Tob

YDD

R

gsiotstlimbicttovlsewTsoutim

m

dPp

DE

Biochemical and Biophysical Research Communications 263, 597–602 (1999)

Article ID bbrc.1999.1429, available online at http://www.idealibrary.com on

enascin Is Expressed in the Mesenchymef the Embryonic Lung and Down-Regulatedy Dexamethasone in Early Organogenesis

un Zhao1

epartment of Medicine, Duke University Medical Center and Research Service,urham Veterans Affairs Medical Center, Durham, North Carolina 27710

eceived August 5, 1999

Interactions between mesenchyme and epitheliumaItftTpac(bhsp

lgIFekaiItccwt

(sairtos

Tenascin (TN) is a hexameric extracellular matrixlycoprotein that is temporally and spatially re-tricted during lung development. This study exam-nes the expression and regulation of TN in early lungrganogenesis. Two TN isoforms were detected in to-al RNA isolated from embryonic day 14 rat lung tis-ues by reverse transcriptase polymerase chain reac-ion. The localization of TN in embryonic day 14 ratung tissues was investigated by using in situ hybrid-zation performed with an antisense RNA probe. TN

RNA was expressed exclusively by the mesenchymeut not by the epithelium of embryonic rat lungs. Thentense expression of TN was observed in the mesen-hyme that immediately surrounds the growing epi-helial cells of the developing bronchi. The effect ofhe synthetic glucocorticoid hormone dexamethasonen the regulation of TN expression was examined by initro lung explant culture. Two TN polypeptides, thearger (Mr 230 kDa, TN230) polypeptide and themaller (Mr 180 kDa, TN180) isoform, were detected inmbryonic day 21 rat lungs by immunoblot analysisith anti-TN antibody. Dexamethasone inhibited bothN230 and TN180 biosynthesis. The study demon-trates the expression of TN at the early stage of lungrganogenesis and presents evidence of hormonal reg-lation of TN in lung development, suggesting a poten-ial role of TN in the communication between the ep-thelial and mesenchymal cells during lung branching

orphogenesis. © 1999 Academic Press

Key Words: lung development; extracellular matrix;esenchyme; epithelium.

Abbreviations used: TN, tenascin; FN-III, fibronectin type III likeomains; RT-PCR, reverse transcription polymerase chain reaction;BS, phosphate-buffered saline; TBS, Tris-buffered saline; PAGE,olyacrylamide gel electrophoresis.

1 Address correspondence to the author at Research Service 151,urham VA Medical Center, Durham, NC 27705. Fax: 919-286-6824.-mail: zhaoyun@duke.edu.

597

re critical to induction and morphogenesis of the lung.t has been shown that the mesenchyme controls bothhe branching pattern and epithelial growth and dif-erentiation, and tracheal epithelium branches only inhe presence of bronchial mesenchymal tissue (1–3).he inducing effect of mesenchyme on epithelial mor-hogenesis and their mutual influence might be medi-ted by extracellular matrix molecules that facilitateell-cell and cell-matrix interactions (4, 5). TenascinTN) is an extracellular matrix glycoprotein that hasoth cell adhesive and anti-adhesive properties. TNas been shown to interfere with attachment andpreading of a number of cell types in culture by eitherromoting or inhibiting cell adhesion (6–8).The primary structure of TN shows a modular mo-

ecular design of repeated structural units of epidermalrowth factor (EGF) like domains and fibronectin typeII like domains (FN-III). Alternative splicing of theN-III generates various TN isoforms. In human TN,ight contiguous FN-III repeats, coding for nearly 100Da of molecular weight of TN polypeptide, undergolternative splicing which may result in at least eightsoforms (9, 10). In mouse, the largest TN has 13 FN-II repeats. Five such FN-III repeats undergo alterna-ive splicing and three isoforms are identified by cDNAloning (11), and the longest TN mRNA variant (7kb)ontains five consecutive insertional FN-III repeats,hereas the shortest (5.5 kb) lacks 5 consecutive inser-

ional FN-III repeats.TN has been reported to be expressed in mouse lung

11) and avian lung parabronchi (12, 13). Our previoustudies showed that two TN isoforms generated bylternative splicing of FN-III domains were expressedn the lung and the expression of TN isoforms wasegulated by transforming growth factor-b (14). TN isemporally and spatially restricted during lung devel-pment and mesenchymal-derived cells are the majorource of TN (15). In adult lung, expression of TN is

0006-291X/99 $30.00Copyright © 1999 by Academic PressAll rights of reproduction in any form reserved.

rather limited, but TN is greatly induced following theii

mosmgirlmm

M

DLmsdgwL

rmctGtis

(tttTeayfttbMmT4fiKdmffisspth

hl

usPMycpappttasfgswwp

pwfvacitwahPwdbfpNwhnN3RS

r(Rws

Vol. 263, No. 3, 1999 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

nitial lung injury induced by intratracheal bleomycinnstillation (16).

To better understand the role of TN in lung develop-ent, we investigated the expression and localization

f TN in lung organogenesis at the early developmentaltage. We demonstrate that TN was expressed by theesenchymal tissues of embryonic rat lung. Given that

lucocorticoid hormones have been shown to play a rolen the development of lung (17–19), we examined theegulation of TN by a synthetic glucocorticoid ana-ogue, dexamethasone, and presented evidence of hor-

onal regulation of TN in embryonic lung develop-ent.

ATERIALS AND METHODS

Animals and tissue preparation. Timed-pregnant Sprague-awley rats were purchased from Zivic Miller (Allison Park, PA).ungs were removed while the animals were under pentobarbital (50g/kg) anesthesia, and lungs were frozen in liquid nitrogen and

tored at 270°C. Lung tissues were fixed in ice-cold 4% paraformal-ehyde in phosphate-buffered saline (PBS), dehydrated throughraded ethanol, and embedded in paraffin. Five mm thick sectionsere cut and mounted on 3-aminopropyl-triethoxysilane (Sigma, St.ouis, MO) treated glass slides.

Organ culture of embryonic rat lung tissue. The lung tissues fromat fetuses aged 21 gestational days were collected under a dissectingicroscope. We divided the lung tissue using a McIlwain tissue

hopper, and placed the lung slices in culture dishes and maintainedhem in organ culture in serum-free DMEM medium (GIBCO/BRL,rand island, NY) plus 500 units/ml penicillin, and 50 mg/ml strep-

omycin as described by Chen and Little (20). Lung explants werencubated in control medium or in medium containing dexametha-one (Sigma, St. Louis, MO).

RNA isolation and reverse transcription polymerase chain reactionRT-PCR). We isolated lungs from 25 gestational day 14 rat fe-uses. Total RNA was prepared from lung tissues essentially usinghe method of Chirgwin by extracting tissue with 4 M guanidiumhiocyanate and pelleted through a cushion of cesium chloride (21).he pellets were extracted with phenol/chloroform and followed bythanol precipitation. Quality and quantity of the RNA was evalu-ted by UV spectrophotometry and by denaturing agarose gel anal-sis in the presence of ethidium bromide. cDNA was synthesizedrom 1-5 mg of total RNA primed with oligo (dT)12–18, and reverseranscribed in a final volume of 20 ml using superscript II reverseranscriptase (GIBCO/BRL, Grand Island, NY) in 13 synthesisuffer containing 20 mM Tris-HCl, pH 8.4, 50 mM KCl, 2.5 mMgCl2, 100 mg/ml BSA, 10 mM DTT, 500 mM each dNTP. Theixture was incubated at 42°C for 50 min, heated at 70°C for 15 min.he original mRNA was destroyed by incubation with RNase H at2°C for 10 min. TN target sequences were amplified by PCR in anal volume of 50 ml containing 20 mM Tris-HCl, pH 8.4, 50 mMCl, 2.5 mM MgCl2, 100 mg/ml BSA, 10 mM DTT, 500 mM eachNTP, 200 pM each primer P1 and P2 with 2 U of Taq DNA poly-erase. PCR cycling conditions were 22-35 cycles consisting of 92°C

or 1 min, 60°C for 1 min, 72°C for 2 min, and followed by a 5 minnal extension at 72°C. Two oligonucleotide primers for PCR (P1,ense: 59d[CGGAATTCAGGGCAGACACAAGAGCAAG]39; P2, anti-ense: 59d[AACTGCAGTTCCTTCGGAGAACCCATGG]39) encom-assing the entire FN-III splicing domain were synthesized based onhe knowledge that TN cDNA from human, mouse and chicken areighly homologous (9, 11). These regions were selected for their

598

ighly conserved nucleotide sequence. The PCR product was ana-yzed by agarose gel electrophoresis.

Immunoblotting. Protein extraction from lung tissue was done bysing a basic (pH 11.5) buffer of 0.2 M cyclohexylamino propaneulfonic acid in 150 mM NaCl, 1 mM EDTA in the presence of 1 mMMSF (Sigma, St. Louis, MO), 0.3 mM aprotinin (Sigma, St. Louis,O) and 1 mM pepstatin (Sigma, St. Louis, MO) to prevent proteol-

sis. After clarification of the extracts by centrifugation, the proteinontent was assayed by the BioRad protein assay kit (Bio-Rad). Theroteins were separated on SDS-PAGE gel with a 3% stacking gelnd an 8% separating gel under reducing condition using up to 70 mgrotein per lane, and transferred electrophoretically to nitrocelluloseaper in 200 mM glycine, 20 mM Trisbase, and 20% methanol. Afterransfer, the nitrocellulose sheets were blocked for 5 hrs at roomemperature in 5% dry milk in Tris-buffered saline (TBS), incubatedt 4°C overnight in the same buffer containing anti-tenascin anti-erum (Telios Pharmaceuticals, San Diego, CA), and then incubatedor 2 hrs at room temperature with alkaline phosphatase-conjugatedoat anti-rabbit IgG. Primary antibody dilution was at 1:100 andecondary antibody was at a dilution of 1:2000. Blots were washedith four changes of TBS after each incubation. Bound antibodiesere visualized by a color reaction with 5-bromo-4-chloro-3-indolylhosphate/nitro blue tetrazolium (BCIP/NBT).

In situ hybridization. Sections of paraformaldehyde-fixed andaraffin-embedded rat lungs were subjected to in situ hybridizationith [35S]-cRNA. Sense and antisense cRNA riboprobes were generated

rom rat TN cDNA subcloned into pGEM-7Zf, which was kindly pro-ided by Dr. Ikramuddin Aukhil from the University of North Carolinat Chapel Hill. The plasmid was linearized with restriction enzymes.RNA was obtained in the sense and antisense orientation by transcrib-ng from T7 and SP6 promoters, respectively, using the Riboproberanscription kit (Stratagene, La Jolla, CA). Riboprobes were labeledith [35S]-UTP (Amersham, Arlington, IL), and were reduced to anverage fragment length of about 200 nucleotide bases by alkalineydrolysis. Sections were rehydrated, fixed in 4% paraformaldehyde inBS, and treated with proteinase K. The sections were treated againith 4% paraformaldehyde in PBS, and acetylated with acetic anhy-ride. Following dehydration through ethanol, the sections were prehy-ridized for 2 hrs at 50°C in hybridization solution (containing 50%ormamide, 0.3 M NaCl, 20 mM Tris-HCl, pH 8.0, 5 mM EDTA, 0.02%olyvinylpyrolidone, 0.02% Ficoll, 0.02% bovine serum albumin, 10 mMaH2PO4, 500 mg/ml tRNA and 100 mM dithiothreitol). Hybridizationas performed with 2 to 5 3 107cpm/ml [35S]-labeled cRNA probe inybridization solution (with 10% dextran sulfate) and incubated over-ight at 55°C. The slides were washed with 53 SSC (13 SSC is 0.15 MaCl, 15 mM trisodium citrate) containing 10 mM dithiothreitol at7°C, followed by washing with 23 SSC at 65°C and then treated withNase A. Washing was continued with 23 SSC at 65°C and then 0.13SC at 37°C. Sections were next dehydrated, dried, and dipped in

FIG. 1. RT-PCR analysis of TN in RNA isolated from embryonicat lung tissue. 5 mg of total RNA from gestational day 14 rat lunglane 1) and postnatal day 1 rat lung (lane 2) were amplified byT-PCR. The PCR was performed for 35 cycles and the productsere analyzed on a 1% agarose gel. Molecular weight markers are

hown in the left lane (M).

Kwh

R

Rpprbadsncm

eeesdyip(csfibttid

hovcoL

Vol. 263, No. 3, 1999 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

odak NTB-3 autoradiographic emulsion. After exposure at 4°C for 1-2eeks, the slides were developed and counter-stained withematoxylin/eosin.

ESULTS AND DISCUSSION

Detection of TN expression in embryonic rat lung byT-PCR analysis. Lung development undergoes arenatal period of branching morphogenesis and aostnatal period of alveolarization (22, 23). In theat, lung organogenesis starts as a simple foregutud that encroaches upon surrounding mesenchymeround the 11th day of gestation. By the gestationalay 14, the primitive bud is formed, but the lung istill in the pseudoglandular stage. The tubule origi-ating from a ventral diverticulum of the foregutontinues to grow invasively into the surroundingesenchyme. Interactions between mesenchyme and

FIG. 2. TN expression in day 14 gestational age rat embryo. (Aybridized with a [35S]-UTP-labeled antisense TN cRNA probe. Sectif morphology. (B) Dark-field photomicrograph of the same area depertebral column. (C) Higher magnification photomicrograph of theRNA probe. (D) Dark-field photomicrograph of the same area depicf lung. A and B at same magnification; bar in (A) equals 25 mm. C aniv, liver; In, intestine; VC, vertebral column.

599

pithelium are critical to induction and morphogen-sis of the lung at this stage. To determine if TN wasxpressed in the lung at this early developmentaltage, we isolated RNA from embryonic rat lung ofay 14 gestational age and performed RT-PCR anal-sis. We detected two TN splicing isoforms expressedn gestational day 14 rat lung (Figure 1). PCR am-lification revealed two distinct bands, one large1.42 kb) and one small (340 bp). The 1.42 kb TNDNA fragment contained 5 fibronectin type IIIplicing repeats, and the 340 bp band was missing 4bronectin type III repeats. The organ plan of theronchial tree pattern has not been established byhe gestational day 14. Expression of TN mRNA inhe rat lung at this very early developmental stagendicates a potential role of TN in bronchial treeevelopment.

right-field photomicrograph of day 14 gestational age rat embryowere counterstained with hematoxylin and eosin for demonstration

ed in A. TN mRNA was expressed in the lung, intestine, liver, andbryonic lung bud hybridized with a [35S]-UTP-labeled antisense TNin C. TN message was primarily localized within the mesenchymeat same magnification; bar in (C) equals 5 mm. Lu, lung; He, heart;

) Bonsict

emtedd D

epii

Vol. 263, No. 3, 1999 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

FIG. 3. TN expression in the embryonic lung and intestine. Higher magnification photomicrographs of the mesenchymal tissue and thepithelial lining of the developing bronchus (A) and (B) the developing intestine hybridized with a [35S]-UTP-labeled antisense TN cRNArobe showing positive signal in the mesenchymal tissue adjacent to the epithelium of the developing duct. No significant labeling was seenn the epithelium. A and B at same magnification; bar in (A) and (B) equals 2.5 mm. Me, mesenchyme; Ep, epithelium; Br, bronchus; It,ntestinal tube.

600

Localization of TN mRNA in embryonic rat lungtcsctbtluomctcthis(wtc

mbbachTbeegl

aog

ebdlleeTsfteacdMltpMawomspt(deltb

s2ppaadl

pdeeL5

Vol. 263, No. 3, 1999 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

issue by in situ hybridization. To determine the lo-alization of TN mRNA in rat lung, we hybridizedections of rat embryos with an antisense [35S]-labeledRNA probe (Figure 2). TN mRNA was detectable inhe mesenchymal cells of day 14 gestational age em-ryonic rat lung tissue. TN mRNA was also present inhe liver, intestine and vertebral column. Only a veryow level of TN mRNA was detected in the heart (Fig-res 2A and 2B). Figures 2C and 2D show the devel-ping lung bud hybridized with TN cRNA probe. TNessage was primarily localized within the mesen-

hyme surrounding the developing bronchi. The in-ense expression of TN was observed in the mesen-hyme immediately adjoining to the growing epithelialissues of the developing bronchi (Figure 3A). Theigher-magnification photomicrograph of the develop-

ng intestinal tube hybridized with TN cRNA probehows a similar pattern to that of the developing lungFigure 3B). A strong hybridization with TN probesas observed in the mesenchymal tissue adjacent to

he epithelium of the developing intestine. No signifi-ant labeling was seen in the epithelium.

Our in situ hybridization analysis indicated that TNRNA was produced exclusively in the mesenchyme

ut not in the epithelium at sites of active growth ofronchus in 14 day rat embryonic lungs, which is inccord with our previous findings (15, 16). Mesen-hyme including fibroblasts, smooth muscles and gliasas been shown to be the cellular source of TN (24–26).he mesenchyme directs and controls lung epithelialudding and branching (1–3). The finding that TN isxpressed by the mesenchyme surrounding the differ-ntiating epithelial tissues of the early lung bud sug-est a possible functional role of TN in the process ofung development. TN may function as an adhesion or

FIG. 4. Dose-dependent effect of dexamethasone on the expres-ion of TN in embryonic rat lung. Lung explants from fetal rat of1 day gestational age were incubated in culture for 24 hrs inresence of dexamethasone. TN extracts were resolved on SDS-olyacrylamide gel, and analyzed by Western blotting with annti-TN antibody and visualized using a anti-rabbit IgG conjugatedlkaline phosphatase and chromogenic substrate. Lane 1, 1027 Mexamethasone; lane 2, control; lane 3, 1029 M dexamethasone; andane 4, control.

601

n anti-adhesion molecule (8), which influences matrixrganization and cell-cell interactions during organo-enesis.

Effect of dexamethasone on biosynthesis of TN inmbryonic rat lung. Glucocorticoid hormones haveeen shown to be major regulatory molecules in theevelopment of lung (18, 19). Dexamethasone treatedungs had growth retardation, distorted branching, di-ated proximal tubules, and suppressed proliferation ofpithelial cells of the distal tubules (27). We furtherxamined the role of dexamethasone in regulation ofN expression by employing the lung explant cultureystem. TN extracts from rat lung explants maintainedor 24 hrs in the presence of dexamethasone at concen-rations of 1029 M and 1027 M were analyzed by West-rn blot (Figure 4). The inhibitory effect of dexameth-sone on TN biosynthesis was apparent at aoncentration of 1029 M. TN expression was greatlyecreased by dexamethasone at a concentration of 1027

. Figure 5 shows the effects of dexamethasone on theevels of TN expression as a function of incubationime. Embryonic rat lung explants were cultured in theresence of dexamethasone at a concentration of 1029

, and the incubation was continued for 0, 12, 24, 48,nd 60 hrs. The level of TN expression in these tissuesere analyzed by Western blotting. A strong decreasef TN was evident 12 hrs after the addition of dexa-ethasone to the culture medium. The inhibition of TN

ynthesis continued after a 60 hr treatment. The ex-ression of TN has been found to be up-regulated byransforming growth factor-b (14) and interleukin-428). In contrast, dexamethasone acted as a strongown-regulator of TN expression. Our finding of theffect of dexamethasone on TN expression in rat fetalung is consistent with previously reported observa-ions on bone marrow stromal cells and in 3T3 fibro-lasts (29). The glucocorticoid regulation of TN would

FIG. 5. Effect of dexamethasone on the time course of TN ex-ression in embryonic rat lung. Lung explants from fetal rat of 21ay gestational age were incubated in the absence (control) or pres-nce of dexamethasone (1029 M) for 12, 24, 48, and 60 hrs. TN wasxtracted from these explants and subjected to immunoblot analysis.ane 1, control; lane 2, 12 hrs; lane 3, 24 hrs; lane 4, 48 hrs; and lane, 60 hrs.

be an important mechanism relevant to lung develop-m

atdseetplctmv

A

adWNp

R

Baralle, F., and Zardi, L. (1991) Nucleic Acids Res. 19(3), 525–

1

1

1

1

1

1

1

1

1

1

22

2

22

2

2

2

2

2

Vol. 263, No. 3, 1999 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

ent.In conclusion, this study describes the expression

nd localization of TN in early lung organogenesis andhe regulation of TN expression by dexamethasone. Weemonstrate that TN was expressed at the very earlytage of lung organogenesis. TN is synthesized by mes-nchymal cells and is restrictively localized in the mes-nchyme adjoining to the growing epithelial tissues ofhe development lung bud. We speculate that TN maylay a role as a morphogenetic mediator which regu-ates mesenchymal-epithelial interactions and bron-hial tree development. Further studies are necessaryo elucidate the mechanism by which TN regulatesesenchymal-epithelial interactions during lung de-

elopment.

CKNOWLEDGMENTS

The author acknowledges the technical help of Robert Silbajorisnd thanks Dr. Stephen L. Young for discussions and assistanceuring the course of this work. Yun Zhao is a recipient of the Clifford. Perry Research Award from the American Lung Association oforth Carolina. This work was supported by grants from the De-artment of Veterans Affairs and the American Lung Association.

EFERENCES

1. Hilfer, S. R., Rayner, R. M., and Brown, J. W. (1985) Tissue Cell17(4), 523–538.

2. Goldin, G. V., and Wessells, N. K. (1979) J. Exp. Zool. 208(3),337–346.

3. Masters, J. R. (1976) Dev. Biol. 51(1), 98–108.4. Bernfield, M. (1984) Semin. Perinatol. 8(2), 117–122.5. Bissell, M. J., Hall, H. G., and Parry, G. (1982) J. Theor. Biol.

99(1), 31–68.6. Chiquet-Ehrismann, R., Kalla, P., Pearson, C. A., Beck, K., and

Chiquet, M. (1988) Cell 53(3), 383–390.7. Lightner, V. A., and Erickson, H. P. (1990) J. Cell Sci. 95(Pt 2),

263–277.8. Spring, J., Beck, K., and Chiquet-Ehrismann, R. (1989) Cell

59(2), 325–334.9. Siri, A., Carnemolla, B., Saginati, M., Leprini, A., Casari, G.,

602

531.0. Sriramarao, P., and Bourdon, M. A. (1993) Nucleic Acids Res.

21(1), 163–168.1. Saga, Y., Tsukamoto, T., Jing, N., Kusakabe, M., and Sakakura,

T. (1991) Gene 104(2), 177–185.2. Abbott, L. A., Lester, S. M., and Erickson, C. A. (1991) Anat.

Embryol. (Berlin) 183(3), 299–311.3. Koch, M., Wehrle-Haller, B., Baumgartner, S., Spring, J.,

Brubacher, D., and Chiquet, M. (1991) Exp. Cell Res. 194(2),297–300.

4. Zhao, Y., and Young, S. L. (1995) Am. J. Physiol. 268(2 Pt 1),L173–L180.

5. Zhao, Y., and Young, S. L. (1995) Am. J. Physiol. 269(4 Pt 1),L482–L491.

6. Zhao, Y., Young, S. L., and McIntosh, J. C. (1998) Am. J. Physiol.274(6 Pt 1), L1049–L1057.

7. Adamson, I. Y., and King, G. M. (1986) Lab. Invest. 55(2), 145–152.

8. Schmid, W., Cole, T. J., Blendy, J. A., and Schutz, G. (1995) J.Steroid Biochem. Mol. Biol. 53(1–6), 33–35.

9. Ballard, P. L. (1987) Mead Johnson Sympos. Perinat. Dev. Med.30, 22–27.

0. Chen, J. M., and Little, C. D. (1987) Dev. Biol. 120(2), 311–321.1. Chirgwin, J. M., Przybyla, A. E., MacDonald, R. J., and Rutter,

W. J. (1979) Biochemistry 18(24), 5294–5299.2. Spooner, B. S., and Wessells, N. K. (1970) J. Exp. Zool. 175(4),

445–454.3. Ten Have-Opbroek, A. A. (1991) Exp. Lung Res. 17(2), 111–130.4. Chiquet-Ehrismann, R., Mackie, E. J., Pearson, C. A., and

Sakakura, T. (1986) Cell 47(1), 131–139.5. Daniloff, J. K., Crossin, K. L., Pincon-Raymond, M., Murawsky,

M., Rieger, F., and Edelman, G. M. (1989) J. Cell Biol. 108(2),625–635.

6. Tucker, R. P., and McKay, S. E. (1991) Development 112(4),1031–1039.

7. Oshika, E., Liu, S., Ung, L. P., Singh, G., Shinozuka, H., Micha-lopoulos, G. K., and Katyal, S. L. (1998) Pediatr. Res. 43(3),305–314.

8. Makhluf, H. A., Stepniakowska, J., Hoffman, S., Smith, E., Le-Roy, E. C., and Trojanowska, M. (1996) J. Invest. Dermatol.107(6), 856–859.

9. Ekblom, M., Fassler, R., Tomasini-Johansson, B., Nilsson, K.,and Ekblom, P. (1993) J. Cell Biol. 123(4), 1037–1045.