t cell cancer therapy requires cd40-cd40l activation of
TRANSCRIPT
Article
T Cell Cancer Therapy Req
uires CD40-CD40LActivation of Tumor Necrosis Factor and InducibleNitric-Oxide-Synthase-Producing Dendritic CellsGraphical Abstract
Highlights
d Effective anti-tumor CD8+ T cell therapy requires expansion
of Tip-DCs
d Tip-DC differentiation depends on the affinity between TCR
and MHC-peptide complexes
d CD40/CD40L axis is necessary for tumor rejection mediated
by CD8+ T cells
d Favoring Tip-DC function in tumor environment enhances
ACT efficacy
Marigo et al., 2016, Cancer Cell 30, 377–390September 12, 2016 ª 2016 Elsevier Inc.http://dx.doi.org/10.1016/j.ccell.2016.08.004
Authors
Ilaria Marigo, Serena Zilio,
Giacomo Desantis, ..., Jerome Galon,
Peter J. Murray, Vincenzo Bronte
[email protected] (I.M.),[email protected] (P.J.M.),[email protected] (V.B.)
In Brief
Marigo et al. show that nitric oxide
produced by Tip-DCs, a subset of tumor-
infiltrating myeloid cells, is important for
tumor control by adoptive cell therapy
(ACT). Tip-DCs require the CD40-CD40L
pathway but not CSF-1R; CSF-1R
blockade reduces immunosuppressive
macrophages and improves tumor
control by ACT.
Accession Numbers
GSE74427
Cancer Cell
Article
T Cell Cancer Therapy Requires CD40-CD40LActivation of Tumor Necrosis Factor and InducibleNitric-Oxide-Synthase-Producing Dendritic CellsIlaria Marigo,1,11,* Serena Zilio,2 Giacomo Desantis,1 Bernhard Mlecnik,3,4,5 Andrielly H.R. Agnellini,2 Stefano Ugel,6
Maria Stella Sasso,2 Joseph E. Qualls,7 Franz Kratochvill,7 Paola Zanovello,1,2 Barbara Molon,1,10 Carola H. Ries,8
Valeria Runza,8 Sabine Hoves,8 Amelie M. Bilocq,3,4,5 Gabriela Bindea,3,4,5 Emilia M.C. Mazza,9 Silvio Bicciato,9
Jerome Galon,3,4,5 Peter J. Murray,7,* and Vincenzo Bronte6,*1Istituto Oncologico Veneto, IOV-IRCCS, 35128 Padova, Italy2Oncology and Immunology Section, Department of Surgery, Oncology and Gastroenterology, University of Padova, 35128 Padova, Italy3INSERM UMRS1138, Laboratory of Integrative Cancer Immunology, Paris 75006, France4Universite Paris Descartes, Paris 75006, France5Cordeliers Research Centre, Universite Pierre et Marie Curie Paris 6, Paris 75006, France6Department of Medicine, Verona University Hospital, 37134 Verona, Italy7Departments of Infectious Diseases and Immunology, St. Jude Children’s Research Hospital, Memphis, TN 38105, USA8Roche Innovation Center Munich, Oncology Discovery, Pharma Research and Early Development, 82377 Penzberg, Germany9Department of Life Sciences, Center for Genome Research, University of Modena and Reggio Emilia, 41100 Modena, Italy10Present address: Venetian Institute of Molecular Medicine (VIMM), 35129 Padova, Italy11Lead Contact
*Correspondence: [email protected] (I.M.), [email protected] (P.J.M.), [email protected] (V.B.)http://dx.doi.org/10.1016/j.ccell.2016.08.004
SUMMARY
Effective cancer immunotherapy requires overcoming immunosuppressive tumor microenvironments.We found that local nitric oxide (NO) production by tumor-infiltrating myeloid cells is important for adoptivelytransferred CD8+ cytotoxic T cells to destroy tumors. These myeloid cells are phenotypically similar to in-ducible nitric oxide synthase (NOS2)- and tumor necrosis factor (TNF)-producing dendritic cells (DC), orTip-DCs. Depletion of immunosuppressive, colony stimulating factor 1 receptor (CSF-1R)-dependent argi-nase 1+ myeloid cells enhanced NO-dependent tumor killing. Tumor elimination via NOS2 required theCD40-CD40L pathway. We also uncovered a strong correlation between survival of colorectal cancerpatients and NOS2, CD40, and TNF expression in their tumors. Our results identify a network of pro-tumorfactors that can be targeted to boost cancer immunotherapies.
INTRODUCTION
Immunotherapy with antibodies selected to block immune
checkpoint signaling molecules such as CTLA-4, PD-1, or
PD-L1 or their combinations activates tumor-specific CD8+
T lymphocytes within the tumor stroma, and in some cases
drives cancer eradication (Page et al., 2014; Topalian et al.,
Significance
Overcoming an immunosuppressive tumor environment is fun(ACT). We demonstrate that Tip-DCs accumulating within thecross-presenting tumor antigens and activating adoptively trarequiring CD40-CD40L, Tip-DCs produce anti-tumor NO andgood survival share a tumor signature comprising the key moleing CSF-1R signaling before ACT reduced immunosuppressivetion and enhancing anti-tumor activity of poorly active CD8+ T cbalance between pro- and anti-tumor myeloid cells in the tum
Canc
2015). Adoptive cell therapy (ACT) with CD4+ or CD8+ T lympho-
cytes specific for tumor antigens is also an emerging approach
to treat cancer patients (Rosenberg and Restifo, 2015). The
progress to achieve the optimal efficacy following ACT is
impeded by incomplete understanding of the cellular andmolec-
ular interactions in the tumor microenvironment. For example,
although the avidity and affinity of T cell receptor (TCR) toward
damental for increasing the efficacy of adoptive cell therapytumor after ACT fuel an intra-tumoral ‘‘virtuous circle’’ by
nsferred and endogenous CD8+ T cells. Through a pathwayTNF. Our data show that colorectal cancer patients with
cules identified in the study (CD40L, TNF, and NOS2). Block-macrophage accumulation while preserving Tip-DC activa-ells. These observations provide a rationale for switching theor microenvironment.
er Cell 30, 377–390, September 12, 2016 ª 2016 Elsevier Inc. 377
the target antigen contribute to ACT efficacy, the affinity of
the target peptide for the presenting major histocompatibility
complex class I (MHCI) molecule is much more important
(Arina and Bronte, 2015). Relatively high binding affinities for
the MHCI-peptide complex (<10 nM) are necessary for tumor
eradication following ACT (Engels et al., 2013; Robbins et al.,
2013). Targeting tumor-specific neoantigens with the highest
MHCI affinity might be a basic requirement for optimal ACT.
Effective immunotherapy is limited in most patients by the
immunosuppressive tumor environment. Local immunosuppres-
sion of T cells with anti-tumor potential is orchestrated by cells
from the mononuclear phagocyte system, such as myeloid-
derived suppressor cells (MDSCs) and tumor-associated ma-
crophages (TAMs) (Gabrilovich et al., 2012; Ugel et al., 2015).
Understanding how the immunosuppressive milieu develops
and persists is central to harnessing the power of immunothera-
peutic strategies.
Tumor-associated myeloid cells inhibit anti-tumor T cell re-
sponsesbyoverlappingand redundantpathways.Akey inhibitory
pathway in the tumor microenvironment involves the metabolism
of arginine through regulated expression of two enzymes: argi-
nase 1 (ARG1, encoded byARG1) hydrolyzes arginine while nitric
oxide synthase 2 (NOS2, also known as inducible NOS or iNOS,
encoded by NOS2) generates nitric oxide (NO) from arginine
andoxygen (Colegio et al., 2014;Gabrilovich et al., 2012;Ginhoux
et al., 2015; Marigo et al., 2010; Ugel et al., 2015). In cancer the
precise roles of ARG1, NOS2, and their reaction products in pro-
motingor controlling cancer remain controversial. For example, in
human breast cancers, increased NOS2 is associated with poor
clinical outcome (Glynn et al., 2010). By contrast, local low-dose
g-irradiation ‘‘reprograms’’macrophages to releaseNO, support-
ing T helper 1 (Th1) responses and CD8+ T lymphocytes (Klug
et al., 2013). Irradiation of human carcinomas also causes local
NOS2+ macrophage accumulation and increased infiltration of
CD4+ and CD8+ T cells (Klug et al., 2013). The net contribution
of NOS2 to promote or contain tumors likely depends on the
cell types upregulating NOS2 and the NO concentration reached
in the tissue microenvironment. ARG1 is immunosuppressive in
part through local depletion of arginine, restricting its availability
to growing T cells in Th2- and Th1-dominated infections (Du-
que-Correa et al., 2014; Pesce et al., 2009). ARG1 can also
compete with NOS2 for L-arginine and thus limit the overall ability
of activated myeloid cells to generate NO (Bronte and Zanovello,
2005; El Kasmi et al., 2008). Collectively, the precise roles of
ARG1, NOS2, and NO remain unknown.
Despite the immunosuppressive environment created by
MDSCs and TAMs, some protocols of ACT do induce tumor
eradication. In tumors responding to ACT, three possible out-
comes have been described for tumor-infiltrating myeloid cells:
elimination; change toward a more pro-inflammatory and less
suppressive phenotype; or no elimination or detectable pheno-
typic changes (Arina and Bronte, 2015). A key step in the gener-
ation of an immune response against cancer is the tumor antigen
uptake and presentation in draining lymph nodes to T cells, re-
sulting in the priming and activation of effector CD8+ and CD4+
T cells (Chen and Mellman, 2013). Here, we investigate how
the adoptive transfer of CD8+ T cells targeting a tumor-specific
antigen with high MHCI affinity fuels this process within the
immunosuppressive tumor microenvironment.
378 Cancer Cell 30, 377–390, September 12, 2016
RESULTS
Effective Adoptive CD8+ Anti-tumor T Cell TherapyRequires NOS2To define when and where ARG1 and NOS2 are expressed in
cancer, we isolated cells expressing the pan-myeloid marker
CD11b from spleens or tumors of EG7 lymphoma tumor-bearing
wild-type (WT) mice and analyzed them for the expression of
both proteins. ARG1+ and ARG1+NOS2+ cells were foundmainly
among CD11b+ cells isolated from the tumor rather than the
spleen. Moreover, NOS2 expression was significantly higher
among CD11b+ cells from the tumor (Figures 1A–1C and S1A).
This is consistent with data from other solid tumor models (Cole-
gio et al., 2014; Corzo et al., 2010; Haverkamp et al., 2011; Mar-
igo et al., 2010). The lack of ARG1, NOS2, or both did not affect
the accumulation of CD11b+ cells in tumors (Figure S1B).
Despite intense speculation about the roles of ARG1 and
NOS2 in cancer, it seems that no study has used a genetic
approach to differentiate their relative roles in the same setting.
To measure the potential pro- and anti-tumor effects of NOS2
and ARG1, we focused on single- and double-gene knockout
(KO) mice in which whole-animal Nos2mutation was used alone
or in combination with a macrophage-specific Arg1 deficiency
(El Kasmi et al., 2008). We used a system whereby the tumor ex-
pressed a defined antigen (ovalbumin [OVA]) in host back-
grounds genetically manipulated for Nos2, Arg1, or both. When
we transferred OVA-specific T cells into EG7-tumor-bearing
mice we found that the immunosuppressive capacity of tumor-
infiltrating CD11b+ cells on antigen-stimulated CD8+ T cells
increased during cancer progression, and this effect was almost
completely ablated by the absence of NOS2 (Figure 1D). ARG1
partially cooperated with NOS2 to suppress T cell proliferation
and cytotoxicity but only at later time points, when tumor sizes
were larger (Figures 1D and S1C).
To test the influence of host myeloid ARG1 and NOS2 on the
outcomes of cellular immunotherapy, we adoptively transferred
in vitro activated, congenically marked OVA-specific CD8+
T cells into EG7-tumor-bearing mice lacking NOS2, ARG1, or
both (Figure S1D). OVA is recognized as having high affinity
and can be used as a model that recapitulates the therapeutic
anti-tumor immune response against non-self, mutated epitopes
(Gubin et al., 2014; Kreiter et al., 2015). Higher percentages of
OVA-specific, CD8+CD45.1+ T cells were recovered in Nos2�/�
mice than in WT mice (Figures 1E and 1F), consistent with the
results in Figure 1D, where NOS2 is required to inhibit T cell pro-
liferation. Transferred T cells also produced interferon g (IFN-g)
in Nos2�/� mice compared with WT controls (Figures 1E
and 1F). Despite the expansion of antigen-specific CD8+
T cells in the Nos2�/� mice compared with controls, host
NOS2 ablation reduced the therapeutic effect of transferred
T cells with or without concomitant ARG1 ablation (Figure 1G).
Thus, myeloid expression of NOS2 inhibits T cell proliferation
and IFN-g production but is nevertheless important for the
anti-tumor efficacy of these T cells.
In the same setting as described above (Figure S1D), elimina-
tion of ARG1 improved the efficacy of ACT and increased
survival. Given that ARG1 competes with NOS2 for arginine
and loss of ARG1 causes myeloid cells to produce more NO
(El Kasmi et al., 2008), the most straightforward explanation for
Survival after ACT
Days0 10 20 30 40 50
% o
f sur
viva
l
0
20
40
60
80
100
G Survival without ACT
Days0 10 20 30
% o
f sur
viva
l
0
20
40
60
80
100 WTARG KONOS KOARG NOS KO
WT
++
% o
f CD
8 C
D45
.1
00.050.100.150.200.250.30
D E F
05
101520253035
00.20.40.60.81.01.21.4
++
% o
f CD
8 C
D45
.1
6-74-52-30-1
020406080
100Day 10
NS
MLP
C
AR
G K
O
NO
S K
O
AR
G N
OS
KO
WT
Day 21
020406080
100
*
*
***
**
*
*
Spleen TumorDAPI NOS2
ARG1CD11b
A
WT
WT
++
on C
D8
CD
45.1
+%
of I
FN-γ
cel
ls
++
on C
D8
CD
45.1
+%
of I
FN-γ
cel
ls
WT
**
0
20
40
60
80
WTWT
******
NOSKO
NOSKO
NOSKO
NOSKO
EG7
EG7 EG7
EG7
+%
of O
VA-s
peci
fic C
D8
cel
ls p
er g
ener
atio
n
Spleen Tumor
Fluo
resc
ence
inte
nsity
102
103
104
105
106
+NOS2 +ARG1 +NOS2+ARG1
+%
of C
D11
b c
ells
0
5
10
15
20
25Spleen Tumor ***
B C
Figure 1. NOS2 Is Essential for Effective
ACT
(A) Representative images of CD11b+ cells sorted
from spleens or tumors of EG7-tumor-bearing WT
mice stained for NOS2, ARG1, and DAPI. Scale
bars, 25 mm.
(B and C) CD11b+ cells sorted from spleens or
tumors of EG7-tumor-bearing WT mice were
quantified for the percentage of ARG1+, NOS2+,
and ARG1+NOS2+ cells (B) or for fluorescence
intensity of NOS2 expression (C). In (C) Median
[50th percentile] is represented as a line inside the
box. Lines at the bottom and top of the box
represent, respectively, the 25th and the 75th
quartile, and the whiskers represent 10th and 90th
percentile. Outliers beyond the whiskers are indi-
vidually plotted as black dots. ***p % 0.001 by
unpaired Student’s t test. n = 357 cells from spleen
or tumor were evaluated.
(D) CD11b+ cells from tumors ofWT, ARGKO, NOS
KO, or ARG NOS KO mice were sorted and
co-culturedwith OVA-specific, carboxyfluorescein
succinimidyl ester (CFSE)-labeled, CD8+CD45.1+
T lymphocytes in the presence of OVA peptide.
Percentage of proliferating T cells within a given
number of cell divisions (from 0 to 7 as indicated) is
shown in bar graph format relative to positive
control (mixed lymphocyte peptide culture [MLPC],
lymphocytes stimulated with OVA peptide) or
negative controlswithoutOVA (NS, not stimulated).
(E and F) WT and EG7-tumor-bearingWT and NOS
KO mice were adoptively transferred with
OVA-specific CD8+CD45.1+ T lymphocytes. Cells
derived from spleens (E) or tumors (F) were stim-
ulated with OVA peptide, and percentage of
CD45.1+CD8+ cells and IFN-g+ cells is shown in
the CD45.1+CD8+ gate. Mean ± SD; n = 4, repre-
sentative of three independent experiments.
***p % 0.001, **p % 0.01, *p % 0.05 by one-way
ANOVA.
(G) Survival percentages of EG7-tumor-bearing
WT and KO mice either untreated (n = 5 for each
group) or treated with ACT (WT, n = 20; ARG KO,
n = 15; NOS KO, n = 18; ARG NOS KO, n = 17).
*p % 0.05 by log-rank test.
See also Figure S1.
these data is that NOS2 and NO are required for the efficacy of
therapeutic CD8+ T cells while ARG1 tempers theNO-dependent
response. In agreement with this interpretation, lack of ARG1
favored the expansion of intra-tumoral NOS2+ cells following
Cancer
transfer of tumor-specific CD8+ T cells in
WT mice (Figure S1E). The 27% increase
in NO-producing cells caused by ARG1
absence might have relevant conse-
quences in the dynamic interplay of tumor
cell killing, as shown later.
ACT Induces the Expansion ofNOS2+ Myeloid Cells within TumorsSince the data in Figure 1 implicated local
tumor NOS2+ myeloid cells as essential
for ACT efficacy, we next investigated
changes in the number and types of intra-tumoral myeloid cells
after ACT. Following the gating strategy shown in Figure 2A, we
observed that ACT induced the expansion of Ly6C+ class II MHC
(MHCII+) CD11b+ cells within the tumor (Figure 2B). Moreover,
Cell 30, 377–390, September 12, 2016 379
++
% o
f CD
11b
NO
S2
cel
ls
0
10
20
30
40
50
60C
*** ***
w/o CD8 CD8
D
NOS2
CD
11b
0 210 310 410 510
0
210
310
410
510
NOS2
CD
11b
0 210 310 410 510
0
210
310
410
5100.9168.13
F4/80
Ly6C
0 210 310 410 510
0
210
310
410
510
83.74
Ly6G
Ly6C
0 310 410 510
0
210
310
410
510 97.72
MHCII
Ly6C
0 210 310 410 510
0
210
310
410
510 5.490.65
87.17
5.0666.93
Ly6G
Ly6C
0 310 410 510
0
210
310
410
510 99.85
MHCII
Ly6C
0 210 310 410 510
0
210
310
410
510 65.726.70
24.71
F4/80
Ly6C
0 210 310 410 510
0
210
310
410
510
39.44
WT w/o CD8
WT + CD8
A
40.91
50K 100K 150K 200K 250KFSC-A
50K
100K
150K
200K
250KS
SC
-A
50K 100K 150K 200K 250KSSC-H
50K
100K
150K
200K
250K
SS
C-A
92.01
50K 100K 150K 200K 250KFSC-A
50K
100K
150K
200K
250K
FSC
-A
98.82
0
210
310
410
510
50K 100K 150K 200K 250KSSC-A
CD
11b
69.85
MHCII
Ly6C
0 210 310 410 510
0
210
310
410
510
42.55
23.99 28.05
69.840
210
310
410
510
50K 100K 150K 200K 250KFSC-A
LIV
E/D
EA
D
Ly6G
11.27
86.99
Ly6C
0 310 410 510
0
210
310
410
510
F4/80
Ly6C
0 310 410 510
0
210
310
410
510
49.59highF4/80
+ +LY6C MHCIIhigh -LY6C MHCII
+LY6G
B
highF4/800
5
10
15
20
25
30
35**
highLy6C-MHCII
+Ly6C+MHCII
+Ly6G
w/o CD8 CD8
+%
of C
D11
b c
ells
highF4/80highLy6C-MHCII
+Ly6C+MHCII
+Ly6G
F
No LPS + LPS
++
% o
f CD
11b
TN
F c
ells
0
2
4
6
8
10
E
No LPS 0
0.2
0.4
0.6
0.8
1.0
+ LPS
high + +F4/80 NOS2 TNF
**
***
++
% o
f CD
1 1b
TN
F c
ellsw/o CD8
CD8
Rel
ease
d IF
N-γ
(pg/
ml) w/o CD8
CD8
0
10
20
30
40
50
60
Medium
***
70
highF4/80highLy6C-MHCII
+Ly6C+MHCII
+Ly6G
+ + + +Ly6C MHCII NOS2 TNF
Figure 2. Adoptive Transfer of Tumor-Specific CD8+ T Cells Induces Tip-DC Expansion
(A) Dot plots indicating the overall gating strategy to define the myeloid subpopulations in EG7 tumor mass.
(B) Quantification of tumor-infiltratingmyeloid subpopulations in the CD11b+ gate inmice treated with ACT (CD8) or untreated (w/o CD8). n = 18 pooled from three
experiments.
(legend continued on next page)
380 Cancer Cell 30, 377–390, September 12, 2016
inside the CD11b+NOS2+ cell fraction (comprising the whole
NOS2+ cell population), which expanded after ACT, the number
of Ly6C+MHCII+ cells increasedwhereas F4/80highmaturemacro-
phages declined in number (Figures 2C, 2D, and S2A), suggesting
that Ly6C+MHCII+ cells but not F4/80high macrophages contrib-
uted to the NOS2 activity required for cancer elimination. Impor-
tantly, in agreement with other observations (Korrer and Routes,
2014; Kratochvill et al., 2015), ARG1 expression is linked to the
F4/80high mature macrophages, indicating that the intra-tumoral
ARG1+ cells described above are macrophages (Figure S2B).
Compared with control mice, Ly6G�CD11b+ cells isolated from
the tumor-bearingmice adoptively transferredwith tumor-specific
CD8+ T cells had enhanced cytostatic activity when co-cultured
with tumor cells (Figure S2C). This anti-tumor action was absent
in cells isolated fromNos2�/� mice (Figure S2C) and was accom-
panied by increased NOS2 expression in cells isolated from WT
mice (Figure S2D), suggesting that ACT-induced NOS2 activity in
myeloid cells contributed to the anti-tumor activity. ACT also
enhanced the ability of Ly6C+MHCII+CD11b+NOS2+ cells but not
F4/80high macrophages, to produce tumor necrosis factor (TNF)
ex vivo, another hallmark of activated myeloid cells (Figure 2E).
In addition to tumor killing, we found that ACT triggered the
ability of intra-tumoral Ly6C+MHCII+ cells to stimulate naive,
OVA-specificCD4+ T cells fromOT-II transgenicmice (Figure 2F).
The TNF and NOS2 upregulation coupled with the antigen-stim-
ulating cell capacity and the cell-surface marker profile (Figures
2A–2D and S2E) suggested that ACT was linked to the accumu-
lation of an anti-tumor population of myeloid cells most similar to
TNF- and NOS2-producing inflammatory dendritic cells, often
termed Tip-DCs (Aldridge et al., 2009; Serbina et al., 2003). We
define these cells as NOS2+Ly6C+MHCII+ and refer to them as
Tip-DCs hereafter.
Tip-DCs Improve the Therapeutic Effect of ACTTranscriptome characterization showed that Tip-DCs sorted
from the tumor mass following ACT are more similar to tissue
dendritic cells (DCs) than to monocytic MDSCs (M-MDSCs) or
tissue macrophages (MFs) (Figures S3A and S3B; Tables S1
and S2). This similarity emerged when we used subsets of
most variable genes across tissue MFs, tissue DCs, M-MDSCs,
and Tip-DCs (Figure S3A), as well as a set of previously
described gene signatures specific for DCs (Miller et al., 2012),
macrophages (Gautier et al., 2012), and M-MDSCs (Figure S3B)
(Conde et al., 2015).
To demonstrate the relevance of NO production in the anti-tu-
mor activity of Tip-DCs and confirm their therapeutic benefit, we
injected EG7 tumors grown inNos2�/�mice with Tip-DCs sorted
fromWT or Nos2�/� EG7 tumor-bearing mice previously treated
with ACT (Figure 3A). After ACT, survival of Nos2�/� mice was
increased only after intra-tumoral transfer of Tip-DCs from WT
mice (Figure 3B).
(C and D) Frequency (C, n = 18 pooled from three experiments) and representativ
each quadrant) for tumor-infiltrating myeloid populations in the CD11b+NOS2+ g
(E) Frequency of different myeloid subpopulations in tumor cell suspensions stim
experiment of three.
(F) Sorted myeloid subpopulations were cultured with naive CD4+ lymphocytes to
of three.
Data in (B), (C), (E), and (F) represent mean ± SD. ***p % 0.001, **p % 0.01 by on
To test the ability of human Tip-DCs to improve ACT, we
generated these cells by incubating human CD14+ monocytes
with the supernatants collected from the co-culture of CD8+
T cells specific for human telomerase reverse transcriptase
(hTERT) with peripheral blood mononuclear cells (PBMCs)
pulsed with the HLA-A2-restricted, hTERT peptide. Human cells
consistent with the phenotype of Tip-DCs differentiated
in vitro expressed high levels of MHCI, MHCII, CD86, and TNF,
and upregulated NOS2, compared with monocytes from which
they were derived (Figure 3C). NOG mice bearing the MDA-
MB-231 mammary carcinoma were treated by ACT with
hTERT-specific CD8+ T cells, in association with injection of
either human monocytes or hTip-DCs (Figure S3C). Only the
supply of Tip-DCs significantly improved the ACT (Figure 3D).
Tip-DC Differentiation Is Dependent on the Affinitybetween TCR and MHC-Peptide Complexes and Can BeAchieved In VitroTo further evaluate the ability of activated CD8+ T cells to induce
Tip-DC expansion and activity in response to antigen expres-
sion, we transferred the OVA-specific CD8+ T cells into B16 mel-
anoma-bearing mice (Figure 4A). We selected two melanoma
lines expressing high or low levels of OVA antigen, as assessed
by the staining with a monoclonal antibody (mAb) recognizing
the surface expression of the complex between MHCI molecule
and OVA peptide and by the amount of IFN-g released by OVA-
specific T cells after co-incubation with the tumor cell lines (Fig-
ures S4A and S4B). We found that the in vivo expansion of
NOS2+Ly6C+MHCII+ cells and the efficacy of the immuno-
therapy mediated by ACT were dependent on the tumor antige-
nicity, being evident only in B16 melanoma-expressing high
amounts of OVA (Figure 4A).
We next evaluatedwhether Tip-DC generation from circulating
precursors could be affected by factors produced from activated
T cells. To test this, we cultured CD11b+ cells isolated from
spleens of naive mice in the presence of supernatants from
in vitro stimulated CD8+ T cells, with or without the addition of
CD40 agonist, to induce the generation of Tip-DCs in vitro.
We used CD8+ T cells from OT-I transgenic mice or
transgenic mice bearing a TCR recognizing an H-2Kb-restricted
epitope of the melanoma antigen tyrosinase-related protein 2
(TRP-2180–188) with high or low affinities (Zhu et al., 2013), termed
hereafter TRP-2high and TRP-2low, respectively. Supernatant
from antigen-stimulated CD8+ T cells from OT-I and TRP-2high
but not TRP-2low mice induced the in vitro differentiation of
Tip-DCs, whereas stimulation with anti-CD3 and anti-CD28
mAbs was poorly effective (Figures 4B and 4C). NOS2 expres-
sion was significantly higher with supernatant from OT-I, and
in the presence of CD40 agonist whereas TNF expression was
not significantly affected (Figure 4D). Similarly, human Tip-DCs
induced in vitro, from CD14+ monocytes stimulated with the
e flow cytometry plots (D, percentages of different populations are indicated in
ate (red boxes) in WT mice untreated (w/o CD8) or treated with ACT (CD8).
ulated or not with lipopolysaccharide in the CD11b+ gate. n = 6, representative
evaluate IFN-g released in supernatants by ELISA. Representative experiment
e-way ANOVA. See also Figure S2.
Cancer Cell 30, 377–390, September 12, 2016 381
+CD14 monocytesTip-DCs
PBS
CD14
% o
f sur
viva
l
Survival after ACTC
Survival without ACT
Tip-DCs
Days
% o
f sur
viva
l
D
Per
cent
age
of m
axim
um
NOS2
TNF
MHCI
MHCII
CD80
CD86
010 110 210 310 410
0
20
40
60
80
100
20
40
60
80
100
Days
***
A
EG7 s.c. injection
Day 0 Day 7
6 0.5 x 10 OVA-specific+ +CD8 CD45 lymphocytes
+61 x 10 Tip-DCs
from WT and NOS KOintratumoral injection
Mouse sacrifice
Day 10 2200 mmtumors
NOS KO
61 x 10 Tip-DCsfrom WT and NOS KOintratumoral injection
B
Days
% o
f sur
viva
l
0
20
40
60
80
100
0 10 20 30 40
**
Tip-DCs from WTTip-DCs from NOS KO
0 10 20 30 40 0 10 20 30 40 50 600
Figure 3. Tip-DCs Are Functionally Active in the Tumor Environment
(A) A schematic representation of the experiment. s.c., subcutaneous.
(B) Survival of EG7-tumor-bearing NOS KO mice treated with ACT and with sorted Tip-DCs from WT or NOS KO mice; n = 6. **p % 0.01, log-rank test.
(C) In vitro generated human Tip-DCs were analyzed by flow cytometry for the indicated molecules.
(D) NOG mice were injected subcutaneously with MDA-MB-231 and intratumorally with CD14 monocytes, Tip-DCs, or PBS and either treated or intravenously
with anti-hTERT-specific CD8+ T cells or left untreated. Survival percentages of n = 15, pooled from three independent experiments, are reported. ***p% 0.001,
log-rank test.
See also Figure S3.
supernatant of the in vitro co-culture between the high-affinity
hTERT-specific TCR-engineered T cells and HLA-A2-restricted
hTERT peptide-pulsed PBMCs, expressed a significant amount
of NOS2 and TNF (Figure S4C).
Collectively, the degree of antigen expression, TCR avidity,
and the efficient antigen recognition by the CD8+ T lymphocytes
contributed to Tip-DC generation. Consistent with these results,
mice bearing the B16 melanoma, naturally expressing the
TRP-2180–188 epitope, showed a significant survival benefit only
following transfer of CD8+ T cells with high affinity toward
TRP-2 antigen (Figures 4E and S4D).
Ligation of CD40 stimulates expression of NOS2 in macro-
phages (Weiss et al., 2010) and microglia (Jana et al., 2001)
via an IFN-g-dependent mechanism and is therefore potentially
important in activating NOS2 in the tumor microenvironment.
The in vitro generation of Tip-DCs was dependent on anti-
CD40 stimulation (Figures 4D and 4E) but only partially de-
pendent by IFN-g, whereas the expression of NOS2 and TNF
was not affected by IFN-g blockade (Figures S4E and S4F).
CD40-CD40L Axis Is Required for Tumor RejectionMediated by CD8+ T CellsTo evaluate whether CD40 engagement stimulated a prompt NO
release following CD8+ T cell recognition of tumor, we stained
living tissue slices of tumors grown in WT or different KO mice
to assess NO following CD40 activation (Figure S5A). Tumor-an-
382 Cancer Cell 30, 377–390, September 12, 2016
tigen-specific (OVA) CD8+ T cells from OT-I mice but not cells
recognizing an irrelevant antigen (gp100) induced NO release
in WT tumor slices, which was abrogated in Nos2�/� tissue
(Figures 5A and S5B), confirming specificity of NO production
by NOS2 and not by the non-immune NOS isoforms (NOS1,
NOS3). Slices from tumors grown in either CD40 or CD40L KO
mice had reduced NO release following interaction with tumor-
specific CD8+ T cells from OT-1, suggesting a role of CD40/
CD40L axis on tissue-infiltrating cells to sustain NOS2 activation
(Figure 5A).
To investigate the role of CD40L expression by CD8+ T cells in
the induction of the NOburst, we isolated polyclonal CD8+ T cells
expanded from the spleens of WT or CD40L KO mice previously
vaccinated with OVA peptide and tested their ability to induce
NO release in contact with slices of tumors grown in WT or
CD40L KO mice. Even though lack of CD40L in CD8+ T cells
specific for OVA decreased the NO release in WT tumors, the
highest reduction was observed in tumors grown in CD40L KO
mice (Figure 5B), suggesting that CD40L signaling is ‘‘upstream’’
of NO release by NOS2 following ACT.
To test the specificity of the CD40/CD40L axis in tumor rejec-
tion, wemonitored the survival ofWT, CD40 (encoded by Tnfrsf5)
KO, and CD40L (encoded by Cd40lg) KO mice bearing EG7
tumors and treated them with tumor-specific CD8+ T cells. We
found that lack of CD40L abrogated therapeutic activity while
lack of CD40 had a partial effect (Figure 5C). To understand
IsotypeStaining
E
A
% o
f sur
viva
l
+Ly6C+MHCII
highLy6C-MHCII
highF4/80 +Ly6G
++
% o
n C
D11
b N
OS
2
0
20
40
60
80
100
+Ly6C+MHCII
highLy6C-MHCII
highF4/80 +Ly6G0
20
40
60
80
100
++
% o
n C
D1 1
b N
OS
2
**
**
highB16 OVA lowB16 OVA
Days
0
20
40
60
80
100
0 10 20 30 40Days
0
20
40
60
80
100
% o
f sur
viva
l
0 10 20 30 40
w/o CD8 CD8 /
*
Days
0
% o
f sur
viva
l
0
20
40
60
80
100 w/o CD8CD8 OVA
low CD8 TRP2highCD8 TRP2
5 10 15 20 25 30 35
**
OT-I highTRP2 lowTRP2M.F.I.5074
M.F.I.1790
M.F.I.699
M.F.I.432
NOS2
TNF
Cou
ntC
ount
NOS2
TNFC
ount
Cou
nt
B
MHCII
Ly6C
MHCII
Ly6C
MHCII
Ly6C
DCTNFNOS2
Medium
OT-I w/o Anti-C
D40
OT-I+ Anti-CD40
high
TRP2 + Anti-C
D40
low
TRP2 + Anti-CD40
Anti-CD3 +
++
+%
of C
D11
b L
y6C
MH
CII
cel
ls
0
10
20
30
40
50
Anti-CD28 + Anti-C
D40
** ***
***
MFI
0
1000
2000
3000
4000
5000
6000
* ***
**
Medium
OT-I w/o Anti-C
D40
OT-I+ Anti-CD40
high
TRP2 + Anti-C
D40
Anti-CD3 +
Anti-CD28 + Anti-C
D40
/
44.8 28.4 6.01
Figure 4. Affinity between TCR and MHC-Peptide Complexes Regulates Tip-DC Generation and ACT Effectiveness
(A) Percentage of survival (*p% 0.05, log-rank test) and percentage of different tumor-infiltrating myeloid subpopulations in the CD11b+NOS2+ gate (mean ± SD,
representative of three independent experiments; **p% 0.01, by one-way ANOVA) forWTmice bearing B16-OVAhigh (n = 7) or B16-OVAlow (n = 6) tumor treated or
not with ACT.
(B) Splenic CD11b+ cells were cultured in the presence of cell-culture supernatant of antigen-stimulated OT-I, TRP2high, or TRP2low CD8+ T cells and anti-CD40
antibody for 48 hr and then analyzed for Tip-DC differentiation. Representative dot plots are shown.
(C) Percentage of CD11b+Ly6C+MHCII+ cells generated in vitro by splenic CD11b+ cells in different culture conditions. Mean ± SD; n = 4, representative
experiment of three. ***p % 0.001, **p % 0.01 by one-way ANOVA.
(D) As in (C), showing mean fluorescence intensity (MFI) of NOS2 and TNF for CD11b+Ly6C+MHCII+ cells. Mean ± SD; n = 4, representative experiment of three.
***p % 0.001, **p % 0.01, *p % 0.05 by one-way ANOVA.
(E) B16-tumor-bearing mice were adoptively transferred with CD8+ T cells from mice expressing the TCR specific for TRP-2 antigen either with TRP-2high or
TRP-2low. As negative control, anti-OVA CD8+ T cells were transferred. Survival of mice untreated or treated with ACT is reported. n = 10 mice pooled from three
independent experiments. **p % 0.01, log-rank test.
See also Figure S4.
how CD40 was involved in the NO-dependent therapeutic activ-
ity induced byCD8+ T cells, we isolated Ly6G�CD11b+ cells from
tumors grown in CD40-deficient mice. Different from WT mice
(Figure S2C), ACT did not increase the cytostatic effect of
Ly6G�CD11b+ cells against EG7 tumor cells (Figure S5C) and
did not increase the expression of NOS2 (Figure S5D) in cells
from Tnfrsf5�/� mice. These data indicate NOS2-induced tumor
killing requires activation of CD40 within intra-tumoral myeloid
cells.
To identify which cells in the recipient provided the endoge-
nous CD40L necessary for the therapeutic efficacy of ACT, we
quantified Cd40lg mRNA in different cells isolated from the
Cancer Cell 30, 377–390, September 12, 2016 383
A
D
C
WT NOSKO
CD40KO
CD40LKO
Fold
indu
ctio
n ov
er c
ontro
l
0
0.5
1.0
1.5
2.0
2.5
3.0w/o CD8 CD8 gp100
Days0 5 10 15 20 25 30
% o
f sur
viva
l
0
20
40
60
80
100 WTCD40 KO
Survival without ACT Survival after ACT
Days0 10 20 30 40 50
0
20
40
60
80
100
*****
2A
rea
(mm
)
WT CD40L KO
Day 13**
****
0
20
40
60
WT CD40L KOWT CD40L KO
Day 9
**
0
20
40
60
WT CD40L KOEG7 Tumor free EG7 Tumor free
0
1
2
3
4
5
6 *********
WT CD40LKO
Fold
indu
ctio
n ov
er c
ontro
l
w/o CD8
PolyclonalCD8 OVA
B
PolyclonalCD8 OVAfrom WT
from
CD40L KO
CD40L KO
CD8 OVA
Figure 5. CD40-CD40L Is Required for ACT
Effectiveness
(A) CFSE-labeled CD8+ T cells specific for either
OVA or gp100 antigens were incubated with EG7
tumor slices from either WT or different KO mice
as indicated. NO was detected by confocal mi-
croscopy of slices loaded with DAR-4M AM.
NO-release levels were measured as mean of
fluorescence and expressed as fold induction over
control (without CD8). Mean ± SEM; n=12 slices
pooled from three independent experiments.
***p % 0.001, **p % 0.01 by one-way ANOVA.
(B) CFSE-labeled polyclonal CD8+ T cells specific
for OVAwere derived from immunizedWT or CD40L
KO mice and were incubated with EG7 tumor slices
from either WT or CD40L KO mice, as indicated.
NO was detected as in (A). Mean ± SEM; n = 12
slices pooled from three independent experiments,
***p % 0.001 by one-way ANOVA and the Holm-
Sidak method of correction for all pairwise multiple
comparisons.
(C) Survival percentages of WT, CD40 KO, and
CD40L KO EG7-tumor-bearing mice untreated or
treated with ACT (n = 10); *p % 0.05, ***p % 0.001,
log-rank test.
(D) EG7-tumor-bearing RAG-deficient mice were
reconstituted with CD8+ T lymphocytes isolated
from spleens and lymph nodes of WT and CD40L
KO, either EG7-tumor-bearing or tumor-free, mice.
After 2 days, ACT with OVA-specific CD8+CD45.1+
T lymphocytes was performed. Tumor area at days
9 and 13 following ACT are reported. Horizontal
lines represent means of n = 7. **p % 0.01 by
unpaired Student’s t test.
See also Figure S5.
tumors of WT mice undergoing ACT. Apart from the transferred
CD8+CD45.1+ T lymphocytes, the other cells expressing
Cd40lg mRNA among tumor-infiltrating populations were the
recipient, host-derived CD4+ and CD8+ T cells (Figure S5E).
However, OVA-specific CD8+ T cells did not require help from
CD4+ T cells to induce tumor regression, since the depletion of
CD4+ T cells had no effect on ACT efficacy (Figure S5F).
To demonstrate that CD40L expression on endogenous
CD8+ T cells contributes to tumor rejection, we transferred
CD8+ T cells isolated from secondary lymphoid organs of
EG7-tumor-bearing WT or Cd40lg�/� mice to immunodeficient
EG7-tumor-bearing RAG mice. With this strategy, we reconsti-
tuted the endogenous anti-tumor CD8+ T cell repertoire pre-
ACT with either normal or CD40L-deficient CD8+ T lympho-
cytes. As an additional control, CD8+ T cells were enriched
from tumor-free mice. After reconstitution, mice were adop-
tively transferred with OVA-specific CD8+ T cells and tumor
growth was analyzed (Figure S5G). Following ACT, CD40L-
competent, endogenous CD8+ T cells from tumor-bearing WT
384 Cancer Cell 30, 377–390, September 12, 2016
mice contributed to control tumor growth
more effectively than CD8+ T lympho-
cytes isolated from either tumor-free or
Cd40lg�/� mice (Figure 5D). These data
demonstrate that the CD8+ T cell reper-
toire activated by tumors contributes to
tumor eradication following ACT by providing endogenous
CD40L help.
Enhanced ACT Efficacy Based on Supporting Tip-DCFunctionF4/80high mature macrophages express high amounts of ARG1
(Kratochvill et al., 2015) and are dependent on CSF-1 (Noy and
Pollard, 2014). Like Tip-DCs, these cells originate from inflam-
matorymonocytes recruited to the tumor and increase in number
over time during tumor growth (Franklin et al., 2014; Kratochvill
et al., 2015; Movahedi et al., 2010). Therefore, interfering with
CSF-1-dependent cells could enhance NO-dependent ACT by
reducing the number of ARG1+ cells. EG7-tumor-bearing WT
mice were acutely treated with a single dose of anti-CSF-1R
mAb and then injected with tumor-specific CD8+ T cells (Fig-
ure S6A). While ACT sustained and enhanced the decrease in
F4/80high macrophages following treatment with the anti-
CSF-1R mAb for 6 days, macrophage depletion did not
alter the expansion of NOS2+Ly6C+MHCII+ cells, suggesting a
A
BCtrl
++
% o
n C
D11
b N
OS
2 c
ells
010203040506070
Ctrl
++
% o
n C
D11
b N
OS2
cel
ls
010203040506070w/o CD8
CD8
Anti-CSF-1RAnti-CSF-1R
highF4/80
*** ***
**
D
Ab CTRLAb CTRL + CD8Anti-CSF-1R
ACT treatmentmAb treatment
Ctrl CSF-1R
Monocytes Granulocytes Macrophages
++
+%
of C
D45
CD
3 C
D8
+CD8 T cells
++
++
% o
f CD
45 C
D3
CD
8 C
D25
+Activated CD8 T cells**
**
C
*
w/o CD8 CD8
01234567
02468
10121416
0
102030
40506070
02468
101214161820
0
1
2
3
4
5Tip-DCs
02468
1012141618
++
++
% o
f CD
1 1b
Ly6
C M
HC
II N
OS
2
Ctrl CSF-1RCtrl CSF-1R
Ctrl CSF-1RCtrl CSF-1RCtrl CSF-1R
** **
* ***
**
* ** **
**
++
-%
of C
D11
b L
y6C
Ly6
G
+-
+%
of C
D11
b L
y6C
Ly6
G
+-
+%
of C
D11
b L
y6C
F4/
80
Days after ACT
0 7 10 14 21 24
3Tu
mor
vol
ume
(mm
)
Anti-CSF-1R + CD8
0500
100015002000250030003500
0500
100015002000250030003500
Days after ACT
0 7 10 14 21 24
3Tu
mor
vol
ume
(mm
)
Ab CTRL + CD8Anti-CSF-1R + CD8ACT treatmentmAb treatment
+ +Ly6C MHCIIFigure 6. Improving ACT Effectiveness by
Favoring Intra-tumoral Myeloid Balance
Toward Tip-DC Accumulation
(A) EG7-tumor-bearing WT mice were treated with
either anti-CSF-1R or Ctrl antibody, followed or
not by ACT with OVA-specific CD8+CD45.1+
T lymphocytes. Percentage of different myeloid
subpopulations in the CD11b+NOS2+ gate within
the tumor mass is shown. n = 12 pooled from two
independent experiments.
(B and C) WT (B) or NOS KO (C) MCA203-tumor-
bearing mice were treated weekly with either anti-
CSF-1R or control antibody and injected or not
with mTERT-specific CD8+ T lymphocytes. Tumor
volume at indicated days is shown as mean ± SD,
n=15.
(D) Percentage of different immune subpopulations
in tumors from mice treated with anti-CSF-1R or
control antibody with or without ACT (n = 8).
Data in (A)–(D) represent mean ± SD. ***p % 0.001,
**p% 0.01, *p% 0.05 by one-way ANOVA. See also
Figure S6.
CSF-1R-independent step for their accrual or differentiation
following ACT (Figure 6A).
Considering the activity of anti-CSF-1R on F4/80high mature
macrophages but not on Tip-DCs, we speculated that reprog-
ramming the tumor microenvironment with anti-CSF-1R mAb
could also improve the efficacy of ACT with limited reactivity to-
ward tumor antigens. To test this we used amodel in which CD8+
T cells have weak reactivity to their cognate antigen and fail to
mediate anti-tumor effects in normal mice. We used mouse
TERT (mTERT)-specific CD8+ T cells, which lack anti-tumor
activity against the TERT+ MCA203 fibrosarcoma when used
alone (Ugel et al., 2010, 2012). Repeated administrations of
anti-CSF-1R mAb with mTERT-specific CD8+ T cells on WT
mice induced an additive delay in tumor growth (Figures S6B
and 6B). The combined treatment had no effect when ad-
ministered to Nos2�/� mice (Figure 6C). ACT plus anti-CSF-1R
therapy caused a reduction in intra-tumoral macrophages and
Cance
monocytes while the numbers of granulo-
cytes, Tip-DCs, total CD8+ T cells, and,
in particular, activated CD8+ T cells
expanded (Figure 6D).
CD40L, NOS2, and TNF within theIntra-tumoral Immune Network AreLinked with Outcome of ColorectalCancer PatientsThe most complete picture of the immune
reaction in human cancer has been
described in colorectal cancer (CRC)
(Bindea et al., 2013b). In CRC tissues, we
correlated CD40LG, NOS2, and TNF
expression with markers specific for im-
mune cell subpopulations using ClueGO
(Bindea et al., 2009) and CluePedia
(Bindea et al., 2013a). We found an associ-
ation between the intra-tumoral expres-
sion of these genes with markers of cyto-
toxic CD8+ T cells, T cells, Th1, and activated DCs (Figure 7A).
B cells, Th2, Th17, and macrophages were included in the
network but had weaker correlations with the expression of
CD40LG, NOS2, and TNF compared with cytotoxic CD8+
T cells, T cells, Th1, and activated DCs. Other immune cell
populations did not correlate with the three target genes (Figures
7A and S7A). The expression of cytotoxic CD8+ T cells, T cells,
and Th1 markers was higher in tumors with high expression of
CD40LG, NOS2, and TNF compared with tumors with either
heterogeneous or low levels (Figure S7B). Similar results were
observed for MHCII genes and the genes related to antigen-pre-
senting machinery (Figure S7B). Results obtained by compari-
son of gene-expression profiles were validated by immunohisto-
chemistry. A significantly higher density of CD3+ T cells was
observed in tumors with high CD40LG (Figure S7C) and TNF
(Figure S7D), with a similar trendobserved forNOS2 (Figure S7E).
Tumors with high expression of CD40LG, TNF, or NOS2 showed
r Cell 30, 377–390, September 12, 2016 385
B
HiHiHi
LoLoLo
Survival (Months)0 40 80 12020 60 100
0
20
40
60
80
100
Dis
ease
-Fre
e S
urvi
val (
DFS
) [%
]
A
0
100
200
300
0
200
400
600**
CD3
HiHiHiHtgLoLoLo
NOS2TNF
CD40LGCD80
50
100
150
200
250
CD8extra
*
0
40
80
120
CD8intra
0
500
1000
1500
CD4
***
0
400
800
1200
CD680
50
100
150
200
IL170
2
4
8
6
T-Bet
*
#cel
ls/m
m2 C
T
C
140
Htg
IL12RB2
FN1
CCL22
CSF2
CD209
DCN
LAMP3
MSR1
CD83aDDCC
CCL17
CCL13
CCL1
DCC
MMaacccccrrrroophages
CD68
CCL7
PPBP
CXCL5
Normmaal mucosa
GZMBMAFTFH
RORC
IL17A
GZMA
CXCL13
Th17 cells
CD6
CTLA4
TBX21
IFNG
CD2
Thh11 ccells
GNLY CXCR5 LTA
KLRF1 STAT4PDCD1
CD38
GZMK
CD4
Th22 ceellls
LAIR2
GATA3
B cellllssssMS4A1
SMAD2 CXCR6
T helper cellllss HLA-DOB
CD28
BLK
IL2RB
CD3G
CD3ECD19
CD247ZAP70
TTTTTT ccccccceeeells
Cyyttoottoxxic cceells
GZMH
CD8A
PRF1
IL26PMCH
CD88 T cells NOS2
TNF
CD1AiDC
CD1E
CD
40LG
CD8A17 19 21 23
21
232527 ρ = 0.53
CD
40LG
GZMK
21
23
25
27
18 20 22 24 26
ρ = 0.53
CD
40LG
HLA-DOB18 20 22 24 26
21232527 ρ = 0.62
TNF
CD
8A 21
17
19
23
20 22 24 26
ρ = 0.31
CD
83TNF
20 22 24 26
21
17
19
23 ρ = 0.58
CD40LG XCL1NK cells
NCR1
CLEC4CpDC
FOXP3TReg
Tgd TRD
FPR2CXCR1
CXCR2Neutrophils
CCR2
NFATC4
TeTT mLTK
TPSAB1
MS4A2
Mast cells
CMA1
IL5RA
CCR3 PTGDR2
Eosinophils
#cel
ls/m
m2 C
T
Figure 7. CD40LG, NOS2, and TNF Correlate with Survival in Human CRC
(A) Correlations between CD40LG, NOS2, and TNF expression (qPCR) in CRC (n = 125 patients) and immunome markers visualized in a ClueGO-CluePedia
network. Markers associated to specific immune cell populations share the color of the node. The lines between nodes (edges) represent Spearman’s rank
correlation values and are colored red (CD40LG, r > 0.5), blue (NOS2, r > 0.2), and green (TNF, r > 0.5), respectively. Negative correlation is shown with a
sinusoidal line. The lower graphs show pairwise correlation plots corresponding to the network edges.
(B) Density of immune cells (number of positive cells permm2 of tissue surface area) infiltrating the center of the tumor (CT) in patients with (HiHiHi), heterogeneous
(Htg), or low (LoLoLo) expression of CD40LG, NOS2, and TNF. A parametric or non-parametric test was applied. Error bars denote mean ± SEM; n=107. The
median cell count per mm2 is shown by a blue line. **p % 0.01, *p % 0.05.
(C) Disease-free survival of patients having high, heterogeneous, and low expression of CD40LG, NOS2, and TNF.
See also Figure S7.
an increased density of CD8+, CD4+, T-Bet+ T cell infiltrate (Fig-
ures S7C–S7E). Patients with tumors having high (Hi) expression
of all three markers CD40LG, NOS2, and TNF (HiHiHi) had a
significant higher intra-tumoral density of CD3+ T cells, CD4+
T cells, and T-Bet+ Th1 cells (Figure 7B). In addition, CD8+
386 Cancer Cell 30, 377–390, September 12, 2016
T cells were significantly increased in the stroma of HiHiHi pa-
tients, whereas Th17 cells and macrophages showed no differ-
ences (Figure 7B). We investigated the effect of CD40LG,
NOS2, and TNF on disease-free survival (DFS) (Figure 7C). Pa-
tients having a high intra-tumoral expression of all three markers
had longer DFS compared with patients with low levels of these
markers (hazard ratio = 4.35, 95% confidence interval = 1.66–
11.75, log-rank p = 0.033).
DISCUSSION
We describe an interaction between anti-tumor CD8+ T cells and
Tip-DCs causing tumor growth control dependent on NO pro-
duction. ACT-based therapy requires the triggering of a
‘‘virtuous circle’’ whereby CD8+ T cell recognition of tumor
antigen is necessary to recruit and activate Tip-DCs, which in
turn present tumor antigens promoting T cell expansion and
tumor-killing activity by TNF and NO production. We found that
NO release is dominant for the anti-tumor activity of ACT and
is restrained by ARG1 expression in F4/80high macrophages.
NO produced by NOS2 in the tumor environment can restrain
the ability of T cells to produce IFN-g. Although we did not inves-
tigate the source of the immune-suppressive NO, it is likely that
F4/80+ cells in tumor might contribute in some situations (Vicetti
Miguel et al., 2010). The same study also highlighted that some
tissues, such as the anterior chamber of the eye, can negatively
regulate the NOS2 activity induced by ACT in tumor-infiltrating
F4/80+ cells by restraining NO production (Vicetti Miguel et al.,
2010).
We define a myeloid population expanded after ACT as Tip-
DCs; these cells have an inflammatory DC profile based on their
transcriptome and immune phenotype, functional activity as
antigen-presenting cells, and the ability to secrete NO and
TNF. The number of Tip-DCs varies between 0.01% and
0.15% in mouse tumors of different origins (data not shown)
and their number increases between 3.5- and 12-fold following
ACT. In all tumors, NOS2+ macrophages were either unchanged
or reduced. These data suggest that further studies are needed
to evaluate whether the clinical efficacy of TCR- or chimeric
antigen receptor-transduced T lymphocytes correlates with the
intra-tumoral expansion of human Tip-DCs.
Importantly, Tip-DCs did not require CSF-1R signaling for their
differentiation. However, CD40 engagement on Tip-DCs by
CD8+ T cells is one of the key molecular events underlying
both NO production and the anti-tumor effect. Tumors of CRC
patients with prolonged DFS shared a signature comprising
CD8+ T cells and activated DCs as well as CD40LG, TNF, and
NOS2 expression, suggesting that anti-tumor functions of
Tip-DCs and their activation and effector mechanisms might
overlap with the cognate events in the mouse (Bindea et al.,
2013b; Galon et al., 2006).
A basic requirement for T cells to eradicate tumors is the high
affinity of the targeted peptides for MHCI molecules (Engels
et al., 2013). We found that when tumor cells express a sufficient
amount of MHCI-peptide complexes, tumor-specific CD8+
T cells with sufficient TCR avidity expand and activate Tip-
DCs. Tip-DCs originate from bone marrow monocytes, and their
main roles are the rapid and local activation of T cell response
(Aldridge et al., 2009; Bosschaerts et al., 2010; Serbina et al.,
2003) and the pro-inflammatory activity in psoriatic lesions of
patients’ skin (Lowes et al., 2005). A key feature of Tip-DCs
is their ability to prime naive T cells (Chong et al., 2011). Our
data indicate that the immune functions of Tip-DCs extend
beyond the control of infections, are necessary for tumor growth
control, and might be part of a broader mechanism of tissue
homeostasis by locally coupling the adaptive immunity to cell
growth control.
Mok et al. (2014) reported an improvement of immuno-
therapy by ACT using the treatment interfering with CSF-1R
signaling. Moreover, anti-CSF-1R blocking antibody is
currently being tested in pre-clinical and early-phase clinical
trials as a means to deplete pro-tumor macrophages (Ries
et al., 2014). We demonstrate here that it is possible to
encourage ACT toward a poorly recognized tumor-associated
antigen by tilting the balance between immunosuppressive
cells such as macrophages and Tip-DCs without altering
Tip-DC generation from precursors. The use of anti-CSF-1R
antibodies in ACT could be modified to deplete F4/80+ macro-
phages at the time when Tip-DCs are most active in killing
tumors. Alternatively, Tip-DCs might be prepared in vitro and
targeted to the tumor environment to aid both locally distrib-
uted and incoming anti-tumor T lymphocytes. The antithetical
relationship between indwelling tumor macrophages and
Tip-DCs is therefore a further point of attack in designing
rational immunotherapies.
CD40-CD40L interplay controls an array of pathways at the
base of both initiation and progression of cellular and humoral
adaptive immunity (Gommerman and Summers deLuca, 2011).
Moreover, CD40 agonists induce T cell-dependent and -inde-
pendent tumor regression in both mice and patients with
pancreatic cancer (Beatty et al., 2011). Contrary to our initial
model, CD40L was not provided by tumor-infiltrating CD4+
but rather CD8+ T lymphocytes. A proportion (around 25% in
average) of central and effector memory CD8+ T cells express
CD40L and can display helper functions, and induce maturation
of monocyte-derived DCs and in vivo antigen-presenting cell
activation (Frentsch et al., 2013). The present study assigns
an important role to expression of CD40L on endogenous
CD8+ T cells. However, under some circumstances CD40L
might be provided by CD4+ T lymphocytes recognizing
mutated tumor epitopes, which are frequently detected in
mouse and human tumors (Gubin et al., 2014; Kreiter et al.,
2015; Linnemann et al., 2015).
Clinical evidence suggests that ACT efficacy can be increased
by chemotherapy-induced lymphodepletion of the host (Restifo
et al., 2012), but our data propose alternatives. The CD8+
T cells recognizing the self-antigen mTERT can treat established
melanomas as effectively as T cells derived from Pmel-1 TCR
transgenic mice, which recognize the hgp-100 melanoma anti-
gen (Ugel et al., 2010). However, melanoma growth control
following ACT with CD8+ T cells was achieved only in mice
completely lacking adaptive immunity, lymphodepleted by
non-myeloablative irradiation, or pre-treated with low doses of
the chemotherapeutic drug 5-fluorouracil (Ugel et al., 2010,
2012). In normal hosts, mTERT-specific CD8+ T lymphocytes
lack therapeutic efficacy and do not induce the appearance of
Tip-DCs unless coupled with CSF-1R blockade.
In conclusion, we have dissected mechanisms governing
the interplay between therapeutic anti-cancer T cells and the
local immunosuppressive microenvironment. Most significantly,
we have elucidated distinct nodes in the interplay between
activated T cells and myeloid cells that can be exogenously
manipulated to enhance cancer immunotherapy.
Cancer Cell 30, 377–390, September 12, 2016 387
EXPERIMENTAL PROCEDURES
Mice
C57BL/6 (WT) and congenic CD45.1 (Ly5+) OT-I mice (C57BL/6-Tg
(TcraTcrb)1100Mjb/Crl) and OT-II mice (C57BL/6-Tg (TcraTcrb)425Cbn/Crl) were
from Charles River Laboratories. Pmel-1 transgenic mice with a Va1Vb13
H-2b-restricted TCR specific for murine and human melanoma peptide
gp10025–33 by CD8+ T lymphocytes were provided by N. Restifo of the NIH.
Rag2�/�gc�/� (RAG), Tnfrsf5�/� (B6.129P2-Cd40tm1Kik/J), Cd40lg�/�
(B6.129S2-Cd40lgtm1Imx/J), and Nos2�/� mice were from Jackson Labora-
tories. Tie2cre+, Arg1flox/flox, Nos2�/� Arg1flox/flox, and Nos2�/�;Arg1flox/flox;Tie2cre+ mice have been previously described (Duque-Correa et al., 2014;
El Kasmi et al., 2008; Pesce et al., 2009). NOG mice (NOD.Cg-Prkdcscid
Il2rgtm1Sug/JicTac) were from Taconic. The TCR Tg mouse strains 37B7 (TCRlow
mice) and 24H9 (TCRhigh mice), which bear a TCR transgene that recognizes
an H-2Kb–restricted epitope of TRP-2180–188, were a gift from A. Hurwitz
(NCI, NIH). Females of 8 weeks were used for all experiments. Mice were
maintained in specific pathogen-free conditions at the Veneto Institute of
Oncology and were randomized before the first treatment.
Animal Studies
All animal experiments were approved by our local animal ethics committee at
the University of Padova andwere executed in accordancewith governing Ital-
ian law and EU directives and guidelines. Mice were monitored daily and
euthanized when displaying excessive discomfort.
Cell Lines, Synthetic Peptides, and Reagents
Cell lines, Synthetic peptides, and reagents are detailed in the Supplemental
Experimental Procedures.
Cytofluorimetric Analysis and Sorting
Antibodies used, staining procedures, and cell-sorting procedures are
detailed in the Supplemental Experimental Procedures.
Adoptive Cells Therapy
Mice were injected subcutaneously with 0.5 3 106 EG7 cells. After 7 days,
mice were injected intravenously with 0.53 106 antigen-stimulated T lympho-
cytes specific for OVA class I epitope. Tumor volume was monitored every
2 days with a caliper and mice were euthanized when tumors reached
200 mm2. OVA-specific CD8+CD45.1+ T lymphocytes were prepared from
OT-I splenocytes and plated in 24-well plates in presence of 1 mg/mL
OVA257–264 (SIINFEKL) peptide. Cultures were maintained for 7 days in
complete medium with 20 IU/mL interleukin-2. Data are presented as the
percentage of survival after ACT. In MCA203 tumor-bearing mice, ACT was
performed as described in Figures S6B and 6B–6D by using mTERT-specific
CD8+ T lymphocytes, as previously described (Ugel et al., 2012).
Ex Vivo Antigen Stimulation Assays
Myeloid cells sorted from the tumor masses of EG7-tumor-bearing and WT
mice either treated with ACT or untreated were co-cultured with 53 104 naive
CD4+ T lymphocytes isolated by immunomagnetic sorting fromOT-II mice, in a
final volume of 200 mL of complete DMEM in U-bottomed 96 well plates for
72 hr. Supernatants from co-cultures were collected and assessed for the
concentration of mouse IFN-g.
ELISA
ELISA for mouse IFN-g (R&D Systems) was performed according to the
manufacturer’s instructions.
NO Detection within Viable Tumor Slices
C57BL/6, NOS2 KO, CD40L KO, and CD40 KO mice were inoculated subcu-
taneously with 0.5 3 106 EG7-OVA cells. At day 7 tumors were dissected,
embedded in 6% agarose (Invitrogen), and cut on a vibratome (Leica,
VT1000S) to obtain thick viable tumor slices (250 mm). Slices were loaded
with the NO fluorescent probe (diaminorhodamine-4M AM; Sigma) for 1 hr at
37�C. Carboxyfluorescein succinimidyl ester (CFSE)-labeled CD8+ T cells
(1.2 3 106) were added on the top of tumor slices. After 2 hr, tumor slices
were fixed with 4% paraformaldehyde for 30 min at room temperature. Nuclei
388 Cancer Cell 30, 377–390, September 12, 2016
were counterstained with 1 mg/mL ToPRO (Invitrogen). Slides were mounted
with ProLong (Invitrogen) and analyzed by confocal microscopy (TCS SP5;
Leica). For quantitative analysis of NO staining, 50 different and noncontiguous
regions of interest (ROIs) were randomly selected, and DAR-4M AM mean in-
tensity was quantified for each ROI. Results were expressed as fold induction
over control (no CD8+ T cells).
Human Tip-DC Differentiation
Human CD14+ monocytes, immunomagnetically separated from buffy coat of
HLA-A2+ healthy donors, were co-cultured for 48 hr in vitro using the superna-
tant of a 24-hr co-culture between specific anti-h-TERT865–873 CD8+
T cells (obtained as reported in Supplemental Experimental Procedures) and
HLA-A2-restricted PBMCs pulsed with the specific human hTERT865–873(RLVDDFLLV) peptide.
The study was approved by local ethics committee (AOUI of Verona, no.
1496) and the donors were enrolled after signing informed consent.
Combined ACT and Human Tip-DC Treatment
For in vivo testing of the therapeutic activity of hTERT-specific T cells, 13 106
MDA-MB231 cells were inoculated subcutaneously in the left flank of NOG
mice. After 10 days, mice were inoculated intravenously with hTERT-specific
CD8+ T cells (2.53 106 cells/mouse) in association with intra-tumoral injection
of either monocytes or hTip-DCs (both at 13 106 cells/mouse). The treatment
was repeated three times every 5 days. Tumor volume was calculated accord-
ing to the following equation: V (mm3) = (d2 3 D)/2, where d (mm) and D (mm)
are the smallest and largest perpendicular tumor diameters, respectively, as
assessed by caliper measurement.
Combined ACT and Murine Tip-DC Treatment
Murine Tip-DCs were sorted from tumor mass of WT or Nos2�/� EG7-tumor-
bearing mice after 3 days from ACT with 0.5 3 106 antigen-stimu-
lated T lymphocytes specific for OVA class I peptide as indicated in
Supplemental Experimental Procedures. After 7 days Nos2�/� EG7-tumor-
bearing mice were inoculated intravenously with OVA-specific CD8+ T cells
(0.5 3 106 cells/mouse) in association with intra-tumoral injection of either
Tip-DCs from WT or Nos2�/� mice (both at 1 3 106 cells/mouse) on the
same day and 2 days later. Data are presented as the percentage of survival
as described in Figures 3A and 3B.
Vaccination Protocol to Obtain Polyclonal CD8+ T Cells
Recognizing OVA
WT and CD40L KO mice were intraperitoneally injected with 100 mg
of FGK45.5 antibody against CD40 (BioXcell) and then rubbed with
imiquimod (Meda) after the administration of OVA257–264 (SIINFEKL) peptide
(200 mg/mouse) at the tail base. Peptide injection was repeated twice every
7 days.
Statistical Analysis
Values are reported as mean ± SD. We performed statistical analysis by
Student’s t test or one-way ANOVA and the Holm-Sidak method of correction
for all pairwise multiple comparisons. We assumed normality and equal
distribution of variance between the different groups analyzed. Survival in
mouse experiments are reported as Kaplan-Meier curves and significance
was determined by log-rank test. Values were considered significant at
p % 0.05 and are indicated as *p % 0.05, **p % 0.01, and ***p % 0.001. All
analyses were performed using SigmaPlot software.
Colorectal Cancer Patients
CRC patients who underwent primary resection of their tumor at the Laennec-
HEGP Hospitals between 1996 and 2004 were reviewed and previously
described (Galon et al., 2006). Ethical, legal, and social implications were
approved by ethical review board from CPP Hotel Dieu, Ile de France. All
experiments were performed according to the Helsinki guidelines. Informed
consent was obtained from all subjects at the collection time.
Low-Density Array Real-Time Taqman qPCR Analysis
The human tissue samples for real-time qPCR were treated and processed as
reported in detail in the Supplemental Experimental Procedures section.
Tissue Microarray Immunohistochemistry Analysis
Tissue microarray from the center and invasive margin of colorectal tumors
were constructed (Galon et al., 2006). Procedures for immunohistochemistry
analysis are detailed in Supplemental Experimental Procedures.
Statistical Analysis for Studies with Human Samples
All bar plots are shown as mean ± SEM. For pairwise comparisons of
parametric and non-parametric data, Student’s t test and Mann-Whitney-
Wilcoxon rank-sum test were used, respectively. The hazard ratio (Cox
proportional hazards model) and the log-rank test were used to compare
disease-free and overall survival between patients in different groups. To avoid
overfitting, we corrected hazard ratios and log-rank p values obtained by the
‘‘minimum p value’’ approach. A p value of <0.05 was considered statistically
significant. Analyses were performed with the statistical software R imple-
mented as a statistical module in TME.db. Functional and correlation analyses
were performed using CluePedia and ClueGO (Bindea et al., 2009, 2013a)
within the Cytoscape framework. The normality of the data was tested using
the Shapiro-Wilk test. Correction of the hazard ratios and log-rank p values
were done as suggested by Hollander et al. Altman et al., respectively, as
previously reported (Mlecnik et al., 2011).
ACCESSION NUMBERS
The Gene Expression Omnibus accession number for the microarray data re-
ported in this paper is GEO: GSE74427.
SUPPLEMENTAL INFORMATION
Supplemental Information includes Supplemental Experimental Procedures,
seven figures, and two tables and can be found with this article online at
http://dx.doi.org/10.1016/j.ccell.2016.08.004.
AUTHOR CONTRIBUTIONS
Conceptualization, I.M. and V.B.; Methodology, P.J.M., F.K., and B. Molon;
Formal Analysis, B. Mlecnik, G.B., J.G., S.B., and E.M.C.M.; Investigation,
I.M., S.Z., A.H.R.A., M.S.S., G.D., S.U., J.E.Q., and A.M.B.; Resources,
C.H.R., V.R., and S.H.; Writing – Original Draft, I.M., G.B., E.M.C.M., P.Z.,
and C.H.R.; Writing – Review & Editing, I.M., J.G., S.B., P.J.M., and V.B.; Su-
pervision, J.G., S.B., P.J.M., and V.B.; Funding acquisition, V.B.
ACKNOWLEDGMENTS
We thank Kevin Leone for the artwork. This work was supported by grants from
the Italian Ministry of Health (FINALIZZATA RF-2011-02348435 cup:
E35G1400019001); Italian Ministry of Education Universities, and Research
(FIRB cup: B31J11000420001 and RBAP11T3WB); EPIGEN – Italian Flagship
Project Epigenomics; Italian Association for Cancer Research (AIRC, grants
6599, 12182, 14103 and Special Program Molecular Clinical Oncology 5 per
mille); PRIN 2009 (2009NREAT2_003); the National Cancer Institute of France
(INCa), INSERM; Qatar National Research Fund under its National Priorities
Research Program award number NPRP09-1174-3-291; the Cancer Research
For PersonalizedMedicine (CARPEM); Paris Alliance of Cancer Research Insti-
tutes (PACRI); the LabEx Immuno-oncology; NIH grants CA189990 (P.J.M.)
and CA138064 (J.E.Q.); Alex’s Lemonade Stand Foundation and the Hartwell
Foundation (P.J.M.); Cancer Center Core Grant P30 CA21765, the Austrian
Science Fund J3309-B19 (F.K.), and the American Lebanese Syrian Associ-
ated Charities; Cariparo Foundation Fellowship (A.H.R.A.).
Received: October 30, 2015
Revised: May 13, 2016
Accepted: August 9, 2016
Published: September 12, 2016; corrected online September 26, 2016
REFERENCES
Aldridge, J.R., Jr., Moseley, C.E., Boltz, D.A., Negovetich, N.J., Reynolds, C.,
Franks, J., Brown, S.A., Doherty, P.C., Webster, R.G., and Thomas, P.G.
(2009). TNF/iNOS-producing dendritic cells are the necessary evil of lethal
influenza virus infection. Proc. Natl. Acad. Sci. USA 106, 5306–5311.
Arina, A., and Bronte, V. (2015). Myeloid-derived suppressor cell impact on
endogenous and adoptively transferred T cells. Curr. Opin. Immunol. 33,
120–125.
Beatty, G.L., Chiorean, E.G., Fishman, M.P., Saboury, B., Teitelbaum, U.R.,
Sun, W., Huhn, R.D., Song, W., Li, D., Sharp, L.L., et al. (2011). CD40 agonists
alter tumor stroma and show efficacy against pancreatic carcinoma in mice
and humans. Science 331, 1612–1616.
Bindea, G., Mlecnik, B., Hackl, H., Charoentong, P., Tosolini, M., Kirilovsky, A.,
Fridman, W.H., Pages, F., Trajanoski, Z., and Galon, J. (2009). ClueGO: a
Cytoscape plug-in to decipher functionally grouped gene ontology and
pathway annotation networks. Bioinformatics 25, 1091–1093.
Bindea, G., Galon, J., and Mlecnik, B. (2013a). CluePedia Cytoscape plugin:
pathway insights using integrated experimental and in silico data.
Bioinformatics 29, 661–663.
Bindea, G., Mlecnik, B., Tosolini, M., Kirilovsky, A., Waldner, M., Obenauf,
A.C., Angell, H., Fredriksen, T., Lafontaine, L., Berger, A., et al. (2013b).
Spatiotemporal dynamics of intratumoral immune cells reveal the immune
landscape in human cancer. Immunity 39, 782–795.
Bosschaerts, T., Guilliams, M., Stijlemans, B., Morias, Y., Engel, D., Tacke, F.,
Herin, M., De Baetselier, P., and Beschin, A. (2010). Tip-DC development dur-
ing parasitic infection is regulated by IL-10 and requires CCL2/CCR2, IFN-
gamma and MyD88 signaling. PLoS Pathog. 6, e1001045.
Bronte, V., and Zanovello, P. (2005). Regulation of immune responses by
L-arginine metabolism. Nat. Rev. Immunol. 5, 641–654.
Chen, D.S., and Mellman, I. (2013). Oncology meets immunology: the cancer-
immunity cycle. Immunity 39, 1–10.
Chong, S.Z., Wong, K.L., Lin, G., Yang, C.M., Wong, S.C., Angeli, V., Macary,
P.A., and Kemeny, D.M. (2011). Human CD8(+) T cells drive Th1 responses
through the differentiation of TNF/iNOS-producing dendritic cells. Eur. J.
Immunol. 41, 1639–1651.
Colegio, O.R., Chu, N., Szabo, A.L., Chu, T., Rhebergen, A.M., Jairam, V.,
Cyrus, N., Borowski, C.E., Eisenbarth, S.C., Phillips, G.M., et al. (2014).
Functional polarization of tumor-associated macrophages by tumor-derived
lactic acid. Nature 513, 559–563.
Conde, P., Rodriguez, M., van der Touw, W., Jimenez, A., Burns, M., Miller, J.,
Brahmachary, M., Chen, H.M., Boros, P., Rausell-Palamos, F., et al. (2015).
DC-SIGN(+) macrophages control the induction of transplantation tolerance.
Immunity 42, 1143–1158.
Corzo, C.A., Condamine, T., Lu, L., Cotter, M.J., Youn, J.I., Cheng, P., Cho,
H.I., Celis, E., Quiceno, D.G., Padhya, T., et al. (2010). HIF-1alpha regulates
function and differentiation of myeloid-derived suppressor cells in the tumor
microenvironment. J. Exp. Med. 207, 2439–2453.
Duque-Correa, M.A., Kuhl, A.A., Rodriguez, P.C., Zedler, U., Schommer-
Leitner, S., Rao, M., Weiner, J., 3rd, Hurwitz, R., Qualls, J.E., Kosmiadi,
G.A., et al. (2014). Macrophage arginase-1 controls bacterial growth and pa-
thology in hypoxic tuberculosis granulomas. Proc. Natl. Acad. Sci. USA 111,
E4024–E4032.
El Kasmi, K.C., Qualls, J.E., Pesce, J.T., Smith, A.M., Thompson, R.W., Henao-
Tamayo, M., Basaraba, R.J., Konig, T., Schleicher, U., Koo, M.S., et al. (2008).
Toll-like receptor-induced arginase 1 in macrophages thwarts effective immu-
nity against intracellular pathogens. Nat. Immunol. 9, 1399–1406.
Engels, B., Engelhard, V.H., Sidney, J., Sette, A., Binder, D.C., Liu, R.B., Kranz,
D.M., Meredith, S.C., Rowley, D.A., and Schreiber, H. (2013). Relapse or erad-
ication of cancer is predicted by peptide-major histocompatibility complex af-
finity. Cancer Cell 23, 516–526.
Franklin, R.A., Liao, W., Sarkar, A., Kim, M.V., Bivona, M.R., Liu, K., Pamer,
E.G., and Li, M.O. (2014). The cellular and molecular origin of tumor-associ-
ated macrophages. Science 344, 921–925.
Frentsch, M., Stark, R., Matzmohr, N., Meier, S., Durlanik, S., Schulz, A.R.,
Stervbo, U., Jurchott, K., Gebhardt, F., Heine, G., et al. (2013). CD40L expres-
sion permits CD8+ T cells to execute immunologic helper functions. Blood 122,
405–412.
Cancer Cell 30, 377–390, September 12, 2016 389
Gabrilovich, D.I., Ostrand-Rosenberg, S., and Bronte, V. (2012). Coordinated
regulation of myeloid cells by tumours. Nat. Rev. Immunol. 12, 253–268.
Galon, J., Costes, A., Sanchez-Cabo, F., Kirilovsky, A., Mlecnik, B., Lagorce-
Pages, C., Tosolini, M., Camus, M., Berger, A., Wind, P., et al. (2006). Type,
density, and location of immune cells within human colorectal tumors predict
clinical outcome. Science 313, 1960–1964.
Gautier, E.L., Shay, T., Miller, J., Greter, M., Jakubzick, C., Ivanov, S., Helft, J.,
Chow, A., Elpek, K.G., Gordonov, S., et al. (2012). Gene-expression profiles
and transcriptional regulatory pathways that underlie the identity and diversity
of mouse tissue macrophages. Nat. Immunol. 13, 1118–1128.
Ginhoux, F., Schultze, J.L., Murray, P.J., Ochando, J., and Biswas, S.K. (2015).
New insights into the multidimensional concept of macrophage ontogeny,
activation and function. Nat. Immunol. 17, 34–40.
Glynn, S.A., Boersma, B.J., Dorsey, T.H., Yi, M., Yfantis, H.G., Ridnour, L.A.,
Martin, D.N., Switzer, C.H., Hudson, R.S., Wink, D.A., et al. (2010).
Increased NOS2 predicts poor survival in estrogen receptor-negative breast
cancer patients. J. Clin. Invest. 120, 3843–3854.
Gommerman, J.L., and Summers deLuca, L. (2011). LTbetaR and CD40:
working together in dendritic cells to optimize immune responses. Immunol.
Rev. 244, 85–98.
Gubin, M.M., Zhang, X., Schuster, H., Caron, E., Ward, J.P., Noguchi, T.,
Ivanova, Y., Hundal, J., Arthur, C.D., Krebber, W.J., et al. (2014). Checkpoint
blockade cancer immunotherapy targets tumour-specific mutant antigens.
Nature 515, 577–581.
Haverkamp, J.M., Crist, S.A., Elzey, B.D., Cimen, C., and Ratliff, T.L. (2011).
In vivo suppressive function of myeloid-derived suppressor cells is limited to
the inflammatory site. Eur. J. Immunol. 41, 749–759.
Jana, M., Liu, X., Koka, S., Ghosh, S., Petro, T.M., and Pahan, K. (2001).
Ligation of CD40 stimulates the induction of nitric-oxide synthase in microglial
cells. J. Biol. Chem. 276, 44527–44533.
Klug, F., Prakash, H., Huber, P.E., Seibel, T., Bender, N., Halama, N.,
Pfirschke, C., Voss, R.H., Timke, C., Umansky, L., et al. (2013). Low-dose
irradiation programs macrophage differentiation to an iNOS(+)/M1 phenotype
that orchestrates effective T cell immunotherapy. Cancer Cell 24, 589–602.
Korrer, M.J., and Routes, J.M. (2014). Possible role of arginase-1 in concom-
itant tumor immunity. PLoS One 9, e91370.
Kratochvill, F., Neale, G., Haverkamp, J.M., Van de Velde, L.A., Smith, A.M.,
Kawauchi, D., McEvoy, J., Roussel, M.F., Dyer, M.A., Qualls, J.E., and
Murray, P.J. (2015). Tnf counterbalances the emergence of M2 tumor macro-
phages. Cell Rep. 12, 1902–1914.
Kreiter, S., Vormehr, M., van de Roemer, N., Diken, M., Lower, M., Diekmann,
J., Boegel, S., Schrors, B., Vascotto, F., Castle, J.C., et al. (2015). Mutant MHC
class II epitopes drive therapeutic immune responses to cancer. Nature 520,
692–696.
Linnemann, C., van Buuren,M.M., Bies, L., Verdegaal, E.M., Schotte, R., Calis,
J.J., Behjati, S., Velds, A., Hilkmann, H., Atmioui, D.E., et al. (2015). High-
throughput epitope discovery reveals frequent recognition of neo-antigens
by CD4+ T cells in human melanoma. Nat. Med. 21, 81–85.
Lowes, M.A., Chamian, F., Abello, M.V., Fuentes-Duculan, J., Lin, S.L.,
Nussbaum, R., Novitskaya, I., Carbonaro, H., Cardinale, I., Kikuchi, T., et al.
(2005). Increase in TNF-alpha and inducible nitric oxide synthase-expressing
dendritic cells in psoriasis and reduction with efalizumab (anti-CD11a). Proc.
Natl. Acad. Sci. USA 102, 19057–19062.
Marigo, I., Bosio, E., Solito, S., Mesa, C., Fernandez, A., Dolcetti, L., Ugel, S.,
Sonda, N., Bicciato, S., Falisi, E., et al. (2010). Tumor-induced tolerance and
immune suppression depend on the C/EBPbeta transcription factor.
Immunity 32, 790–802.
Miller, J.C., Brown, B.D., Shay, T., Gautier, E.L., Jojic, V., Cohain, A., Pandey,
G., Leboeuf, M., Elpek, K.G., Helft, J., et al. (2012). Deciphering the transcrip-
tional network of the dendritic cell lineage. Nat. Immunol. 13, 888–899.
Mlecnik, B., Tosolini, M., Kirilovsky, A., Berger, A., Bindea, G., Meatchi, T.,
Bruneval, P., Trajanoski, Z., Fridman, W.H., Pages, F., and Galon, J. (2011).
390 Cancer Cell 30, 377–390, September 12, 2016
Histopathologic-based prognostic factors of colorectal cancers are associ-
ated with the state of the local immune reaction. J. Clin. Oncol. 29, 610–618.
Mok, S., Koya, R.C., Tsui, C., Xu, J., Robert, L., Wu, L., Graeber, T.G., West,
B.L., Bollag, G., and Ribas, A. (2014). Inhibition of CSF-1 receptor improves
the antitumor efficacy of adoptive cell transfer immunotherapy. Cancer Res.
74, 153–161.
Movahedi, K., Laoui, D., Gysemans, C., Baeten, M., Stange, G., Van den
Bossche, J., Mack, M., Pipeleers, D., In’t Veld, P., De Baetselier, P., et al.
(2010). Different tumor microenvironments contain functionally distinct
subsets of macrophages derived from Ly6C(high) monocytes. Cancer Res.
70, 5728–5739.
Noy, R., and Pollard, J.W. (2014). Tumor-associated macrophages: from
mechanisms to therapy. Immunity 41, 49–61.
Page, D.B., Postow, M.A., Callahan, M.K., Allison, J.P., and Wolchok, J.D.
(2014). Immune modulation in cancer with antibodies. Annu. Rev. Med. 65,
185–202.
Pesce, J.T., Ramalingam, T.R., Mentink-Kane, M.M., Wilson, M.S., El Kasmi,
K.C., Smith, A.M., Thompson, R.W., Cheever, A.W., Murray, P.J., and Wynn,
T.A. (2009). Arginase-1-expressing macrophages suppress Th2 cytokine-
driven inflammation and fibrosis. PLoS Pathog. 5, e1000371.
Restifo, N.P., Dudley, M.E., and Rosenberg, S.A. (2012). Adoptive immuno-
therapy for cancer: harnessing the T cell response. Nat. Rev. Immunol. 12,
269–281.
Ries, C.H., Cannarile, M.A., Hoves, S., Benz, J., Wartha, K., Runza, V., Rey-
Giraud, F., Pradel, L.P., Feuerhake, F., Klaman, I., et al. (2014). Targeting tu-
mor-associated macrophages with anti-CSF-1R antibody reveals a strategy
for cancer therapy. Cancer Cell 25, 846–859.
Robbins, P.F., Lu, Y.C., El-Gamil, M., Li, Y.F., Gross, C., Gartner, J., Lin, J.C.,
Teer, J.K., Cliften, P., Tycksen, E., et al. (2013). Mining exomic sequencing
data to identify mutated antigens recognized by adoptively transferred tu-
mor-reactive T cells. Nat. Med. 19, 747–752.
Rosenberg, S.A., and Restifo, N.P. (2015). Adoptive cell transfer as personal-
ized immunotherapy for human cancer. Science 348, 62–68.
Serbina, N.V., Salazar-Mather, T.P., Biron, C.A., Kuziel, W.A., and Pamer, E.G.
(2003). TNF/iNOS-producing dendritic cells mediate innate immune defense
against bacterial infection. Immunity 19, 59–70.
Topalian, S.L., Drake, C.G., and Pardoll, D.M. (2015). Immune checkpoint
blockade: a common denominator approach to cancer therapy. Cancer Cell
27, 450–461.
Ugel, S., Scarselli, E., Iezzi, M., Mennuni, C., Pannellini, T., Calvaruso, F.,
Cipriani, B., De Palma, R., Ricci-Vitiani, L., Peranzoni, E., et al. (2010).
Autoimmune B-cell lymphopenia after successful adoptive therapy with telo-
merase-specific T lymphocytes. Blood 115, 1374–1384.
Ugel, S., Peranzoni, E., Desantis, G., Chioda, M., Walter, S., Weinschenk, T.,
Ochando, J.C., Cabrelle, A., Mandruzzato, S., and Bronte, V. (2012).
Immune tolerance to tumor antigens occurs in a specialized environment of
the spleen. Cell Rep. 2, 628–639.
Ugel, S., De Sanctis, F., Mandruzzato, S., and Bronte, V. (2015). Tumor-
induced myeloid deviation: when myeloid-derived suppressor cells meet
tumor-associated macrophages. J. Clin. Invest. 125, 3365–3376.
Vicetti Miguel, R.D., Cherpes, T.L., Watson, L.J., and McKenna, K.C. (2010).
CTL induction of tumoricidal nitric oxide production by intratumoral macro-
phages is critical for tumor elimination. J. Immunol. 185, 6706–6718.
Weiss, J.M., Ridnour, L.A., Back, T., Hussain, S.P., He, P., Maciag, A.E.,
Keefer, L.K., Murphy, W.J., Harris, C.C., Wink, D.A., and Wiltrout, R.H.
(2010). Macrophage-dependent nitric oxide expression regulates tumor cell
detachment and metastasis after IL-2/anti-CD40 immunotherapy. J. Exp.
Med. 207, 2455–2467.
Zhu, Z., Singh, V., Watkins, S.K., Bronte, V., Shoe, J.L., Feigenbaum, L., and
Hurwitz, A.A. (2013). High-avidity T cells are preferentially tolerized in the tumor
microenvironment. Cancer Res. 73, 595–604.
Cancer Cell, Volume 30
Supplemental Information
T Cell Cancer Therapy Requires CD40-CD40L
Activation of Tumor Necrosis Factor and Inducible
Nitric-Oxide-Synthase-Producing Dendritic Cells
Ilaria Marigo, Serena Zilio, Giacomo Desantis, Bernhard Mlecnik, Andrielly H.R.Agnellini, Stefano Ugel, Maria Stella Sasso, Joseph E. Qualls, Franz Kratochvill, PaolaZanovello, Barbara Molon, Carola H. Ries, Valeria Runza, Sabine Hoves, Amélie M.Bilocq, Gabriela Bindea, Emilia M.C. Mazza, Silvio Bicciato, Jérôme Galon, Peter J.Murray, and Vincenzo Bronte
1
Supplemental Data
Figure S1. Related to Figure 1. ARG1 and NOS2 are mainly expressed in tumor-infiltrating myeloid cells.
(A) NOS2 MFI on CD11b+ cells from spleen or tumor of WT EG7 tumor-bearing mice measured by FACS analysis; mean ± s.d; n=11, pooled from 3 independent experiments; **p ≤ 0.01, unpaired Student t-test analysis. (B) Percent of tumor-infiltrating CD11b+ cells in either WT or KO mice at day 10 and 21 post-EG7 tumor implant. Mean ± s.d; n=9 mice/group, pooled from 3 independent experiments. (C) Decreasing proportions of tumor-infiltrating CD11b+ cells from either WT or KO EG7 tumor-bearing mice were cultured with fixed numbers of stimulated, OVA-specific CD8+CD45.1+ lymphocytes. In the left panel, the percentage of proliferating, CFSE-labeled CD8+CD45.1+ lymphocytes is shown. In the right panel, L.U.30 (lytic unit 30%) is shown as a measure of lymphocyte-mediated lysis. For each experiment, either proliferation or lytic activity of control MLPC, i.e. OVA-specific CD8+CD45.1+ lymphocytes stimulated without myeloid cells are set as 100% and indicated by a dotted line. Mean ± s.d. ; n=3, representative of 3 independent experiments. (D) Timeline for experimental treatment reported in Fig.1. WT, NOS KO and ARG NOS KO mice were injected with EG7 cells. At day 7, mice were either treated or not with OVA-specific, CD8+CD45.1+ lymphocytes obtained from OT-I mice. Mice were euthanized at day 10 to perform FACS analysis and cell sorting or when the tumor reached an area of 200 mm2. (E) Percent of CD11b+NOS2+ cells, in tumor-derived cell suspensions from WT and ARG KO mice, either untreated or treated with ACT. Mean ± s.d.; n=8, pooled from 2 independent experiments. ***p ≤ 0.001, **p ≤ 0.01 and *p ≤ 0.05, by using One Way ANOVA and the Holm–Sidak method of correction for all pairwise multiple comparisons.
2
Figure S2. Related to Figure 2. Characterization of tumor-infiltrating myeloid subpopulations. (A) Representative flow cytometry gating strategy to define tumor infiltrating myeloid populations CD11b+NOS2+ in NOS KO mice treated with (CD8) used as negative control for anti-NOS2 antibody staining. (B) Normalized Arg1 mRNA expression in CD11b+ tumor infiltrating Ly6ChighMHCII- and F4/80high myeloid cells (n=3, representative of 3 independent experiments). The F4/80high cell fraction was enriched within the Ly6C-MHCII+ cells and is the equivalent of Ly6Clow, F4/80+ population shown in Figure 1 panel A. Horizontal lines represent means. ***p ≤ 0.001, unpaired Student t-test analysis. (C) Upper diagram indicates the overall experimental design to assess the proliferation of tumor cells. Right panels show CD11b+Ly6G- cells sorted from WT, NOS KO and ARG, NOS double KO, EG7 tumor-bearing mice, either untreated or treated with ACT, co-cultured with CFSE-labeled EG7 cells at the ratios shown at the top of the figure. The percentage of proliferating EG7 cells after co-culture compared to CFSE-labeled EG7 tumor cells cultured without CD11b+Ly6G-cells is shown. Mean ± s.d; n=9, pooled from 3 independent experiments. *p ≤ 0.05, unpaired Student t-test analysis. (D) Immunoblot analysis of NOS2 expression in the lysate of CD11b+Ly6G- cells sorted from tumor mass of WT mice either receiving or not ACT (left) and relative signal quantification expressed in arbitrary units (A.U., right panel) normalized to actin. Mean ± s.d; n=3, representative of 3 independent experiments; *p ≤ 0.05 unpaired Student t-test analysis. (E) Representative analysis of cell surface markers in CD11b+Ly6C+MHCII+NOS2+ cells from EG7 tumors from WT mice adoptively transferred with OVA-specific CD8+CD45.1+ lymphocytes. Staining for specific mAbs are shown as white histograms while isotype controls are indicated with black histograms.
3
Figure S3. Related to Figure 3. Gene expression analysis of the myeloid cell collection and experimental treatments of mice. (A-B) An integrated gene expression matrix was generated merging transcriptional profiles of Tip-DCs and publicly available microarray data of tissue macrophages (MFs), tissue dendritic cells (DCs) and monocytic myeloid-derived suppressor cells (M-MDSCs). (A) Unsupervised clustering of Tip-DCs. Sample grouping, obtained from the expression levels of genes with a coefficient of variation larger than the 90th percentile of the coefficients of variation in the entire dataset. (B) From left to right: relative gene expression level of DC, macrophage, and M-MDSC specific genes in tissue MFs, M-MDSCs, tissue DCs, and Tip-DCs. (C) Schematic plot of in vivo therapy mediated by Tip-DCs intratumoral injection. Briefly, 8-week-old NOG mice were injected s.c. with human HLA-A2 restricted mammary carcinoma cells (MDA-MB31, 1x106 cells/mouse). After 10 days, mice were treated with human specific anti-hTERT CD8+ T cells (2.5x106 cells/mouse) by i.v. administration in association with intratumoral injection of either monocytes (1x106 cells/mouse) or Tip-DCs (1x106 cells/mouse). The immunotherapeutic treatment was repeated three times every 5 days.
4
Table S1. Related to figure 3. Complete list of gene expression datasets used in this study and their sources.
Series id Platform Sample id Reference
E-GEOD-15907
Mouse Gene 1.0 ST
GSM605850, GSM605851, GSM605852, GSM605856, GSM605857, GSM605858, GSM605862, GSM605863, GSM605864, GSM538239, GSM538240, GSM538241, GSM605823, GSM605824, GSM605825, GSM854273, GSM854274, GSM854275
Heng et al., 2008
Mouse Gene 1.0 ST
EA07068_226626, EA07068_226627, EA07068_226628, EA07068_226638, EA07068_226639, EA07068_226640, EA07068_226649, EA07068_226650, EA07068_226651
Heng et al., 2008
GSE42061 Mouse Genome 430 2.0
GSM1031725, GSM1031726, GSM1031727 Lei et al., 2013
GSE17322
Mouse Genome 430 2.0
GSM433363, GSM433365, GSM433367
Edelson et al., 2010
---
Mouse Genome 430 2.0
Tip_DC_A, Tip_DC_B, Tip_DC_C --
Table S2. Related to figure 3. Provided as an Excel file. Complete list of the 1675 genes with a coefficient of variation larger than the 90th percentile of the coefficients of variation in the entire dataset
5
Figure S4. Related to Figure 4. Affinity between TCR and MHC complex and INFγ affect Tip-DC generation (A) B16-OVAhigh (white histogram) and B16-OVAlow (grey histogram) tumor cell lines express MHCI-OVA complexes at different amounts. Isotype antibody was used as control (black histogram). (B) IFN-γ released in the supernatant of tumor cell lines in co-culture with different ratios of OVA-specific, CD8+CD45.1+ T lymphocytes. Bars represent mean ± s.d. Ctrl: cultures of OVA-specific CD8+CD45.1+ T lymphocytes without tumor cells. (C) Human Tip-DCs were generated in vitro from CD14 (monocytes) cells by using supernatant from different stimulated CD8+ T cells with peptides specific for TERT, HCV, with anti-CD3+ anti- CD28 or with PMA/ionomycin. Error bars, indicating mean ± s.d for MFI fold increase of NOS2 and TNF calculated on MFI of monocytes without the T cell activated supernatant. (n=3 pooled experiments). (D) Diagram illustrating experimental treatment reported in Figure 4A,B. WT mice at day 0 were injected s.c. with B16 cells at day 0; at day 10, 15 and 20 mice were treated or not iv with TRP2-specific CD8+ lymphocytes with high (TRP2high) or low affinity (TRP2low) or unspecific OVA-CD8+ lymphocytes. Mice were sacrificed when the tumor reached a volume of 2000 mm3 for the survival experiments. (E, F) Tip-DCs were generated in vitro by splenic CD11b+ cells stimulated with the supernatant of OT-I in presence of anti-CD40 antibody. Different concentrations (12.5, 25 and 50 µg/ml) of H22, INFγ blocking antibody or its isotype control PIP (50 µg/ml) were also added to the cultures. Mean ± s.d.; n=4 pooled experiments. (E) Percentage of CD11b+Ly6C+MHCII+ cells. (F) MFI of NOS2 and TNF for CD11b+Ly6C+MHCII+ cells. (C-F) Mean ± s.d.; ***p ≤ 0.001, **p ≤ 0.01 and *p ≤ 0.05, by using One Way ANOVA and the Holm–Sidak method of correction for all pairwise multiple comparisons.
6
Figure S5. Related to Figure 5. CD40-CD40L axis is essential for NOS2 up-regulation and antitumor activity following ACT. (A) At day 7 post implant, EG7 tumors were dissected, embedded in agarose and cut with a vibratome to obtain viable tumor slices (250 µm). The slices were loaded with DAR-4M AM probe, which detects NO. CFSE-labeled T cells specific for either OVA or gp100 antigen were added on the top of tumor slices. After incubation, tumor slices were fixed and analyzed by confocal microscopy. (B) Representative images of NO production after T cell interaction within viable tumor slices. From the left: NO production (red) in the presence of OVA-specific CD8+ T cells (green, OVA-CD8), gp100-specific CD8+ T cells (green, gp100-CD8) or in the absence of CD8+ T cells (w/o CD8). Top: tumor slices from WT mice; bottom: tumor slices from NOS2 KO mice. DAPI (blue). Scale bar, 50 µm. (C) CD11b+Ly6G- cells were sorted from CD40 KO tumor-bearing mice untreated or treated with ACT. Myeloid cells were cultured with CFSE-labeled EG7 cells at different ratios shown in the abscissa. Percent of proliferating EG7 cells after co-culture is compared with CFSE-labeled EG7 cells cultured without CD11b+Ly6G- cells. Mean ± s.d; n=9, pooled from 3 independent experiments.
7
(D) Immunoblot of NOS2 expression in the lysate of CD11b+Ly6G- cells sorted from tumor mass of CD40 KO mice either receiving or not ACT (left) and relative signal quantification expressed in arbitrary units (A.U., right). Representative of 3 independent experiments, Mean ± s.d; n=3. *p ≤ 0.05, unpaired Student t-test analysis. (E) Different cell populations were sorted from tumor masses of WT, EG7 tumor-bearing mice treated or untreated with ACT. Total RNA was isolated from separated cells and qRT-PCR for Cd40lg mRNA was performed. Relative quantity (R.Q.) normalized to the value of CD8+CD45.1- cells without ACT is shown. ND= not detectable. (F) Mice were treated or not with an anti-CD4 (GK1.5) antibody at day -2, 0 and +4 related to EG7 tumor injection. Survival percentage of mice treated or untreated with anti-CD4 GK1.5 mAb without (left) or with ACT (right) is reported; n=8 mice/group; 2 independent experiments. (G) Diagram of mouse treatment for the experiment reported in Figure 4D. RAG-deficient mice were s.c.-injected with EG7 cells; at day 5 mice were transferred i.v. with CD8+ T cells isolated from the spleens and lymph nodes of either WT or CD40L KO, EG7 tumor-bearing mice or tumor-free mice. At day 7, mice were transferred or not with OVA-specific, CD8+CD45.1+ lymphocytes. Mice were sacrificed when the tumor area reached 200 mm2.
Figure S6. Related to Figure 6. Strategies to improve ACT protocols. (A) Diagram of mouse treatment for the experiment reported in Figure 6A. WT mice were injected s.c. with EG7 cells; at day 4, mice were treated with anti-CSF-1R antibody or with its isotype control antibody (Ctrl Ab). At day 7, mice were transferred or not with OVA-specific, CD8+CD45.1+ lymphocytes. At day 10, mice were sacrificed to perform FACS analysis. (B) Diagram of mouse treatment for the experiment reported in Figure 6B, C, D. WT or NOS KO mice were injected with MCA203 cells and at day 7 mice were treated with anti-CSF-1R antibody or with the isotype control antibody (Ctrl Ab); Antibody treatments were repeated weekly for 4 times, as indicated by the arrows. At day 7, mice were transferred or not with mTERT-specific, CD8+ lymphocytes. Tumor growth was monitored and mice were sacrificed at day 37 to perform FACS analysis.
8
Figure S7. Related to Figure 7. Immune gene expression in relation to CD40LG, NOS2 and TNF expression (A) Correlation between the expression of CD40LG, NOS2 and TNF in CRC (n=125 patients) and immune markers. Correlation plots corresponding to the edges from the ClueGO-CluePedia network (Figure 7) are shown. (B) Representative genes for T cells, Th1, CD8 and cytotoxic cells as well as genes related to antigen presenting molecules and MHCII genes were investigated in tumors. Error bars, mean ± s.e.m. Tumors with high (HiHiHi), heterogeneous(Htg) and low (LoLoLo) ,expression of CD40LG, NOS2 and TNF are shown. (C-E) Intratumoral immune cell density in relation to CD40LG, NOS2 and TNF expression. Immune cell infiltrates from 107 CRC patients were analyzed by tissue microarray (TMA). T (CD3, CD4), cytotoxic T (CD8), Th1 (T-Bet), Th17 (IL-17), TFH (CXCR5), B (CD20) cells and macrophages (CD68) and immature dendritic cell (CD1a) were quantified by immunohistochemistry in the center of the tumor (CT). CD8+ cell density was evaluated as total cell density, as well as extratumoral (within the stroma) and intratumoral (within the tumor glands) cells. The density of the cells (number of positive cells per mm2 surface area) was measured using Spot Browser® ALPHELYS. Comparison of the mean ± s.e.m. cell densities in tumors with Hi (white) and Lo (light gray) expression of CD40LG (C), TNF (D) and NOS2 (E) is shown. The median cell count/mm2 is shown in blue. ***p < 0.001, **0.001 ≤ p < 0.05, *0.05 ≤ p < 0.1, Shapiro normality test.
9
Supplemental Experimental Procedures
Cell lines EG7 cells derived from OVA-transfected EL4 thymoma cells (Moore et al., 1988), B16-OVAlow and B16-OVAhigh
melanoma cell lines from L. Zitvogel (Institut Gustave Roussy, Vilejuif, France) and MCA203 fibrosarcoma cells (Ugel et al., 2012). Cell lines were cultured in DMEM 10% FBS supplemented with 2 mM L-glutammine, 10 mM HEPES, 20 µM β-ME, 150 U/ml streptomycin, 200 U/ml penicillin. B16-OVAlow and B16-OVAhigh cell lines and EG7 were cultured with G418 (0.4 mg/ml) to maintain OVA expression. PG13 mouse retrovirus-packaging cells, modified to produce complete retroviral particles containing hTERT865-873-TCRα/β construct, a gift by Prof. M. I. Nishimura (Loyola University Medical Center, Department of Surgery, Maywood, United States), were cultured in IMDM medium (Lonza, BioWhittaker). MDA-MB-231 cells (HLA-A2+ mammary carcinoma cell line) a gift of M. P. Colombo (Molecular Immunology Unit, Department of Experimental Oncology and Molecular Medicine, Fondazione IRCCS Istituto Nazionale dei Tumori, Milan, Italy), were maintained in RPMI 1640 medium (Lonza) supplemented with 10% Fetal Bovine Serum, 2 mM L-Glutamine, 10 mM HEPES, 100 U/ml Penicillin, and 100 U/ml Streptomycin. Before injections, all cell lines were pretested for the absence of mycoplasma. To establish tumors, EG7 cells (0.5x106 cells/mouse), B16-OVA, MCA203 (1x106 cells/mouse) and MDAMB231 (1x106 cells/mouse) were injected subcutaneously (s.c.) on the left flank and tumor growth was monitored every 2 days by calipers. Synthetic peptides and reagents Peptides: H-2 Kb-restricted OVA epitope (OVA257-264, SIINFEKL), H-2 I-Ab-restricted OVA epitope (OVA323-339, ISQAVHAAHAEINEAGR), the H-2Db-restricted hgp10025—33 epitope (KVPRNQDWL), H-2b-restricted epitope mTRP-2180–188 (SVYDFFVWL) and HLA-A2-restricted hTERT865-873 epitope (RLVDDFLLV), HLA-A2-restricted hHCV1406-1415 (KLVALGINAV) epitope were all synthesized by JPT (JPT, Peptide Technologies, Germany). The hamster monoclonal anti-mouse INF-γ blocking antibody H22 and its control, the hamster monoclonal anti-mouse GST antibody PIP, were provide by Schreiber R.D. The mouse monoclonal IgG1 (MOPC-21, indicated as mIgG1) and the rat anti-mouse CD40 (FGK45) were a gift from Biogen Idec (Cambridge, MA). The chimeric anti mouse CSF-1R IgG1 antibody 2G2 (Ries et al., 2014) and its isotype MOPC-21 (from Biogen Idec) were administrated at the concentration of 30 mg/Kg. GK1.5 (anti-CD4, BioXCell) was given intraperitoneally (i.p.) 2 days before and 0, 2, and 4 days following challenge with tumor at 200 µg/mice. Tumor cell isolation Tumors were cut in small pieces and incubated with a digestive solution composed of collagenase IV (1 mg/ml), hyaluronidase (0.1 mg/ml), DNase (4.5 mg/ml) and incubated at 37°C; every 10 min, tumors were mechanically disaggregated using a 5 ml pipette. After 1 hr, cells were collected and washed in complete medium twice to remove all digestive solutions prior to flow isolation. Immunomagnetic sorting CD11b+ cells were isolated from spleens and tumors with anti-CD11b MicroBeads (Miltenyi Biotec, Germany). CD11b+Ly6G- cells were isolated from the tumor masses first by depleting with anti-Ly6G MicroBead Kit (Miltenyi Biotec). The negative fraction from previous step was decanted and CD11b+ cells were sorted as described above. In some experiments, CD11b+Ly6G- cells were co-cultured with 0.1x106 CFSE-labeled EG7 cells at 3:1; 2:1; 1:1 ratios for 24 h. Spleens and lymph nodes from tumor-free or EG7 tumor-bearing mice were used to separate CD8+ T lymphocytes by using CD8α+ T cell isolation Kit (Miltenyi Biotec). CD4+ naive T lymphocytes were isolated from spleens of OT-II mice using a kit (Miltenyi Biotec). All separations were performed according to manufacturer’s instructions by using Midi Macs columns (Miltenyi Biotec). Purity of cell populations was evaluated by flow cytometry and exceeded 90%. Immunoblot analysis Cells were collected, washed in ice-cold PBS and stored at -80o C. Whole cell lysates were obtained as previously described (Gallina et al., 2006), in presence of a protease inhibitor cocktail (Calbiochem). Lysates were separated on 10% SDS-PAGE gels, and then transferred onto an ImmobilonP membrane (Millipore). The immunoblots were probed with an anti-NOS2 polyclonal rabbit antibody (1:1000, Santa Cruz, M-19, catalogue no. sc-650) or anti-α smooth muscle actin antibodies (Sigma-Aldrich, 20-33, catalogue no. A5060). Cytofluorimetric analysis and sorting Cells were processed as described (Gallina et al., 2006) and FcR binding sites blocked. The antibodies used were: anti-CD11b PE-Cy7 (clone M1/70, catalogue no. 552850), anti-LY6G APC-Cy7 (clone 1A8, catalogue no. 560600), anti-CD11c APC (clone HL3, catalogue no. 550261), anti-I-A/I-E PerCP-Cy5.5 (clone M5/114.15.2, catalogue no. 562363), anti-CD4 APC (clone RM4-5, catalogue no. 553051), anti-CD80 FITC (clone 16-10A1, catalogue no. 553768), anti-TNFα FITC (clone MP6-XT22, catalogue no. 554418) and anti-IFN-γ FITC (clone XMG1.2, catalogue no. 554418) (all from BD), anti-CD45.1PE (clone A20, catalogue no. 12-0453-83), anti-CD8 PerCP-Cy5.5 (clone 53-6.7, catalogue no. 45-0081-82), anti-Ly6C eFluor 450 (clone HK1.4, catalogue no. 48-5932-82), anti-CD3 FITC (clone 145-2C11, catalogue no. 100306), anti-CD86 biotin (clone GL1, catalogue no. 13-0862-82), anti-CD40 FITC (clone HM40-3,
10
catalogue no. 11-0402-85), streptavidin-APC (catalogue no. 17-4317-82), anti-mouse OVA257-264 (SIINFEKL) peptide bound to H-2Kb PE (catalogue no. 12-5743) (all from eBioscience), anti-F4/80 FITC (AbDSerotec, clone CI:A3-1, catalogue no. MCA497FB), anti-CCR2 PE (R&D systems, clone 475301, catalogue no. FAB5538P). Aqua Live/Dead®dye (Invitrogen) was used to analyze cell viability. Rabbit anti-mouse NOS2 (Abcam, polyclonal catalogue no.15323) and the secondary antibody anti-rabbit Rhodamine Red X (Jackson Immune Research, catalogue no. 711-295-152) were used to analyze the intracellular staining of NOS2. TNF and INF-γ were detected using anti-TNFα FITC (clone MP6-XT22, catalogue no. 554418) and anti-INF-γ FITC (clone XMG1.2, catalogue no. 554418) both from BD. For intracellular staining we used a BD Cytofix/Cytoperm Kit. Flow data were acquired with a LSRII FACS (BD Biosciences) and analyzed with FlowJo software (Tree Star, Inc.). For FACS sorting, tumor cell suspensions were stained with fluorochrome-conjugate antibodies in PBS at 4oC for 20 min, then washed and resuspended in FACS buffer (PBS, EDTA 0.5 mM, FBS 3%, 150 U/ml streptomycin, 200 U/ml penicillin). Myeloid cells were sorted following the gating strategy reported in Figures 2A. To perform in vivo transfer of murine Tip-DCs, a population of CD11b+ Ly6G-Ly6C+MHCII+ was sorted from tumor masses of EG7 tumor bearing WT or Nos2-/- mice 3 days after ACT. Cells were sorted by using a FACS Aria® (BD Biosciences).
Immunofluorescence and immunohistochemistry Purified CD11b+ cells from either spleens or tumors of EG7 tumor-bearing mice were immobilized on coverslips using CellTak cell and tissue adhesive (BD). Samples were fixed for 5 min in 4% PFA at RT and washed with PBS. Non-specific binding sites were blocked with PBS containing 10% FBS 0.02% Tween 20 (Sigma) and primary antibodies were incubated overnight at 4°C in blocking solution. Coverslips were washed 3 times in PBS 0.02% Tween 20 and conjugated secondary antibodies were added and incubated for 2 hr at 37°C followed by washing. Nuclear staining was performed with DAPI (Invitrogen) for 10 min at RT. Slices were mounted with ProLongR Gold Antifade Reagent (Invitrogen) and analyzed with a Leica TCS SP5 confocal microscopy. The primary antibodies used were rat anti-mouse CD11b (BD Pharmingen, clone M1/70, catalogue no. 550282), goat anti-mouse liver arginase (ARG1) (Abcam, polyclonal, catalogue no. 60176), and rabbit anti-mouse NOS2 (Abcam, polyclonal, catalogue no.15323). Secondary antibodies were all purchased from Jackson Immune Research, Alexa Fluor® 647 donkey anti- rat (catalogue no.712-605-153), Rhodamine Red-X donkey anti- goat (catalogue no.705-295-003) and Alexa Fluor® 488 donkey anti-rabbit (catalogue no.711-545-152). Images were acquired with a Zeiss LSM 510 Meta confocal microscope. CFSE cell labeling OT-I/CD45.1+ splenocytes and EG7 cells (for proliferation assays) and CD8+ T lymphocytes, derived from the spleen of either OT-I or Pmel-1 mice (for NO detection), were labeled with carboxyfluorescein succinimidyl ester (CFSE, CFSE-Cell Trace Kit, Invitrogen Molecular Probe) according to manufacturer’s instructions.
Mixed lymphocyte peptide culture (MLPC) MLPC culture on C57BL/6 background was prepared by mixing γ-irradiated C57BL/6 splenocytes with OT-I/CD45.1 splenocytes in order to obtain 1% OVA-specific T lymphocytes in the final culture. OVA-specific lymphocytes were previously CFSE-labeled for the proliferation assay. A total of 0.6x106 mixed cells were plated in flat-bottom 96-well plates and stimulated for 3 days with 1 µg/ml OVA peptide. Where required, MDSCs (derived from immunomagnetic sorting) were added at decreasing percentages (24%, 12%, 6%, 3% and 1.5%). T-cell proliferation assays and cytotoxicity evaluation with 51chromium release assays were performed as previously described (Dolcetti et al., 2010). Generation of hTERT-specific T cells HLA-A*0201-restricted and hTERT865-873 peptide (RLVDDFLLV)-specific TCRα/β genes (patent n° PD2015A000062) were cloned from CTL isolated from hTERT-vaccinated HLA-A2 transgenic mice (Ugel et al., 2010). The two TCR sequences (Vα and Vβ) were codon optimized and linked by a cleavage sequence to allow equal expression of the two chains. Another cleavage sequence was inserted to link the expression of a truncated form of CD34 molecule, which functions as a tag report. The construct was introduced into a pg1SAMEN-CMVSRa retroviral vector (Norell et al., 2010) to stably transfect PG13 packaging cell line. The viral supernatant was used to incubate OKT-3-activated PBMCs for 18 hr at 37°C and 5% CO2, in the presence of hIL-15 (100 µg/ml) and rIL-2 (300 IU/ml). The infected PBMCs were mainly cytotoxic T cells (85% of total T cells) and analyzed by the expression of tag-reporter by flow cytometry and purified by CD34-immunomagnetic sorting.
RNA extraction and qRT-PCR RNA was extracted from FACS-sorted cell populations using the RNeasy Micro Kit (Qiagen). cDNA was generated using the reverse transcriptase SuperScript II and poly dT primers (Invitrogen). PCR and fluorescence detection were performed using the ABI 7900HT fast real-time PCR Systems in a reaction volume of 20 µl containing 1× TaqMan Universal PCR Master Mix (Applied Biosystems) and 20 ng cDNA. For quantification of mouse Cd40lg and Rn18s the 1× TaqMan Gene Expression Assays Mm00441911_m1 and Mm03928990_g1 (Applied Biosystems) were used. Arg1 and Gapdh were detected using an Arg1 specific primer set (fwd ACAGTCTGGCAGTTGGAAGCATC, rev GGGAGTCCCCAGGAGAATCCT, Probe FAM-CTGGCCACGCCAGGGTCCAC-TAMRA) and a Gapdh-specific primer/probe mix (Applied Biosystems). All measurements were performed in duplicates and were either analyzed by
11
absolute quantification using a standard curve or by the ΔΔCt relative quantification method: the arithmetic means of the cycle threshold (Ct) values were calculated and target gene mean Ct values were normalized to the respective endogenous control (Rn18s or Gapdh), and then to the highest ΔCt value. The values obtained were converted by the formula 2(−ΔΔCt) to be expressed as fold changes in regulation compared with the reference sample.
NO detection on tumor cells by flow cytometry and cell sorting Tumors from mice treated with ACT were disaggregated as described above with digestive solution supplemented of DAF-FM Diacetate (4-Amino-5-Methylamino2', 7' Difluorofluorescein Diacetate) (Invitrogen) at a concentration of 5 µuM for 30 min at RT, followed by 30 min at 37°C. After isolation, tumor cells were washed in PBS and incubated with anti-Fc-γ receptor for 10 min at 4 °C to reduce unspecific binding. The samples were stained with the following antibodies: anti-CD11b PE-Cy7, anti-Ly6C eFluor 450, anti-Ly6G APC-Cy7 for 20 min at 4°C and sorted at FACS ARIA. The population of interest was CD11b+ DAF-FM+ Ly6C+ Ly6G- within live cells. To analyze cell viability samples were stained with Aqua Live/Dead® dye (Invitrogen).
Gene expression Total RNA was isolated using TRIzol reagent (Life Technologies, CA, USA) and RNA integrity assessed using Agilent-2100-Bioanalyzer (Agilent Technologies, CA, USA). cDNA from samples was amplified and total RNA was purified with Ovation Pico WTA System V2 (NuGEN, CA, USA). Samples were hybridized to Affymetrix Mouse Genome 430 2.0 arrays and scanned with an Affymetrix GCS 3000 7G scanner.
Myeloid cell data collection and processing Tip-DC expression data was merged with 3 publicly available datasets comprising microarray data of tissue macrophages (twelve samples), tissue dendritic cells (twelve samples), and monocytic myeloid-derived suppressor cells (nine samples). All data were measured on Affymetrix arrays and have been downloaded from public repositories (Gene Expression Omnibus (http://www.ncbi.nlm.nih.gov/geo), ArrayExpress (https://www.ebi.ac.uk/arrayexpress/) or obtained by the authors of the original publications (see Table S1 for details on the single datasets). The complete list of datasets is provided in Table 1 of supplemental data section. Microarray probe fluorescence signals of samples belonging to the same platform were converted to expression values using the Robust Multiarray Average procedure (Irizarry et al., 2003) of the affy Bioconductor package. Fluorescence intensities were background-adjusted and normalized using quantile normalization, and log2 expression values were calculated using median polish summarization and custom chip definition files for a total of 21115 custom probe sets for Mouse Gene 1.0 ST Array based on Entrez genes (mogene10st_Mm_ENTREZG version 19.0.0) (Dai et al., 2005) and 17856 custom probe sets for Mouse Genome 430 2.0 Array based on Entrez genes (Mouse4302_Mm_ENTREZG version 19.0.0). All data analyses were performed in R version 3.1.3 using Bioconductor libraries and R statistical packages. Microarray data of Tip-DCs are available in GEO and the accession number is GSE74427. Merging of myeloid cells transcriptional data All samples hybridized on Mouse Gene 1.0 ST Array were concatenated with those hybridized on Mouse Genome 430 2.0 Array, matching 16 742 Entrez gene IDs, i.e. the common identifier of custom probe sets in both data sets. A direct merging of raw CEL files, although desirable for an efficient removal of batch effects, was unfeasible due to the different probe sequences of Mouse Gene 1.0 ST and Mouse Genome 430 2.0 arrays. The combined matrix was subjected to ComBat (Johnson et al., 2007) to remove batch effect. ComBat was applied with default parameters with the exception of the adjustment variables that were imputed as a vector of platform type labels.
Unsupervised sample clustering Global unsupervised clustering was performed using the function hclust of R stats package with Pearson correlation as distance metric and average agglomeration method. Before unsupervised clustering, to reduce the effect of noise from non-varying genes, we removed those genes with a coefficient of variation smaller than the 90th percentile of the coefficients of variation in the entire dataset. The filter retained 1675 genes that are more variable across samples (Table S2).
Gene signature comparisons Gene expression profiles of the tissue DCs, tissue MFs, M-MDSC and Tip-DCs were compared using the published genes signatures of DCs (Miller et al., 2012), MFs (Gautier et al., 2012) and M-MDSCs (Conde et al., 2015). Gene expression heatmaps have been generated using dChip software.
Human Tip-DC differentation for in vitro studies. For in vitro studies, h-TERT specific T cells were co-cultured with HLA-A2 restricted PBMCs pulsed with 1µg/ml hTERT or hHCV1 peptide for 24 h. Naive T cells were isolated from HLA-A2 PBMCs and activated for 3 days with coated anti-CD3 antibody at the concentration of 10µg/ml (clone OKT3, eBioscience, catalogue no. 16-0037-85) and anti-CD28 at the concentration of 5µg/ml (clone CD28.2, eBioscience, catalogue no. 16-0289-85) or for 5h with 50 ng/ml of PMA and 1µg/ml of ionomycin (both form SIGMA). Culture supernatants were collected and transferred to isolated monocytes (1×106/well) in 24-well plates for 48 h. Harvested cells were then incubated with LPS (100 ng/mL) for 5 hr in
12
presence of Brefeldin A (3 µg/ml) and stained with anti human CD80 (clone 2D10.4, eBioscience, catalogue no. 12-0809-41), anti human CD86 (clone 2331, BD, catalogue no. 555660), anti-HLA-ABC (clone W6/32, BioLegend, catalogue no. 311429) and anti HLA-DR (clone L243, BioLegend, catalogue no. 307630), human TNFα (clone MAb11, BioLegend, catalogue no. 502932) and anti human-iNOS (clone 6, BD, catalogue no. 610330) to perform FACS analysis. Murine Tip-DC differentiation Supernatants from CD8+ cells isolated from OT-I mice, or CD8+ cells from TRP2high and TRP2low pulsed with the specific peptides for 5 days or from naive CD8+ cells stimulated with coated anti-CD3 antibody at the concentration of 3 µg/ml (clone 2C11, eBioscience) and anti-CD28 at the concentration of 2 µg/ml (clone 37.5, eBioscience) for 3 days were collected. CD11b+ cells isolated from spleen of WT mice were cultured in the presence of different supernatants or medium in 24-well plates (1×106/well) for 48 h. Plates were coated or not with 10 µg/ml of anti-CD40 antibody. To evaluate the effect of blocking INF-γ in the generation of Tip-DCs, increasing amount of H22 antibody (or the control PIP) were added to cultures of CD11b+ cells in the presence of supernatant from stimulated CD8+ cells from OT-I mice into coated with anti-CD40 antibody plates. Cells were collected and stained for FACS analysis. Low density array (LDA) real-time Taqman qPCR analysis Tissue sample material was snap-frozen within 15 min after surgery and stored in liquid nitrogen. From this material 125 frozen tumor specimens were randomly selected for RNA extraction. The total RNA was isolated by homogenization with the RNeasy isolation kit (Qiagen, Valencia, CA). A bioanalyzer (Agilent Technologies, Palo Alto, CA) was used to evaluate the integrity and the quantity of the RNA. The 125 analyzed RNA samples were all from different patients. The RT qPCR experiments were all performed according to the manufacturer's instructions (Applied-Biosystems, Foster City, CA). The quantitative real-time TaqMan qPCR analysis was performed using Low Density Arrays and the 7900 robotic real-time PCR-system (Applied Biosystems). As internal control 18S ribosomal RNA primers and probes were used. Data were analyzed using the SDS Software v2.2 (Applied Biosystems) and TMEdb statistical module.
Tissue microarray (TMA) immunohistochemistry analysis Tissue microarray (TMA) from the center (CT) and invasive margin (IM) of colorectal tumors were constructed (Galon et al., 2006). Sections were incubated with monoclonal antibodies against CD3 (SP7), CD4 (Ventana, 7904423, Clone SP35), CD8 (4B11), CD45RO (OPD4), CD57 (NK1), cytokeratin (AE1AE3), cytokeratin-8 (Neomarkers, Fremont, CA), CD68 (PGM-1), CD20 (L26; DAKO, Carpinteria, CA), CXCR5 (LifeSpan Biosciences, LS-A1384) and IL-17 (H-132; Santa Cruz Biotechnology, Santa Cruz, CA). Envision+ system (enzyme-conjugated polymer backbone coupled to secondary antibodies) and DAB-chromogen were applied (Dako, Copenhagen, Denmark). Double stainings were revealed with phosphate-conjugated secondary antibodies and FastBlue-chromogen. For single stainings, tissue sections were counterstained with Harris hematoxylin. Isotype-matched mouse monoclonal antibodies were used as negative controls. Slides were analyzed using an image analysis workstation (Spot Browser, ALPHELYS). The density was recorded as the number of positive cells per unit tissue surface area (Galon et al., 2006). Supplemental References
Dai, M., Wang, P., Boyd, A. D., Kostov, G., Athey, B., Jones, E. G., Bunney, W. E., Myers, R. M., Speed, T. P., Akil, H., et al. (2005). Evolving gene/transcript definitions significantly alter the interpretation of GeneChip data. Nucleic Acids Res 33, e175. Dolcetti, L., Peranzoni, E., and Bronte, V. (2010). Measurement of myeloid cell immune suppressive activity. Current protocols in immunology / edited by John E Coligan [et al] Chapter 14, Unit 14 17. Edelson, B. T., Kc, W., Juang, R., Kohyama, M., Benoit, L. A., Klekotka, P. A., Moon, C., Albring, J. C., Ise, W., Michael, D. G., et al. (2010). Peripheral CD103+ dendritic cells form a unified subset developmentally related to CD8alpha+ conventional dendritic cells. The Journal of Experimental Medicine 207, 823-836. Gallina, G., Dolcetti, L., Serafini, P., De Santo, C., Marigo, I., Colombo, M. P., Basso, G., Brombacher, F., Borrello, I., Zanovello, P., et al. (2006). Tumors induce a subset of inflammatory monocytes with immunosuppressive activity on CD8+ T cells. The Journal of Clinical Investigation 116, 2777-2790. Heng, T. S., Painter, M. W., and Immunological Genome Project, C. (2008). The Immunological Genome Project: networks of gene expression in immune cells. Nature Immunology 9, 1091-1094. Irizarry, R. A., Hobbs, B., Collin, F., Beazer-Barclay, Y. D., Antonellis, K. J., Scherf, U., and Speed, T. P. (2003). Exploration, normalization, and summaries of high density oligonucleotide array probe level data. Biostatistics 4, 249-264.
13
Johnson, W. E., Li, C., and Rabinovic, A. (2007). Adjusting batch effects in microarray expression data using empirical Bayes methods. Biostatistics 8, 118-127. Lei, L., Li, H., Yan, F., and Xiao, Y. (2013). Hyperlipidemia impaired innate immune response to periodontal pathogen porphyromonas gingivalis in apolipoprotein E knockout mice. PloS One 8, e71849. Moore, M. W., Carbone, F. R., and Bevan, M. J. (1988). Introduction of soluble protein into the class I pathway of antigen processing and presentation. Cell 54, 777-785. Norell, H., Zhang, Y., McCracken, J., Martins da Palma, T., Lesher, A., Liu, Y., Roszkowski, J. J., Temple, A., Callender, G. G., Clay, T., et al. (2010). CD34-based enrichment of genetically engineered human T cells for clinical use results in dramatically enhanced tumor targeting. Cancer Immunol Immunother 59, 851-862.