, areinvariant among numerous HCV isolates. Since Gln or Gluresidues frequently occur at position 1703 in other HCV iso-lates, the sequence requirements at this position are not yetclear and may covary with other positions within the HCVgenome. On the other hand, several invariant residues weresurprisingly tolerant of substitutions, including E1704A,E1704R, E1709A, E1709R, and E17010A, and E17010R. Onthe basis of our structural model, these mutations should affectthe pH threshold for alpha-helix formation. However, the largenumber of acidic residues in this region may be able to com-pensate for changes at individual positions. In addition, se-quence conservation at these positions may reflect their role inother aspects of the viral life cycle not addressed by our rep-lication assays.

FIG. 8. Structural model of the NS4A C-terminal acidic region. (A) The experimentally determined helical region is shown as in Fig. 1C (top)or as a helical wheel (bottom). Residue colors are as follows on the basis of the chemical properties of their side chains: acidic, red; basic, blue;hydrophobic, black. Tyr and Cys, which have unique chemical properties, are green and yellow, respectively. (B) Semiexperimental model of theNS4A C-terminal acidic region deduced from the CD and NMR data. Residues are numbered from the start of NS4A and colored as in panel A.(C) Surface rendering of the NS4A C terminus acidic region. Residues are numbered according to their positions in the Con1 polyprotein andcolored as follows on the basis of the phenotype of Ala substitutions: severe defects, deep purple; strong defects, purple; intermediate defects, pink;no phenotype, white; untested, black. These renderings were prepared with PyMOL (http://pymol.sourceforge.net/).



http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

The replication defects of several NS4A mutants were sup-pressed by mutations in NS3 (Tables 1 and 2 and Fig. 3). Thesechanges mapped to different regions on the surface of NS3,including a cluster of residues (I1097, Q1112, and P1115) nearwhere the cofactor portion of NS4A exits the serine proteasedomain (Fig. 5). Given this location, we hypothesize that NS4Amay fold back to directly interact with this surface. However,attempts to computationally dock the NS4A C-terminal alphahelix onto the surface of NS3 did not yield a convincing modeland additional structural studies on NS3-4A are necessary toaddress this hypothesis. Additional suppressor mutations(R1187L, A1218D, A1226D, and S1369R) mapped to residuesat or near the interface between the NS3 serine protease andhelicase domains. Given that NS4A regulates both serine pro-tease and RNA helicase activities of NS3 (53), perhaps theseresidues contribute to interdomain interactions within NS3. Itshould be noted that there is likely to be flexibility between theserine protease and helicase domains of NS3 that is not ap-parent from the crystal structure of full-length, single-chainNS3-4A, which captured the C terminus of NS3 bound to theserine protease substrate binding surface (71).

Previous work has shown that mutations in NS3 can lead tocell culture adaptation and increased HCV RNA replication(reviewed in reference 6). Indeed, mutations at Q1112, P1115,and A1226 were previously noted in other cell culture-adaptedreplicons, although their relative contributions to replicationfitness were not specifically addressed (44, 62, 72, 75). Wefound that P1115R and R1187L did not enhance the replica-tion of the wild-type Con1 replicon, while Q1112R and S1369Ronly moderately enhanced Con1 replication efficiency. Thus,the ability of these mutations to dramatically suppress thereplication defects of NS4A mutants likely reflects their abilityto compensate for a change in NS3-4A conformation and/orability to interact with another partner, rather than as generalenhancers of replication. This further suggests that these sitesmay be directly involved in interaction with NS4A or anotherreplicase component.

Given the importance of NS4A in regulating NS3-4A serineprotease activity, we tested whether our panel of Ala substitu-tions would exhibit decreased polyprotein processing but sawno effect. However, the vaccinia virus-T7 system drives high-level expression in Huh-7.5 cells and is likely to miss subtledifferences in serine protease activity and NS5A hyperphos-phorylation. Detailed enzymatic analysis of purified mutantNS3-4A complexes is necessary to discern the effects of thesemutations on the serine protease and RNA helicase activities.For a few of our NS4A mutants, full-length NS3-4A has beenpurified and no significant differences in serine protease activ-ity have been noted (R.K.F.B., B.D.L., and A.M.P., unpub-lished data). The helicase activity of these mutants is still underinvestigation.

Our panel of NS4A Ala substitutions exhibited a strikingcorrelation between defective replication and decreased NS5Ahyperphosphorylation. These results are consistent with previ-ous observations that NS5A hyperphosphorylation is an im-portant determinant of RNA replication. In addition, it ap-pears that the R1703A mutation may inhibit replication by aprocess other than altered NS5A hyperphosphorylation. Al-though NS5A phosphorylation acceptor sites have not yet beenfully defined, there is mounting evidence that hyperphosphor-

ylation includes phosphorylation at position S2204 by caseinkinase I and that the efficiency of this phosphorylation eventdepends on prior phosphorylation of S2201 by another kinase(56, 57).

The functional role of NS5A hyperphosphorylation is not yetfully understood. On the one hand, HCV RNA replication canbe greatly enhanced by mutations in NS5A that block hyper-phosphorylation (1, 7, 18) or by proprietary kinase inhibitorsthat block NS5A hyperphosphorylation (51). On the otherhand, HCV replication is attenuated by RNAi-mediated si-lencing of casein kinase I expression, which also blocks hy-perphosphorylation (56). One model to explain these seem-ingly disparate results is that the physical interaction betweenNS5A and casein kinase I may be required for HCV replica-tion, but that the kinase activity of this binding partner may, inturn, downregulate replication efficiency. For instance, it isknown that NS5A loses its ability to interact with human ves-icle-associated membrane protein A (hVAP-A), a putativereplicase assembly factor, upon hyperphosphorylation (18).Thus, the dynamics of NS5A hyperphosphorylation may leadto alternating cycles of RNA replication and silent infection,which may confer an advantage on persistent virus infections invivo.

Given that NS4A mutations that block hyperphosphoryla-tion also block RNA replication and that these effects arerelieved by second-site suppressor mutations in NS3, we hy-pothesize that NS4A likely acts upstream of casein kinase Iand that the NS4A-mediated conformation of NS3-4A mayinfluence this NS5A-kinase interaction. This model is in linewith previous studies showing that NS4A is required for NS5Ahyperphosphorylation (3, 28) and that NS5A hyperphosphory-lation is blocked by clustered Ala substitutions in the NS4AC-terminal acidic domain (31).

In conclusion, the present work shows that the C-terminalacidic region of NS4A encodes one or more activities that arecritical for NS5A hyperphosphorylation and HCV replication,that second-site changes in NS3 can compensate for changes inthis region, and that alpha-helical folding of this region de-pends on local electrostatic interactions and could behave as amolecular switch. Further work is necessary to examine therole of this region in the enzymatic activities of NS3-4A, toclarify the interaction with NS5A and/or other binding part-ners, and to define the structural basis for these activities.

ACKNOWLEDGMENTS

We thank M. Evans for the Bsd replicon, B. Moss and T. Telling-huisen for providing vTF7-3, A. Gauthier for sharing her NS4B West-ern blot assay conditions, and P. Holst for administrative and technicalsupport.

This work was funded through United States PHS grantsK01CA107092 (to B.D.L.), F32GM071120 (to R.K.F.B.), R01GM60620(to A.M.P.), and R01CA057973 (to C.M.R.); the French Centre Nationalde la Recherche Scientifique (to F.P.); and the Agence Nationale deRecherche sur le Sida et les Hepatites Virales (to F.P. and R.M.).

REFERENCES

1. Appel, N., T. Pietschmann, and R. Bartenschlager. 2005. Mutational analysisof hepatitis C virus nonstructural protein 5A: potential role of differentialphosphorylation in RNA replication and identification of a genetically flex-ible domain. J. Virol. 79:3187–3194.

2. Appel, N., T. Schaller, F. Penin, and R. Bartenschlager. 2006. From structureto function: new insights into hepatitis C virus RNA replication. J. Biol.Chem. 281:9833–9836.



http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

3. Asabe, S. I., Y. Tanji, S. Satoh, T. Kaneko, K. Kimura, and K. Shimotohno.1997. The N-terminal region of hepatitis C virus-encoded NS5A is importantfor NS4A-dependent phosphorylation. J. Virol. 71:790–796.

4. Bartenschlager, R., L. Ahlborn-Laake, J. Mous, and H. Jacobsen. 1994.Kinetic and structural analyses of hepatitis C virus polyprotein processing.J. Virol. 68:5045–5055.

5. Bartenschlager, R., L. Ahlborn-Laake, K. Yasargil, J. Mous, and H. Jacobsen.1995. Substrate determinants for cleavage in cis and in trans by the hepatitis Cvirus NS3 proteinase. J. Virol. 69:198–205.

6. Bartenschlager, R., M. Frese, and T. Pietschmann. 2004. Novel insights intohepatitis C virus replication and persistence. Adv. Virus Res. 63:71–180.

7. Blight, K. J., A. A. Kolykhalov, and C. M. Rice. 2000. Efficient initiation ofHCV RNA replication in cell culture. Science 290:1972–1974.

8. Blight, K. J., J. A. McKeating, and C. M. Rice. 2002. Highly permissive celllines for subgenomic and genomic hepatitis C virus RNA replication. J. Vi-rol. 76:13001–13014.

9. Branch, A. D., D. D. Stump, J. A. Gutierrez, F. Eng, and J. L. Walewski.2005. The hepatitis C virus alternate reading frame (ARF) and its family ofnovel products: the alternate reading frame protein/F-protein, the double-frameshift protein, and others. Semin. Liver Dis. 25:105–117.

10. Bryson, K., L. J. McGuffin, R. L. Marsden, J. J. Ward, J. S. Sodhi, and D. T.Jones. 2005. Protein structure prediction servers at University College Lon-don. Nucleic Acids Res. 33:W36–W38.

11. Buck, M. 1998. Trifluoroethanol and colleagues: cosolvents come of age.Recent studies with peptides and proteins. Q. Rev. Biophys. 31:297–355.

12. Cerino, A., and M. U. Mondelli. 1991. Identification of an immunodominantB cell epitope on the hepatitis C virus nonstructural region defined by humanmonoclonal antibodies. J. Immunol. 147:2692–2696.

13. Chen, Y. H., J. T. Yang, and K. H. Chau. 1974. Determination of the helixand beta form of proteins in aqueous solution by circular dichroism. Bio-chemistry 13:3350–3359.

14. Cuff, J. A., M. E. Clamp, A. S. Siddiqui, M. Finlay, and G. J. Barton. 1998.JPred: a consensus secondary structure prediction server. Bioinformatics14:892–893.

15. Dimitrova, M., I. Imbert, M. P. Kieny, and C. Schuster. 2003. Protein-protein interactions between hepatitis C virus nonstructural proteins. J. Vi-rol. 77:5401–5414.

16. Erbel, P., N. Schiering, A. D’Arcy, M. Renatus, M. Kroemer, S. P. Lim, Z.Yin, T. H. Keller, S. G. Vasudevan, and U. Hommel. 2006. Structural basisfor the activation of flaviviral NS3 proteases from dengue and West Nilevirus. Nat. Struct. Mol. Biol. 13:372–373.

17. Evans, M. J., C. M. Rice, and S. P. Goff. 2004. Genetic interactions betweenhepatitis C virus replicons. J. Virol. 78:12085–12089.

18. Evans, M. J., C. M. Rice, and S. P. Goff. 2004. Phosphorylation of hepatitisC virus nonstructural protein 5A modulates its protein interactions and viralRNA replication. Proc. Natl. Acad. Sci. USA 101:13038–13043.

19. Failla, C., L. Tomei, and R. De Francesco. 1994. Both NS3 and NS4A arerequired for proteolytic processing of hepatitis C virus nonstructural pro-teins. J. Virol. 68:3753–3760.

20. Favier, A., B. Brutscher, M. Blackledge, A. Galinier, J. Deutscher, F. Penin,and D. Marion. 2002. Solution structure and dynamics of Crh, the Bacillussubtilis catabolite repression HPr. J. Mol. Biol. 317:131–144.

21. Florese, R. H., M. Nagano-Fujii, Y. Iwanaga, R. Hidajat, and H. Hotta. 2002.Inhibition of protein synthesis by the nonstructural proteins NS4A and NS4Bof hepatitis C virus. Virus Res. 90:119–131.

22. Foy, E., K. Li, C. Wang, R. Sumpter, Jr., M. Ikeda, S. M. Lemon, and M.Gale, Jr. 2003. Regulation of interferon regulatory factor-3 by the hepatitisC virus serine protease. Science 300:1145–1148.

23. Frick, D. N., R. S. Rypma, A. M. Lam, and B. Gu. 2004. The nonstructuralprotein 3 protease/helicase requires an intact protease domain to unwindduplex RNA efficiently. J. Biol. Chem. 279:1269–1280.

24. Fuerst, T. R., E. G. Niles, F. W. Studier, and B. Moss. 1986. Eukaryotictransient-expression system based on recombinant vaccinia virus that syn-thesizes bacteriophage T7 RNA polymerase. Proc. Natl. Acad. Sci. USA83:8122–8126.

25. Hugle, T., F. Fehrmann, E. Bieck, M. Kohara, H. G. Krausslich, C. M. Rice,H. E. Blum, and D. Moradpour. 2001. The hepatitis C virus nonstructuralprotein 4B is an integral endoplasmic reticulum membrane protein. Virology284:70–81.

26. Ishido, S., T. Fujita, and H. Hotta. 1998. Complex formation of NS5B withNS3 and NS4A proteins of hepatitis C virus. Biochem. Biophys. Res. Com-mun. 244:35–40.

27. Jasanoff, A., and A. R. Fersht. 1994. Quantitative determination of helicalpropensities from trifluoroethanol titration curves. Biochemistry 33:2129–2135.

28. Kaneko, T., Y. Tanji, S. Satoh, M. Hijikata, S. Asabe, K. Kimura, and K.Shimotohno. 1994. Production of two phosphoproteins from the NS5A re-gion of the hepatitis C viral genome. Biochem. Biophys. Res. Commun.205:320–326.

29. Kato, J., N. Kato, H. Yoshida, S. K. Ono-Nita, Y. Shiratori, and M. Omata.2002. Hepatitis C virus NS4A and NS4B proteins suppress translation invivo. J. Med. Virol. 66:187–199.

30. Kim, J. L., K. A. Morgenstern, C. Lin, T. Fox, M. D. Dwyer, J. A. Landro,S. P. Chambers, W. Markland, C. A. Lepre, E. T. O’Malley, S. L. Harbeson,C. M. Rice, M. A. Murcko, P. R. Caron, and J. A. Thomson. 1996. Crystalstructure of the hepatitis C virus NS3 protease domain complexed with asynthetic NS4A cofactor peptide. Cell 87:343–355.

31. Koch, J. O., and R. Bartenschlager. 1999. Modulation of hepatitis C virusNS5A hyperphosphorylation by nonstructural proteins NS3, NS4A, andNS4B. J. Virol. 73:7138–7146.

32. Kolykhalov, A. A., E. V. Agapov, and C. M. Rice. 1994. Specificity of thehepatitis C virus NS3 serine protease: effects of substitutions at the 3/4A,4A/4B, 4B/5A, and 5A/5B cleavage sites on polyprotein processing. J. Virol.68:7525–7533.

33. Komoda, Y., M. Hijikata, S. Sato, S. Asabe, K. Kimura, and K. Shimotohno.1994. Substrate requirements of hepatitis C virus serine proteinase for in-termolecular polypeptide cleavage in Escherichia coli. J. Virol. 68:7351–7357.

34. Kou, Y. H., S. M. Chou, Y. M. Wang, Y. T. Chang, S. Y. Huang, M. Y. Jung,Y. H. Huang, M. R. Chen, M. F. Chang, and S. C. Chang. 2006. Hepatitis Cvirus NS4A inhibits cap-dependent and the viral IRES-mediated translationthrough interacting with eukaryotic elongation factor 1A. J. Biomed. Sci.13:861–874.

35. Kuang, W. F., Y. C. Lin, F. Jean, Y. W. Huang, C. L. Tai, D. S. Chen, P. J.Chen, and L. H. Hwang. 2004. Hepatitis C virus NS3 RNA helicase activityis modulated by the two domains of NS3 and NS4A. Biochem. Biophys. Res.Commun. 317:211–217.

36. Leinbach, S. S., R. A. Bhat, S. M. Xia, W. T. Hum, B. Stauffer, A. R. Davis,P. P. Hung, and S. Mizutani. 1994. Substrate specificity of the NS3 serineproteinase of hepatitis C virus as determined by mutagenesis at the NS3/NS4A junction. Virology 204:163–169.

37. Li, K., E. Foy, J. C. Ferreon, M. Nakamura, A. C. Ferreon, M. Ikeda, S. C.Ray, M. Gale, Jr., and S. M. Lemon. 2005. Immune evasion by hepatitis Cvirus NS3/4A protease-mediated cleavage of the Toll-like receptor 3 adaptorprotein TRIF. Proc. Natl. Acad. Sci. USA 102:2992–2997.

38. Li, X. D., L. Sun, R. B. Seth, G. Pineda, and Z. J. Chen. 2005. Hepatitis Cvirus protease NS3/4A cleaves mitochondrial antiviral signaling protein offthe mitochondria to evade innate immunity. Proc. Natl. Acad. Sci. USA102:17717–17722.

39. Lin, C., J. A. Thomson, and C. M. Rice. 1995. A central region in thehepatitis C virus NS4A protein allows formation of an active NS3-NS4Aserine proteinase complex in vivo and in vitro. J. Virol. 69:4373–4380.

40. Lin, C., J. W. Wu, K. Hsiao, and M. S. Su. 1997. The hepatitis C virus NS4Aprotein: interactions with the NS4B and NS5A proteins. J. Virol. 71:6465–6471.

41. Lin, R., J. Lacoste, P. Nakhaei, Q. Sun, L. Yang, S. Paz, P. Wilkinson, I.Julkunen, D. Vitour, E. Meurs, and J. Hiscott. 2006. Dissociation of aMAVS/IPS-1/VISA/Cardif-IKKε molecular complex from the mitochondrialouter membrane by hepatitis C virus NS3-4A proteolytic cleavage. J. Virol.80:6072–6083.

42. Lindenbach, B. D., M. J. Evans, A. J. Syder, B. Wolk, T. L. Tellinghuisen,C. C. Liu, T. Maruyama, R. O. Hynes, D. R. Burton, J. A. McKeating, andC. M. Rice. 2005. Complete replication of hepatitis C virus in cell culture.Science 309:623–626.

43. Lindenbach, B. D., H. J. Thiel, and C. M. Rice. 2007. Flaviviridae: the virusesand their replication, p. 1101–1152. In D. M. Knipe and P. M. Howley (ed.),Fields virology, fifth ed., vol. 1. Lippincott-Raven Publishers, Philadelphia,PA.

44. Lohmann, V., S. Hoffmann, U. Herian, F. Penin, and R. Bartenschlager.2003. Viral and cellular determinants of hepatitis C virus RNA replication incell culture. J. Virol. 77:3007–3019.

45. Loo, Y. M., D. M. Owen, K. Li, A. K. Erickson, C. L. Johnson, P. M. Fish,D. S. Carney, T. Wang, H. Ishida, M. Yoneyama, T. Fujita, T. Saito, W. M.Lee, C. H. Hagedorn, D. T. Lau, S. A. Weinman, S. M. Lemon, and M. Gale,Jr. 2006. Viral and therapeutic control of IFN-� promoter stimulator 1during hepatitis C virus infection. Proc. Natl. Acad. Sci. USA 103:6001–6006.

46. Merutka, G., H. J. Dyson, and P. E. Wright. 1995. ‘Random coil’ 1H chemicalshifts obtained as a function of temperature and trifluoroethanol concentra-tion for the peptide series GGXGG. J. Biomol. NMR 5:14–24.

47. Meylan, E., J. Curran, K. Hofmann, D. Moradpour, M. Binder, R. Barten-schlager, and J. Tschopp. 2005. Cardif is an adaptor protein in the RIG-Iantiviral pathway and is targeted by hepatitis C virus. Nature 437:1167–1172.

48. Montserret, R., M. J. McLeish, A. Bockmann, C. Geourjon, and F. Penin.2000. Involvement of electrostatic interactions in the mechanism of peptidefolding induced by sodium dodecyl sulfate binding. Biochemistry 39:8362–8373.

49. Moradpour, D., E. Bieck, T. Hugle, W. Wels, J. Z. Wu, Z. Hong, H. E. Blum,and R. Bartenschlager. 2002. Functional properties of a monoclonal anti-body inhibiting the hepatitis C virus RNA-dependent RNA polymerase.J. Biol. Chem. 277:593–601.

50. Mottola, G., G. Cardinali, A. Ceccacci, C. Trozzi, L. Bartholomew, M. R.Torrisi, E. Pedrazzini, S. Bonatti, and G. Migliaccio. 2002. Hepatitis C virusnonstructural proteins are localized in a modified endoplasmic reticulum ofcells expressing viral subgenomic replicons. Virology 293:31–43.

51. Neddermann, P., M. Quintavalle, C. Di Pietro, A. Clementi, M. Cerretani, S.



http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

Altamura, L. Bartholomew, and R. De Francesco. 2004. Reduction of hep-atitis C virus NS5A hyperphosphorylation by selective inhibition of cellularkinases activates viral RNA replication in cell culture. J. Virol. 78:13306–13314.

52. Nomura-Takigawa, Y., M. Nagano-Fujii, L. Deng, S. Kitazawa, S. Ishido, K.Sada, and H. Hotta. 2006. Non-structural protein 4A of hepatitis C virusaccumulates on mitochondria and renders the cells prone to undergoingmitochondria-mediated apoptosis. J. Gen. Virol. 87:1935–1945.

53. Pang, P. S., E. Jankowsky, P. J. Planet, and A. M. Pyle. 2002. The hepatitisC viral NS3 protein is a processive DNA helicase with cofactor enhancedRNA unwinding. EMBO J. 21:1168–1176.

54. Penin, F., J. Dubuisson, F. A. Rey, D. Moradpour, and J. M. Pawlotsky. 2004.Structural biology of hepatitis C virus. Hepatology 39:5–19.

55. Penin, F., C. Geourjon, R. Montserret, A. Bockmann, A. Lesage, Y. S. Yang,C. Bonod-Bidaud, J. C. Cortay, D. Negre, A. J. Cozzone, and G. Deleage.1997. Three-dimensional structure of the DNA-binding domain of the fruc-tose repressor from Escherichia coli by 1H and 15N NMR. J. Mol. Biol.270:496–510.

56. Quintavalle, M., S. Sambucini, C. Di Pietro, R. De Francesco, and P.Neddermann. 2006. The isoform of protein kinase CKI is responsible forhepatitis C virus NS5A hyperphosphorylation. J. Virol. 80:11305–11312.

57. Quintavalle, M., S. Sambucini, V. Summa, L. Orsatti, F. Talamo, R. DeFrancesco, and P. Neddermann. 2007. Hepatitis C virus NS5A is a directsubstrate of casein kinase I-, a cellular kinase identified by inhibitor affinitychromatography using specific NS5A hyperphosphorylation inhibitors.J. Biol. Chem. 282:5536–5544.

58. Rost, B. 1996. PHD: predicting one-dimensional protein structure by profile-based neural networks. Methods Enzymol. 266:525–539.

59. Rost, B., G. Yachdav, and J. Liu. 2004. The PredictProtein server. NucleicAcids Res. 32:W321–W326.

60. Sambrook, J., and D. W. Russell. 2001. Molecular cloning: a laboratorymanual, third ed., vol. 1. Cold Spring Harbor Laboratory Press, Cold SpringHarbor, NY.

61. Schwieters, C. D., J. J. Kuszewski, N. Tjandra, and G. M. Clore. 2003. TheXplor-NIH NMR molecular structure determination package. J. Magn. Re-son. 160:65–73.

62. Sumpter, R., Jr., C. Wang, E. Foy, Y. M. Loo, and M. Gale, Jr. 2004. Viralevolution and interferon resistance of hepatitis C virus RNA replication in acell culture model. J. Virol. 78:11591–11604.

63. Tanji, Y., M. Hijikata, Y. Hirowatari, and K. Shimotohno. 1994. Hepatitis Cvirus polyprotein processing: kinetics and mutagenic analysis of serine pro-teinase-dependent cleavage. J. Virol. 68:8418–8422.

64. Tanji, Y., M. Hijikata, S. Satoh, T. Kaneko, and K. Shimotohno. 1995.Hepatitis C virus-encoded nonstructural protein NS4A has versatile func-tions in viral protein processing. J. Virol. 69:1575–1581.

65. Tellinghuisen, T. L., J. Marcotrigiano, and C. M. Rice. 2005. Structure of thezinc-binding domain of an essential component of the hepatitis C virusreplicase. Nature 435:374–379.

66. Thanabal, V., D. O. Omecinsky, M. D. Reily, and W. L. Cody. 1994. The 13Cchemical shifts of amino acids in aqueous solution containing organic sol-vents: application to the secondary structure characterization of peptides inaqueous trifluoroethanol solution. J. Biomol. NMR 4:47–59.

67. Wishart, D. S., and B. D. Sykes. 1994. The 13C chemical-shift index: a simplemethod for the identification of protein secondary structure using 13C chem-ical-shift data. J. Biomol. NMR 4:171–180.

68. Wolk, B., D. Sansonno, H. G. Krausslich, F. Dammacco, C. M. Rice, H. E.Blum, and D. Moradpour. 2000. Subcellular localization, stability, and trans-cleavage competence of the hepatitis C virus NS3-NS4A complex expressedin tetracycline-regulated cell lines. J. Virol. 74:2293–2304.

69. Wuthrich, K. 1986. NMR of proteins and nucleic acids. John Wiley, NewYork, NY.

70. Yan, Y., Y. Li, S. Munshi, V. Sardana, J. L. Cole, M. Sardana, C.Steinkuehler, L. Tomei, R. De Francesco, L. C. Kuo, and Z. Chen. 1998.Complex of NS3 protease and NS4A peptide of BK strain hepatitis C virus:a 2.2 Å resolution structure in a hexagonal crystal form. Protein Sci. 7:837–847.

71. Yao, N., P. Reichert, S. S. Taremi, W. W. Prosise, and P. C. Weber. 1999.Molecular views of viral polyprotein processing revealed by the crystal struc-ture of the hepatitis C virus bifunctional protease-helicase. Structure 7:1353–1363.

72. Yi, M., and S. M. Lemon. 2004. Adaptive mutations producing efficientreplication of genotype 1a hepatitis C virus RNA in normal Huh7 cells.J. Virol. 78:7904–7915.

73. Yusim, K., R. Richardson, N. Tao, A. Dalwani, A. Agrawal, J. Szinger, R.Funkhouser, B. Korber, and C. Kuiken. 2005. Los Alamos hepatitis C im-munology database. Appl. Bioinformatics 4:217–225.

74. Zhang, Z. X., M. Chen, C. Hultgren, A. Birkett, D. R. Milich, and M.Sallberg. 1997. Immune responses to the hepatitis C virus NS4A protein areprofoundly influenced by the combination of the viral genotype and the hostmajor histocompatibility complex. J. Gen. Virol. 78(Pt. 11):2735–2746.

75. Zhu, Q., J. T. Guo, and C. Seeger. 2003. Replication of hepatitis C virussubgenomes in nonhepatic epithelial and mouse hepatoma cells. J. Virol.77:9204–9210.



http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

the c terminus of hepatitis c virus ns4a encodes an ...jvi.asm.org/content/81/17/8905.full.pdf ·...

Documents