targeting stat5 or stat5-regulated pathways suppresses ... · 28/08/2018 · abl1 tyrosine kinase...

1

Title: Targeting STAT5 or STAT5-regulated pathways suppresses leukemogenesis

of Ph+ acute lymphoblastic leukemia

Authors: Valentina Minieri1, Marco De Dominici

1, Patrizia Porazzi

1, Samanta A.

Mariani2, Orietta Spinelli

3, Alessandro Rambaldi

3,4, Luke F. Peterson5, Pierluigi Porcu

6,

Marja T. Nevalainen7, and Bruno Calabretta

1*

Affiliations: 1Department of Cancer Biology, Sidney Kimmel Cancer Center, Thomas

Jefferson University, Philadelphia, PA, U.S.A.; 2The Queen’s Medical Research

Institute, Centre for Inflammation Research, The University of Edinburgh, Scotland, UK;

3Hematology and Bone Marrow Transplant Unit, Ospedale Papa Giovanni XXIII,

Bergamo, Italy; 4Universita’ Statale Milano, Italy; 5Department of Internal Medicine,

University of Michigan, Ann Arbor, MI; 6Department of Medical Oncology, Thomas

Jefferson University, Philadelphia, PA, U.S.A.; 7Department of Pathology, Medical

College of Wisconsin Cancer Center, Milwaukee, WI.

Running Title: STAT5 pathways in Ph+ ALL

Keywords: Acute Lymphoblastic Leukemia, STAT5, Apoptosis

Financial Support: this work was supported, in part, by NCI grant RO1-CA167169 (B.

Calabretta) and RO1-CA113580, R21CA178755 and Advancing a Healthier Wisconsin

(#5520368) (M. Nevalainen).

*Correspondence: Dr. Bruno Calabretta, Department of Cancer Biology and Sidney

Kimmel Cancer Center, Thomas Jefferson University, 233 South 10th Street,

Philadelphia, PA 19107, USA.

Phone: 215 5034522

E-mail: [email protected]

Conflict of Interest Disclosure: the authors declare no potential conflict of interest.

on April 3, 2021. © 2018 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on August 28, 2018; DOI: 10.1158/0008-5472.CAN-18-0195

http://cancerres.aacrjournals.org/

2

Abstract

Combining standard cytotoxic chemotherapy with BCR-ABL1 tyrosine kinase inhibitors

(TKI) has greatly improved the upfront treatment of patients with Philadelphia

chromosome-positive (Ph+) acute lymphoblastic leukemia (ALL). However, due to the

development of drug resistance through both BCR-ABL1-dependent and -independent

mechanisms, prognosis remains poor. The STAT5 transcription factor is activated by

BCR-ABL1 and by JAK2-dependent cytokine signaling; therefore, inhibiting its activity

could address both mechanisms of resistance in Ph+ ALL. We show here that genetic

and pharmacologic inhibition of STAT5 activity suppresses cell growth, induces

apoptosis, and inhibits leukemogenesis of Ph+ cell lines and patient-derived newly

diagnosed and relapsed/TKI-resistant Ph+ ALL cells ex vivo and in mouse models.

STAT5 silencing decreased expression of the growth-promoting PIM-1 kinase, the

apoptosis inhibitors MCL-1 and BCL-2, and increased expression of pro-apoptotic BIM

protein. The resulting apoptosis of STAT5-silenced Ph+ BV173 cells was rescued by

silencing of BIM or restoration of BCL-2 expression. Treatment of Ph+ ALL cells,

including samples from relapsed/refractory patients, with the PIM kinase inhibitor

AZD1208 and/or the BCL-2 family antagonist Sabutoclax markedly suppressed cell

growth and leukemogenesis ex vivo and in mice. Together, these studies indicate that

targeting STAT5 or STAT5-regulated pathways may provide a new approach for

therapy development in Ph+ ALL, especially the relapsed/TKI-resistant disease.




3

Introduction

Philadelphia chromosome-positive (Ph+) acute lymphoblastic leukemia (ALL) is

characterized by the t(9;22) translocation that generates the p190- and, less frequently,

the p210-BCR-ABL1 fusion protein, both of which have constitutive tyrosine kinase

activity (1,2). The Philadelphia chromosome is the most common cytogenetic

abnormality in adult ALL patients, occurring in about 20-30% of the cases (3,4).

The incidence of Ph+ ALL increases with age, with up to 50% being diagnosed in

patients older than 60 years (5).

Allogeneic hematopoietic stem cell transplantation (HSCT) is an effective consolidation

therapy for patients with Ph+ ALL who have achieved a complete response (CR) after

induction of remission chemotherapy (6). However, 10-20% of patients fail to achieve

CR and allogeneic HSCT is only available for patients with suitable matched donors. In

addition, the odds of treatment-related mortality as well as relapse are high (7).

The outcome of Ph+ ALL patients has improved significantly with the introduction of

imatinib and second generation TKI as a first-line therapy, especially when used in

combination with chemotherapy (8). However, resistance to TKI develops rapidly in

most Ph+ ALL patients and the 5-year overall survival is

4

STAT5 has a pivotal role in promoting cell survival and the subsequent B cell

expansion, during early B cell development. CD19-Cre-mediated deletion of STAT5A/B

in the B cell compartment impairs IL-7-activated survival pathways, blocking B cell

differentiation at the pre-pro-B stage (13-15). Of interest, the defective B-cell

development induced by genetic deletion of STAT5 was rescued by restoring

expression of STAT5-regulated BCL-2 (16).

In malignant precursor B-cells, deregulated JAK-STAT5 activity may allow survival of

leukemic cell independently of stroma-derived cytokine signals (17). The STAT5

pathway is constitutively active in Ph+ ALL and in a subset of B-ALL that contains

activating mutations in the JAK1 or JAK2 (18-20). Importantly, STAT5 can be activated

in Ph+ leukemia cells either indirectly through JAK2 phosphorylation or directly by BCR-

ABL1 since STAT5 is a known substrate of BCR-ABL1 (21), and an intact STAT5

signaling is required for maintenance of BCR-ABL1-driven leukemias (19). Furthermore,

STAT5 is a marker of disease progression in Ph+ chronic myeloid leukemia (CML),

based on correlation of high STAT5 mRNA levels with TKI resistance and advanced

disease stages, irrespective of the presence of tyrosine kinase domain (TKD) BCR-

ABL1 mutations (22, 23).

Together, these data suggest that STAT5 itself or STAT5-regulated pathways could

serve as rational targets not only to circumvent the BCR-ABL1-dependent TKI

resistance of Ph+ ALL but also to suppress growth-promoting STAT5 signals activated

through BCR-ABL1-independent mechanisms. In this study, using genetic and

pharmacological approaches, we show that STAT5 is critical for the growth of Ph+ ALL

cell lines and of newly diagnosed and relapsed/TKI-resistant patient-derived Ph+ ALL




5

cells ex vivo and in mice. Moreover, we found that the growth-promoting effects of

STAT5 depend on changes in the expression/activity of PIM-1, BIM, and BCL-2 and that

these proteins can serve as therapeutic targets ex vivo and in xenografts of patient’s

derived Ph+ ALL cells.




6

Materials and Methods

Cell lines, Ph+ primary ALL samples, and cell cultures 

The SUP-B15 cell line (Ph+ ALL) was purchased from ATCC; the Z181 cell line (Ph+

ALL) was kindly provided by Dr. Z. Estrov, (M.D. Anderson Cancer Center, Houston,

TX); the BV173 cell line (Ph+ CML-lymphoid blast crisis) (24) was kindly provided by Dr.

N. Donato (NIH, Bethesda, MD). EBV-immortalized B cells GM03798 and GM12878,

were purchased from the Coriell Institute (Camden, NJ). All these cell lines and the TKI-

resistant T315I-BV173 derivative line (25) were cultured in Iscove’s Modified Dulbecco’s

Medium (Corning) supplemented with 10% heat-inactivated fetal bovine serum (FBS)

(Biowest USA), 1% penicillin–streptomycin (Thermo Fisher Scientific) and 1% L-

glutamine (Thermo Fisher Scientific) at 37°C, 5% CO2. The Ph-like ALL MUTZ-5 and

MHH-CALL-4 cell lines were kindly provided by Dr. M. Carroll (University of

Pennsylvania, Philadelphia, PA). These lines were cultured in RPMI supplemented with

20% FBS, 1% penicillin-streptomycin, and 1% L-glutamine at 37°C, 5% CO2.

Cell lines were tested for mycoplasma every 3 months as described (26). Ph+ ALL cell

lines were routinely authenticated by monitoring B-cell markers and BCR-ABL1 isoform

expression. Ph-like cell lines were authenticated by B-cell immunophenotyping (CD19

and CD10), and by monitoring CRLF2 and phospho-STAT5 expression.

Primary adult human Ph+ ALL cells were kindly provided by: Dr. Alessandro Rambaldi

(Hematology and Bone Marrow Transplant Unit, Bergamo, Italy), Dr. Luke F. Peterson

(University of Michigan), Dr. Michael Caligiuri (City of Hope Cancer Center, CA), Dr.

Pierluigi Porcu (Thomas Jefferson University), and Dr. Martin Carroll (University of




7

Pennsylvania). Main characteristics of the samples are described in Supplementary

Table S1. G-CSF-mobilized peripheral blood CD34+ primary cells (J48 and J50) from

healthy donors were obtained from the Bone Marrow Transplantation Unit, Thomas

Jefferson University. Primary adult human Ph-like cells were provided by Dr. Pierluigi

Porcu. Primary cells were maintained in SFEM (Stem Cell Technologies) supplemented

with interleukin IL-3 (10 ng/mL), IL-6 (10 ng/mL), IL-7 (10 ng/mL), Flt3-L (20 ng/mL) and

Stem Cell Factor (30 ng/mL) (ProSpec).

Relapsed/TKI-resistant Ph+ ALL samples were assessed for the presence of ABL1 TKD

mutations by Sanger sequencing; briefly, RNA was extracted with RNAeasy plus mini kit

(Qiagen), cDNA was reverse transcribed by using Superscript III (Thermo Fisher

Scientific). The ABL1 TKD was PCR-amplified with a forward primer located on BCR

exon 1 (p190 FW: 5’-CTCGCAACAGTCCTTCGACA-3’) or with a forward primer located

on exon 12 (P210 FW: 5’-CTGCAGATGCTGACCAACTC-3’) and a common reverse

primer (TKD REV: 5’-CCTGCAGCAAGGTACTCACA-3’). Gel purified PCR products

were sequenced in both directions using TKD REV primer or TKD FW primer (5’-

CCCACTGTCTATGGTGTGTCC-3’).

Cell viability

Cell viability was assessed by MTT assay in 96-multiwell plates. Cells were seeded at a

concentration of 150,000 or 300,000 cells/ml (depending on length of the treatment and

cell line growth rate) and then treated with DMSO (Ctrl) or the specific drug. At the time

point of interest, 100 l of cell cultures were transferred in 96-multiwell plates and

incubated with 10 l of 0.5 mg/mL MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-




8

diphenyltetrazolium bromide, Sigma Aldrich) at 37 °C for three hours. Then, formazan

crystals were dissolved with 0.1 M HCl in 2-propanol and absorbance was measured at

570 nm using a QUANT microplate scanning spectrophotometer (BioTek instruments)

and KC4 V.3.4 software.

Apoptosis

Cells were incubated at 100,000/ml with 1 L of the CellEvent Caspase 3/7 Green

Detection Reagent (Thermo Fisher Scientific) for 25 min at 37 C and analyzed by flow

cytometry using a 488 nm excitation laser.

For GFP-positive cell lines, apoptosis was measured by Annexin V staning: 100,000

cells were washed in Annexin V Binding Buffer (10 mM HEPES, 140 mM NaCl, and 2.5

mM CaCl2, pH 7.4), spun and re-suspended in 50 L of Annexin V Binding Buffer, then

incubated with 1.5 L of Cy 5.5-Annexin V (BD Pharmigen) for 15 min at room

temperature (RT). Samples were analyzed by flow cytometry using a 640 nm laser.

Colony formation assays

shRNA lentivirus-transduced or drug-treated SUP-B15, BV173 or Z181 cells were

plated in methylcellulose (Stem Cell Technologies) supplemented with Iscove’s Modified

Dulbecco’s Medium, 10% heat-inactivated fetal bovine serum (FBS), 1% penicillin–

streptomycin and 1% L-glutamine. Colonies were counted 10 days later.

shRNA lentivirus-transduced or drug-treated blast cells from Ph+ ALL, Ph-like patients,

or CD34+ cells from healthy donors, were plated in methylcellulose supplemented with

SFEM, IL-3 (10 ng/mL), IL-6 (10 ng/mL), IL-7 (10 ng/mL), Flt3-L (20 ng/mL) and Stem




9

Cell Factor (30 ng/mL). Colonies were counted 7-10 days later.

Lentiviral production and cell transduction

STAT5 short hairpin RNA (shSTAT5) designed against the STAT5 mRNA sequence

ATCTGGCTTGTTAATGAGTAG (TRCN0000019356) and SCR short hairpin RNA

(shSCR) CCTAAGGTTAAGTCGCCCTCG were obtained in the pLKO.1-puro vector

(Dharmacon) and subsequently cloned in the Tet-pLKO-puro vector (Addgene,

Cambridge, MA, USA) for inducible shRNA expression, using AgeI and EcoRI restriction

enzyme sites and following Addgene’s protocols.

BIM short hairpin RNA (shBIM) designed against the BIM mRNA sequence

CCAGACCACTACTGAATATAA (TRCN0000020155) and cloned into the Tet-pLKO-

Neo lentiviral-vector were kindly provided by Dr. Z. Jagani (27).

The PIM1-s cDNA (NCBI: NM_0026483) was generated from total RNA purified from

BV173 cells and inserted in the XbaI-SalI restriction enzyme sites of the pUltra, GFP-

expressing, lentiviral vector developed by Dr. Malcolm Moore (Addgene, plasmid #

24129). The BCL2 cDNA (isoform , NM_000633.2) was PCR-amplified from reverse

transcribed total RNA of BV173 cells with a forward primer including the XbaI restriction

sequence and with a reverse primer including a HA-tag coding sequence

(TACCCATACGATGTTCCAGATTACGCT) and an EcoRI restriction site sequence. The

product was then inserted into the XbaI-EcoRI sites of the pUltra-hot, mCherry

expressing, lentiviral vector (Addgene plasmid # 24130).

The FG12 MCL-1/IRES-GFP lentivirus was kindly provided by Dr. Maria S. Soengas

(Spanish National Cancer Centre, Madrid, Spain).




10

For lentiviral production, 293T cells were transiently transfected with the indicated

plasmids, the envelope plasmid pMD2.G and the 2nd generation lentiviral packaging

plasmid psPAX2 (Addgene). Infectious supernatant was collected at 24 h, concentrated

by ultracentrifugation and used to infect Ph+ ALL cell lines or primary patient’s cells by

spinoculation. SUP-B15, BV173 and Z181 cell lines were transduced with the inducible

shSTAT5 or shBIM lentivirus and selected in the presence of puromycin (3 g/ml) or

G418 (400 g/ml) for 5 or 14 days, respectively. shRNAs (shSTAT5 or shBIM) were

induced with Doxycycline (2.5 g/ml). Due to the limited viability of primary Ph+ ALL

cells in liquid culture, these cells were transduced with the stable shSTAT5 or shSCR

pLKO.1 lentivirus 16h after thawing, and selected in the presence of puromycin.

Western blot lysates were obtained after 60 hours of puromycin selection.

For studies of PIM1-s overexpression, shSTAT5-BV173 cells were transduced with the

PIM1-s lentivirus and selected by EGFP sorting, using a BD FACSARIAII cell sorter.

For studies of MCL-1 or BCL-2 overexpression, shSTAT5-BV173 or shSTAT5-shBIM-

BV173 cells were transduced with the MCL-1 or BCL-2 lentivirus and selected by EGFP

or mCherry sorting respectively, using a BD ARIAII cell sorter.

Protein analysis

Cells were counted and lysed at a density of 10,000/L in Laemmli Buffer supplemented

with 5% -Mercaptoethanol. Lysates where run on a 4-20% gradient polyacrylamide

gels (Biorad) and transferred onto a nitrocellulose membrane (Fisher Scientific) using a

semi-dry trans-blot transfer cell (Bio-Rad). Membranes were then blocked in 5% non-fat

dry milk/TBS-T and incubated with the following primary antibodies: STAT5 (C-17)




11

(1:4000; Santa Cruz Biotechnology # sc-835), p-STAT5 (Y649) (1:1000; BD #611964),

STAT3 (1:1000; Transduction lab), β-ACTIN (8H10D10) (1:4000; Cell Signaling

#3700S) or β-ACTIN (D6A8) (1:4000; Cell signaling #8457P), BCL-2 (1:1000; BD

#610538), MCL-1 (S-19) (1:1000; Santa Cruz # sc-819), BCL-XL (1:1000; Cell Signaling

#2762S), PIM-1 (1:250; Cell Signaling #2907S), p-BAD (S112) (40A9) (1:500 Cell

Signaling #5284T), BAD (1:1000; Santa Cruz #sc-8044), p-4EBP1 (T37/46) (1:500; Cell

Signaling #236B4), 4EBP1 (1:1000; cell Signaling #9644P), p-MYC (phospho-S62)

(1:1000; Abcam #ab185656), c-MYC (N-262) (1:1000, Santa Cruz #sc-768), BIM

(1:1000; Cell Signaling #2818S), NOXA (1:500; Novus Biological #NB600-1159), PUMA

(1:1000; AbCam # ab9643).

After incubation with HRP-conjugated secondary antibodies (Thermo Fisher Scientific),

signals were visualized by chemiluminescent reaction using Supersignal West Pico or

Dura Chemiluminescent Substrates (Thermo Fisher Scientific). When different

antibodies were probed to the same nitrocellulose membrane, previous signals were

removed by incubation with 0.5% sodium azide for 10 minutes at RT or by stripping in

62 mM Tris-HCL pH 6.8, 2% SDS, 0.7% β-mercaptoethanol for 20 min at 50 C.

Quantitative PCR analysis.

RNA was isolated from shSCR-BV173 and shSTAT5-BV173 cells, untreated or

treated with Doxycycline at 2.5 μg/ml, using the RNeasy Plus Mini Kit (Qiagen,

Limburg, The Netherlands) and reverse-transcribed (2 μg) with the High-Capacity

cDNA Reverse Transcription Kit (ThermoFisher Scientific, Waltham, MA,

USA). Quantitative PCR was performed with the QuantStudio 12k Flex (Life




12

Technologies) instrument and QuantStudio 12K Flex software, using the following

primers: MYC FW 5’-GTCACACCCTTCTCCCTTCG-3’; MYC RV 5’-

ATGTCTCCTCCCAGCAGCTC-3’; TRIB3 FW 5’-TGCGTGATCTCCAAGCTGTGT-3’;

TRIB3 RV 5’-GCTTGTCCCACAGGGAATCA-3’; ITGα5 FW 5’-

GGCTTCAACTTAGACGCGGA-3’; ITGα5 RV 5’-GGCTGGCTGGTATTAGCCTT-3’;

ITGβ1 FW 5’-CCGCGCGGAAAAGATGAATTT-3’; ITGβ1 RV 5’-

CCACAATTTGGCCCTGCTTG-3’; PIM1 FW 5’-ACACGGACTTCGATGGGACC-3’;

PIM1 RV 5’-GATGGTCTCAGGGCCAAGCA-3’; IDH2 FW 5’-

GCCGGCACTTTCAAAATGG-3’T; IDH2 RV 5’-TCCTTGACACCACTGCCATC-3’;

UBC FW 5’-GTCGCAGTTCTTGTTTGTGGATC-3’; UBC RV 5’-

GTCTTACCAGTCAGAGTCTTCACGAAG-3’; GAPDH FW 5’-

CCCATCACCATCTTCCAGGAG-3’; GADPH RV 5’-CTTCTCCATGGTGGTGAAGACG-

3’.

Animals

Animal experiments were approved by Thomas Jefferson University IACUC under

protocol 00012.

For leukemogenesis assays, 106 leukemia cells (shSTAT5-cell lines or primary cells

from Ph+ ALL patients) were injected intravenously in 7- to 9-week-old NOD/SCID/IL-

2Rγnull mice (The Jackson Laboratory).

To induce STAT5 down-regulation in vivo, mice were continuously treated with

Doxycycline (2 g/L) in D(+)-sucrose-supplemented (30 g/L) drinking water starting 72

hours post-cell injection.




13

IST5-002 was dissolved in 0.2% hydroxypropyl methylcellulose and administered

intraperitoneally (50 or 100 mg/kg) daily for a total of 14 days.

Sabutoclax (5 mg/kg; ApexBio) was dissolved in 10% Kolliphor-EL (Sigma-Aldrich)-10%

ethanol-80% PBS and administered intraperitoneally every other day for a total of seven

doses (14 days).

AZD1208 (100 mg/Kg; SelleckChem) was dissolved in 0.5% hydroxypropyl

methylcellulose-0.1% Tween 80 and administrated by oral gavage every day for 14

days.

Leukemia formation was monitored by flow cytometry detection of the human CD19

antigen (by antibody #555415 from BD Bioscience) in peripheral blood obtained by retro

orbital bleeding.

Statistical analyses

Data, expressed as mean s.d. of three experiments, were analyzed for statistical

significance by unpaired, two-tailed Student's t-test. P

14

Results

STAT5 silencing decreases cell growth, increases apoptosis, and suppresses

leukemogenesis of Ph+ ALL cells

To investigate the role of STAT5 in Ph+ ALL, we transduced human Ph+ leukemia cell

lines BV173, SUP-B15 and Z181 with a lentiviral plasmid carrying a doxycycline (Doxy)-

inducible shSTAT5 (shSTAT5-Tet-pLKO) and assessed cell growth and survival upon

Doxy treatment.

Doxy treatment induced a decrease in STAT5 expression in each cell line (Fig. 1A).

However, the effect was more pronounced in BV173 cells and became detectable after

a 72 h treatment due to the long half-life of the STAT5 protein (29). As control, levels of

STAT3 were not affected by the Doxy-induced shSTAT5 (Fig. 1A).

STAT5 silencing markedly reduced cell growth of all three lines, but the effect was more

evident in BV173 cells (Fig. 1B), probably reflecting the near complete inhibition of

STAT5 expression in these cells (see Fig. 1A).

STAT5 silencing caused a marked increase in the apoptosis of BV173 and SUP-B15

cell lines measured by flow cytometry detection of Caspase 3/7 activation (Fig. 1C).

Apoptosis was detected at 72 h and increased after a 96 and 120 h of Doxy treatment,

consistent with the kinetics of Doxy-induced STAT5 downregulation. In BV173 cells,

apoptosis induced by STAT5 silencing for 72-120 h ranged from 46% to 95%, while in

SUP-B15 cells, at the same time points, it ranged from 20% to 26%. Compared to

control cells, induction of apoptosis in STAT5-silenced Z181 cells was not statistically

significant.




15

The dependence of Ph+ ALL cell lines on STAT5 expression was also assessed by

methylcellulose colony formation assays. These assays revealed that Doxy-treated,

STAT5-silenced BV173, SUP-B15 and Z181 cells were markedly less clonogenic than

the untreated counterparts (Fig. 1D). Doxy treatment had no effect on STAT5

expression, apoptosis, or colony formation of shScramble-transduced Ph+ ALL cells

(Supplementary Fig. S1A-C).

Next, we assessed STAT5 requirement for leukemia development in NOD/SCID-IL-

2Rγnull (NSG) mice injected with Ph+ BV173, SUP-B15, or Z181 cells transduced with

the Doxy inducible shSTAT5 lentivirus. Mice were injected in the tail vein with 106 cells

and, starting at day 7, Doxy was added to the drinking water while control mice were left

untreated. Control mice injected with shSTAT5-BV173 or SUP-B15 cells died of

leukemia (bone marrow heavily infiltrated by leukemic cells and splenomegaly) within 60

days of leukemic cell injection (median survival = 58 days). Mice injected with shSTAT5-

BV173 cells and given Doxy to induce STAT5 silencing survived up to 188 days with a

median survival of 162 days; such increase in overall survival was statistically significant

(p< 0.001) (Fig. 1E). Mice injected with shSTAT5-SUP-B15 cells and treated with Doxy

survived up to 105 days with a median survival of 82 days which is significantly longer

of that of the untreated mice (median survival = 55 days; p< 0.001) (Fig. 1E). Doxy

treatment also induced a statistically significant increase in the survival of NSG mice

injected with shSTAT5-Z181 cells (Fig. 1E). Untreated mice injected with shSTAT5-

Z181 cells survived significantly longer (median survival = 102 days) than those injected

with shSTAT5-BV173 or SUP-B15 cells; however, Doxy-treated mice injected with

shSTAT5-Z181 cells survived more than 180 days (Fig. 1E).




16

To further evaluate the requirement for STAT5 expression for growth of primary Ph+

ALL cells we utilized colony formation assays of patient-derived primary Ph+ ALL cells.

For these assays, peripheral blood blast cells from four Ph+ ALL patients, two newly

diagnosed (ALL #004 and ALL #011) and two from relapsed ALL post therapy with TKIs

(ALL #5775 and ALL #3961) were transduced with a lentivirus constitutively expressing

a STAT5 shRNA used to silence STAT5 expression in K562 cells (30), or a scramble

shRNA and plated (105 cells/plate) in methylcellulose in the presence of puromycin. As

shown in Fig. 2A, STAT5 expression was downregulated in shSTAT5 lentivirus-

transduced cells from each patient (left panels). Expression of STAT5-regulated BCL-2

and MCL-1 was also downregulated in STAT5-silenced samples, except for BCL-2 in

sample ALL #004. Importantly, STAT5-silenced cells from patient’s samples were

markedly less clonogenic than the scramble-transduced counterparts (Fig. 2A, right

panels).

Of interest, suppression of colony formation and a marked decrease of BCL-2 and MCL-

1 levels compared to the scramble-transduced counterpart was also observed in

STAT5-silenced blast cells from a patient with Ph-like ALL (#005, Supplementary Table

S2) (Fig. 2B).

Pharmacological inhibition of phospho-STAT5 suppresses Ph+ ALL growth ex

vivo and in mice

In silico screening of chemical structure databases has recently identified IST5-002 as a

candidate small molecule inhibitor of STAT5 (31). Such activity was confirmed based on

its ability to suppress JAK2 and BCR-ABL1-mediated STAT5 phosphorylation,




17

STAT5A/B dimerization, and to inhibit the transcriptional activity of STAT5A and

STAT5B (31).

Thus, we assessed if IST5-002 can mimic the ex vivo and in vivo effects of STAT5

silencing in Ph+ ALL cells. Treatment with IST5-002 markedly suppressed the growth of

Ph+ cell lines, including the TKI-resistant T315I BV173 derivative (Supplementary Fig.

S2). IST5-002-induced growth suppression was associated with markedly decreased

STAT5 phosphorylation (Supplementary Fig. S2).

More importantly, treatment with IST5-002 also suppressed STAT5 phosphorylation and

colony formation of leukemic blasts from eight Ph+ ALL patients (Fig. 3A and 3B),

including five samples (ALL #2534, ALL #5775, ALL #1577, ALL#27574 and ALL

#3961) from patients with relapsed leukemia post-therapy with TKIs.

The Ph-like ALL cell lines MUTZ-5 and MHH-CALL-4 exhibit expression of phospho-

STAT5 (Supplementary Fig. S3A) driven by the IGH/CRLF2 translocation and JAK2

mutation (32). Treatment with IST5-002 suppressed STAT5 phosphorylation and growth

of these cell lines (Supplementary Fig. S3B) as well as STAT5 phosphorylation and

colony formation of a primary Ph-like ALL sample (#005) also carrying the IGH/CRLF2

translocation (Supplementary Table 2) (Supplementary Fig. S3C).

To assess whether IST5-002 treatment has detrimental effects on normal hematopoietic

cells, we performed colony formation assays of cytokine-treated stem cell-enriched G-

CSF-mobilized CD34+ cells, samples J48 and J50, from two healthy donors. Treatment

with IST5-002 (5 or 10µM) suppressed cytokine-dependent STAT5 phosphorylation in

both samples (Supplementary Fig. S4); however, IST5-002 had no effect on colony




18

formation at the 5 µM concentration and partially reduced colony formation in sample

J50 only at the 10µM concentration (Supplementary Fig. S4).

Then, we tested whether treatment with IST5-002 suppressed leukemogenesis in NSG

mice injected with Ph+ ALL cells. For these experiments, we used the Ph+ ALL SUP-

B15 cell line and primary cells from a patient with a TKI-resistant Ph+ ALL with the

T315I ABL1 kinase domain mutation.

In the SUP-B15 model, mice were treated with vehicle only or with 50 mg/kg of IST5-

002 for 14 consecutive days starting 7 days after cell injection. Vehicle-treated mice had

a median survival of 56 days; by contrast, mice treated with IST5-002 survived up to 89

days, with a median survival of 68 days (p

19

The growth suppression of Ph+ ALL cells induced by STAT5 silencing is largely caused

by enhanced apoptosis (Fig. 1C). Thus, we assessed the expression of members of the

BCL-2 family, some of which were previously reported to be regulated by STAT5 (33-

36); such analysis is a necessary first step to further investigate if there is a functional

link between changes in the expression of BCL-2 family proteins and apoptosis induced

by STAT5 silencing. Compared to the untreated counterparts, Doxy-treated shSTAT5-

BV173, shSTAT5-SUP-B15, and shSTAT5-Z181 cells exhibited a decrease in the

expression of anti-apoptotic BCL-2 and MCL-1 proteins (Fig. 4A). Decreased

expression of anti-apoptotic BCL-2 and MCL-1 proteins was also observed in STAT5-

silenced Ph+ primary ALL cells and the Ph-like primary sample #005 (Fig. 2).

Doxy-treated shSTAT5-BV173, shSTAT5-SUP-B15, and shSTAT5-Z181 cells also

exhibited an increase in the expression of the BH3-only pro-apoptotic BIM protein,

although such an increase was detected at 72 but not at 96 h in Z181 cells (Fig. 4A).

Expression of anti-apoptotic BCL-XL protein was unchanged (Fig, 4A).

To investigate whether increased BIM expression can explain the enhanced apoptosis

of STAT5-silenced Ph+ ALL cells, we generated the shSTAT5-BV173 derivative cell line

transduced with a Doxy-regulated BIM shRNA lentivirus (shSTAT5-shBIM-BV173 line)

(Fig. 4B) and assessed apoptosis induced by STAT5 silencing. As shown in Fig. 4C-D

and Supplementary Fig. S5, downregulation of BIM expression suppressed apoptosis

induced by STAT5 silencing; however, a fraction of Doxy-treated shSTAT5-shBIM

BV173 cells were apoptotic at 96 h (Fig. 4D), in spite of apparently complete inhibition

of BIM expression (Fig. 4B). Next, we generated the shSTAT5-BCL-2-BV173 or the

shSTAT5-MCL-1-BV173 derivative line (Fig. 4E, left panel) and assessed whether




20

restoring BCL-2 or MCL-1 expression would also rescue the apoptosis of STAT5-

silenced BV173 cells. In these lines, we assessed apoptosis only by Annexin V staining

because GFP expression does not allow to measure active Caspase 3/7. As shown in

Fig. 4C and 4D, expression of BCL-2 was as effective as BIM silencing in inhibiting

apoptosis induced by STAT5 silencing while the effect of MCL-1 expression was

negligible. Based on these findings, we generated the shSTAT5-shBIM-BCL-2-BV173

and the shSTAT5-shBIM-MCL-1-BV173 derivative lines (Fig. 4E, right panel) and asked

whether combining BIM silencing with BCL-2 or MCL-1 expression would be more

effective than BIM silencing or BCL-2/MCL-1 expression alone in blocking apoptosis

induced by STAT5 silencing. As shown in Fig. 4C and 4D, combining BIM silencing with

BCL-2 or MCL-1 expression rescued almost completely the apoptosis of STAT5-

silenced BV173 cells.

Role of the STAT5-regulated PIM-1 gene in the growth of Ph+ ALL cells.

In a previous study (31), we performed oligonucleotide microarray hybridization to

generate the gene expression profile of STAT5-silenced Ph+ K562 cells. Thus, we

assessed whether the expression of select STAT5-regulated genes identified in K562

cells was also modulated in STAT5-silenced BV173 cells. As shown in Supplementary

Fig. S6, expression of MYC, TRIB3, ITGB1, IDH2, ITGA5, PIM1 was markedly reduced

in STAT5-silenced BV173 cells, compared to control cells. Then, we focused on STAT5-

regulated PIM-1 because of: i) its established oncogenic effects (35); ii) commercially

available compounds that inhibit PIM-1 and PIM-2 (37-39); iii) the efficacy of the




21

selective PIM kinase inhibitor AZD1208 in pre-clinical models of acute myeloid leukemia

(40).

First, we assessed if PIM-1 protein levels were reduced in STAT5-silenced Ph+ ALL cell

lines. Doxy-treated shSTAT5 Ph+ cell lines all showed decreased expression of the

short isoform of PIM-1 (PIM1-s) (Supplementary Fig. S7A).

Expression of PIM1-s in blast cells from patients with Ph+ ALL showed sample-to-

sample variation; however, it correlated well with levels of total and tyrosine

phosphorylated STAT5 (Supplementary Fig. S7B).

Of interest, levels of PIM1 and STAT5A and STAT5B mRNAs were also correlated in

microarray dataset from patients with acute B-cell leukemia; in the Ph+ subset only the

STAT5A-PIM1 correlation was statistically significant (Supplementary Fig. S7C-F).

However, assessing levels of phospho-STAT5 is likely to be more informative than

evaluating mRNA levels in correlative studies (41).

Then, we asked whether restoring PIM-1s expression in STAT5 silenced BV173 cells

would rescue the growth inhibition of these cells. PIM-1s overexpression did not

enhance the overall growth of STAT5-silenced BV173 cells because apoptosis and BIM

expression induced by STAT5 silencing was not rescued (Supplementary Fig. S8A-B).

These findings indicate that STAT5 activation downstream of BCR-ABL1 promotes

growth and survival of Ph+ ALL cells through different effectors.

The role of the PIM-1 kinase in Ph+ ALL cells was assessed by pharmacological

inhibition with the pan-PIM inhibitor AZD1208 (40).

BV173, SUP-B15, and Z181 cell lines were treated with 3 M AZD1208 and PIM

kinase-regulated pathways were analyzed by western blotting (Fig. 5A).




22

Previous studies showed that PIM-1 stabilizes c-MYC expression through

phosphorylation of Serine 62 (42, 43). Consistent with these findings, AZD1208-treated

BV173, SUP-B15 or Z181 cells exhibited reduced levels of phospho (S62) MYC, but

total levels of c-MYC were little changed (Fig. 5A).

Phosphorylation of BAD by PIM-1 at Serine 112 is a mechanism through which BAD is

sequestered in the cytoplasm in complex with 14-3-3 allowing mitochondrial BCL-2 to

suppress BAX-dependent apoptosis (44).

As expected, treatment of Ph+ ALL cell lines with AZD1208 led to a decrease in S112

phosphorylation with no changes in total levels of BAD (Fig. 5A). Expression of NOXA

was low or undetectable and the expression of both PUMA and NOXA was not induced

by AZD1208 treatment (Fig. 5A)

The translation regulator eukaryotic elongation factor 4E-BP1 is also regulated by PIM

kinases, directly at the Threonines 37/46 priming sites and indirectly via mTOR-

dependent mechanisms, causing the dissociation from eukaryotic initiation factor 4, and

promoting the activation of cap-dependent translation (45-47).

Multiple bands, indicative of hyperphosphorylated 4E-BP1, were detected in untreated

BV173, SUP-B15 and Z181 cells (Fig. 5A). Treatment with AZD1208 induced a marked

decrease of phospho (T37/46)-4E-BP1 expression in SUP-B15, BV173 and Z181 cells

(Fig. 5A) but total 4E-BP1 levels did not change (Fig. 5A).

Consistent with the effect of AZD1208 in Ph+ ALL cell lines, AZD1208-treated blast cells

from three Ph+ ALL patients also showed decreased phosphorylation of BAD (S112), c-

MYC (S62) and 4E-BP1 (T37/46) (Fig. 5B). Levels of total BAD and 4E-BP1 remained

unchanged (Fig. 5B)




23

Of interest, STAT5 silencing in BV173, SUP-B15, or Z181 cells had effects similar to

those of AZD1208 treatment on the phosphorylation of c-MYC (S62), 4E-BP1 (T37/46),

and BAD (S112) (Fig. 5C), likely reflecting downregulation of PIM-1 levels. However,

total levels of c-MYC were markedly reduced only after STAT5 silencing, suggesting

that STAT5 regulates c-MYC expression through multiple pathways, including enhanced

transcription (see Supplementary Fig. S6).

Together, these data indicate that PIM-1 might regulate cell growth of Ph+ ALL cells via

activation of multiple pathways and suggest that pharmacological inhibition of PIM-1

could suppress Ph+ ALL cell growth.

The PIM kinase inhibitor AZD1208 cooperates with the BCL-2 family antagonist

Sabutoclax to suppress Ph+ ALL cell growth ex vivo and in NSG mice

Changes in the expression of BCL-2 and BIM appear to be essential for the apoptosis of

STAT5-silenced Ph+ ALL cells (Fig. 4) and several growth-promoting pathways are

suppressed in these cells by pharmacological inhibition of STAT5-regulated PIM kinase

(Fig. 5). Thus, we tested the effects of the PIM kinase inhibitor AZD1208 and the pan-

BCL-2 family inhibitor Sabutoclax in Ph+ ALL cells ex vivo and in NSG mice.

Sabutoclax functions as a BH3 mimetic that, like BIM, binds anti-apoptotic members of

the BCL-2 family (BCL-2, BCL-XL, MCL-1) blocking their anti-apoptotic activity (48, 49).

MTT assays revealed that treatment with AZD1208 or Sabutoclax suppressed the

growth of BV173, SUP-B15, and Z181 cells, including the TKI resistant BV173 (T315I)

cell line and that the combined treatment was more effective than either drug alone




24

(Supplementary Fig. S9A-D), suggesting that these drugs target non-overlapping

pathways.

While treatment with Sabutoclax alone strongly increased apoptosis in each Ph+ ALL

cell line, treatment with AZD1208 alone did not. However, the AZD1208/Sabutoclax

combination further increased apoptosis in BV173, BV173 (T315I), SUP-B15, and Z181

cells (Supplementary Fig. S9E-H). These findings suggest that suppressing PIM kinase

signaling (e.g., phosphorylation of BAD) is insufficient to provide a strong apoptotic

signal, but it enhanced apoptosis induced by the BCL-2 family antagonist Sabutoclax.

These findings also suggest that the AZD1208/Sabutoclax combination may inhibit

synergistically the growth of Ph+ ALL cells.

Thus, Ph+ ALL cell lines were treated with three doses of AZD1208 and/or Sabutoclax,

and the effects on cell growth were analyzed by MTT assay (Supplementary Fig. S10A-

D). Combination indexes (C.I.) were calculated using CompuSyn software and plotted in

Supplementary Fig. S10E-H.

The combined treatment had synergistic effects at all drug concentrations except one in

parental and TKI-resistant BV173 cells and in Z181 cells while the effect was

predominantly additive in SUP-B15 cells (Supplementary Fig. S10E-H).

Interestingly, co-treatment with the two drugs also enhanced apoptosis of Ph-like

MUTZ-5 and MHH-CALL-4 cell lines compared to treatment with AZD1208 or

Sabutoclax alone (Supplementary Fig. S11).

To further analyze the efficacy of the combined AZD1208/Sabutoclax treatment on Ph+

ALL cells, we performed methylcellulose colony assays of drug-treated BV173, BV173

(T315I), SUP-B15 cell lines, and nine primary samples from Ph+ ALL patients. These




25

samples are from six newly diagnosed and three relapsed/TKI-resistant ALL patients

(Sample #557 expresses the p210 isoform and carries the T315I ABL1 mutation;

sample #3961 expresses the p190 isoform and carries the T315I mutation; and sample

#11463 expresses the p190 isoform with no mutations detected in the TKD). Treatment

with AZD1208 or Sabutoclax alone suppressed, with varying degrees, colony formation

in each case, with the exception of Sabutoclax treatment of ALL samples #1539 and

#3934, but the most marked effect was observed when the two drugs were used in

combination (Fig. 6A and B).

Next, we assessed the effect of the AZD1208/Sabutoclax combination in leukemia

progression in vivo. NSG mice were injected with Ph+ ALL #004, #536 or #557 (T315I)

cells and, when peripheral blood CD19+ cells were 5-20%, mice were treated for 14

days with AZD1208 alone, Sabutoclax alone, or with both drugs. Then, peripheral blood

leukemia burden was assessed; the AZD1208/Sabutoclax combination was more

effective than either drug alone in suppressing Ph+ ALL, resulting in leukemia burdens

lower than those observed before the treatment, in each Ph+ ALL sample (Fig. 7A and

B).




26

Discussion

In this study, we assessed the dependence of Ph+ ALL cells on the expression/activity

of STAT5 and its downstream effectors and used such knowledge for targeted therapy

of Ph+ ALL in patient-derived xenografts.

The role of STAT5 for in vivo maintenance of oncogenic Abl-driven ALL was previously

investigated in p210-BCR-ABL1 or v-Abl-induced leukemia upon conditional deletion of

STAT5A/B (18, 19, 50). STAT5 expression was found to be dispensable for p210-BCR-

ABL1-driven B-cell leukemia in Balb/c mice while STAT5A/B deletion markedly

suppressed v-Abl- and p190-BCR-ABL1-driven B-cell leukemia in C57BL/6 mice (18,

19, 50). Whether such outcomes reflect differences in genetic background of recipient

mice and/or biological properties of p210-BCR-ABL1 versus v-Abl-transformed B-cell

precursors is, at the moment, unclear.

Despite the potential relevance of STAT5 in BCR-ABL1-driven leukemia, the role of

STAT5 expression has not been previously assessed in human Ph+ ALL cells. Using

Ph+ ALL cell lines expressing a Doxy-regulated shSTAT5 which inhibits the expression

of both STAT5 isoforms, we show here that downregulation of STAT5 expression leads

to markedly decreased proliferation and colony formation, induction of apoptosis, and

significantly prolonged survival of NSG mice injected with Ph+ ALL cells. Of interest,

FACS-sorted CD19+ BV173 isolated from the bone marrow of a mouse which

developed leukemia, in spite of being continuously treated with Doxy, expressed STAT5

suggesting that re-expression of STAT5 caused the re-growth of Ph+ ALL.




27

STAT5-silenced primary Ph+ ALL cells from patients with newly diagnosed or

relapsed/TKI-resistant disease were markedly less clonogenic than the empty vector-

transduced counterpart.

Of interest, STAT5 silencing also suppressed colony formation from blast cells of a

patient with IGH/CRLF2-positive Ph-like ALL.

Based on these findings, we assessed the reliance of Ph+ ALL cells on STAT5 activity

by ex vivo and in vivo assays using IST5-002, a small molecule inhibitor of STAT5A/B

tyrosine phosphorylation and dimerization, recently identified through structure-based in

silico screening of compounds binding to the STAT5 SH2 domain (31).

Such STAT5 inhibitor was highly effective in suppressing colony formation and

proliferation of Ph+ and Ph-like ALL cells while sparing a large fraction of normal stem

cell-enriched CD34+ hematopoietic cells, in spite of suppressing STAT5

phosphorylation very effectively also in these cells. The in vivo effects of IST5-002 were

more modest of those induced by STAT5 silencing; since it is unclear whether any of

the commercially available STAT5 inhibitors, including IST5-002, will be ever used in

clinical trials, we investigated if Ph+ ALL cells are dependent on STAT5-regulated

pathways that may provide alternative targets for the therapy of Ph+ ALL. Targeting

such pathways should phenocopy, in part, the effects induced by STAT5 silencing or

pharmacological inhibition.

We found that the marked apoptosis induced by silencing STAT5 expression in Ph+

BV173 cells was largely dependent on downregulation of BCL-2 or upregulation of pro-

apoptotic BIM while modulating MCL-1 expression had negligible effects. While these

findings suggest that levels of BCL-2 and BIM are critical for STAT5-regulated survival




28

of BV173 cells, other Ph+ ALL cell lines and patients’-derived primary ALL cells may

have different requirements for STAT5-regulated BCL-2 family members. In particular,

this would not be surprising based on our findings that levels of BCL-2 family members

exhibit wide variations in Ph+ ALL cells (51).

The growth and colony formation of Ph+ ALL cells, including those derived from blast

cells of newly diagnosed or relapsed/TKI-resistant Ph+ ALL patients, was also markedly

suppressed by pharmacological inhibition of the STAT5-regulated PIM1 kinase.

However, restoring PIM1 expression was insufficient to rescue the impaired growth of

STAT5-silenced BV173 cells. These findings suggest that the anti-apoptotic signals that

may be mediated by the PIM1 kinase through phosphorylation of the BH3-only protein

BAD cannot compensate for the increased expression of BIM protein induced by STAT5

silencing.

On the other hand, PIM kinase inhibition suppressed growth-promoting pathways

dependent on c-MYC expression and 4EBP-1 phosphorylation (42,45-47), likely

explaining the ex vivo growth inhibitory effects of AZD1208 in Ph+ ALL cells.

Given that that Ph+ ALL cells rely for their growth on the expression/activity of STAT5-

regulated effectors that can be targeted pharmacologically, we assessed the growth of

Ph+ ALL cells ex vivo and in NSG mice, upon treatment with the PIM kinase inhibitor

AZD1208 and the pan-BCL-2 inhibitor Sabutoclax.

In most Ph+ ALL samples, including three samples from patients with relapsed/TKI-

resistant disease, co-treatment with Sabutoclax and AZD1208 had synergistic or

additive growth-suppressive effects compared to the treatment with single agents; these




29

findings are not surprising since AZD1208 and Sabutoclax inhibit non-overlapping

pathways regulated, at least in part, by STAT5 in Ph+ ALL cells.

The additive growth-suppressive effect of the AZD1208/Sabutoclax combination was

also detected in vivo by leukemogenesis assays in NSG mice injected with three Ph+

ALL primary samples, including sample #557 which carries the TKI-resistant T315I

mutation.

Although these assays are not directly comparable, it should be noted that in vivo

growth suppression by treatment with AZD1208 or Sabutoclax alone did not correlate

exactly with data from colony formation assays. In particular, leukemia load was

markedly suppressed by treatment with Sabutoclax alone while treatment with AZD1208

alone was effective only in one of three Ph+ ALL samples, in contrast to the statistically

significant inhibition of colony formation induced by AZD1208 in eight of nine samples.

While these data point to the need of performing additional studies to assess to extent

to which treatment with AZD1208 suppresses Ph+ ALL growth ex vivo, they support the

main finding of our in vivo studies which is the marked suppression of leukemia load

induced by the AZD1208/Sabutoclax combination.

In summary, our data indicate that targeting STAT5 or STAT5-regulated pathways by

pharmacological approaches might provide an alternative treatment for patient with Ph+

ALL, especially those with relapsed or TKI-resistant disease.




30

Acknowledgments

This work was supported, in part, by NCI grant RO1-CA167169 (B. Calabretta), RO1-

CA113580 (M.T. Nevalainen), and R21CA178755 (M.T. Nevalainen). We thank Dr.

C.M. Eischen for critically reviewing the article. We thank Dr. Z. Jagani (Novartis,

Cambridge, MA) for kindly providing the Tet-pLKO-Neo shBIM lentiviral vector, Dr. M.

Carroll from the Stem Cell and Xenograft Core of the University of Pennsylvania for

providing primary Ph+ ALL samples and Dr. N. Flomenberg and the Bone Marrow

Transplantation unit at Thomas Jefferson University for providing CD34+ human

hematopoietic progenitor cells.




31

References

1. Faderl S, Kantarjian HM, Talpaz M, Estrov Z. Clinical significance of cytogenetic

abnormalities in adult acute lymphoblastic leukemia. Blood. 1998;91:3995-4019.

2. Lugo TG, Pendergast AM, Muller AJ, and Witte ON. Tyrosine kinase activity and

transformation potency by bcr-abl oncogene products. Science. 1990. 247:1079-

1082.

3. Wetzler M, Dodge RK, Mrozek K, Carroll AJ, Tantravahi R, Block AW, et al.

Prospective karyotype analysis in adult acute lymphoblastic leukemia: the cancer

and leukemia Group B experience. Blood. 1999. 93:3983-93.

4. Gleissner B, Gokbuget N, Bartram CR, Janssen B, Rieder H, Janssen JW, et al.

Leading prognostic relevance of the BCR-ABL translocation in adult acute B-

lineage lymphoblastic leukemia: a prospective study of the German Multicenter

Trial Group and confirmed polymerase chain reaction analysis. Blood. 2002.

99:1536-43.

5. El Fakih R, Jabbour E, Ravandi F, Hassanein M, Anjum F, Ahmed S, and

Kantarjian H. Current paradigms in the management of Philadelphia

chromosome positive acute lymphoblastic leukemia in adults. American J.

Hematol. 2017. Am J Hematol. 2017 Oct 3. doi: 10.1002/ajh.24926. [Epub ahead

of print]

6. Bassan R, Rossi G, Pogliani EM, Di Bona E, Angelucci E, Cavattoni I, et al.

Chemotherapy-phased imatinib pulses improve long-term outcome of adult




32

patients with Philadelphia chromosome-positive acute lymphoblastic leukemia:

Northern Italy Leukemia Group protocol 09/00. J Clin Oncol. 2010. 28(22):3644-52.

7. Stirewalt DL, Guthrie KA, Beppu L, Bryant EM, Doney K, Gooley T, et al.

Predictors of relapse and overall survival in Philadelphia chromosome-positive

acute lymphoblastic leukemia after transplantation. Biology of Blood and Marrow

Transplantation. 2003. 9:206-12.

8. Yanada M, Takeuchi J, Sugiura I, Akiyama H, Usui N, Yagasaki F, et al. High

complete remission rate and promising outcome by combination of imatinib and

chemotherapy for newly diagnosed BCR-ABL-positive acute lymphoblastic

leukemia: a phase II study by the Japan Adult Leukemia Study Group. J. Clin.

Oncol. 2006. 24:460-6

9. Rowe JM, Buck G, Burnett AK, Chopra R, Wiernik PH, Richards SM, et al.

Induction therapy for adults with acute lymphoblastic leukemia: results of more

than 1500 patients from the international ALL trial: MRC UKALL XII/ECOG

E2993. Blood. 2005;106:3760-7

10. Dores GM, Devesa SS, Curtis RE, Linet MS, Morton LM. Acute leukemia

incidence and patient survival among children and adults in the United States,

2001-2007. Blood 2012;119:34-43

11. Pulte D, Jansen L, Gondos A, Katalinic A, Barnes B, Ressing M, et al. Survival of

adults with acute lymphoblastic leukemia in Germany and the United States.

PloS One. 2014;9:e85554

12. Soverini S, De Benedittis C, Papayannidis C, Paolini S, Venturi C, Iacobucci I, et

al. Drug resistance and BCR-ABL kinase domain mutations in Philadelphia




33

chromosome-positive acute lymphoblastic leukemia from the imatinib to the

second-generation tyrosine kinase inhibitor era: The main changes are in the

type of mutations, but not in the frequency of mutation involvement. Cancer

2014.120:1002-9.

13. Goetz CA, Harmon IR, O'Neil JJ, Burchill MA, and Farrar MA. STAT5 activation

underlies IL7 receptor-dependent cell development. J. Immunol. 2004. 172:

4770-4778.

14. Dai X, Chen Y, Di L, Podd A, Li G, Bunting KD, et al. Stat5 is essential for early

B cell development but not for B cell maturation and function. J. Immunol. 2007.

179: 1068-1079.

15. Malin S, McManus S, and Busslinger M. STAT5 in B cell development and

leukemia. Curr. Opin. Immunol. 2010. 22: 168-176.

16. Malin S, McManus S, Cobaleda C, Novatchkova M, Delogu A, Bouillet P, et al.

Role of STAT5 in controlling cell survival and immunoglobulin gene

recombination during pro-B cell development. Nat. Immunol. 2010. 11: 171-179.

17. Roberts KG, Morin RD, Zhang J, Hirst M, Zhao Y, Su X, et al. Genetic alterations

activating kinase and cytokine receptor signaling in high-risk acute lymphoblastic

leukemia. Cancer Cell. 2012. 22:153-166.

18. Hoelbl A, Kovacic B, Kerenyi MA, Simma O, Warsch W, Cui Y, et al. Clarifying

the role of Stat5 in lymphoid development and Abelson-induced transformation.

Blood. 2006;107:4898-906.




34

19. Hoelbl A, Schuster C, Kovacic B, Zhu B, Wickre M, Hoelzl MA, et al. Stat5 is

indispensable for the maintenance of bcr/abl-positive leukaemia. EMBO Mol.

Med. 2010.2:98-110

20. Schwaller J, Parganas E, Wang D, Cain D, Aster JC, Williams IR, et al. Stat5 is

essential for the myelo- and lymphoproliferative disease induced by TEL/JAK2.

Mol. Cell. 2000. 6:693-704.

21. Xie S, Wang Y, Liu J, Sun T, Wilson MB, Smithgall TE, et al. Involvement of Jak2

tyrosine phosphorylation in Bcr-Abl transformation. Oncogene 2001.20:6188-95

22. Nelson EA, Walker SR, Weisberg E, Bar-Natan M, Barrett R, Gashin LB, et al.

The STAT5 inhibitor pimozide decreases survival of chronic myelogenous

leukemia cells resistant to kinase inhibitors. Blood. 2011;117:3421-9

23. Warsch W, Kollmann K, Eckelhart E, Fajmann S, Cerny-Reiterer S, Holbl A, et al.

High STAT5 levels mediate imatinib resistance and indicate disease progression

in chronic myeloid leukemia. Blood. 2011.117:3409-20.

24. Pegoraro L, Matera L, Ritz J, Levis A, Palumbo A, and Biagini G. Establishment

of a Ph1-positive human cell line (BV173). J. Natl. Cacer. Inst.1987. 70: 447-453.

25. Wu, J, Meng F, Ying Y, Peng Z, Daniels L, Bornmann WG, et al. ON012380, a

putative BCR-ABL kinase inhibitor with a unique mechanism of action in imatinib-

resistant cells. Leukemia. 2010. 24: 869-872.

26. Young L, Sung J, Stacey G, Masters JR. Detection of Mycoplasma in cell

cultures. Nature protocols. 2010. 5:929-34




35

27. Jagani Z, Wiederschain D, Loo A, He D, Mosher R, Fordjour P, et al. The

Polycomb group protein Bmi-1 is essential for the growth of multiple myeloma

cells. Cancer Res. 2010.70:5528-38.

28. Chou TC. Drug combination studies and their synergy quantification using the

Chou-Talalay method. Cancer Res. 2010;70:440-6.

29. Chia DJ, Subbian E, Buck TM, Hwa V, Rosenfeld RG, Skach WR, et al. Aberrant

folding of a mutant Stat5b causes growth hormone insensitivity and proteasomal

dysfunction. J. Biol. Chem. 2006;281:6552-8.

30. Soliera AR, Mariani SA, Audia A, Lidonnici MR, Addya S, Ferrari-Amorotti G, et

al. Gfi-1 inhibits proliferation and colony formation of p210BCR/ABL-expressing

cells via transcriptional repression of STAT 5 and Mcl-1. Leukemia. 2012.

26(7):1555-63.

31. Liao Z, Gu L, Vergalli J, Mariani SA, De Dominici M, Lokareddy RK, et al.

Structure-based screen Identifies a potent small molecule Inhibitor of Stat5a/b

with therapeutic potential for prostate cancer and chronic myeloid leukemia. Mol.

Cancer Ther. 2015. 14:1777-93.

32. Tasian SK, Doral MY, Borowitz MJ, Wood BL, Chen IM, Harvey RC, et al.

Aberrant STAT5 and PI3K/mTOR pathway signaling occurs in human CRLF2-

rearranged B-precursor acute lymphoblastic leukemia. Blood. 2012. 120: 833-

842.

33. Yoshimoto G, Miyamoto T, Jabbarzadeh-Tabrizi S, Iino T, Rocnik JL, Kikushige

Y, et al. FLT3-ITD up-regulates MCL-1 to promote survival of stem cells in acute




36

myeloid leukemia via FLT3-ITD-specific STAT5 activation. Blood. 2009. 114:

5034-5043.

34. Gesbert F and Griffin JD. Bcr/Abl activates transcription of the Bcl-X gene

through STAT5. Blood. 2000. 96: 2269-2276.

35. Lord JD, McIntosh BC, Greenberg PD, Nelson BH. The IL-2 receptor promotes

lymphocyte proliferation and induction of the c-myc, bcl-2, and bcl-x genes

through the trans-activation domain of Stat5. J Immunol. 2000. 164:2533-41.

36. Nawijn MC, Alendar A, and Berns A. For better or for worse: the role of Pim

oncogenes in tumorigenesis. Nat. Rev. Cancer. 2011. 11: 23-34.

37. Chen LS, Redkar S, Bearss WG, Wierda NG, and Gandhi V. Pim kinase inhibitor,

SGI-1776, induces apoptosis in chronic lymphocytic leukemia cells. Blood. 2009.

114: 4150-4157.

38. Xia Z, Knaak C, Ma J, Beharry ZM, Mciness C, Wang W, et al. Synthesis and

evaluation of novel inhibitors of PIM-1 and PIM-2. J. Med. Chem. 2009. 52: 74-

86.

39. Curi DA, Beauchamp EM, Blyth GT, Arslan AD, Donato NJ, Giles FJ et al. Pre-

clinical evidence of PIM kinase inhibitor activity in BCR-ABL1 unmutated and

mutated Philadelphia chromosome-positive (Ph+) leukemias.Oncotarget.

2015.6:33206-16

40. Keeton EK, McEachern K, Dillman KS, Palakurthi S, Cao Y, Grondine MR, et al.

AZD1208, a potent and selective pan-Pim kinase inhibitor, demonstrates efficacy

in preclinical models of acute myeloid leukemia. Blood. 2014;123:905-13.



https://www.ncbi.nlm.nih.gov/pubmed/10679091http://cancerres.aacrjournals.org/

37

41. Heltemes-Harris LM, Willette MJ, Ramsey LB, Qiu YH, Neeley ES, Zhang N, et

al. Ebf1 or Pax5 haploinsufficiency synergizes with STAT5 activation to initiate

acute lymphoblastic leukemia. J Exp Med. 2011. 208:1135-49.

42. Zhang Y, Wang Z, Li X, Magnuson NS. Pim kinase-dependent inhibition of c-Myc

degradation. Oncogene. 2008;27:4809-19.

43. Horiuchi D, Camarda R, Zhou AY, Yau C, Momcilovic O, Balakrishnan S, et al.

PIM1 kinase inhibition as a targeted therapy against triple-negative breast tumors

with elevated MYC expression. Nat. Medicine. 2016;22:1321-9

44. Aho TL, Sandholm J, Peltola KJ, Mankonen HP, Lilly M, Koskinen PJ. Pim-1

kinase promotes inactivation of the pro-apoptotic Bad protein by phosphorylating

it on the Ser112 gatekeeper site. FEBS letters. 2004;571:43-9.

45. Yang Q, Chen LS, Neelapu SS, Miranda RN, Medeiros LJ, and Gandhi V.

Transcription and translation are primary targets of Pim kinase inhibitor SGI-1776

in mantle cell lymphoma. Blood. 2012. 120:3491-500.

46. Tamburini J, Green AS, Bardet V, Chapuis N, Park S, Willems L, et al. Protein

synthesis is resistant to rapamycin and constitutes a promising therapeutic target

in acute myeloid leukemia. Blood. 2009. 114:1618-27.

47. Zhang F, Beharry ZM, Harris TE, Lilly MB, Smith CD, Mahajan S, and Kraft AS.

PIM1 protein kinase regulates PRAS40 phosphorylation and mTOR activity in

FDCP1 cells. Cancer Biol Ther. 2009. 8:846-53.

48. Wei J, Stebbins JL, Kitada S, Dash R, Placzek W, Rega MF, et al. BI-97C1, an

optically pure Apogossypol derivative as pan-active inhibitor of antiapoptotic B-



https://www.ncbi.nlm.nih.gov/pubmed/21606506https://www.ncbi.nlm.nih.gov/pubmed/19458359http://cancerres.aacrjournals.org/

38

cell lymphoma/leukemia-2 (Bcl-2) family proteins. J Med Chem. 2010. 53:4166-

4176.

49. Goff DJ, Court Recart A, Sadarangani A, Chun HJ, Barrett CL, Krajewska M, et

al. A Pan-BCL2 inhibitor renders bone-marrow-resident human leukemia stem

cells sensitive to tyrosine kinase inhibition. Cell Stem Cell. 2013 12:316-28.

50. Walz C, Ahmed W, Lazarides K, Betancur M, Patel N, Hennighausen L, et al.

Essential role for Stat5a/b in myeloproliferative neoplasms induced by BCR-

ABL1 and JAK2(V617F) in mice. Blood. 2012.119:3550-60.

51. De Dominici M, Porazzi P, Soliera AR, Mariani SA, Addya S, Fortina P, et al.

Targeting CDK6 and BCL2 exploits the "MYB addiction" of Ph+ acute

lymphoblastic leukemia. Cancer Res. 2018. 78:1097-1109.



https://www.ncbi.nlm.nih.gov/pubmed/29233926http://cancerres.aacrjournals.org/

39

Figure legends

Fig. 1. Effect of STAT5 silencing on cell growth, apoptosis and leukemogenesis of

Ph+ leukemia cell lines.

(A-D): Western blot (A), cell growth (B), apoptosis (C), and colony formation (D) of

untreated or doxycycline (Doxy)-treated shSTAT5 Ph+ cell lines. Cell growth was

determined by MTT assays and data are expressed as optical density (O.D). For Z181

cells, MTT assays were performed until 144 h. Apoptosis was measured as the % of

cells expressing activated Caspase 3/7 by flow cytometry analysis. For colony formation

assays, cells were seeded in methylcellulose plates (2,500-5,000 cells/dish), with or

without Doxy. Colonies were counted 7-10 days after plating. Results are expressed as

% inhibition of colony formation in Doxy-treated versus untreated plates. (no

asterisk=not significant, *p

40

Fig. 3. Effect of the STAT5 inhibitor IST5-002 on colony formation and

leukemogenesis of Ph+ ALL cells. Western blot (A) and colony formation (B) of IST5-

002-treated primary Ph+ ALL cells. For western blot analysis, cells from Ph+ ALL

samples were left untreated (Ctrl) or treated with 5 or 10 μM IST5-002 for 24 h. Whole

cell lysates were blotted with anti-p-STAT5, STAT5 and β-actin antibodies. For colony

formation assays, cells (100,000/dish) were seeded in methylcellulose plates in

presence of medium only or with 5 or 10 μM IST5-002. Colonies were counted after 10

days. Results are expressed as % inhibition of colony formation from IST5-002-treated

versus untreated cells (***p

41

(B), or in shSTAT5-BV173 ectopically expressing MCL-1 or BCL-2 (E, left), or in the

shSTAT5-shBIM-BV173 line expressing MCL-1 or BCL-2 (E, right); (C, D) % of

apoptotic cells detected by Annexin V staining in shSTAT5-BV173 parental and

derivative cell lines, untreated or Doxy treated to silence STAT5 expression.

Fig. 5. Effect of PIM kinase inhibition or STAT5 silencing on signal transduction

pathways in Ph+ ALL cells. Western Blot analysis of PIM-1-regulated proteins in

AZD1208-treated Ph+ ALL lines (A) and primary Ph+ ALL samples (B) or in STAT5-

silenced Ph+ ALL lines (C).

Fig. 6. Effect of AZD1208 and Sabutoclax on colony formation of Ph+ leukemia

cell lines and primary Ph+ ALL cells. Methylcellulose colony formation of BV173,

SUP-B15 and BV173 (T315I) cell lines (A) or primary Ph+ ALL samples (B), untreated

or treated with AZD1208 (3 M), Sabutoclax (80 nM), or a combination of AZD1208 and

Sabutoclax. Colonies were counted 7-10 days after plating; results are expressed as %

inhibition of colony formation from drug-treated versus untreated cells (*p

42

based on data shown in the A panels (NS=not significant, *p

Published OnlineFirst August 28, 2018.Cancer Res Valentina Minieri, Marco De Dominici, Patrizia Porazzi, et al. leukemogenesis of Ph+ acute lymphoblastic leukemiaTargeting STAT5 or STAT5-regulated pathways suppresses

Updated version

10.1158/0008-5472.CAN-18-0195doi:

Access the most recent version of this article at:

Material

Supplementary

http://cancerres.aacrjournals.org/content/suppl/2018/08/28/0008-5472.CAN-18-0195.DC1

Access the most recent supplemental material at:

Manuscript

Authoredited. Author manuscripts have been peer reviewed and accepted for publication but have not yet been

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/early/2018/08/28/0008-5472.CAN-18-0195To request permission to re-use all or part of this article, use this link



http://cancerres.aacrjournals.org/lookup/doi/10.1158/0008-5472.CAN-18-0195http://cancerres.aacrjournals.org/content/suppl/2018/08/28/0008-5472.CAN-18-0195.DC1http://cancerres.aacrjournals.org/cgi/alertsmailto:[email protected]://cancerres.aacrjournals.org/content/early/2018/08/28/0008-5472.CAN-18-0195http://cancerres.aacrjournals.org/

Article FileFigure 1Figure 2Figure 3Figure 4Figure 5Figure 6Figure 7

targeting stat5 or stat5-regulated pathways suppresses ... · 28/08/2018 · abl1 tyrosine kinase...

Documents