system appendpdf cover-forpdf - university of …...draft 2 48 abstract 49 a novel rpa-iac assay...

Draft

Development of a recombinase polymerase amplification

assay for Vibrio parahaemolyticus detection with an internal

amplification control

Journal: Canadian Journal of Microbiology

Manuscript ID cjm-2017-0504.R2

Manuscript Type: Article

Date Submitted by the Author: 21-Dec-2017

Complete List of Authors: Yang, Huanlan; Jinan University, Department of Food Science &

Engineering Wei, Shuang; Guangdong Entry-Exit Inspection and Quarantine Bureau Gooneratne, Ravi; Lincoln University Faculty of Agriculture and Life Sciences, Department of Wine, Food and Molecular Biosciences, Faculty of Agriculture & Life Sciences Mutukumirad, Anthony N.; Massey University - Albany Campus Ma, Xuejun; Chinese Center for Disease Control and Prevention Tang, Shuze; Jinan University, Department of Food Science & Engineering Wu, Xiyang; Jinan University, Department of Food Science & Engineering

Is the invited manuscript for consideration in a Special

Issue? : N/A

Keyword: V. parahaemolyticus, internal amplification control, isothermal nucleic acid amplification, toxR, recombinase polymerase amplification

https://mc06.manuscriptcentral.com/cjm-pubs

Canadian Journal of Microbiology

Draft

1

Development of a recombinase polymerase amplification assay 1 for Vibrio parahaemolyticus detection with an internal 2

amplification control 3 Huan-Lan Yang

a, Shuang Wei

b, Ravi Gooneratne

c, Anthony N Mutukumira

d, Xue-Jun 4

Mae, Shu-Ze Tang

a, Xi-Yang Wu

a* 5 6 a Department of Food Science & Engineering, Jinan University, Guangzhou, China, 510632 7

b Guangdong Entry-Exit Inspection and Quarantine Bureau, Guangzhou, China, 510632 8

c Centre for Food Research and Innovation, Department of Wine, Food and Molecular Biosciences, 9

Faculty of Agriculture & Life Sciences, Lincoln University, Christchurch 7647, New Zealand 10 d Massey Institute of Food Science and Technology, Institute of Food and Nutrition, Massey 11 University, Albany Campus, New Zealand 12 e Chinese Center for Disease Control and Prevention, Beijing, China, 102206

13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 --------------------------------------------------- 43 *Corresponding author: Professor Xi-Yang Wu, Department of Food Science & Engineering, Jinan 44 University, Guangzhou, China, 510632; Tel / Fax: +86-20-85220225 45 Email: [email protected] 46 47

Page 1 of 25



Draft

2

Abstract 48

A novel RPA-IAC assay using recombinase polymerase and an internal amplification 49

control (IAC) for Vibrio parahaemolyticus detection was developed. Specific primers 50

were designed based on the coding sequence (CDS) for the toxR gene in V. 51

parahaemolyticus. The recombinase polymerase amplification (RPA) reaction was 52

conducted at a constant low temperature of 37°C for 20 min. Assay specificity was 53

validated by using 63 Vibrio strains and 10 non-Vibrio bacterial species. In addition, a 54

competitive IAC was employed to avoid false-negative results, which co-amplified 55

simultaneously with the target sequence. The sensitivity of the assay was determined as 56

3×103 CFU/mL, which is decidedly more sensitive than the established PCR method. 57

This method was then used to test seafood samples which were collected from local 58

market. 7 out of 53 different raw seafoods were detected as V.p positive, which were 59

consistent with those obtained using traditional culturing method and biochemical assay. 60

This novel RPA-IAC assay provides a rapid, specific, sensitive and more convenient 61

detection method for V. parahaemolyticus. 62

Keywords: V. parahaemolyticus; internal amplification control; recombinase polymerase 63

amplification; isothermal nucleic acid amplification; toxR 64

65

66

67

68

69

70

Page 2 of 25



Draft

3

1. Introduction 71

The V. parahaemolyticus bacterium inhabits surface waters and estuarine ecosystems 72

of varying temperatures and salinities around the world, and it can be detected in a wide 73

range of raw and mishandled seafood. This pathogen is of increasing concern, and it is 74

now a leading cause of bacterial food poisonings in the coastal provinces of China (Croci 75

et al. 2007; Liu et al. 2012; Nilsson and Turner 2016; Robert-Pillot et al. 2014). Lai et al. 76

(2010) reported a total positive rate of V. parahaemolyticus in samples taken from the 77

Pearl River estuary district in Guangzhou, China at 34.10%, 47.50%, 27.27% and 51.11% 78

for aquatic products, water, mud and other environmental samples, respectively. 79

Conventional culture-based and biochemical-based methods for the detection of food-80

borne pathogens are laborious and time-consuming (normally requiring more than 3 days 81

to complete). The application of genetic-based bacteria identification is more rapid and 82

specific (Crannell et al. 2016). Various PCR methods for the detection of V. 83

parahaemolyticus have been reported (Kim et al. 1999; Lee et al. 1995), however, the 84

conventional PCR requires thermal cycling equipment, which is not suitable for field 85

application. Therefore, the development of a simple, sensitive, rapid method to detect V. 86

parahaemolyticus for field use is indicated. 87

A number of isothermal nucleic acid amplification methods that do not require the use 88

of thermal cycling equipment have emerged (Cao et al. 2015; Gill and Ghaemi 2008; 89

Asiello and Baeumner 2011). These platforms use a fixed temperature heater in place of a 90

thermal cycler. Examples of isothermal nucleic acid amplification techniques are the loop 91

mediated amplification (LAMP), helicase dependent amplification (HDA), strand-92

displacement amplification (SDA), and rolling circle amplification (RCA). Among these 93

Page 3 of 25



Draft

4

isothermal amplification platforms, recombinase polymerase amplification (RPA) 94

represents a PCR-like, simple and easy to use method. RPA uses bacterial recombinase 95

enzymes to anneal primers to a template DNA for extension and amplification using an 96

isothermal polymerase. The RPA reaction runs at a constant low temperature of 37-42°C 97

for less than 1h, and it is available in a lyophilized form that can be transported without 98

the need for cold chain storage (Crannell et al. 2015; Lillis et al. 2016). Unlike other 99

DNA isothermal technologies (e.g., LAMP, which uses 4–6 primer pairs in one reaction), 100

RPA employs a recombinase enzyme to direct only two primers to a homologous target 101

sequence in a DNA template (Jaroenram and Owens 2014; Nimitphak et al. 2008). 102

Moreover, RPA products can be easily detected by gel electrophoresis (Piepenburg et al. 103

2006) in real-time using TwistAmpTMexo probes (TwistDx, Cambridge, UK) (Euler et al. 104

2013) or a lateral flow dipstick (LFD) assay (Wu et al. 2016). The ability to amplify low 105

concentrations of DNA and RNA rapidly without complex instrumentation makes RPA a 106

suitable tool for use at the point of care in resource limited settings (RLS) (Lillis et al. 107

2016). So far, RPA assays have been used for the detection of Francisella tularensis 108

(Sabate et al. 2014), Ebola virus (Yang et al. 2016) and foodborne viruses (Moore and 109

Jaykus 2017). 110

IAC (Internal amplification control) has been widely used in PCR assays to achieve an 111

acceptable level of confidence due to the absence of false-negative results. These can be 112

caused by inhibitory substances in the sample matrix, incorrect mixing of reagents, poor 113

enzyme activity, and other unknown factors (Maaroufi et al. 2006). In a previous study, 114

the use of IAC in a multiplex PCR to detect four different Vibrio species in food samples 115

was described (Wei et al. 2014) 116

Page 4 of 25



Draft

5

In this study, an RPA-IAC assay that targets the toxR gene for the detection of V. 117

parahaemolyticus was developed. A competitive IAC was developed by inserting into a 118

plasmid for better control of stability, size and copy number. 119

2. Materials and Methods 120

2.1. Bacterial strains 121

The Vibrio strains used in this study were collected from clinical and environmental 122

samples (Table 1). They were generously provided by the Shantou Entry-Exit Inspection 123

and Quarantine Bureau (Shantou, China), and by the School of Agriculture and Biology, 124

Shanghai Jiaotong University (Shanghai, China). The remaining strains were obtained 125

from the Department of Food Science and Engineering, Jinan University (Guangzhou, 126

China). 127

2.2 DNA extraction 128

Vibrio strains were grown in LB broth (Hopebio, Qingdao, China) containing 3% NaCl, 129

and the other bacterial strains were grown in Brain Heart Infusion Broth (BHI; Hopebio). 130

All cultures were grown aerobically at 37°C. DNA was extracted and purified using the 131

TIANamp Bacteria DNA Kit (Tiangen Biotech Co., Ltd., Beijing, China). The 132

concentration and the purity of extracted DNA were quantified using a Nano-Drop ND-133

1000 spectrophotometer (NanoDrop Technologies, Inc., Wilmington, DE, USA), and the 134

DNA samples were stored at -20°C before use. 135

2.3 Target genes and primer design 136

RPA was based on amplification of the toxR gene from V. parahaemolyticus (GenBank 137

ID: AB029908). The specific primers were designed according to the TwistAmpTM 138

reaction kit manual. The primers were modified using Primer Premier V5.0 software 139

Page 5 of 25



Draft

6

(Premier Biosoft International, Palo Alto, CA, USA) to maintain minimal mutual 140

interference among the different primers, and they were successfully checked for relevant 141

homologies by a BLAST search. All the oligonucleotide primers were purchased from 142

Sangon Biotech (Shanghai, China). 143

2.4 Construction of the IAC 144

The IAC was constructed based on methods previously reported (Abdulmawjood et al. 145

2002; Liu et al. 2012), with some modifications. An internal portion of the V. 146

parahaemolyticus genome, identified as CP011406, which was not homologous with the 147

target gene, was amplified by the YXF/R primer pair (Wei et al. 2014). Then, the 148

CP011406 gene was amplified by PCR using the long chimeric primers IACF/R. The 3’ 149

end sequences of IACF/R corresponded to the YXF/R primer set. Moreover, the 5’ 150

hanging end sequences of IACF/R corresponded to the F14/R14 primer set (Figure 1). 151

The PCR conditions were: 94 °C for 5 min, followed by 30 cycles of 94 °C for 30 s, 152

57 °C for 30 s and 72 °C for 60 s, and a final step at 72 °C for 10 min. The PCR product, 153

including the flanking regions of the target primer set, was cloned into a Mach1-T1 154

vector (Transgen, Beijing, China) and then transformed into a Trans1-T1 Phage Resistant 155

Chemically Competent Cell (Transgen, Beijing, China). The recombinant plasmid 156

(pYHL-1) was confirmed by DNA sequencing. 157

2.5 RPA-IAC assay 158

The RPA assay was carried out using the TwistAmp Basic kit (TwistDX, Cambridge, 159

UK). A typical RPA reaction in a 50 µL volume contained 100 ng of DNA templates, 0.5 160

M betaine, 480 nM of RPA primers F/R14, 1x rehydration buffer and 2 µL of 8.6×103 161

copies of internal amplification control plasmid pYHL-1. This master mix was used to 162

Page 6 of 25



Draft

7

rehydrate the freeze-dried reaction pellet, and 14 mM magnesium acetate was added to 163

the solution to initiate the reaction. The reaction was performed in a dry block heater 164

(Botong chemical Co., Ltd., Shanghai, China) at 37 °C. To optimize the reaction time, the 165

RPA-IAC assay was amplified for different periods of time (10, 20, 30, 40, 50, 60, 80 and 166

100 min). The assay was run in triplicate each length of time. The RPA products were 167

separated by 2% agarose gel electrophoresis, and stained with Goldview Nucleic Acid 168

Stain (Ding guo chang sheng Biotechnology, Beijing, China). DNA in the gel was 169

visualized by exposure to UV light and photographed with a digital capture system 170

(Tanon, Shanghai, China). The density of the bands was measured by Quantity One 171

software (BioRad). DNA fragment sizes were estimated using a DL2,000 DNA Marker 172

(TaKaRa, Otsu, Japan). RPA products were further validated by DNA sequencing. 173

2.6 Specificity and sensitivity test of RPA-IAC assay 174

The specificity of the RPA-IAC assay was evaluated using 63 Vibrio strains and 10 175

other bacterial species, while the sensitivity of the RPA-IAC assay was evaluated using 176

10-fold dilutions of the reference strain, ranging from 3×101-3×10

7 CFU/mL, and 8.6×10

3 177

copies of plasmid pYHL-1. Each strain dilution was plate counted followed by DNA 178

extraction. Each RPA-IAC assay was repeated three times. 179

2.7 Comparison with PCR detection techniques 180

The sensitivity of the newly developed RPA-IAC assay was compared with the 181

previously established, conventional PCR, which was also based on the toxR gene (Lee et 182

al. 2014). The PCR primers tox-F/R are listed in Table 2. 183

2.8 Application of RPA-IAC assay 184

Page 7 of 25



Draft

8

Fifty-three seafood samples, including shrimp, cuttlefish, clams and oyster, were 185

randomly selected from a seafood market in October in Guangzhou, China, which were 186

treated according to FDA’s Bacteriological Analytical Manual (The BAM) (Food and 187

Drug Administration, 2010). Briefly, a 50 g sample from each seafood was added to 450 188

ml PBS dilution water and blended for 1 min at 8,000 rpm. The homogenate was added to 189

alkaline peptone water (APW) and incubated overnight at 35±2°C. One milliliter from 190

each sample was analyzed using the RPA-IAC assay. The remainder of the incubated 191

APW was streaked onto thiosulfate citrate bile salts sucrose agar culture medium (TCBS) 192

(Hopebio, Qingdao, China) and incubated at 35±2°C overnight. All suspicious isolates 193

were purified and subjected to the biochemical identification. 194

195

3. Results 196

3.1 Primer design 197

The toxR gene encodes transmembrane proteins involved in the regulation of virulence 198

associated genes, and these are well conserved in the genus Vibrio (Matsumoto et al. 199

2000). By evaluating the specificity of the primers using on-line, a species specific CDS 200

(GenBank ID: AB029908) was selected as the target gene for V. parahaemolyticus. A 30-201

mer forward primer (F14: 5’-ACTCGTATGAGAACGTGACATTGCGTATTT-3’) and a 202

30-mer reverse primer (R14: 5’-TTGAACTCAGAAGGAGAAACAAGCAGGTAG-3’) 203

were then designed. Multiple alignments of F/R14 sequences and its phylogenetically 204

related reference species were constructed with the BioEdit program, as shown in Figure 205

2. 206

207

Page 8 of 25



Draft

9

3.2 RPA-IAC reaction time 208

The RPA-IAC amplicons with the expected size were visualized when the reaction 209

time was as brief as 20 min. The 331-bp amplicon of IAC can be easily distinguished 210

from the 426-bp target amplicon by gel electrophoresis. Quantity One software (Bio-Rad 211

Laboratories, Inc., USA), which was used to measure the density of the amplicon bands 212

on the gel, demonstrated that a longer reaction time (up to 40 min) could slightly increase 213

the yields. Notably, extending reaction time to 100 min reaction did not produce any 214

unspecific products and the amplicon yield was almost equal to that of the 40 min 215

reaction (Figure 3). To ensure the reaction performed rapidly, all RPA reactions were 216

performed for 20 min only. 217

3.3 Specificity and sensitivity of RPA-IAC assay 218

A total of 63 Vibrio strains, including V. parahaemolyticus (44), V. cholera (2), V. 219

alginolyticus (10) and V. vulnificus (5), V. mimicus (2) and 10 other non-Vibrio strains, 220

were tested using the RPA-IAC assay (Table 1). The IAC amplicon was apparent in all 221

strains tests (Figure 4), indicating that the IAC worked effectively. A 426-bp specific 222

band was only amplified in the V. parahaemolyticus strains. The results are summarized 223

in Table 1. The sensitivity V. parahaemolyticus was 3×103 CFU/mL (Figure 5). This 224

sensitivity was compared with the standard PCR by using the same templates at identical 225

concentrations. The sensitivity of the standard PCR was 3×104

CFU/mL for V. 226

parahaemolyticus, demonstrating that it is less sensitive than the RPA-IAC assay. 227

3.4 Application of the RPA-IAC assay 228

Fifty-three seafood samples, collected from local market, were used to detect the 229

presence of V. parahaemolyticus by the RPA-IAC assay. The RPA-IAC assay results 230

Page 9 of 25



Draft

10

indicated that 7 samples (13.2%) were V. parahaemolyticus positive, which was 231

consistent with the result of conventional culture method and biochemical test (as shown 232

in Table 3). 233

4. Discussion 234

In this study, a sensitive RPA-based assay to detect V. parahaemolyticus was developed, 235

while a competitive IAC was incorporated to indicate false-negative results. To our 236

knowledge, this is the first study of using RPA to detect V. parahaemolyticus with an IAC 237

to maximize detection accuracy. 238

The IAC has been proven to be an effective means to avoid false-negative results. 239

Daher et al. (2014) constructed an IAC in an RT-RPA to detect Group B Streptococci. 240

There are two ways to design an IAC - as a competitive or non-competitive unit. In other 241

studies, a non-competitive IAC with two pairs of PCR primers were complementary to 242

the target DNA and non-target DNA, respectively, were used to indicate inhibition 243

(Nordstrom et al. 2007; Wei et al. 2014). The disadvantage of a non-competitive IAC is 244

that both the IAC and the target gene are amplified under the same conditions, which may 245

be less efficient for one or both of these reactions (Hoorfar et al. 2004). However, a 246

competitive IAC can co-amplify simultaneously with the target sequence, and hence 247

effectively indicate false-negative results. Moreover, by using the competitive strategy, 248

both the target sequence and the IAC are amplified with one common set of primers 249

under the same conditions, which eliminates the risk of undesired interactions among 250

multiple primers and which may not become sub-efficient for one or both reactions after 251

optimization (Oikonomou et al. 2008). In this study, the target gene and the IAC were 252

easily differentiated by agarose gel electrophoresis due to differences in RPA product 253

Page 10 of 25



Draft

11

sizes. The optimal copies of IAC had no influence on the sensitivity of the assay. 254

Various factors may affect the identification of the results in this assay, and the 255

selection of the target gene and primer design are the two key steps. For example, the 16S 256

rRNA sequences of V. parahaemolyticus and V. alginolyticus are 99% identical, and 257

hence, not useful in differentiating between V. parahaemolyticus and V. alginolyticus 258

(Ruimy et al. 1994). Many target genes from V. parahaemolyticus have been reported, 259

such as dnaJ (Nhung et al. 2007), toxR (Lee et al. 2014), gyrB (Venkateswaran et al. 260

1998), pR72H (Lee et al. 1995), atpA (Izumiya et al. 2011), tdh, trh and tlh (Nordstrom et 261

al. 2007). However, the prevalence of tdh+ and trh+ genes in V. parahaemolyticus strains 262

in the environment appears to be very low (Rosec et al. 2009). In contrast, the toxR gene 263

is abundant in both clinical strains and environmental strains, and it has already been 264

confirmed as the marker gene for identification of V. parahaemolyticus (Kim et al. 1999). 265

Hence, the toxR gene was selected for use in this study. 266

One consideration with RPA is that primers for high or low GC content (>70% or 267

<30%, respectively) and mismatches at the 3'-end of the primer sequence reduce the 268

efficiency of RPA amplification. Moreover, since RPA functions at low and constant 269

temperature, which differs from conventional PCR, it is recommended one chooses target 270

regions with high mismatches to closely-related species (Daher et al. 2015). In this study, 271

the CDS of toxR shows distant homology and highly variable sequences from other 272

species based on sequence alignment. 273

The sensitivity of the RPA-IAC method in the present study was 3×103 CFU/mL, 274

which is comparable to the conventional PCR. It was observed that a longer amplification 275

time period did not significantly increase the sensitivity. The possible explanations for 276

Page 11 of 25



Draft

12

this are: 1. Inadequate recombinase polymerase or dNTPs in the reaction mix; 2. Primers 277

not perfectly designed; 3. Low resolution of agarose gel electrophoresis. Using a 278

fluorescent probe system for real time detection may largely enhance the sensitivity. 279

The limitation of this study is that it may not be ideal for field application. Evaluation 280

of the RPA-IAC assay using raw clinical samples and portable fluorescence detection 281

equipment or a lateral flow strip is required in the future to further advance this 282

methodology. Moreover, the use of a boiling method (Wang and Turechek 2016) instead 283

of a DNA extraction kit will be attempted for field application with a quicker time-to-284

result. 285

5. Conclusions 286

An RPA-IAC assay was developed which can be used as a rapid and specific assay for 287

the detection of V. parahaemolyticus. IAC played a significant role in the detection of 288

false-negative results. This method would be most helpful not only in food pathogen 289

detection and risk assessment but also in the rapid diagnosis of clinical samples and in 290

epidemiological studies. 291

292

Acknowledgements 293

This work was supported by the Science and Technology Project of Guangdong 294

Province (2015A050502030, 2016A050503031) and the Science and Technology 295

Planting Project of Guangdong Entry-Exit Inspection and Quarantine Bureau 296

(2017GDK48, 2015GDK27). We sincerely thank Dr. William Riley for critical reading 297

and reviewing of the manuscript. 298

Page 12 of 25



Draft

13

Conflict of interest 299

The authors declare that they have no conflicts of interest. 300

301

Reference: 302

Abdulmawjood A., et al. 2002. Two methods for construction of internal amplification controls for the detection of 303

Escherichia coli O157 by polymerase chain reaction. Molecular and Cellular Probes. 16(5): 335-339. 304

Asiello P J., and Baeumner A J. 2011. Miniaturized isothermal nucleic acid amplification, a review. Lab Chip. 11(8): 305

1420-1430. doi: 10.1039/c0lc00666a. 306

Cao D., et al. 2015. Real-time fluorescence Loop-Mediated Isothermal Amplification (LAMP) for rapid and reliable 307

diagnosis of pulmonary tuberculosis. Journal of Microbiological Methods. 109(2015): 74-78. doi: 308

10.1016/j.mimet.2014.12.013. 309

Crannell Z., et al. 2016. Multiplexed recombinase polymerase amplification assay to detect intestinal protozoa. 310

Analytical Chemistry. 88(3): 1610-1616. doi: 10.1021/acs.analchem.5b03267. 311

Crannell Z A., Cabada M M., Castellanos-Gonzalez A., Irani A., White A C., and Richards-Kortum R. 2015. 312

Recombinase polymerase amplification-based assay to diagnose Giardia in stool samples. The American Journal of 313

Tropical Medicine and Hygiene. 92(3): 583-587. doi: 10.4269/ajtmh.14-0593. 314

Croci L., et al. 2007. Comparison of different biochemical and molecular methods for the identification of Vibrio 315

parahaemolyticus. Journal of Applied Microbiology. 102(1): 229-237. doi: 10.1111/j.1365-2672.2006.03046.x. 316

Daher R K., et al. 2015. Influence of sequence mismatches on the specificity of recombinase polymerase amplification 317

technology. Molecular and Cellular Probes. 29(2): 116-121. doi: 10.1016/j.mcp.2014.11.005. 318

Sabate J., Adly N Y., Sanchez J L., Henry O., and Sullivan C K. 2014. Electrochemical detection of Francisella 319

tularensis genomic DNA using solid-phase recombinase polymerase amplification. Biosensors and Bioelectronics. 320

54(8): 674-678. doi: 10.1016/j.bios.2013.11.03. 321

Euler M., et al. 2013. Development of a panel of recombinase polymerase amplification assays for detection of 322

biothreat agents. Journal of clinical microbiology. 51(4): 1110-1117. doi: 10.1128/JCM.02704-12. 323

Food and Drug Administration. 2010. Bacteriological analytical manual [online]. Available from 324

https://www.fda.gov/Food/FoodScienceResearch/LaboratoryMethods/ucm2006949.htm. 325

Gill P., and Ghaemi A. 2008. Nucleic acid isothermal amplification technologies: a review. Nucleosides Nucleotides 326

and Nucleic Acids. 27(3): 224-243. doi: 10.1080/15257770701845204. 327

Hoorfar J., et al. 2004. Practical considerations in design of internal amplification controls for diagnostic PCR assays. 328

Page 13 of 25



Draft

14

Journal of Clinical Microbiology. 42(5): 1863-1868. doi: 10.1128/jcm.42.5.1863-1868.2004. 329

Izumiya H., et al. 2011. Multiplex PCR assay for identification of three major pathogenic Vibrio spp., Vibrio cholerae, 330

Vibrio parahaemolyticus, and Vibrio vulnificus. Molecular and Cellular Probes. 25(4): 174-176. doi: 331

10.1016/j.mcp.2011.04.004. 332

Jaroenram W., and Owens L. 2014. Recombinase polymerase amplification combined with a lateral flow dipstick for 333

discriminating between infectious Penaeus stylirostris densovirus and virus-related sequences in shrimp genome. 334

Journal of Virological Methods. 208: 144-151. doi: 10.1016/j.jviromet.2014.08.006. 335

Kim Y., et al. 1999. Identification of Vibrio parahaemolyticus strains at the species level by PCR targeted to the toxR 336

Gene. Journal of Clinical Microbiology. 37(4): 1173-1177. 337

Lai X., et al. 2010. Research of Vibrio parahaemolyticus of aquatic products and environment in the Pearl River estuary. 338

Journal of Tropical Medicine. 10(6): 715-718. 339

Lee C., et al. 1995. Sequence of a cloned pR72H fragmen and its use for detection of Vibrio parahaemolyticus in 340

shellfish with the PCR. Applied and Environmental Microbiology. 61(4): 1311-1317. 341

Lee N., et al. 2014. A multiplex PCR assay for simultaneous detection of Escherichia coli O157:H7, Bacillus cereus, 342

Vibrio parahaemolyticus, Salmonella spp., Listeria monocytogenes, and Staphylococcus aureus in Korean ready-to-eat 343

food. Foodborne Pathogens and Disease. 11(7): 574-580. doi: 10.1089/fpd.2013.1638. 344

Lillis L., et al. 2016. Factors influencing Recombinase polymerase amplification (RPA) assay outcomes at point of care. 345

Molecular and Cellular Probes. 30(2): 74-78. doi: 10.1016/j.mcp.2016.01.009. 346

Liu B., et al. 2012. Development of a real time PCR assay for rapid detection of Vibrio parahaemolyticus from seafood. 347

Protein Cell. 3(3): 204-212. doi: 10.1007/s13238-012-2017-6. 348

Maaroufi Y., et al. 2006. Development of a multiple internal control for clinical diagnostic real-time amplification 349

assays. FEMS Immunology and Medical Microbiology. 48(2): 183-191. doi: 10.1111/j.1574-695X.2006.00125.x. 350

Matsumoto C., et al. 2000. Pandemic spread of an O3:K6 clone of Vibrio parahaemolyticus and emergence of related 351

strains evidenced by arbitrarily primed PCR and toxRS sequence analyses. Journal of Clinical Microbiology. 38(2): 352

578-585. 353

Moore M D., and Jaykus L A. 2017. Development of a recombinase polymerase amplification assay for detection of 354

epidemic human Noroviruses. Scientific Reports. 7: 40244. doi: 10.1038/srep40244. 355

Nhung P H., et al. 2007. Rapid and specific identification of 5 human pathogenic Vibrio species by multiplex 356

polymerase chain reaction targeted to dnaJ gene. Diagnostic Microbiology and Infectious Disease. 59(3): 271-275. doi: 357

10.1016/j.diagmicrobio.2007.05.016. 358

Nilsson W B., and Turner J W. 2016. The thermostable direct hemolysin-related hemolysin (trh) gene of Vibrio 359

Page 14 of 25



Draft

15

parahaemolyticus:sequence variation and implications for detection and function. Journal of Microbiological Methods. 360

126(2016): 1-7. doi: 10.1016/j.mimet.2016.04.007. 361

Nimitphak T., et al. 2008. Shrimp hepatopancreatic Parvovirus detection by combining Loop-mediated isothermal 362

amplification with a lateral flow dipstick. Jounal of Virological Methods. 154(1): 56-60. doi: 363

10.1016/j.jviromet.2008.09.003. 364

Nordstrom J L., et al. 2007. Development of a multiplex real-time PCR assay with an internal amplification control for 365

the detection of total and pathogenic Vibrio parahaemolyticus bacteria in oysters. Applied and Environmental 366

Microbiology. 73(18): 5840-5847. doi: 10.1128/AEM.00460-07. 367

Oikonomou I., et al. 2008. Selective PCR: a novel internal amplification control strategy for enhanced sensitivity in 368

Salmonella diagnosis. Letters in Applied Microbiology. 46(4): 456-461. doi: 10.1111/j.1472-765X.2008.02340.x. 369

Piepenburg O., et al. 2006. DNA detection using recombination proteins. PloS Biology. 4(7): 1115-1121. doi: 370

10.1371/journal.pbio.0040204. 371

Robert-Pillot A., Copin S., Himber C., Gay M and Quilici M L. 2014. Occurrence of the three major Vibrio species 372

pathogenic for human in seafood products consumed in France using real-time PCR. International Journal of Food 373

Microbiology. 189(2014): 75-81. doi: 10.1016/j.ijfoodmicro.2014.07.014. 374

Rosec J P, et al. 2009. Detection of total and pathogenic Vibrio parahaemolyticus in shellfish: comparison of PCR 375

protocols using pR72H or toxR targets with a culture method. International Journal of Food Microbiology. 129(2): 136-376

145. doi: 10.1016/j.ijfoodmicro.2008.11.017. 377

Ruimy R., et al. 1994. Phylogenetic analysis and assessment of the genera Vibrio, Photobacterium, Aeromonas, and 378

Plesiomonas deduced from small-subunit rRNA sequences. International Jounal of Systematic Bacteriology. 44(3): 379

416-426. doi: 10.1099/00207713-44-3-416. 380

Venkateswaran K., et al. 1998. Cloning and nucleotide sequence of the gyrB gene of Vibrio parahaemolyticus and its 381

application in detection of this pathogen in shrimp. Applied and Environmental Microbiology. 64(2): 681-687. 382

Wang H., and Turechek W W. 2016. A Loop-mediated isothermal amplification assay and sample preparation procedure 383

for sensitive detection of xanthomonas fragariae in strawberry. Plos One. 11(1):1007-1013. doi: 384

10.1016/10.1371/journal.pone.0147122. 385

Wei S., et al. 2014. Multiplex PCR assays for the detection of Vibrio alginolyticus, Vibrio parahaemolyticus, Vibrio 386

vulnificus, and Vibrio cholerae with an internal amplification control. Diagnostic Microbiology and Infectious Disease. 387

79(2): 115-118. doi: 10.1016/j.diagmicrobio.2014.03.012. 388

Wu Y D., et al. 2016. Recombinase polymerase amplification (RPA) combined with lateral flow (LF) strip for 389

equipment-free detection of Cryptosporidium spp. oocysts in dairy cattle feces. Parasitology Research. 115(9): 3551-390

Page 15 of 25



Draft

16

3555. doi: 10.1007/s00436-016-5120-4. 391

Yang M., et al. 2016. Development and evaluation of a rapid and sensitive EBOV-RPA test for rapid diagnosis of Ebola 392

Virus disease. Scientific Reports. 6: 26943. doi: 10.1038/srep26943. 393

394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430

Page 16 of 25



Draft

17

Figure 1 Schematic for the construction of IAC. 431

432

Figure 2 Alignment of primer F/R 14 with homologous target sequences in the genus 433

Vibrio, obtained from GenBank. Dots represent consensus with F14 (1) or R14 (2) 434

sequence. 435

436

Figure 3 Comparison of RPA-IAC amplicon yield at different reaction times. The data 437

were obtained from triplicate experiments. 438

439

Figure 4 Specificity test of RPA-IAC assay. M, molecular weight marker; lane 1, V. 440

parahaemolyticus; lane 2, V. alginolyticus; lane 3, V. mimicus; lane 4, V. vulnificus; lane 5, 441

V. cholera; lane 6, Enterobacter sakazakii; lane 7, E.coli; lane 8 Staphylococcus aureus; 442

lane 9, Bacillus subtilis; lane 10, Lactobacillus planetarium; lane 11, blank control. 443

444

Figure 5 Detection sensitivity for V. parahaemolyticususing primer set F/R 14. The 445

concentration of V. parahaemolyticus varied from 3×101 3×10

7 CFU/mL. M, molecular 446

weight marker; lane 1, 3×107 CFU/mL; lane 2, 3×10

6 CFU/mL; lane 3, 3×10

5 CFU/mL; 447

lane 4, 3×104

CFU/mL; lane 5 3×103 CFU/mL; lane 6, 3×10

2 CFU/mL; lane 7, 448

3×101CFU/mL; lane 8, blank control. 449

Page 17 of 25



Draft

Table 1 Bacterial strains used and the detection results

Species Source, strain (No.) RPA-IAC detection

V.p IAC

V. parahaemolyticus Ref. ATCC17802 (1) + +

Env. Shantou, China (1) + +

Clin. Shanghai, China (2) + +

Env. Chaozhou, China (7)

Env. Shenzhen, China (1)

Env. Zhanjiang, China (3)

Env. Zhangzhou, China (1)

Env. Raoping, China (1)

Env. Beihai, China (1)

Env. Guangzhou, China (13)

+

+

+

+

+

+

+

+

+

+

+

+

+

+

O1 Env. Guangzhou, China (3) + +

O2

O3

O4

O6





+

+

+

+

+

+

+

+





V. alginolyticus Ref. ATCC 17749 (1) - +

Env. Chaozhou, China (1) - +


Env. Macau, China (1)

Env. Shenzhen, China (1)

Env. Zhanjiang, China (1)

-

-

-

-

+

+

+

+

V. mimicus Env. Chaozhou, China (1)

Ref. ATCC 33653 (1)

-

-

+

+

V. vulnificus Env. Shantou, China (2)

Ref. CMGCC 1.1758 (1)

-

-

+

+

Env. Shantou, China (2) - +

V. cholera

Enterobacter sakazakii

Escherichia. coli

Env. Shantou, China (2)

Ref. ATCC 29544 (2)


-

-

-

+

+

+

Staphylococcus aureus Env. Guangzhou, China (2) - +

Bacillus subtilis Env. Guangzhou, China (2) - +

Lactobacillus planetarium Env. Guangzhou, China (2) - +

Note: Ref. Reference strains; Env. Environmental strains; Clin. Clinical strains.

Page 18 of 25



Draft

Table 2 Sequences of primers utilized

Names Sequences (5'-3') Product

size

Reference

14F ACTCGTATGAGAACGTGACATTGCGTATTT 426bp This study

14R TTGAACTCAGAAGGAGAAACAAGCAGGTAG

YXF GAAAGTTGAACATCATCAGCACGA 271bp (Wei, et al.

2014) YXR GGTCAGAATCAAACGCCG

IACF ACTCGTATGAGAACGTGACATTGCGTATTTGAA

AGTTGAACATCATCAGCACGA

331bp

375bp

This study

(Lee, et

al., 2014)

IACR

tox-F

tox-R

TTGAACTCAGAAGGAGAAACAAGCAGGTAGGG

TCAGAATCAAACGCCG

TCATTTGTACTGTTGAACGCCTA

AATAGAAGGCAACCAGTTGTTGAT

Page 19 of 25



Draft

Table 3 Detection of seafood samples using RPA-IAC assay and traditional culture

method

P*: positive results N*: negative results

Food Number Traditional culture (P*/N*) RPA-IAC(P*/N*)

Shrimp 12 1/11 1/11

Cuttlefish 17 2/15 2/15

Clams 8 1/7 1/7

Oyester 16 3/13 3/13

Total 53 7/46 7/46

Page 20 of 25



Draft

Figure 1 Schematic for the construction of IAC.

54x34mm (300 x 300 DPI)

Page 21 of 25



Draft

Figure 2 Alignment of primer F/R 14 with homologous target sequences in the genus Vibrio, obtained from GenBank. Dots represent consensus with F14 (1) or R14 (2) sequence.

75x32mm (300 x 300 DPI)

Page 22 of 25



Draft

Figure 3 Comparison of RPA-IAC amplicon yield at different reaction times. The data were obtained from triplicate experiments.

80x44mm (300 x 300 DPI)

Page 23 of 25



Draft

Figure 4 Specificity test of RPA-IAC assay. M, molecular weight marker; lane 1, V. parahaemolyticus; lane 2, V. alginolyticus; lane 3, V. mimicus; lane 4, V. vulnificus; lane 5, V. cholera; lane 6, Enterobacter sakazakii; lane 7, E.coli; lane 8 Staphylococcus aureus; lane 9, Bacillus subtilis; lane 10, Lactobacillus planetarium;

lane 11, blank control.

80x54mm (300 x 300 DPI)

Page 24 of 25



Draft

Figure 5 Detection sensitivity for V. parahaemolyticususing primer set F/R 14. The concentration of V. parahaemolyticus varied from 3×101 3×107 CFU/mL. M, molecular weight marker; lane 1, 3×107 CFU/mL; lane 2, 3×106 CFU/mL; lane 3, 3×105 CFU/mL; lane 4, 3×104 CFU/mL; lane 5 3×103 CFU/mL; lane 6,

3×102 CFU/mL; lane 7, 3×101CFU/mL; lane 8, blank control.

66x55mm (300 x 300 DPI)

Page 25 of 25



system appendpdf cover-forpdf - university of …...draft 2 48 abstract 49 a novel rpa-iac assay...

Documents