Egypt. J. Lab. Med. Vol.(27) No.3, October, 2015

THE EGYPTIAN JOURNAL OF LABORATORY MEDICINE “DAR EL HEKMA”, 42, Kasr El‐Eini Street, Cairo, Egypt 

PUBLISHED BY THE EGYPTIAN SOCIETY OF LABORATORY MEDICINE 

(ESLM)  Editor in  Chief:        Ali Ahmed Shams El‐Din Editor:           Naguib Zoheir Mostafa             e‐mail: ejlm@hotmail.com  Assistant Editors:        Sahar Kamal       

Mervat Mamdooh Khorshied Heba Mahmoud Gouda  

 ADVISORY BOARD Alphabetical Order 

 Clinical Chemistry  Mohga Zewar 

Ahmed Abdel Samie Omran  Nabiela Thabet Fatma El Mogui  Naila Omran Omar Ali Alroubi  Nevine Kassem  Omneya Youssef  Samir Sahlab Ousama Bakr Seddik  Sherif Ahmed Ali Sawsan Housny  Sourya Badawy Mona Salem  Mouna Sedrak  Histopathology  Abdullah Khalil 

Clinical Microbiology  Eleya Ishaak 

Amany El Kholy   Ragaa Lashin  ImmunologySoheir Helal  Aida Abd El Azim Abd El Salam Walaa Gad  Aisha Abdel Ghaffar   Azza Aboul Enein 

Hematology  Azza Kamel 

Azza Ahmed Mohamed  Farha El Shennawy Azza Mostafa  Mervat El‐Ansary Fadila Sabri  Moemena Abdel Wahab Kamel Hala Farawella  Mona Rafik Hala Gabr  Nawal Afifi Laila Hegazy  Safaa El KaraksyLoutfi Abdul Nabui  Taghreed Gaafar  

NOTES TO THE CONTRIBUTORS 

  The Egyptian Journal of Laboratory Medicine published by the Egyptian Society of Laboratory Medicine (ESLM) welcomes original papers, review articles, book reviews, abstracts from current literature and technical notes concerning different clinical laboratory procedures. The journal is published three times annually. 

Articles to be published should  not be  published elsewhere, and should be accepted by a referee of the advisory board. 

The authors will be responsible for published articles and not the editor. 

MANUSCRIPTS: 

1. An original manuscript and a photocopy plus one soft copy on a CD  in  Microsoft words format  should be sent to the editor. (Clinical Pathology Dept., Kasr El‐Eini, Faculty of Medicine, Cairo University), Tel: o2‐23654480 

2. It is necessary to present the manuscripts type‐written, preferably using word processor write on one side of A4 paper only, double spacing, liberal margins and not more than 24 lines per page. 

3. Tables and figures should be: Clear, of very good quality and numbered in Arabic numericals. Photo pictures should be either (black and white or colored). 

4. Site of the tables and figures in the articles should be marked  in the manuscript. 5. The first page should only include (a) Title of paper (b) Authors (c) Institution in which the 

work was carried out (d) Complete address for mailing purposes (e) Mobile Phone and e‐mail. 6. The manuscript should begin with abstract of the work, followed by introduction, material 

and methods, results, discussion and the references. The last page is an Arabic summary. 7. Author’s names should be written as follows: First name then family name or first name, 

initials then family name. 8. References at the end of the paper should be arranged alphabetically in the following order: 

number, name of the author(s) each followed by initials, year in brackets, title of the subject, abbreviation of the journal name, volume number and page. 

9. References within the article are referred to using  the number of reference between brackets in superscript typing. 

10. Authors are requested to condense their papers. 

 

 

page

IMPLICATION OF TLR-3 AND TLR-9 SINGLE NUCLEOTIDE POLYMORPHISMS ON HCV

INFECTION, RESPONSE TO THERAPY AND FIBROSIS PROGRESSION AMONG EGYPTIAN

PATIENTS

Rania A. Zayed , Dalia Omran , Zinab Zakaria , Sameera Ezzat , Salwa Tawfeek and Hossam El-Sweesy

ROLE OF PLACENTAL PROTEIN 13 AS A BIOMARKER FOR EARLY DETECTION OF PRE-

ECLAMPSIA. METHYLENETETRAHYDROFOLATE REDUCTASE GENE POLYMORPHISM

AND RELATION TO DISEASE RISK, AN EGYPTIAN STUDY

Engy El Khateeb and Sherif Dahab..................................................................................................................

CORD BLOOD COPEPTIN AND CALPROTECTIN AS POTENTIAL BIOMARKERS OF

EARLY-ONSET NEONATAL SEPSIS

Manal Mohsen , Wafaa K.Zaki , Rania Ismail , Nehal El-Raggal and Mohamed A. Abd El-Wahed...........

THE STUDY OF BCR-ABL TRANSCRIPT VARIANTS (B2A2 AND B3A2) RELATION TO

DIFFERENT RISK SCORES

Hisham Abdelaziz , Ahmed Omar , Ali Alshemary and Mohamed Keshk..................................................

CRP AND SERUM AMYLOID A AS MARKERS FOR THE AGGRESSIVENESS OF BREAST

CANCER

Rania Elhelely , Rasha Elzehery , Mohammed AF Hegazy and Ramy Faris................................................

EXPRESSION OF CD69 IN CHRONIC LYMPHOCYTIC LEUKEMIA; RELATION TO

PROGNOSIS AND DISEASE PROGRESSION

Mahira I Elmougy and Ghada M Elgohary......................................................................................................

COMBINED ANALYSIS OF LEVELS OF SERUM B-CELL ACTIVATING FACTOR AND

A PROLIFERATION INDUCING LIGAND IN B-CELL CHRONIC LYMPHOCYTIC

LEUKEMIA; CORRELATION WITH CLINICAL FEATURES AND DISEASE PROGRESSION

Mahira I Elmougy and Ghada M. Elgohary.....................................................................................................

IN VITRO APOPTOTIC EFFECT OF METFORMIN ON HUMAN CERVICAL CANCER CELLS

Dina Sabry ,Sahar H. Ahmed and Mohamed A. S. Al-Ghussein....................................................................

ROLE OF INTERCELLULAR ADHESION MOLECULE-1 (ICAM-1) G241R AND K469E GENE

POLYMORPHISM AND SOLUBLE ICAM-1 SERUM LEVELS IN THE DEVELOPMENT OF

ISCHEMIC STROKE IN EGYPTIAN PATIENTS

Abeer Mohamed Mohy , Ahmed Abd Allah Hassan Ali and Heba Omar....................................................

γ- GLOBIN GENE XMN1 POLYMORPHISM-158 AND ITS CORRELATION TO THE

RESPONSE TO HYDROXYUREA IN βTHALASSEMIA MAJOR PATIENTS IN BENISUEF

GOVERNORATE(EGYPT)

Abdel Meged A. Abdel Meged , Dalia G. Amin , Dalia S. Morgan and Safwat L. Shaker...........................

1

13

21

31

39

47

57

65

73

81

1.

2.

3.

4.

5

6.

7.

8.

9.

10.

CONTENTS

IMPLICATION OF TLR-3 AND TLR-9 SINGLE NUCLEOTIDE

POLYMORPHISMS ON HCV INFECTION, RESPONSE TO THERAPY

AND FIBROSIS PROGRESSION AMONG EGYPTIAN PATIENTSRania A. Zayed*, Dalia Omran**, Zinab Zakaria**, Sameera Ezzat***, Salwa Tawfeek****

and Hossam El-Sweesy*****

ABSTRACT

Toll-like receptors (TLRs) are recognized as fundamental contributors to the immune system function against infections.

We studied the association of genetic variation in TLRs and HCV infection susceptibility, response to therapy and fibrosis

progression. Frequency of TLR-3 (_7 C/A [rs3775296]), TLR-3 (c.1377C/T [rs3775290]) and TLR-9 (1237T/C [rs5743836])

single nucleotide polymorphisms (SNPs) was studied in 100 chronic HCV- positive Egyptian patients and 100 healthy controls.

Frequency of SNP in TLR-3 (_7 C/A), TLR-3 (c.1377C/T) and TLR-9 (1237T/C) were not significantly different between studied

HCV- positive patients and controls with p-value 0.121, 0.112, 0.683 respectively. TLR-3 c.1377 T- allele was associated with

failure of end of treatment response (p= 0.006), failure to achieve SVR (p= 0.006) and was found to be related to advanced

stage of fibrosis (p= 0.003). In conclusion, TLR-3 c.1377 T- allele is associated with impaired response to therapy and fibrosis

progression in HCV infected Egyptian patients. Key words: TLR-3; TLR-9; HCV; Fibrosis; IFN; Egypt

Departments of Clinical and Chemical Pathology*, Faculty of Medicine, Cairo University, **Tropical Medicine,

***National Liver Institute, Menofia University, ****Internal Medicine, National Re search Institute, *****Cairo

Fatemic Hospital, Ministry of Health

Egypt. J. Lab. Med. Vol.(27) No.3, October, 2015 1 - 12

INTRODUCTION

Hepatitis C virus (HCV) infection is a mul-

tifactorial disease representing a major health

problem in Egypt where the prevalence is almost

10-fold higher than that in other countries(17).

The immune system is an essential determinant

of viral infection outcome(57). Interactions be-

tween the viruses, hepatocytes, and the host im-

mune systems may determine viral persistence

and disease progression (9).

Toll-like receptors (TLRs) are fundamental

component of the innate immune system and

key regulators of acquired immunity. In hu-

mans, 10 TLRs proteins (TLR1–10) have been

identified(3), that possess different subcellular

localization depending on the specific patho-

gen-associated molecular patterns (PAMPs) or

damage-associated molecular patterns (DAMPs)

they recognize(25), thus called pattern recognition

receptors. TLR1, 2, 4, 5, 6, and 10 are found on

the extracellular surface of cells, while TLR3, 7,

8, and 9, are nucleic-acid sensors located within

the endoplasmic reticulum and endosomes(43,29).

TLRs 3 and 9 recognize microbial nucleic acid

molecular patterns (20-22, 32), TLR-3identifies viral

RNA(6), while TLR-9 is specific for unmethyl-

ated cytosine–phosphate–guanine (CpG) dinu-

cleotide motifs in pathogen DNA (22).

TLRs have an important role in pathogen

recognition and subsequently immune system

activation (2,22,26). They trigger inflammatory cy-

tokines production through nuclear factor-κB–

dependent or interferon (IFN) regulatory fac-

tor–dependent signaling pathways. Activation of

TLR by pathogen binding stimulates inflamma-

tory cytokines production that triggers induction

of type I IFNs(4,36). Type I IFNs (IFN-α, IFN-β)

have potent antiviral properties as they interfere

with virus replication(34,42,45) and possess immu-

nomodulatory activities(53) by promoting mul-

tiple immune functions. Type I IFNs promote;

CD8+ T cell effector functions, survival and

memory (28,31,38,41), polarization of CD4+ T cells

by Th1(52), NK cell activation (10), differentiation

and maturation of DCs(11,30,48). Thus, Type I IFNs

derive its name from a function to “interfere” in

viral replication(56).

Several data supports the role of SNPs in

TLR genes in modulating the risk of viral and

bacterial infections. SNP may alter promoter

activity affecting gene expression, mRNA con-

formation and stability or protein structure and

function (35).

HCV infection adds great financial burden on

the health sector especially in Egypt, having the

highest prevalence of HCV worldwide. “Know

your epidemic, know your response” concept,

Zayed, R. A. et al.2

necessitates the study of every aspect of the dis-

ease that may help in controlling disease dissem-

ination in the community or disease progression

which compromises the life quality of chronic

HCV-infected patients. The treatment regimen

for HCV-4 is composed of IFN-α2b plus ribavi-

rin for of 48 weeks. As TLRs play a role in type

I IFN production, this implies they having anti-

viral potencies against HCV.

The genetic make-up of the host plays an im-

portant role in susceptibility and response to in-

fections (14,54). In the present work, we studied the

frequencies of TLR-3 (c.1377C/T [rs3775290]),

TLR-3 (_7 C/A [rs3775296]) and TLR-9 (1237T/

C [rs5743836]) SNPs in chronic HCV- positive

Egyptian patients in order to clarify the role of

TLR-3and TLR-9 polymorphism in HCV infec-

tion and response to therapy.

SUBJECTS AND METHODS

Two hundred participants were included

in the study; one hundred naïve chronic HCV-

positive patients and one hundred age and sex

matched normal healthy individuals as control

group. Informed consent was obtained from all

participants before enrollment, the study was

performed in accordance with the Helsinki Dec-

laration, and the protocols were approved by

Faculty of Medicine, Cairo University Ethics

Committee.

HCV infection was diagnosed by anti-HCV

antibodies testing and detection of HCV-RNA

(Applied biosystems). All patients had no coin-

fection with hepatitis B virus and no other causes

of chronic liver disease.

Pretreatment Liver biopsy, Clinical and Lab-

oratory evaluation

Liver biopsy specimens were obtained from

all patients included in the study within 3 months

prior to start of treatment regimen. Histopatho-

logic features of fibrosis and activity were scored

according to the Metavir scoring system(8). Fi-

brosis was staged on a scale of 0–4.

Abdominal ultrasound, echocardiography,

fundus examination and body mass index (BMI)

calculation were done for all patients before start

of therapy and on regular basis every month dur-

ing treatment. Body mass index (BMI) was cal-

culated as weight divided by the square of the

height (kg/m2).

Hematological tests and blood chemistry

were analyzed before therapy and at least once

every month during treatment, laboratory inves-

tigations included complete blood count, blood

glucose level, liver function tests (ALT, AST,

Alkaline phosphatase, total bilirubin, Albumin),

prothrombin time and concentration, alfa-feto-

protein, creatinine, blood glucose and quantita-

tive HCV-RNA by PCR.

Treatment regimen and Evaluation of Treat-

ment outcomes

Although, first and second generations of

protease and polymerase inhibitors are used for

treatment of HCV in West Europe and USA, they

are not readily available in developing countries.

Pegylated interferon (PEG-IFN) combined with

daily oral ribavirin were the only drugs used for

treatment of HCV in Egypt until recently.

In the current study, all patients received

complete course of IFN-α2b (1.5 µg/kg/week)

plus ribavirin (1000-1200 mg/day) therapy for

duration of 48 weeks.

Quantitative HCV-RNA by real-time PCR

was done for all patients after complete course

of treatment for 48 weeks and six month later

to detect sustained virological response (SVR).

SVR was defined as undetectable HCV RNA

in serum 24 weeks after cessation of therapy.

Patients with reappearance of HCV RNA after

complete course of treatment or serum HCV

RNA positivity during therapy were considered

as non-responders (NR)(37).

Polymorphism analysis of TLR-3 c.1377C/T

(rs3775290), TLR-3 _7 C/A (rs3775296) and

TLR-9 1237T/C (rs5743836)

Genomic DNA extraction was done from pe-

ripheral blood samples using Gene JET Whole

Blood Genomic DNA purification Mini kit (Ther-

mo Scientific) according to the manufacturer’s

instructions. Isolated DNA was stored at -20°C

until used for PCR amplification. Polymorphism

analysis was performed by polymerase chain re-

action-restriction fragment length polymorphism

(PCR-RFLP) technique. All PCR reactions were

performed in a total volume of 25 μl contain-

TLRs-SNP and HCV : Response to Therapy 3

ing 150-ng genomic DNA, 2X Taq Green PCR

Master Mix, 25 pM of each forward and reverse

primers (Biosearch technologies). PCR amplifi-

cation was carried out in the DNA thermal cycler

(PTC programmable thermal controller, MJ Re-

search, Watertown, MA). Amplification condi-

tions were initial denaturation at 95°C for 5 min

followed by 35 cycles of; 95°C for 45 s, * for 45

s, and 72°C for 30 s, with final extension for 7

min at 72°C (* 55°C for TLR-3 c.1377C/T and

TLR-9 1237T/C and 59°C for TLR-3 _7 C/A).

The amplified PCR products were visualized by

2% agarose gel electrophoresis under UV light.

Primers sequences used and amplified product

size are shown in table 1.

Digestion of the amplified product by specific

restriction enzyme for each polymorphism was

done as follows; 10 µl of the amplified product

were mixed with 1 µl restriction enzyme (Ther-

mo Scientific) and the mixture was incubated

10 minutes (at 37ºC for MboII and BstNI and at

65ºC for TaqI). The product was analyzed by gel

electrophoresis using 4% agarose gel (Promega).

The separated fragments were stained with ethid-

ium bromide and visualized along with 50 bp

ladder (MBI Fermentas, Vilnius, Lithuania) as

a size marker using transilluminator (Bio-Rad,

USA). Restriction enzyme used and the resulting

bp length are shown in table 1.

Statistical analysis:

Data were analyzed using SPSS (Statistical

Package for Social Science) program for statisti-

cal analysis, (version 20; Inc., Chicago. IL). Chi-

square or fisher exact (when expected counted

in 25% of the cell or more is 5) were used to

compare qualitative variable. Logistic regression

analysis was used to calculate odds ratios (OR)

and 95% confidence intervals (CI) for risk esti-

mation. P value less than 0.05 was considered

significant.

RESULTS

Baseline demographic, clinical and labora-

tory data of the studied patients are shown in

table 2.

The frequency of the studied genetic poly-

morphisms in HCV patients and controls is

presented in table 3. There was no statistically

significant difference noticed in the distribution

of TLR-3 _7 C/A, TLR-3 c.1377C/T and TLR-9

1237T/C genotypes between HCV patients and

controls. Also, combined genotypes analysis of

the studied genetic polymorphisms showed that

co-inheritance of the genetic polymorphism in

the three studied genes didn’t confer increased

risk to HCV infection.

HCV Patients were stratified according to

hepatic fibrosis stage, group with mild fibrosis

(F1) and another group with advanced fibrosis

(F2, F3). Different parameters that may relate to

fibrosis progression were studied. Patients with

advanced hepatic fibrosis have significantly ele-

vated AFP serum levels; 5.82 ± 6.07 ng/ml in ad-

vanced fibrosis versus 3.29 ± 2.39 ng/ml in mild

fibrosis (p = 0.000). Otherwise, there were no sta-

tistically significant differences noticed between

the two patients’ groups regarding age, gender,

baseline laboratory data (data not shown). No

symptomatic significance was found as regards

Table (1): Summary of PCR-PFLP assay

Polymorphism Primer Sequence (5' –3′)Length

(bp)

Restriction

enzyme

Fragments

size (bp)

Refer

ence

TLR-3 c.1377C/T

(rs3775290)

CCAGGCATAAAAAGCAATATG

GGACCAAGGCAAAGGAGTTC 337 TaqI

CC: 274, 63

CT: 337, 274, 63

TT: 337

(13)

TLR-3

_7 C/A (rs3775296)

GCATTTGAAAGCCATCTGCT

AAGTTGGCGGCTGGTAATCT 279 MboII

AA: 257, 17

AC: 279, 257, 17

CC: 279

(13)

TLR-9 1237T/C

(rs5743836)

ATGGGAGCAGAGACATAATGGA

CTGCTTGCAGTTGACTGTGT 135 BstNI

TT: 108, 27

TC:108, 60, 48, 27

CC: 60, 48, 27

(35)

Zayed, R. A. et al.4

the distribution of TLR-3 _7 C/A, TLR-9 1237T/

C across the two patients’ groups, but as regards

TLR-3 c.1377C/T, the T- allele was found to be

associated was advanced stage of fibrosis (p=

0.003), (Table 4).

After complete course of combined interferon

and ribavirin therapy for 48 weeks, 86% of the

patients tested negative for HCV-RNA by real

time PCR while 14% were positive. Ninety three

patients were followed up six months later, 72/

93 (77.4%) achieved SVR where 21/93 (22.6%)

tested positive for HCV-RNA.

TLR-3 c.1377 T/T genotype was associated

with failure to achieve end of treatment response

as well as SVR (p= 0.004 and 0.008 respective-

ly). No association was found between TLR-3

_7 C/A and TLR-9 1237T/C different genotypes

and response to treatment or SVR, (Tables 5, 6).

Age, gender, baseline laboratory data and de-

gree of fibrosis were studied among responders

and patients’ group who failed to achieve SVR,

no statistically significant difference was found

between the two groups (data not shown).

Table 3: The Distribution of TLR-3 _7 C/A, TLR-3 c.1377C/T and TLR-9 1237T/C genotypes in HCV Pa-

tients and ControlsControls

GenotypePatients (100) Control (100)

P value OR (95% CI)Count % Count %

TLR3_ 7C/A

AA 2 2.0% 3 3.0% 1.000 0.748 (.122-4.599)

AC 24 24.0% 14 14.0% 0.076 1.923 (.927-3.989)

CC 74 74.0% 83 83.0% REF

AA+AC 26 26.0% 17 17.0% 0.121 1.715 (.863-3.410)

Allele A 28 14% 20 10% 0.218 1.468 (.796-2.698)

Allele C 172 86% 180 90% REF

TLR3-1377 C/T

TT 6 6.0% 6 6.0% 0.763 0.833 (.254-2.731)

CT 28 28.0% 39 39.0% 0.094 0.598 (.327-1.094)

CC 66 66.0% 55 55.0% REF

TT+CT 34 34.0% 45 45.0% 0.112 0.630 (.356-1.115)

Allele T 40 20% 51 25.5% 0.190 0.730 (.456-1.169)

Allele C 160 80% 149 74.5% REF

TLR-9 1237T/C

CC 3 3.0% 3 6.0% 0.396 0.474 (0.019-2.464)

TC 19 19.0% 10 20.0% 0.813 0.901 (0.381-2.130)

TT 78 78.0% 37 74.0% REF

CC+TC 22 22.0% 13 26.0% 0.683 0.803 (0.365-1.768)

Allele C 25 12.5% 16 16% 0.405 0.750 (.380-1.479)

Allele T 175 87.5% 84 84% REF

OR: Odds ratio, CI: Confidence Interval, p-value <0.05 is considered significant

Table 2: Baseline Clinical and Laboratory Data

of the Patients (n=100)

Age 41.1 ± 9.8 y

BMI 26.72± 3.5

Sex Male Female

65 (65%)35 (35%)

ALT (U/L) 53.74±39.5

AST (U/L) 47.37±32.2

T. Bil (mg/dl) 0.81±0.46

Alkaline phosphatase (u/l) 103.4±62.7

Albumin (gm/dl) 4.2±0.48

Creatinine (mg/dl) 0.99±0.17

Glucose (mg/dl) 97.7±21.0

WBC (109 /L) 6.5±1.8

Hb (gm/dl) 13.6±1.5

Platelets (109 /L) 225±59.5

PC (%) 92.2±9.7

AFP (ng/ml) 4.1±4.2

HCV viral Load (IU/ml x 105) 45.8±32.5

Stage of Fibrosis Stage 1 Stage 2 Stage 3

65 (65%)15(15%)20 (20%)

Data are presented as mean±SD and number (%) BMI, body mass index; ALT, alanine aminotransferase; AST, aspartate transaminase; T. Bil, total bilirubin; WBC, white blood count; Hb, Hemoglobin; PC, prothrombin concentration; AFP, alpha fetoprotein; HCV, hepatitis C virus

TLRs-SNP and HCV : Response to Therapy 5

Table 4: Association of gene polymorphism and degree of liver fibrosis

Genotype

Degree of liver fibrosis

P valueMild fibrosis F1 (n=65)Advanced fibrosis F2, F3

(n=35)

Count % Count %

TLR3_ 7C/A

AA 0 .0% 2 5.7%

0.174AC 17 26.2% 7 20.0%

CC 48 73.8% 26 74.3%

AA+AC 17 26.2% 9 25.7% 0.962

Allele A 17 13% 11 16%0.608

Allele C 113 87% 59 84%

TLR3-1377 C/T

TT 4 6.2% 2 5.7%

< 0.001CT 10 15.4% 18 51.4%

CC 51 78.5% 15 42.9%

TT+CT 14 21.5% 20 57.1% < 0.001

Allele T 18 14% 22 31.4%0.003

Allele C 112 86 % 48 68.6%

TLR-9 1237T/C

CC 1 1.5% 2 5.7%

0.183TC 10 15.4% 9 25.7%

TT 54 83.1% 24 68.6%

CC+TC 11 16.9% 11 31.4% 0.095

Allele C 12 9 % 13 18.6%0.057

Allele T 118 91 % 57 81.4%

Table 5: Association of gene polymorphism and response to treatmentTable 5: Association of Gene Polymorphism and Response to Treatment

Genotype

HCV-RNA at Week 48

(End of treatment)P value OR (95% CI)

Negative (n=86) Positive (n=14)

Count % Count %

TLR3 7C/A

AA 1 1.2% 1 7.1% 0.293 0.175 (0.010-3.003)

AC 22 25.6% 2 14.3% 0.511 1.921 (0.394-9.352)

CC 63 73.3% 11 78.6% REF

AA+AC 23 26.7% 3 21.4% 1.000 1.339 (0.343-5.231)

Allele A 24 14% 4 14.3% 1.000 0.973 (0.310-3.051)

Allele C 148 86% 24 85.7% REF

TLR3-1377 C/T

TT 2 2.3% 4 28.6% 0.004 0.059 (0.009-0.385)

CT 25 29.1% 3 21.4% 1.000 0.989 (.236-4.136)

CC 59 68.6% 7 50.0% REF

TT+CT 27 31.4% 7 50.0% 0.225 0.458 (.146-1.434)

Allele T 29 17% 11 39.3% 0.006 0.313 (0.133-0.738)

Allele C 143 83% 17 60.7% REF

TLR-9 1237T/C

CC 2 2.3% 1 7.1% 0.386 0.328 (.027-3.936)

TC 17 19.8% 2 14.3% 1.000 1.396 (.282-6.898)

TT 67 77.9% 11 78.6% REF

CC+TC 19 22.1% 3 21.4% 1.000 1.040 (.263-4.110)

Allele C 21 12.2% 4 14.3% 0.759 0.834 (0.263-2.643)

Allele T 151 87.8% 24 85.7% REF

Zayed, R. A. et al.6

Genotype

HCV-RNA at Week 72 (SVR)

P value OR (95% CI)Negative

(n=72)

Positive

(n=21)

Count % Count %

TLR3_ 7C/A

AA 1 1.4% 1 4.8% 0.402 0.278 (0.016-4.078)

AC 17 23.6% 5 23.8% 1.000 0.944 (0.299-2.981)

CC 54 75.0% 15 71.4% REF

AA+AC 18 25.0% 6 28.6% 0.742 0.833 (0.281-2.470)

Allele A 19 13.2% 7 16.7% 0.568 0.760 (0.296-0.1954)

Allele C 125 86.8% 35 83.3% REF

TLR3-1377 C/T

TT 1 1.4% 4 19.0% 0.008 0.054 (.005-.530)

CT 20 27.8% 6 28.6% 0.563 0.719 (.234-2.206)

CC 51 70.8% 11 52.4% REF

TT+CT 21 29.2% 10 47.6% 0.114 0.453 (.167-1.226)

Allele T 22 15.3% 14 33.3% 0.009 0.361 (0.164-0.791)

Allele C 122 84.7% 28 66.7% REF

TLR-9 1237T/C

CC 1 1.4% 1 4.8% 0.400 0.276 (.016-4.658)

TC 13 18.1% 4 19.0% 1.000 0.897 (.257-3.129)

TT 58 80.6% 16 76.2% REF

CC+TC 14 19.4% 5 23.8% 0.759 0.772 (.242-2.468)

Allele C 15 10.4% 6 14.3% 0.579 0.698 (0.253-1.928)

Allele T 129 89.5% 36 85.7% REF

OR: Odds ratio, CI: Confidence Interval, p-value <0.05 is considered significant

Table 6: Association of gene polymorphism and sustained virological response (SVR)

Figure (1): Characterization of the TLR3 _7 C/A polymorphism using MboII restriction enzyme. Ethidium

bromide stained 4% agarose gel.

Cases 1,4,7 show Homozygous CC (wild genotype): 1band 279 was detected.

Cases 2, 3, 5 show Heterozygous AC genotype: 3 bands 279, 257, 17 were detected.

Case 6 shows Homozygous AA genotype: 2 bands 257, 17 was detected.

M: PCR marker (50-100-150-200-250-300-350-400 bp-etc)

N.B. The 17 bp band cannot be visualized in the horizontal gel electrophoresis.

TLRs-SNP and HCV : Response to Therapy 7

Figure (2): Characterization of the TLR3 c.1377C/T polymorphism using Taq I restriction enzyme. Ethid-

ium bromide stained 4% agarose gel.

Cases 1,2,4,6,8 show Homozygous CC (wild genotype): 2 band 274 and 63 bp were detected..

Cases 3,7 show Heterozygous CT genotype: 3 bands 337, 274 and 63 were detected.

Case 5 shows Homozygous TT genotype: 1 band 337 was detected.

M: PCR marker (50-100-150-200-250-300-350-400 bp-etc).

Figure (3): Characterization of the TLR-9 (-1237 T/C) Polymorphism using BstNI restriction enzyme.

Ethidium bromide stained 4% agarose gel.

Cases 1,2,3, 5 show Homozygous TT (wild genotype): 2 bands 108 and 27 bp were detected.

Case 6 shows Homozygous CC genotype: 3 bands 60, 48 and 27 bp were detected.

Cases 4,7,8 show Heterozygous TC genotype: 4 bands 108, 60, 48 and 27 bp were detected.

M: PCR marker (50-100-150-200-250-300-350-400 bp-etc).

N.B. The 27 bp band cannot be visualized in the horizontal gel electrophoresis.

Zayed, R. A. et al.8

DISCUSSION

Knowing that, genetic variations in the

TLR-signaling pathway contributed in either

susceptibility or resistance to several infectious

diseases(50,55), we studied the impact of TLR-

3 (c.1377C/T [rs3775290]), TLR-3 (_7 C/A

[rs3775296]) and TLR-9 (1237T/C [rs5743836])

SNPs on HCV infection.

The TLR-9 gene is located on chromosome

3p21.3 and spans approximately 5 kb, TLR-9

gene has a major coding region exon in one of

its two exons(36). TLR-9 has been demonstrat-

ed to bind only to DNA virus, so the binding of

HCV which is single-stranded RNA (ssRNA) to

TLR-9 is assumed unlikely(4). However, studies

demonstrated that TLR-9 mRNA and protein are

down-regulated in peripheral blood mononu clear

cells of HCV-infected patients compared to nor-

mal controls, and are negative ly correlated with

serum viral copies(62). In addition, TLR-9 stimu-

lation showed antiviral effects in HCV-infected

individu als(12), and was found to participate in

the early immune response against HCV infec-

tion of the central ner vous system(23). On the oth-

er hand, some other studies showed that TLR-9

level was present at higher levels in HCV pa-

tients compared to healthy controls(61). Although

data are controversial, it points that TLR-9 plays

a role during HCV infection. In our study, the

presence of TLR-9 1237T/C SNP is not associ-

ated with susceptibility to HCV infection or re-

sponse to antiviral therapy. Similarly, Wei et al(58)

showed no signifi cant association in regards to

TLR9 (rs187084) genotype and allele frequency

between chronic HCV patients and subjects who

sponta neously cleared the virus.

In human, TLR-3-promoter region is

responsible for maintenance of promoter

integrality and promoter specific virus re-

sponsive element(51). In our study, the TLR-3

(_7 C/A) SNP within the promoter region is

not associated with HCV infection, and our

results are comparable to results in other

ethnicities(7,13,40). On the other hand, TLR-3

(c.1377 T/T) SNP was associated with fail-

ure of end of treatment response (p= 0.006)

and failure to achieve SVR (p= 0.006). This

can be attributed to unsuccessful host defense

against viral infections which relies on ear-

ly production of type I IFN and subsequent

activation of a cellular cytotoxic response.

TLR3, TLR7, or TLR8 recognize PAMP

thus allow virus linkages with dendritic cell

and subsequent activation and stimulation of

dendritic cells, TLRs-SNPs result in disrup-

tion of PAMP recognition mechanism(27,49).

In a recent study by Firdaus et al(18) TLR-3

expression was found upregulated in pa-

tients who successfully cleared HCV infec-

tion, further supporting the antiviral role of

TLR-3 in HCV infection.

Previous studies stated the association be-

tween TLR-9 and hepatic failure, where, TLR-

9 signals caused hepatic failure by promoting

TNF-α production(15). However, in our study no

symptomatic significance was found as regards

the distribution of TLR-9 1237T/C, TLR-3 _7

C/A in patients with mild hepatic fibrosis or ad-

vanced fibrosis. However, interestingly enough,

TLR-3 c.1377 (T) - allele was found to be associ-

ated with advanced stage of fibrosis (p= 0.003),

because significant hepatic fibrosis is closely re-

lated to failure of response to PEG- INF/ ribavirin

therapy as well(44,46) and this matches with our re-

sults. Also, in the current study, patients with ad-

vanced hepatic fibrosis had significantly elevat-

ed AFP serum levels. This goes with the results

of Hu et al (24) who found that chronic hepatitis

C patients had elevated serum AFP that was in-

dependently associated with stage III/IV hepatic

fibrosis. Patients with elevated AFP serum levels

are less likely to respond to therapy(1,5,13,19). In our

cohort of patients, non-responders were found to

have elevated serum AFP levels however these

levels did not reach statistical significance.

We assumed that both TLR-3 and TLR-9 sig-

naling mechanisms work in synergy to establish

an antiviral state against HCV infection, so we

analyzed whether combined genetic variants in

TLRs act as a potential indicator for Egyptian

host susceptibility to HCV infection, but co-

inheritance of the genetic polymorphism in the

three studied genes didn’t confer increased risk

to HCV infection.

In conclusion, we aimed to demonstrate as-

sociations between TLR-3and TLR-9 SNPs and;

TLRs-SNP and HCV : Response to Therapy 9

susceptibility, therapy outcome and effect on

fibrosis progression in HCV- infected Egyptian

patients; as in the recent years, TLRs are gaining

increased importance due to their role in influenc-

ing host immunity. It has been suggested to use

TLRs as biomarkers for HCV pathogenesis(18).

Also, TLRs use as agonists in antiviral therapy

has been studied(33). In our study, TLR-3 (c.1377

(T) – allele was found to be associated with fail-

ure of response to therapy and advanced fibrosis

stage, however, as regards TLR-9 1237T/C, TLR-

3 _7 C/A, no signifi cant association was found

and the results are comparable between the pa-

tients and control groups. Our study has certain

points of strength as well as certain limitations;

the most important issue is that most of Egyptian

patients are infected with HCV genotype-4 and

the predominant subtype is HCV-4a(47), thus the

obtained results were not fragmented due to in-

clusion of various HCV- genotypes as the patho-

genesis of infection and IFN responsiveness

vary according to genotype(16,39,59,60). On the other

hand, the study encompassed a limited number

of cases. Further studies with larger samples of

patients are required to further add to the validity

of our results, and also studies including other

members of TLR family identified in humans are

required.

REFERENCES:1. Abdoul H, Mallet V, Pol S et al; (2008): Serum alpha-

fetoprotein predicts treatment outcome in chronic hepa-

titis C patients regardless of HCV genotype. PLoS One

3(6): e2391.

2. Ahmad-Nejad P, Ha¨cker H, Rutz M et al; (2002): Bac-

terial CpG-DNA and lipopolysaccharidesactivate Toll-

like receptors at distinct cellular compartments. Eur J

Immunol 32:1958.

3. Akira S, Takeda K (2004): Toll-like receptor signaling.

Nat Rev Immunol 4:499.

4. Akira S, Uematsu S, Takeuchi O (2006): Pathogen rec-

ognition and innate immunity. Cell 124:783.

5. Akuta N, Suzuki F, Kawamura Y et al; (2007): Predic-

tors of viral kinetics to peginterferon plus ribavirin com-

bination therapy in Japanese patients infected with hep-

atitis C virus genotype 1b. J Med Virol 79(11):1686.

6. Alexopoulou L, Holt AC, Medzhitov R et al; (2001):

Recognition of double-stranded RNA and activation of

N F - K B by Toll-like receptor 3. Nature 413:732.

7. Askar E, Bregadze R, Mertens J et al; (2009): TLR3

gene polymorphisms and liver disease manifestations

in chronic hepatitis C. J Med Virol 81: 1204.

8. Bedossa P, Poynard T (1996): An algorithm for the

grading of activity in chronic hepatitis C. The META-

VIR Cooperative Study Group. Hepatology 24:289.

9. Bertoletti A, Gehring AJ (2006): The immune response

during hepatitis B virus infection. Journal of General

Virology 87(6):1439.

10. Biron C A (2001): Interferons _ and _ as immune regu-

lators—a new look. Immunity 14: 661.

11. Blanco P, Palucka A K, Gill M et al; (2001): Induction

of dendritic cell differentiation by IFN-_ in systemic

lupus erythematosus. Science 294:1540.

12. Broering R, Wu J, Meng Z et al; (2008): Toll-like recep-

tor-stimulated non-parenchymal liver cells can reg ulate

hepatitis C virus replication. J Hepatol 48:914.

13. Cheng PL, Eng HL, Chou MH et al; (2007): Ge-

netic polymorphisms of viral infection-associated

Toll-like receptors in Chinese population. Transl Res

150(5):311.

14. Clementi M, Di Gianantonio E (2006): Genetic suscep-

tibility to infectious diseases. Reprod Toxicol 21:345.

15. Dejager L, Libert C (2008): Tumor necrosis factor alpha

mediates the lethal hepatotoxic effects of poly(I:C) in

d-galactosamine-sensitized mice. Cytokine 42(1):55.

16. Dusheiko GM, Schmilovitz-Weiss H, Brown D et al;

(1994): Hepatitis C virus genotypes: an investigation of

type-specific differences in geographic origin and dis-

ease. Hepatology 19:13.

17. El-Zanaty F, Way A (2009): Egypt Demographic and

Health Survey 2008. Cairo, Egypt Ministry of Health,

El Zanaty and Associates, and Macro International.

(Online at: http://dhsprogram.com/pubs/pdf/FR220/

FR220.pdf).

18. Firdaus R, Biswas A, Saha K et al; (2014): Modula-

tion of TLR 3, 7 and 8 Expressions in HCV Genotype

3 Infected Individuals: Potential Correlations of Patho-

genesis and Spontaneous Clearance. BioMed Research

International 2014:Article ID 491064, 7 pages.

19. Gad HH, Dellgren C, Hamming OJ et al; (2009): Inter-

feron-lambda is functionally an interferon but structur-

ally related to the interleukin-10 family. J Biol Chem

284(31): 20869-75.

20. Heil F, Ahmad-Nejad P, Hemmi H et al; (2003): The

Toll-like receptor 7 (TLR7)-specific stimulus loxorib-

ine uncovers a strong relationship within the TLR7, 8

and 9 subfamily. Eur J Immunol 33:2987-2997.

21. Hemmi H, Kaisho T, Takeuchi O et al; (2002): Small

anti-viral compounds activate immune cells via the

TLR7 MyD88-dependent signaling pathway. Nat Im-

munol 3:196.

22. Hemmi H, Takeuchi O, Kawai T et al; (2000): A

Toll-like receptor recognizes bacterial DNA. Nature

408:740.

Zayed, R. A. et al.10

23. Hu K, Wang GW, Wang ZH (2011): TLR9 mRNA ex-

pression and tumor necrosis factor alpha/interleukin-6

secretion in murine microglia by hepatitis C virus stim-

ulation. Zhonghua Yi Xue Za Zhi 91:1070-4.

24. Hu KQ, Kyulo NL, Lim N et al; (2004): Clinical signif-

icance of elevated alpha-fetoprotein (AFP) in patients

with chronic hepatitis C, but not hepatocellular carci-

noma. Am J Gastroenterol 99(5):860.

25. Isaza-Correa J M, Liang Z, van den Berg A et al;

(2014): Toll-like receptors in the pathogenesis of hu-

man B cell malignancies. Journal of Hematology &

Oncology 7:57.

26. Kaisho T, Akira S (2001): Toll-like receptors and their

signaling mechanism in innate immunity. Acta Odontol

Scand 59:124.

27. Kaisho T, Akira S (2003): Regulation of dendritic cell

function through Toll-like receptors. Curr Mol Med

3:373.

28. Kolumam G A, Thomas S, Thompson L J et al; (2005):

Type I interferons act directly on CD8 T cells to allow

clonal expansion and memory formation in response to

viral infection. J. Exp. Med. 202:637.

29. Krishnegowda G, Hajjar AM, Zhu J et al; (2005): In-

duction of proinflammatory responses in macrophages

by the lycosylphosphatidylinositols of Plasmodium fal-

ciparum: cell signaling receptors, glycosylphosphati-

dylinositol (GPI) structural requirement, and regulation

of GPI activity. J Biol Chem 280:8606 .

30. Le Bon A, Etchart N, Rossmann C et al; (2003): Cross-

priming of CD8_ T cells stimulated by virus-induced

type I interferon. Nat. Immunol. 4,1009.

31. Le Bon A, Tough D F (2002): Links between innate and

adaptive immunity via type I interferon. Curr. Opin.

Immunol. 14:432.

32. Lee J, Chuang TH, Redecke V et al; (2003): Molecu-

lar basis for the immunostimulatory activity of guanine

nucleoside analogs: Activation of Toll-like receptor 7.

Proc Natl Acad Sci USA 100:6646.

33. Lee J, Wu C C, Lee K J et al; (2006): Activation of

anti-hepatitis C virus responses via Toll-like receptor 7.

Proc. Natl. Acad. Sci. USA 103:1828–1833.

34. Lindenmann J, Burke D C, Isaacs A (1957): Studies on

the production, mode of action and properties of inter-

feron. Br. J. Exp. Pathol 38:551.

35. Liu F, Lu W, Qian Q et al; (2012): Frequency of TLR

2, 4, and 9 gene polymorphisms in Chinese population

and their susceptibility to type 2 diabetes and coronary

artery disease. J Biomed Biotechnol 2012:373945.

36. Lu KC, Yang HY, Lin YF et al; (2011): The T-1237C

polymorphism of the Toll-like receptor-9 gene is asso-

ciated with chronic kidney disease in a Han Chinese

population. Tohoku J Exp Med 225(2):109.

37. Mangia A, Ricci GL, Persico M et al; (2005): A ran-

domized controlled trial of pegylated interferon al-

pha-2a (40 KD) or interferon alpha-2a plus ribavirin

and amantadine vs interferon alpha-2a and ribavirin in

treatment-naive patients with chronic hepatitis C. J Vi-

ral Hepat 12(3):292.

38. Marrack P, Kappler J, Mitchell T (1999): Type I interfer-

ons keep activated T cells alive. J. Exp. Med.189:521.

39. McHutchison JG, Gordon SC, Schiff ER et al; (1998):

Interferon alfa-2b alone or in combination with ribavi-

rin as initial treatment for chronic hepatitis C. N Engl J

Med 339:1485.

40. Medhi S, Deka M, Deka P et al; (2011): Promoter region

polymorphism & expression profile of toll like recep-

tor-3 (TLR-3) gene in chronic hepatitis C virus (HCV)

patients from India. Indian J Med Res134:200.

41. Mescher M F, Curtsinger J M, Agarwal , et al; (2006):

Signals required for programming effector and memory

development by CD8_ T cells. Immunol. Rev. 211:81.

42. Nagano Y, Kojima Y (1954): Immunizing property of

vaccinia virus inactivated by ultraviolets rays. C. R. Se-

ances Soc. Biol. Fil.148:1700.

43. O’Neill LA, Bowie AG (2007): The family of five:

TIR-domain-containing adaptors in Toll-like receptor

signalling. Nat Rev Immunol 7:353.

44. Parise ER, de Oliveira AC, Conceição RD et al; (2006):

Response to treatment with interferon-alpha and ribavi-

rin in patients with chronic Hepatitis C virus genotypes

2 and 3 depends on the degree of hepatic fibrosis. Braz

J Infect Dis 10(2):78.

45. Pestka S, Krause C D, Walter M R (2004): Interferons,

interferon like cytokines, and their receptors. Immunol.

Rev. 202:8–32.

46. Poynard T, Munteanu M, Colombo M et al; (2011):

FibroTest is an independent predictor of virologic re-

sponse in chronic hepatitis C patients retreated with

pegylated interferon alfa-2b and ribavirin in the EPIC³

program. J Hepatol 54(2):227-35.

47. Ray SC, Arthur RR, Carella A et al; (2000): Genetic

epidemiology of hepatitis C virus throughout Egypt. J.

Infect. Dis 182:698–707.

48. Santini S M, Di Pucchio T, Lapenta , et al; (2002): The

natural alliance between type I interferon anddendritic

cells and its role in linking innate and adaptive immu-

nity. J. Interferon Cytokine Res 22:1071–1080.

49. Sato A, Iwasaki A (2004): Induction of antiviral immu-

nity requires Toll-like receptor signaling in both stro-

mal and dendritic cell compartments. Proc Natl Acad

Sci USA 101:16274.

50. Schröder NW, Schumann RR (2005): Single nucleotide

polymorphisms of Toll-like receptors and susceptibility

to infectious disease. Lancet Infect Dis 5:156.

51. Tanabe M, Kurita-Taniguchi M, Takeuchi K et al;

(2003): Mechanism of up-regulation of human Toll-like

TLRs-SNP and HCV : Response to Therapy 11receptor receptor 3 Secondary to infection of measles

virus-attenuated strains. Biochem Biophys Res Com-

mun 311 : 39.

52. Trinchieri G (2003): Interleukin-12 and the regulation

of innate resistance and adaptive immunity. Nat. Rev.

Immunol.3:133.

53. Trinchieri G (2010): Type I interferon: friend or foe? J.

Exp. Med. 207:2053.

54. Tuite A, Gros P (2006): The impact of genomics on the

analysis of host resistance to infectious disease. Mi-

crobes Infect 8:1647.

55. Turvey SE, Hawn TR (2006): Towards subtlety: under-

standing the role of Toll-like receptor signaling in sus-

ceptibility to human infections. Clin Immunol 120:1.

56. Uematsu S, Akira S (2007): Toll-like Receptors and

Type I Interferons. The Journal of Biological Chemistry

282(21):15319.

57. Visvanathan K, Lewin SR (2006): Immunopathogen-

esis: role of innate and adaptive immune responses.

Semin Liver Dis 26:104.

58. Wei XS, Wei CD, Tong YQ et al; (2014): Single nucleo-

tide polymorphisms of toll-like receptor 7 and toll-like

receptor 9 in hepatitis C virus infection patients from

central China. Yonsei Med J. 55(2):428.

59. Yoshioka K, Kakumu S, Wakita T et al; (1992): Detec-

tion of hepatitis C virus by polymerase chain reaction

and response to interferon alpha therapy: relationship to

genotypes of hepatitis C virus. Hepatology 16:293

60. Zein NN, Rakela J, Krawitt E et al; (1996): Hepatitis

C virus genotypes in the United States: epidemiology,

pathogenicity, and response to interferon therapy. Ann

Intern Me; 125:634.

61. Zhao P, Ma L, Ji , et al; (2015): The Expression of

TLR-9, CD86, and CD95 Phenotypes in Circulating

B Cells of Patients with Chronic Viral Hepatitis B or

C before and after Antiviral Therapy. Mediators of in-

flammation 2015:Article ID 762709, 11 pages.

62. Zhou J, Huang Y, Tian D et al; (2009): Expression of

Toll-like Receptor 9 in Peripheral Blood Mononuclear

Cells from Patients with Different Hepatitis B and C

Viral Loads. J Huazhong Univ Sci TechnolزMed Sciز

29(3):313.

Zayed, R. A. et al.12

تأثير التعدد الشكلى لجين مستقبالت شبيه التول - 9و3 على االصابة بفيروس الكبد الوبائى-سى، االستجابة للعالج و درجة التليف الكبدى بين المرضى المصريين

رانيا زايد – داليا عمران – زينب زكريا - سميرة عزت – سلوى توفيق – حسام السويسى

االصابة بفيروس الكبد الوبائى-سى يعتبر وباء مستمر فى مصر. عرفت مستقبالت شبيه التول بالقيام بدور مهم فى تحفيز الجهاز المناعى لمقاومة االمراض المعدية. فى هذا البحث قمنا بدراسة تأثير التعدد الشكلى لجين مستقبالت شبيه التول - 9و3 على االصابة بفيروس الكبد الوبائى-سى، االستجابة للعالج و درجة التليف الكبدى بين المرضى المصريين. شمل البحث 100 مريض مصاب بفيروس الكبد الوبائى-سى و 100 شخص من األصحاء و المتطابقين في العمر والجنس كعينة ضابطة. تم دراسة التعدد الشكلى الجينى لكل .([TLR-3 (_7 C / A [rs3775296])، TLR-3 (c.1377C / T [rs3775290]) ، TLR-9 (1237T / C [rs5743836 :مناظهر البحث النتائج التالية: ال يوجد اختالف بين المرضى و العينة الضابطة من االصحاء فى نمط التعدد الشكلى لجين مستقبالت شبيه التول TLR-3 (_7 C/A), TLR-3 (c.1377C/T) and TLR-9 (1237T/C) وجود (TLR-3 c.1377 T ) كان مرتبطا بعدم

االستجابة للعالج وله تأثير على تقدم درجة التليف الكبدى فى المرضى المصريين المصابين بفيروس الكبد الوبائى-سى.

ROLE OF PLACENTAL PROTEIN 13 AS A BIOMARKER FOR EARLY

DETECTION OF PRE-ECLAMPSIA. METHYLENETETRAHYDRO

FOLATE REDUCTASE GENE POLYMORPHISM AND RELATION TO

DISEASE RISK, AN EGYPTIAN STUDYEngy El Khateeb* and Sherif Dahab**

ABSTRACT

Objective: to investigate the value of maternal serum Placental Protein 13 (PP13) measurement and uterine

artery indices (Resistance Index (RI) and Pulsatility Index (PI) ) Doppler during first trimester screening as

the prediction of early pre-eclampsia with genotyping for detection of Methylenetetrahydrofolate reductase gene

(MTHFR) polymorphisms (MTHFR677 C/T). Subjects and Methods: Fifty pregnant females were divided into two

groups, twenty five as a control group and twenty five as high risk group; they were subjected to uterine artery

Doppler, measurement of maternal serum (pp-13) and detection of (MTHFR) gene polymorphisms in first trimes-

ter at 11 to 14 weeks of gestation, all pregnancies were followed until 40 weeks for development of pre-eclampsia.

Results: In the cases that developed pre-eclampsia- in both groups- in comparison with un-affected pregnancies it

was noticed that they had low serum level of (PP-13), detection of (MTHFR) gene polymorphisms and higher (PI

and RI) which were of statistically significant difference. Conclusion: Lower level of maternal serum PP-13 in first

trimester, high prevalence of (MTHFR) gene polymorphisms and abnormal increase in uterine artery indices (PI

and RI) are associated with developing pre-eclampsia several months later in pregnancy so they can be used for

early prediction of pre-eclampsia in first trimester.

Departments of Clinical & Chemical Pathology* and Gynecology & Obstetrics**, Faculty of Medicine,

Cairo University

Egypt. J. Lab. Med. Vol.(27) No.3, October, 2015, 13 - 20

INTRODUCTION

Preeclampsia (PE) is a pregnancy-specific

disease defined by new-onset hypertension and

proteinuria after 20 weeks of gestation. It is

present in around 5–10% of all pregnant women

worldwide(5) and is associated with an increased

risk of maternal and fetal morbidity and mortali-

ty, and recently it has been associated with an in-

creased risk of later-life death due to cardiovas-

cular disease for both mother and child(2, 10,12).

Several factors have been suggested to be

involved in the etiology of PE, but there is con-

sensus that the first step in the pathogenesis of

this disease is a defective trophoblastic invasion

early in pregnancy(18), which leads to reduced

placental perfusion and hypoxia(13).

Placental protein 13 (PP-13, galectin-13)

was first isolated in 1983(3,25). It is a homodimer

which is linked by disulfide bonds and has spe-

cial hemostatic and immunobiological functions

at the feto-maternal interface or a developmental

role in the placenta(24)

Placental protein 13 (PP-13) is a member of

the galectin family, predominantly expressed

by the placenta, specifically by the syncytiotro-

phoblast in which it is localized on the brush

border membrane at the maternal fetal interface,

recently maternal serum (PP13) concentrations

were found to be significantly reduced during the

first trimester among women who subsequently

developed pre-eclampsia(24).

Intracellular folate hemostasis depends on

the 5,10-methylenetetrahydrofolate reductase

(MTHFR) gene, which is located at position 36

on the short arm of chromosome 1(27).This gene

codes for the enzyme MTHFR, which catalyses

the irreversible conversion of 5,10-MTHFR to

5-metyltetrahydrofolate, a substrate for methyla-

tion of homocysteine to methionine. 5,10-MTH-

FR C677T is located in the catalytic N-termi-

nal domain of the enzyme, while 5,10-MTHFR

A1298C is located in the regulatory domain of

the enzyme(7).

Biochemically, the 5,10-MTHFR C677T

polymorphism is associated with thermolabil-

ity and reduced enzyme activity. The meta-

bolic consequences are folate deficiency and

mild hyperhomocysteinemia, a risk factor for

thrombotic vascular diseases. It has been sug-

El Khateeb, E. & Dahab, S.14

gested that oxidative stress, platelet aggregation,

and endothelial cell dysfunction contribute to

the vasculotoxicity of homocysteine, and 5,10-

MTHFR polymorphisms have been widely in-

vestigated in relation to a spectrum of several

disease outcomes. Specifically, several studies

have identified maternal 5,10-MTHFR C677T

polymorphisms as obstetric genetic risk factors

for spina bifida, placenta-related vasculopathies,

spontaneous fetal loss, preterm delivery (PTD),

low birth weight (LBW), small for gestational

age (SGA), neuro developmental delays, and

other congenital anomalies (21,15)

Doppler ultrasonography is a non-invasive

method for studying the uteroplacental circula-

tion, provides the capability to qualitatively eval-

uate blood flow in small branches of the uterine

arteries, in normal pregnancy, impedance to flow

in the uterine arteries decreases with gestation,

however in cases of impairment of trophoblas-

tic invasion, doppler studies showed increased

impedance to flow in the uterine arteries as they

failed to develop into low resistance vessels (20,4).

The aim of this work was to assess uterine

artery Doppler and maternal serum placental

protein 13(PP-13) indices as early predictors for

pregnancy induced hypertension of occurrence

of pre-eclampsia and detection of MTHFR gene

polymorphisms in those patients.

SUBJECTS AND METHODS.

This prospective observational case-control

study was performed in Obstetrics and Gynecol-

ogy Department Kasr El Aini Maternity Hospi-

tal (Cairo University). It was conducted on 50

pregnant females who were recruited from the

Antenatal Care Clinic in Kasr El Aini Maternity

Hospital.

Fifty pregnant females were divided into two

groups, twenty five as a control group and twen-

ty five as high risk group; they were subjected

to uterine artery Doppler, measurement of ma-

ternal serum (PP-13) and detection of (MTHFR)

gene polymorphisms in first trimester at 11 to

14 weeks of gestation, all pregnancies were fol-

lowed until 40 weeks for development of pre-

eclampsia.

PP13 ELISA Assay:

- Blood samples were collected with all

aseptic precautions from all study subjects, Sam-

ples were centrifuged and serum was separated

and stored at -20 degrees Celsius until analysis.

- The blood samples were cooled and

centrifuged immediately after collection

and the erythrocytes removed. Serum PP-13

level was determined by enzyme linked im-

mune sorbent assay (ELISA) kit (Cusabio,

USA).

- Detection of (MTHFR677 C/T) polymor-

phisms by PCR-RFLP:

- Three ml of blood were withdrawn from

all the subjects included in the study in a sterile

ethelenediaminetetraacetic acid (EDTA) vacu-

tainer. DNA was extracted from the whole blood

using DNA extraction kit. (QIAamp Blood Kit

(Cat. No. 51106; Qiagen Inc., Valencia, CA) ac-

cording to the manufacturer’s instructions.

- The method described by Frosst et

al.1995, was used for detection of the 677 C→

T polymorphism. A length of 198 base pairs on

exon 4 of the MTHFR gene was amplified us-

ing (5’ TGA AGG AGA AGG TGT CTG CGG

GA 3’) as the forward primer and (5’ AGG ACG

GTG CGG TGA GAG TG 3’) as the reverse

primer.

- The C to T polymorphism at codon 677

introduces a restriction site for enzyme Hinf 1.

The PCR was carried out in a total volume of

25 µL containing about 200 ng/ml DNA, 2 µl

of 2.5 mM of each of the dNTP’s, 0.5 µl of 25

mM MgCl 2 , 10 pmol of both primers and 0.5 U

Taq polymerase. PCR cycling conditions were:

an initial denaturation step at 94°C for 5 min-

utes, and 30 cycles of the following: 94°C for

1 minute, 57°C for 1 minute, and 72°C for 15

seconds. This was followed by a 10 minute ex-

tension at 72°C. Restriction digestion with Hinf

1 (Fermentas, INC, USA) was carried out on 2 µl

buffer, 1 µl Hinf 1, and 8 µl of PCR amplicons

incubated at 37°C for 4 to 6 hours. The digested

fragments were separated on 2.5% agarose gel

electrophoresis stained with ethidium bromide.

The electrophoretic pattern was visualized un-

PP-13 MTHFR Gene Polymorphism and Pre-eclampsia 15

der UV light then photographed using a Pola-

roid camera with a red orange filter. Wild type

(677CC) showed a single band at 198 bp. The

presence of the ‘T’ allele introduces a cut among

heterozygous (677 CT) and three bands of 198

bp, 175 bp and 23 bp were seen. The homozy-

gous (677 TT) had two bands of 175 bp and 23

bp. The size of the amplified product was read

with the use of a DNA ladder of different mo-

lecular weights (fermentas, No Limits™ 100 bp

DNA Fragment, catalogue number SM1441).

Ultrasonography assessment:

- The ultrasound equipment used for

both vaginal sonography and colour Doppler

technique was Elegra (Siemen) ,trans-vaginal

6.5 MHZ ultrasound with pulsed and colour

Doppler . the high pass filter was set at 50-

100 HZ and the pulse repetition frequency

ranged between 1000-2000 HZ.

- Each woman underwent a trans-vag-

inal ultrasonography examination including

colour Doppler techniques to assess the fol-

lowing data:

- Gestational age was determined from

the onset of the normal period , measurement

of the crown –rump length(CRL) was done

to confirm the fetal gestational age , fetal viabil-

ity and careful search for any fetal abnormalities

beside to the resistance index (RI) and pulsative

index (PI) in the uterine arteries both side

right and left .

- All the scans were performed by the

same ultrasound machine by senior staff that

has extensive experience in early first trimester

scans.

- Uterine arteries were seen as aliasing

vessels at the level of the cervical-corporeal

junction with the colour Doppler technique ,and

blood velocity waveform were obtained by

placing the Doppler gate over the coloured

areas and activating the pulsed Doppler func-

tion .angel correction was then applied and

the signal updated until at least four consec-

utive flow velocity wave form of good quality

were obtained then the RI and PI of the right

and left arteries was calculated to determine

the vascular resistance. The presence or absence

of an early diastolic notch in the flow profile

of uterine arteries was noted and determined

if unilateral or bilateral was recorded. All cases

were followed until termination of pregnancy to

detect the development of hypertensive disor-

ders of pregnancy by serial clinical examination,

blood pressure measurement and, urinary pro-

teins.

Statistical Analysis

- Data were statistically described in term

of range, mean and standard deviation. Numerical

data were analysed by using unpaired student`s

T test. Non parametric data were analysed using

(Mann Whitney test) (for independent samples).

P value less than 0.05 was considered statisti-

cally significant, Receiver Operator Character-

istic (ROC) analysis was used to determine the

optimum cut-off value for the studied diagnostic

markers.

RESULTS

The current study was carried out on 50 preg-

nant females divided into two groups, twenty

five as a control group and twenty five as high

risk group.

The high risk group age ranged between 23 to

35 years with a mean value of 28.5±3.58. Control

group age ranged between 21 And 39 years with

a mean of 28.4±4.4. The gestational age of high

risk group ranged between 11-13.5 weeks with

a mean of 12.0+ 1.01. Control group gestational

age ranged between 10-14 weeks with a mean

of 11.9 ± 0.79. There were no statistically

significant differences between the 2 groups as

regards age (p value >0.05) or gestational age (p

value >0.05).

Two cases out of the 25 control cases devel-

oped pre eclampsia (PE) while 23 cases didn’t

develop PE.

Four cases out of the 25 high risk group cases

developed PE while 21 cases didn’t develop PE.

As regards the PP13 results of control sub-

jects, in the PE group the PP13 index was (27.5

±3.535) Pg/ml and in the non PE group it was

(231.13±67.1) Pg/ml, by comparing the two

groups P value was < 0.0001 which is of highly

significant difference .

El Khateeb, E. & Dahab, S.16

Table (1): Comparison between Control subjects and high risk subjects regarding Doppler ultrasonography results

Control

Subjects

High Risk

Subjects

PE

( n= 2 )

Range

(mean+SD)

NO –PE

( n=23 )

Range

(mean+SD)

P-value

PE

(n=4 )

Range

(mean+SD)

NO – PE

( n=21 )

Range

(mean+SD)

P-value

Right

mean uterine artery

RI

0.79-0.81

(0.8±0.01)

0.6-0.79

(0.72±0.04)0.0109

0.77-0.79

(0.78± 0.01)

0.62-0.79

(0.72± 0.05)0.0276

Left mean

uterine artery RI

0.85 -0.9

(0.87± 0.03)

0.6-0.88

(0.72± 0.08)0.0163

0.8-0.83

(0.81± 0.01)

0.56-0.81

(0.72±0.07)0.0190

Right mean

uterine artery PI

2.32-2.34

(2.33±0.01)

0.96-2.2

(1.44± 0.3)0.0004

2.2-2.4

(2.3± 0.05)

1.02-1.9

(1.59± 0.34)0.0004

Left mean uterine

artery PI

2.32-2.34

(2.33±0.01)

0.96-1.6

(1.37± 0.17)0.0001 1.62-2.01 (1.83±0.16)

1.2-2.1

(1.52±0.29)0.0514

P value < 0.05 is considered significant

PE: Pre-eclampsia

RI: Resistance Index

PI: Pulsatility Index

Table (2): Genotype and allele frequencies in high risk and control groups for MTHFR 677C→T and

MTHFR 1298 A→C polymorphisms

Genotypes, alleles High risk group

(n=25)

Control group

(n=25)

OR(95%CI) P value

MTHFR677

-CC

-CT

-TT

-C allele

-T allele

15(60%)

5(20%)

5(20%)

35(46.6%)

15(20%)

21(84%)

3(12%)

1(4%)

91(60%)

5(6.6%)

0.154(0.034-0.546)

2.4(1.00-13.5)

6.3(1.15-8.76)

0.002[S]

0.032[S]

0.028[S]

0.024[S]

→0.0001[HS]

PP-13 MTHFR Gene Polymorphism and Pre-eclampsia 17

As regards the PP13 results of high risk group

cases, In the PE group the PP13 index was (25.2

± 4.20) pg./ml in comparison with non-PE group

PP13 level which was (140.4 ± 57.09) pg./ml

with p value < 0.0035 which was of significant

difference .

The results of Doppler assessment regarding

high risk group and control cases were summa-

rized in the tables from table 1.

The P values of comparing the right and

left uterine arteries PI & RI indices in high risk

group and control group were <0.05 with highly

significant differences.

The results of genotype and allele frequen-

cies in high risk and control groups for MTHFR

677C→T and MTHFR 1298 A→C polymor-

phisms are summarized in table 2.

The results showed significant difference be-

tween high risk and control groups in CC, CT

and, TT alleles of MTHFR gene (p values 0.002,

0.032 and 0.028 respectively).

The results showed also significant difference

and highly significant difference between high

risk and control groups in frequencies of C allele

and T allele in MTHFR gene (p values 0.024 and

0.0001 respectively).

DISCUSSION

Pre-eclampsia is a disorder of pregnancy

characterized by high blood pressure and large

amounts of protein in the urine. Though present

in the majority of cases, protein in the urine

need not be present to make the diagnosis of

preeclampsia(16,6).

There are a host of contributing and related

factors that complicate finding a precise mecha-

nism for preeclampsia(22). These include immu-

nologic, hematologic, genetic, and environmen-

tal factors. Central to the effects of preeclampsia

are the resulting presence of uteroplacental hy-

poxia, an imbalance in angiogenic and anti-an-

giogenic proteins, oxidative stress, maternal

endothelial dysfunction, and elevated systemic

inflammation(22,1).

We are concerned in our study with serum

level of PP13 and uterine arteries Doppler evalu-

ation as first trimester marker for predicting

the occurrence of preeclampsia and screening

of genotype and allele frequencies in patients

and control groups for MTHFR 677C→T and

MTHFR 1298 A→C polymorphisms.

In our study we had two groups: control

group (n=25) and high risk group (n=25) in

control group two patients (n=2) developed pre-

eclampsia (8%) and other patients didn’t develop

it; serum PP13 level showed highly statistically

significant difference p<0.0001.

In high risk group comparing serum PP13

level in patients who developed preeclampsia

(n=4), (16%) and patients who didn’t develop it

(n=21) there was highly statistically significant

difference between both of them p<0.003. So it

was observed that serum level of PP13 was low

in patients developed preeclampsia comparing

with other patients who didn’t develop it in both

groups (control group and high risk group)

A prospective observational study was done

by maternal blood testing at 6-10 gestational

weeks demonstrated significantly decreased se-

rum level PP13 in women who developed pre-

eclampsia several months. Later, with sensitivity

80% and P<0.001 and it is possible that if com-

bined with other variables such as BP, maternal

history, and uterine artery Doppler flow velocity

may have prediction in low risk population(19).

Another study showed that PP13 declined

with maternal weight and was lower in in vitro

fertilization. Levels were converted into mul-

tiples of the median (MoMs) accordingly. In

twins, the median was 1.74 MoM (n=76) vs.

1.00 in singletons (n=676, P<0.0001). Among

twins with severe PE (n=10), the median was

1.53 MoM vs. 1.74 in unaffected twins (P=0.10),

and 2.26 (n=6) for mild PE (P=0.30). Among

singletons with severe PE, the median was 0.44

MoM (n=26, P<0.0001), and for mild PE 0.62

(n=17, P<0.001)(23).

In our study, Doppler of uterine arteries were

chosen as they were the most common arter-

ies used to evaluate utero-placental circulation

in pregnancy through analysis of uterine artery

flow velocity wave form for prediction of pre-

eclampsia.

In control group it showed that right and left

El Khateeb, E. & Dahab, S.18

uterine arteries RI were higher in women who

developed pre-eclampsia than those with normal

outcome ( P = 0.0109 and 0.0163 respectively)

which is statistically significant.

As for high risk group also right and left uter-

ine arteries RI were high in women developed

pre-eclampsia in comparison with women who

did not develop it ( P= 0.027 and 0.0190 respec-

tively) which were found to be highly statisti-

cally significant.

In control group there was highly statistically

significant difference between pre-eclampsia

group (who developed pre-eclampsia) and nor-

mal group (who did not develop it) regarding to

right and left uterine arteries PI ( P=0.0004 and

0.0001 respectively).

Examination of 3058 patient, using T.V.S

uterine artery Doppler at 11-14 weeks with

singleton pregnancies was done, this study has

found that presence of pre-eclampsia because

of high prevalence of this finding in normal

pregnancies(45%) with low specificity (55%),

sensitivity (55%)(11) and this finding is consistent

with pervious study which concluded that early

diastolic notch was unlikely to be useful screen-

ing for pregnancy complications(8,9)

In our study early diastolic notch was not re-

corded except in two patient in high risk group

which was statistically insignificant as P value

was <0.05, with specificity 35% and sensitivity

22%, we have no clear explanation for this find-

ing but may be our sample size was limited in

comparing with other studies numbers (11)

More recent studies showed comparable re-

sults, they had larger studies including 1091,

384, 1123 singleton pregnancies for routine pre-

natal ultrasound examination at 11-14 weeks of

gestation, as regarding the prognostic value of

unilateral / bilateral uterine artery notching in

predicting of pre-eclampsia(14).

In our study we revealed that significant asso-

ciations were detected between MTHFR C677T

polymorphism and risk of PE in patients vs. con-

trols for CC (OR = 0.154, 95% CI:0.034-0.546),

CT (OR = 2.4, 95% CI: (1.00-13.5)), and TT ge-

netic model (OR = 6.3, 95% CI: 1.15-8.76).

A recent study revealed that significant asso-

ciations were detected between MTHFR C677T

polymorphism and risk of PE in the overall

population for TT vs. CC (OR = 1.280, 95% CI:

1.074-1.525), recessive model (OR = 1.264, 95%

CI: 1.067-1.303), and dominant genetic model

(OR = 1.174, 95% CI: 1.057-1.303); in Cauca-

sian population for dominant model (OR = 1.136,

95% CI: 1.022-1.263), and in East Asia popula-

tion for TT vs. CC (OR = 2.199, 95% CI: 1.366-

3.924) CT vs. CC (OR = 1.453, 95% CI: 1.001-

2.109), recessive model (OR = 1.742, 95% CI:

1.202-2.525), and dominant model (OR = 1.783,

95% CI: 1.271-2.501). Conversely, no asso-

ciations were detected in Latin America, South

Asia, and Africa populations(26).

Xia et al., 2013 discussed a number of stud-

ies that investigated the association between

the methylenetetrahydrofolate reductase (MTHFR)

C677T polymorphism and the risk of pre-eclamp-

sia (PE) in various populations and have deliv-

ered inconsistent results. Therefore, this meta-

analysis of 36 case-control studies, comprising

4253 PE cases and 4950 controls, were assessed

to evaluate a possible association. The pooled

results showed that the MTHFR C677T poly-

morphism was significantly associated with PE

(P=0.03, odds ratio (OR)=1.25, 95% confidence

interval (CI)=1.02-1.54, for the additive compar-

ison; P=0.04, OR=1.14, 95% CI=1.01-1.29, for

the dominant genetic model). The results of the

subgroup analysis showed that MTHFR 677T

had the effect of increasing the PE risk for the

recessive genetic model (P<0.0001, OR=1.76,

95% CI=1.33-2.33, P(heterogeneity)=0.28), the

additive comparison (P=0.002, OR=2.09, 95%

CI=1.31-3.31, P(heterogeneity)=0.08) and allele

contrasts (P=0.03, OR=1.42, 95% CI=1.04-1.95,

P(heterogeneity)=0.0001) in the Asians, while

no evidence of an association between MTHFR

C677T polymorphisms and PE was observed in

the Caucasians. This meta-analysis suggests that

the MTHFR C677T polymorphism is capable of

causing PE susceptibility in the Asians but not in

the Caucasians(28).

Another study revealed that the frequency

of combined genotypes of MTHFR CT and TT

(CT+TT) and T allele tended to be higher in se-

PP-13 MTHFR Gene Polymorphism and Pre-eclampsia 19

vere preeclamptic women compared to controls.

A significantly higher level of triglycerides was

observed in the presence of combined geno-

types of MTHFR CT and TT in pre eclamptic

women compared to controls with the same

genotype(17).

Finally in our study we confirmed the poten-

tial role of serum Placental Protein 13(PP-13) in

combination with uterine arteries Doppler indices

(PI and RI), as early predictors of pre-eclampsia

in first trimester of pregnancy and that there is an

association between the MTHFR C677T poly-

morphism and susceptibility to preeclampsia

REFERENCES 1.Al-Jameil (2013) : “A Brief Overview of Preeclampsia”.

Journal of Clinical Medicine Research.

2. Bellamy L., Casas J.-P., Hingorani A. D. et al 2007: “Pre-

eclampsia and risk of cardiovascular disease and cancer

in later life: systematic review and meta-analysis,” Brit-

ish Medical Journal,: 335, 7627,. 974.

3. Bohn H, Kraus W, Winckler W et al 1983: Purification

and characterization of two new soluble placental tissue

proteins (PP13 and PP17): Oncodev Biol Med ; 4:343.

4. Dugoff L, Hobbins JC, Malone FD, et al 2004: First-

trimester maternal serum PAPP-A and free-beta sub-

unit human chorionic gonadotropin concentrations

and nuchal translucency are associated with obstetric

complications: a population-based screening study (the

FASTER Trial). Am J Obstet Gynecol ; 191:1446.

5. Duley L., 2009 “The Global Impact of Pre-eclampsia and

Eclampsia,” Seminars in Perinatology: 33, 3, 130.

6. Eiland, Elosha et al. 2012; Nzerue, Chike; Faulkner, Mar-

quetta. “Preeclampsia ”. Journal of Pregnancy 2012: 1.

7. Friso S, Choi SW, Girelli D, et al. 2002: A common mu-

tation in the 5,10-methylenetetrahydrofolate reductase

gene affects genomic DNA methylation through an in-

teraction with folate status. Proc Natl Acad Sci USA.;

99: 5606.

8. Gomez O, Martinez JM, Figueras F, et al. 2005 Uterine

artery Doppler at 11–14 weeks of gestation to screen for

hypertensive disorders and associated complications in

an unselected population. Ultrasound Obstet Gynecol;

26:490.

9. Martin AM, Bindra R, Curcio P, et al. 2001 Screening for

pre-eclampsia and fetal growth restriction by uterine

artery Doppler at 11-14 weeks of gestation. Ultrasound

Obstet Gynecol ; 18:583.

10. McDonald, A. Malinowski S.D., Zhou,S. et al. 2008

“Cardiovascular sequelae of preeclampsia/eclampsia: a

systematic review and meta-analyses,” American Heart

Journal, :. 156. 5, 918.

11. Melchiorre K, Wormald B, Leslie K, et al. 2008 First-

trimester uterine artery Doppler indices in term and

preterm pre-eclampsia. Ultrasound Obstet Gynecol. ;

32:133.

12. Mongraw-Chaffin M. L., Cirillo P. M., and Cohn B. A.,

2010: “Preeclampsia and cardiovascular disease death:

prospective evidence from the child health and devel-

opment studies cohort,” Hypertension, 56, 1,. 166.

13. Pijnenborg R., Vercruysse L., and Brosens I., 2011

“Deep placentation,”Best Practice and Research : 25,

3, 273.

14. Pilalis A, Souka P, Antsaklis P, et al. 2007: Screening

for pre-eclampsia and fetal growth restriction by uter-

ine artery Doppler and PAPP-A at 11–14 weeks’ gesta-

tion. Ultrasound Obstet Gynecol ; 29:135.

15. Pilsner JR, Hu H, Wright RO, et al. 2010: Maternal

MTHFR genotype and haplotype predict deficits in ear-

ly cognitive development in a lead-exposed birth cohort

in Mexico City. Am J Clin Nutr.; 92:226.

16. Pregnancy, developed by the Task Force on Hyperten-

sion in (2013). Hypertension in pregnancy..

17. Rahimi Z, Malek-Khosravi S, Rahimi Z, et al. 2013

Clin Biochem. Jan;46(1-2):143.

18. Rauramo I. and Forss M., 1988 “Effect of exercise on

placental blood flow in pregnancies complicated by hy-

pertension, diabetes or intrahepatic cholestasis,” Acta

Obstetricia et Gynecologica Scandinavica, : 67, 1,. 15.

19. Romero R, Nien JK, Espinoza J, et al 2008: A longitu-

dinal study of angiogenic (placental growth factor) and

anti-angiogenic (soluble endoglin and soluble vascular

endothelial growth factor receptor-1) factors in normal

pregnancy and patients destined to develop preeclamp-

sia and deliver a small for gestational age neonate. J

Matern Fetal Neonatal Med , 21:9.

20. Schutte JM, Schuitemaker NW, van RJ, Steegers EA et

al. 2008: Substandard care in maternal mortality due to

hypertensive disease in pregnancy in the Netherlands

BJOG ; 115:732.

21. Sohda S, Arinami T, Hamada H, et al. 1997 Methylene-

tetrahydrofolate reductase polymorphism and pre-ec-

lampsia. J Med Genet.;34:525.

22. Steegers, Eric AP; von Dadelszen, et al. 2010 “Pre-ec-

lampsia”. The Lancet : 376 (9741): 631.

23. Svirsky R, Meiri H, Herzog A, et al. 2013 Perinat Med.

Sep 1;41(5):561.

24. Than NG, Pick E, Bellyei S, et al. 2004: Functional

analyses of placental protein 13/galectin-13: Eur J Bio-

chem 271:1065.

25. Visegrady B, Than NG, Kilar F, et al. 2001 : Homology

modelling and molecular dynamics studies of human

placental tissue protein 13 (galectin-13) at al (2001) :

Protein Eng ; 14:875.

El Khateeb, E. & Dahab, S.20

26. Wang XM, Wu HY, Qiu et al. 2013 Med Res.

Apr;44(3):159.

27. Weisberg I, Tran P, Christensen B, et al.1998 second

genetic polymorphism in methylenetetrahydrofolate re-

ductase (MTHFR) associated with decreased enzyme

activity. Mol Genet Metab. ;64:169.

28. Xia XP, Chang WW, Cao YX. 2012., Hypertens Res.

Dec;35(12):1129.

دور البروتين المشيمى 13 فى االكتشاف المبكر لتسمم الحمل وعالقة تعدد الشكل الجينى

للمثيلينهيدروفوالت ريدكتيز وعالقته بخطر حدوث المرض (دراسة مصرية)

انجى الخطيب – شريف دهب

الرحمي الشريان مؤشرات وقياس (PP13) األم دم في 13 المشيمي البروتين قيمة لفحص البحث يهدف للتنبؤ الحمل من شهور ثالث أول دوبلرخالل خالل من ((Pulsatility (PI ومؤشر (RI) المقاومة (مؤشر .(MTHFR) (MTHFR677 C / T) تتراهيدروفوالت للميثيلين الجيني التنميط مع الحمل تسمم قبل بما المبكر

قد و ؛ الخطر مجموعة وعشرين وخمسة مراقبة كمجموعة وعشرين خمسة مجموعتين، إلى الحوامل اإلناث تقسيم تم

الثالثة األشهر في (MTHFR) ل الجينية األشكال عن والكشف (13 (بروتين وقياس الرحمي، للشريان الدوبلر عمل تم الحمل. تسمم الكتشاف أسبوعا 40 حتى الحمل حاالت جميع متابعة وتم الحمل، من أسبوعا 14 إلى 11 بين األولىما تم التوصل الى انه في الحاالت التي اصيبت بeclampsia-pre في كل المجموعات بالمقارنة مع الحاالت التي لم تصاب لوحظ أن لديهم انخفاض مستوى (PP-13)، و األشكال الجينيه ل (MTHFR) وارتفاع (PI و RI) و التي كانت بفروق ذات داللة إحصائية.الخالصة: انخفاض مستوىPP-13 في األشهر الثالثة األولى، و ارتفاع معدل انتشاراألشكال الجينيه ل (MTHFR) وزيادة غير طبيعية في مؤشرات الشريان الرحمي (PI وRI) مع حدوث ما قبل تسمم الحمل بعد عدة أشهر في الحمل حتى أنها يمكن أن تستخدم للتنبؤ المبكر

للتسمم الحملي في الثلث األول من الحمل.

CORD BLOOD COPEPTIN AND CALPROTECTIN AS POTENTIAL BIOMARKERS OF EARLY-ONSET NEONATAL SEPSISManal Mohsen*, Wafaa K.Zaki**, Rania Ismail***, Nehal El-Raggal***

and Mohamed A. Abd El-Wahed***

ABSTRACTBackground: The correct diagnosis of neonatal sepsis is a relevant problem because sepsis is one of the most important

causes of neonatal morbidity, mortality, and prolonged hospital stay. Therefore, early diagnosis and treatment of neonates

with suspected infection is crucial to prevent life threatening complications. New infection markers may potentially improve

guidance of therapeutic decisions. Copeptin and Calprotectin are two markers which have been recently demonstrated to be

strongly elevated in samples from adult patients with sepsis. However a few reports are available in neonates and pediatric

patients. Objective: The aim of this study was to investigate the clinical utility of assaying cord blood copeptin and calprotectin

as markers of early-onset neonatal sepsis. Subjects and Methods: This case control study comprised 138 newborn infants with

gestational age of 28-40 weeks and birth weights between 1500 and 4100 grams, delivered between February 2014 and Janu-

ary 2015 at the Maternity Departments of Manshiet El-Bakry and Ain Shams University Hospitals, Cairo, Egypt, They were

transferred to the Neonatal Intensive Care Unit (NICU) of the hospital because of having at least one risk factor for suspicion of

neonatal sepsis. On the basis of clinical observation over their first 5 postnatal days and sepsis work-up results, into 2 groups:

Early onset neonatal sepsis (EOS) group (n=78) and non-septic control group (n=60). For all included population, two cord

blood samples were collected for blood culture , and assay for Copeptin and Calprotectin by competitive and sandwich enzyme

immunoassays (EIA), respectively. Results: Results of both inflammatory markers were significantly higher in septic neonates

than controls [median copeptin concentration in cord blood was 212 (IQR 95 – 537) vs. 82(60 – 125) pg/mL, and median

calprotectin concentration was 4.6(4.0-9.1) vs. 0.93(0.7-2.0) ng/mL for calprotectin, respectively; p<0.001 for both]. Levels

of copeptin and calprotectin did not associate with CRP results, only calprotectin levels associated with culture positivity,

however, both tests significantly correlated with Rodwell’s score indicating that they are good diagnostic tests for early-onset

septicemia. Moreover, copeptin and calprotectin levels were significantly associated with patients’ outcome. Receiver-operat-

ing-characteristic (ROC) curve analysis showed that copeptin cord blood concentrations were strongly associated with EOS:

sensitivity of 73.3%, a specificity of 100%, positive predictive value (PPV) of 100%, negative predictive value (NPV) of 87.5%

and efficacy 81%. ROC curve for calprotectin showed 100%, sensitivity and 97.5%, specificity. PPV is 98%, NPV is 100% and

efficacy is 98.9%. Conclusion: the current study reveals that copeptin and calprotectin may be considered two promising sensi-

tive and specific predictors for EOS. Keywords: neonatal sepsis, neonatal infection, EOS, copeptin, calprotectin.

Departments of Clinical Pathology*, Medical Microbiology and Immunology**, Pediatrics***

Faculty of Medicine , Ain Shams University

Egypt. J. Lab. Med. Vol.(27) No.3, October, 2015, 21 - 30

INTRODUCTION

Sepsis is one of the most important causes

of neonatal morbidity, mortality, and pro-

longed hospital stay, particularly in preterm,

due to their immature immune response and

exposure to infectious risks in neonatal inten-

sive care units (NICUs) (11,5). In this issue, an

early diagnosis becomes crucial as signs of

sepsis in the newborn are nonspecific(15,19).

Blood culture remains the gold standard test

for diagnosis of neonatal sepsis. However, the

results of blood culture are not available before

24–48 h and there are possible false negative

responses in many instances. For this reason,

a broad spectrum of inflammatory markers has

been proposed for the diagnosis of neonatal sep-

sis (10).

Copeptin is a novel neuroendocrine peptide. It

is 39 amino acids glycopeptides co-synthesized

with arginine vasopressin (AVP) and released

together in stoichiometric pattern from the hypo-

thalamus upon stimulation of AVP release. Due

to difficulties of AVP assay, copeptin largely re-

placed it in clinical assay as surrogate biomarker

because copeptin has easier and more valid mea-

surement methods. In acute stress condition, co-

peptin rises and reflects stress level exactly like

AVP which was largely known as a mediator of

non-specific stress conditions(1).

Calprotectin is antimicrobial, calcium

and zinc binding heterocomplex protein. It

is contained in the cytosol fraction of innate

immunity cells and released immediately

after host-pathogen interaction. For this it

Mohsen, M. , et al.22

has been used as a nonspecific marker for

activation of granulocytes and mononuclear

phagocytes(27,20). In addition to protecting

cells against microorganisms, calprotectin

regulates adhesion of leukocytes to the en-

dothelium and extracellular matrix during

the inflammatory process(28). So calprotectin

has been proposed for the diagnosis of in-

flammatory conditions.

Aim of the Work

The aim of this study was to investigate

the clinical utility of assaying cord blood co-

peptin and calprotectin as markers of early-

onset neonatal sepsis.

SUBJECTS AND METHODS

I. Subjects:

The study series comprised 138 newborn in-

fants with gestational age of 28-40 weeks and

birth weights between 1500 and 4100 grams,

delivered between February 2014 and January

2015 at the Maternity Departments of Manshiet

El-Bakry and Ain Shams University Hospitals,

Cairo, Egypt, They were transferred to the Neo-

natal Intensive Care Unit (NICU) of the hospital

because of having at least one risk factor for sus-

picion of neonatal sepsis (prolonged premature

rupture of membranes > 24 hr, premature onset of

labour, chorioamnionitis or peripartum maternal

fever). EOS cases were defined as neonates who

presented with sepsis within the first 72 hours

of life as defined by the following criteria(25) : i)

at least two clinical signs of sepsis (temperature

instability, irritability or apathy, feeding diffi-

culties, poor capillary refill >2 seconds, apnea,

tachycardia and/or tachypnea); ii) elevated C-

reactive protein >20 mg/L, iii) decision of the

attending physician to treat for at least 7 days

with intravenous antibiotics and iv) recovery of

bacterial pathogens in blood-culture. In infants

with negative blood cultures but clinical diag-

nosis of EOS, all first three criteria mentioned

above were required to be present.

Exclusion criteria:

• Maternal diabetes or pre-eclampsia.

• Chromosomal abnormalities or major

congenital malformations.

• Inborn error of metabolism.

Cord blood samples were withdrawn imme-

diately at birth for determination of:

a. Complete blood counts (CBC) with dif-

ferential smear: usingABX Micros 60 cell coun-

ter (ABX DIAGNOSTICS, Rue du caducée,

ParcEuromédecine, Montpellier Cedex, France)

b. Semiquantitative measurement of serum

C-reactive protein (CRP) concentration, using

latex agglutination test using the AVITEX CRP

commercial kit (Omega Diagnostics Ltd, NOVA

Century Scientific, South Service Road, Burl-

ington, Ontario)

c. Blood culture for isolation of pathogenic

microorganisms.

d. Measurement of copeptin and calprotec-

tin concentrations by enzyme immunoassays us-

ing commercially available copeptin (Human)

EIA Kit (Phoenix Pharmaceuticals, Inc.Beach

Rd., Burlingame, California, USA) and Calpro-

tectin ELISA Kit (MRP 8/14) (Immundiagnostik

AG Stubenwald-Allee, Bensheim, Germany),

respectively.

The neonates were assigned retrospectively,

on the basis of clinical observation over their

first 5 postnatal days and sepsis work-up results,

into 2 groups:

1. Early Onset Neonatal Sepsis group (EOS) (n=78):

Cases diagnosed in the first 72 hours of life

according to the clinical score of Tollner, and

hematological score of Rodwell . They were

31 (39.8%) males and 47 (60.2%) females; 19

(24.4%) were delivered vaginally and 59 (75.6%)

by cesarian section. They had a mean gestational

age of 32.0 ±3.6 weeks, and a mean birth weight

of 2845±766 grams.

2. No infection, (non-septic) Control group (n=60):

Infection was ruled out on both clinical and

laboratory basis. They were 22 (36.7%) males and

38(63.3%) females; 16(26.7%) were delivered

vaginally and 44 (73.3%) by cesarian section.

They had a mean gestational age of 36.55±3.88

weeks, and a mean birth weight of 3217±569

grams. They served as a control group.

Cord Blood Copeptin and Calprotectin in Neonatal Sepsis 23

Procedure of blood sampling:

An informed written consent was taken from

the parents before enrollment of neonates in this

study. Cord blood samples were collected under

complete aseptic conditions immediately after

birth. The collected blood was divided among a

blood culture bottle, an EDTA tube for complete

blood counts, and a plain test tube for serum sepa-

ration. Blood withdrawn into the plain tubes were

allowed to clot for 30 minutes before centrifuga-

tion for 15 minutes at approximately 1000xg. Se-

rum was separated, for immediate assessment of

C-reactive protein and stored at -20oC for the assay

of copeptin and calprotectin. Hemolysed samples

were discarded, repeated freezing and thawing

was avoided.

Procedure of blood culture:

Using a signal blood culture system (oxoid),

the formulation of medium enhances the growth

of aerobic, anaerobic, micro-aerophilic and fungi.

Two sets of blood culture were drawn from each

patient under complete aseptic condition. The

medium were designed to create pressure in se-

lected bottle when organisms are growing caus-

ing displacement of blood /broth mixture into the

chamber as assign of microbial activity. Examina-

tion of blood culture bottle was done every other

day, any bacterial growth was identified by sub-

culture on solid blood agar, Mac-Conkey agar and

Sabouraud,s dextrose agar(SDA) . isolates were

identified on the basis of conventional identifica-

tion methods described in Colle et al (1996) based

on colonial morphology , microscopic examina-

tion of Gram stained films and biological activity

of isolated strain(9).

Principle of Copeptin and Calprotectin en-zyme immunoassays (EIA):

The assay of copeptin is based on a competi-

tive immunoassay technique. In this technique,

the immunoplate is pre-coated with secondary

antibody and the nonspecific binding sites are

blocked. The secondary antibody can bind to the

Fc fragment of the primary antibody (peptide an-

tibody) whose Fab fragment would be competi-

tively bound by both biotinylated peptide and

peptide standard or targeted peptide in samples.

The biotinylated peptide interacts with strepta-

vidin – horseradish peroxidase (SA-HRP) which

catalyzes the substrate solution. The intensity of

the yellow is directly proportional to the amount

of the biotinylated peptide-SA-HRP complex but

inversely proportional to the amount of the pep-

tide in the standard solutions or samples. This is

due to the competitive binding or samples to the

peptide antibody (primary antibody).

The assay of calprotectin utilizes the two-site

“sandwich” technique. Standards, controls and

prediluted (1:50) serum samples are added to the

wells of a microplate coated with a high affinity

monoclonal anti-human calprotectin antibody.

During the first incubation step, Calprotectin in

the samples is bound by the immobilized anti-

body. Then a peroxidase labeled conjugate is

added to each well and the following complex

is formed: capture antibody - human calprotectin

– Peroxidase conjugate. Tetramethyl¬benzidine

(TMB) is used as a peroxidase substrate. Fi-

nally, an acidic stop solution was added to

terminate the reaction. The color changes from

blue to yellow. The intensity of the yellow color

is directly proportional to the calprotectin con-

centration of sample.

Accordingly, standard curves of known

concentration were established from which un-

known concentration of both assayed markers

were determined.

Statistical Analysis:

IBM SPSS statistics (V. 23.0, IBM Corp.,

USA, 2015) was used for data analysis. Data

were expressed as mean and standard deviation

(Mean±SD) for quantitative parametric measures

in addition to Median and interquartile range

(IQR) for quantitative non-parametric measures

and both number and percentage for categorized

data. Comparative statistics was done by Wil-

coxon’s rank sum in case of non-parametric data.

Correlation analysis was performed by Spear-

man’s rank correlation (rs). P values<0.05 were

considered significant, whereas values<0.01

were considered highly significant. Receiver op-

erating characteristic curve (ROC) analysis was

applied to assess the overall diagnostic perfor-

mance of each test.

Mohsen, M. , et al.24

RESULTS

Demographic and clinical characteristics

of the studied groups show no significant dif-

ference between sepsis and control group in

terms of sex distribution and delivery modalities

(p>0.05). Septic neonates, however, were found

to have a significantly lower mean gestational

age (p<0.01) and mean birth weight (p<0.05) as

compared to the control group.

Compared to controls, septic newborns dem-

onstrated significantly lower 1&5 minutes Apgar

scores (p<0.001). In the same group, 93% had

hematological scores ≥3 over the study period.

Most of cases (92.3%) had positive CRP (>6mg/

L). Positive blood cultures for bacteria were

encountered in 30 (38%) cases. Positive blood

cultures demonstrated the presence of Klebsiella

pneumoniae (14%), Coagulase negative Staph.

(8%) Acinetobacter (6%) and E.coli (5%) (Fig-

ure 1).

When we searched for risk factors for ear-

ly-onset neonatal sepsis (EOS) in septic cases,

results showed 34(43.6%) cases were due to

prolonged premature rupture of membranes

(PROM)> 24 hr, 25(32%) due to preterm labor,

16(20.6%) due to chorioamnionitis and 3(3.8%)

due to peripartum maternal fever.

Table 1 shows a highly statistical significant

increase in the level of copeptin and calprotec-

tinin septic than control group.

Table 2 demonstrates comparison between

the levels of copeptin and calprotectin in septic

group according in relation to CRP, blood cul-

ture results and patients’ outcome. Fifty seven

(73.1%) cases improved while 21(26.9%) died.

Gestational age (using Ballard score), birth

weight and mode of delivery did not correlate

with copeptin (rs= 0.195, 0.261 and 0.045, re-

spectively) and calprotectin levels (rs= 0.256,

0.313 and 0.60, respectively); for all p>0.05.

Levels of assayed cord blood copeptin(pg/

mL) and calprotectin(ng/mL) correlated to some

hematological tests in the septic newborns (Ta-

ble 3). However, both markers’ levels showed

significant correlation with Rodwell,s Sepsis

score [median score=5 (3.25-5.3), with co-

peptin: rs=0.471; p=0.021 and with calprotectin

rs=0.704; p=0].

Diagnostic performance test results for deter-

mination of the best cut-off value of copeptin and

calprotectin for prediction of early-onset neona-

tal sepsis are shown in table 4 and figure 2.

Figure 1: Blood culture results of sepsis group.

Table 1: Comparison of cord blood copeptin and calprotectin levels between sepsis and control groups

Variable

Sepsis group

n=78

median (IQR)

Control group

n=60

median (IQR)

Z p significance

Copeptin (pg/mL) 212 (95 – 537) 82 (60 – 125) -3.451 0.001 HS

Calprotectin (ng/mL) 4.6 (4.0-9.1) 0.93 (0.7-2.0) -8.028 0.0 HS

Cord Blood Copeptin and Calprotectin in Neonatal Sepsis 25

Table 2: Comparison between levels of copeptin and calprotectin in septic group according to CRP, blood culture results and

patients’ outcome

CRP Blood culture Patients’ outcome

Negative

n=5

Positive

n=72

Negative

n=48

Positive

n=30

Improved

n=57

Died

n=21

Copeptin

(pg/mL)

Median

(IQR)236(184-462) 294(237-520) 223(97-469) 293(105-510) 228(94-286) 410(328-516)

Z 0.683 1.244 2.952

P 0.337 0.244 0.018

significance NS NS S

Calprotectin

(ng/mL)

Median

(IQR)7.6(4-13.4) 9.4(3.8-15) 5.1(3.4-6.1) 8.0(4.2-15) 4.5(3.2-5.9) 11(7.9-14.3)

Z 0.371 3.409 2.371

P 0.707 0.026 0.046

significance NS S S

Table 3: Correlation of cord blood Copeptin(pg/mL) and Calprotectin(ng/mL) to other laboratory param-

eters in the septic newborns:

Copeptin Calprotectin

Parameter Median (IQR) rs p value Significance rs p value Significance

TLC (x10³/mm³) 13.1(4.6-26.8) 0.437 0.016 S 0.374 0.044 S

Platelet count

(x10³/mm³)99 (54-166) -0.424 0.020 S -0.195 0.819 NS

Granulocytes

(x10³/mm³)6.8 (1.9-17.4) 0.319 0.002 S 0.261 0.051 NS

I/T ratio 0.3 (0.2-0.4) 0.654 <0.001 HS 0.352 0.019S

TLC= total leucocytic count, I/T ratio= ratio of immature to mature granulocytes.

Table 4: Diagnostic performance test results of copeptin and calprotectin for prediction of early-onset neo-

natal sepsis:

Cord blood Copeptin

(pg/mL)

Cord blood

Calprotectin (ng/mL)

Best cut-off value 85 2.25

Sensitivity (%) 73.3 100

Specificity (%) 100 97.5

Positive predictive value (%) 100 98

Negative predictive value (%) 87.5 100

Efficacy (%) 81 98.9

Mohsen, M. , et al.26

DISCUSSION

Prompt diagnosis of sepsis is crucial to es-

tablishing treatment and modifying neonatal

prognosis. Laboratory sepsis markers represent

a helpful tool in the evaluation of a neonate with

a potential infection. Neonatal septicaemia is as-

sociated with hyper-inflammatory host responses

that subtend activation of immune system includ-

ing innate immunity which is fully developed in

the first weeks of life(19,21).

Copeptin concentrations were strongly

elevated in samples from adult patients with

sepsis and high copeptin levels were pre-

dictive of mortality(26,17,23) .Many studies in

adults have shown that copeptin is a valu-

able biomarker of infection in patients with

community-acquired and ventilator-associ-

ated pneumonia(18).

Calprotectin, a major product of innate im-

munity cells, is an antimicrobial that protects

cells against invasive microorganisms and regu-

lates adhesion of leukocytes to the endothelium

and extracellular matrix during the inflammatory

process (27). It has been proposed for the diagnosis

of many inflammatory conditions; however, its

use in the diagnosis of neonatal sepsis remains a

matter of research.

Therefore, we aimed in this study to inves-

tigate the clinical utility of assaying cord blood

copeptin and calprotectin as markers of early-on-

set neonatal sepsis. We performed a case control

study that comprised 138 newborn infants with

gestational age of 28-40 weeks and birth weights

between 1500 and 4100 grams who were trans-

ferred to the NICU because of having a risk fac-

tor of neonatal sepsis. On the basis of clinical

observation over their first 5 postnatal days and

sepsis work-up results, into 2 groups: Early on-

set neonatal sepsis group (EOS) (n=78) and non-

septic control group (n=60).

Our findings revealed no significant differ-

ence between sepsis and control group in terms of

sex distribution and delivery modalities. Chaco

and Sohi (2005) found that the rates of infection

were similar in males and females(6). In Werner

et al., 2012, there was no significant difference

in sepsis between cesarean and vaginal delivery

groups(29). In the current study, Septic neonates,

however, were found to have a significantly low-

er mean gestational age and mean birth weight

AUC

Calprotectin 0.992

Cord Copeptin 0.795

Figure 2: ROC curve analysis showing the diagnostic performance of Cord Copeptin and Calcprotectin

for discriminating patients with sepsis from those without

Cord Blood Copeptin and Calprotectin in Neonatal Sepsis 27

as compared to the controls. This goes in agree-

ment with the study of Abdelmaaboud et al., and

Hornik et al., who observed that very low birth

weight (VLBW) infants are at high risk for both

early- and late-onset neonatal sepsis(2,13)

Compared to controls, septic newborns dem-

onstrated significantly lower 1&5 minutes Apgar

scores. Unfortunately, low Apgar score usually

necessitates more prolonged and aggressive re-

suscitation which is a known risk factor for sep-

sis (12).

Concerning risk factors for EOS in septic

cases, prolonged PROM> 24 hr was found in

34 cases (43.6%) , preterm labour in 25(32%),

chorioamnionitis in 16(20.6%) and peripartum

maternal fever in 3(3.8%).

For all infants included in this work, cord

blood copeptin and calprotectin were assayed

by competitive and sandwich enzyme immuno-

assays (EIA), respectively. Results of both in-

flammatory markers were significantly higher in

septic neonates than controls [212 (95 – 537) vs.

82(60 – 125) pg/mL for copeptin; and 4.6(4.0-

9.1) vs. 0.93(0.7-2.0) ng/mLfor calprotectin,

respectively; p<0.001 for both]. Our results are

in accordance with previous demonstrations as

those of Benzing et al., Morgenthaler et al.and

Abdelmaaboud et al.(3,17,2).

Gestational age (Using Ballard score), birth

weight and mode of delivery did not correlate

with copeptin (rs= 0.195, 0.261 and 0.045, re-

spectively) and calprotectin levels (rs= 0.256,

0.313 and 0.60, respectively); for all p>0.05.

Our data are in contrast with reports from

Schlapbach et al who stated that infants after

vaginal delivery compared to cesarean delivery

had significantly higher copeptin levels, even

when adjusting for gestational age indicating that

the vasopressin system in the neonate is strongly

activated upon perinatal stress(24). However, our

explanation is that most of septic babies, in our

study, were born by cesarian section 59 (75.6%)

as their mothers had had risk factors which ne-

cessitated cesarean section.

In the study by Abdelmaaboud and co-work-

ers, they found significant negative correlations

between calprotectin and both of gestational

ages and weights(2). They attributed their results

to the fact that sepsis is more severe in neonates

with younger ages and lower weights resulting

in higher levels of these inflammatory markers.

However, their reports depended on cases with

late onset sepsis (more than 3 and less than 30

days) rather than ours of EOS.

Most of our patients; 72 (92.3%) had positive

CRP (>6mg/L). Comparison of copeptin and cal-

protectin in neonates with positive and negative

CRP was non-significant. Our findings are in

accordance with those of Schlapbach et al. and

Decembrino et al.(24,10). In fact, the utility of CRP

for the diagnosis of neonatal infection has been

the subject of controversy because of its unsat-

isfactory sensitivity. The CRP concentration in-

creases physiologically in newborns within the

first days after birth. This dynamic behavior may

in part account for the low diagnostic accuracy

of CRP measurements in neonatal infection, par-

ticularly when measured shortly after birth(7,10).

Positive blood cultures for bacteria were en-

countered in 30 (38%) cases. A recent study by

Decembrino et al., showed positive culture in

8/41 neonates (19.51%) with sepsis (10). This is

explained by that the sensitivity of blood culture

for diagnosis of bloodstream infection is still de-

pendent upon the volume of blood used to inocu-

late the culture medium. (4,8). Moreover, low level

of bacteremia is possible in the NICU where in-

fants are often exposed to multiple courses of

empirical antibiotics, including in utero antibiot-

ics.

Forteen percent of positive blood culture

cases were due to Klebsiella pneumoniae (14%),

coagulase negative staph (8%) Acinetobacter

(6%) and E.coli (5%). Our findings are consis-

tent with those of Stoll et al., 2005 and Klinger

et al., 2009, who found that EOS was caused

mainly by gram negative bacteria; while Abdel-

maaboud reported that nosocomial sepsis caused

by coagulase negative staphylococcal (CoNS)

infections continues to be an important cause of

morbidity in NICUs(25,14).

When serum copeptin and calprotectin were

assayed in septic neonates with positive and neg-

ative blood culture results, higher levels of both

markers were obtained in septic neonates with

Mohsen, M. , et al.28

positive blood culture. These high levels were

significant in calprotectin, however, they did not

reach a significant level in copeptin. Our results

were in accordance with those previously ob-

tained by Abdelmaaboud et al. and Decembrino

et al.(2,10).

Of the 78 septic patients, 57(73.1%) in-

fants improved, while 21(26.9%) died. These

results significantly associated with copeptin

and calprotectin initial cord blood values; de-

noting that both are early predictor markers of

survival in neonatal septicemia. Morgenthaler

and colleagues, in their study, had also elevated

copeptin concentrations are elevated in hemor-

rhagic and septic shock and that copeptin was

higher on admission in non-survivors as com-

pared with survivors, suggesting copeptin as a

prognostic marker in sepsis(17). Moreover, re-

ports of Abdelmaaboud and colleagues showed

that patients with positive blood cultures, and/or

those who died within one week after diagnosis

of sepsis had significantly higher levels of cal-

protectin than cases that were negative for blood

cultures or those who survived beyond the first

week after diagnosis of sepsis(2). These findings

may reflect the reliability of serum calprotectin

level as a marker of the severity and outcome of

cases with sepsis.

Correlation analysis of cord blood copeptin

and calprotectin to hematological tests was per-

formed. Copeptin significantly correlated with

total leucocytic count (TLC), granulocytes,

platelet count and I/T ratio, while calprotectin

showed significant correlation with TLC and

I/T ratio. Thrombocytopenia is one of the most

common complications of neonatal sepsis and is

considered one of the hematological parameters

of severity of neonatal sepsis(22,16,2). The signifi-

cant negative correlation of copeptin with plate-

let counts indicate that it may be used as param-

eters of the severity of sepsis.

Rodwell score is a hematologic scoring sys-

tem that uses parameters of complete blood count

to diagnose sepsis; in which score above 3 raises

the possibility of sepsis. Both markers signifi-

cantly correlated with Rodwell’s score indicat-

ing that they are good diagnostic tests for EOS.

Such assumptions are strengthened by studying

the diagnostic performance of the two tests for

prediction of EOS.

Receiver-operating-characteristic (ROC)

curve analysis showed that copeptin cord blood

concentrations at a cut-off of 35pg/mL could dis-

criminate between neonates with and without

septicemia with a sensitivity of 73.3%, a speci-

ficity of 100%, positive predictive value (PPV)

of 100%, negative predictive value (NPV) of

87.5% and efficacy 81%

Regarding the discriminating ability of cal-

protectin between healthy neonates and those

having EOS, even though their blood culture is

negative, our ROC curve at a best cut-off value

of 2.25ng/mL had sensitivity of 100%, specific-

ity of 97.5%, PPV of 98%, NPV of 100% and

efficacy is 98.9%.

Conclusion:

As diagnosis and early treatment of EOS

is crucial to decrease neonatal morbidity and

mortality, our study reveals that copeptin and

calprotectin may be considered two promis-

ing sensitive and specific predictors for early

onset neonatal sepsis.

REFERENCES1. Abdalla, G; Elshafei, A; Abd EL-Motaal, O; et al.

(2014): Copeptin, A novel neuropeptide in acute myo-

cardial infarction. Arab. J. Lab. Med; 40(1): 729.

2. AbdelMaaboud, M. Elmazary, A. M,. Osman, A. M.

(2012): Serum calprotectin as a diagnostic marker of

late onset sepsis in full-term neonates.. Egypt J Pediatr

Allergy Immunol; 10(1):19

3. Benzing J, Wellmann S, Achini F, et al. (2011 ) : Plas-

ma Copeptin in Preterm Infants: A Highly Sensitive

Marker of Fetal and Neonatal Stress.. The Journal of

Clinical Endocrinology & Metabolism (JCEM); 96(6).

4. Bhatti M, Chu A, Hageman JR, et al. (2012): Future

Directions in the Evaluation and Management of Neo-

natal Sepsis. NeoReviews Vol.13 No.2

5. Bizzarro, M. J.; Raskind, C. R.; Baltimore, S. et al.

(2005 ) : Seventy-five years of neonatal sepsis at Yale:

1928–2003, Pediatrics; 116(3): 595.

6. Chacko, B and Sohi I (2005): early Onset Neonatal

Sepsis .Indian Journal of Pediatrics; 72(1):23.

7. Chiesa C.1, Natale F, Pascone R, et al. (2011): Refer-

ence intervals for preterm and term newborns during

the early neonatal period. Clin .Chim .Acta. May 12;

412(11-12).

8. Chu A, Hageman JR, Schreiber MD (2012): Antimicro-

Cord Blood Copeptin and Calprotectin in Neonatal Sepsis 29

bial Therapy and Late Onset Sepsis. Neo Reviews, 13

(2): e94.

9. Colle JG, Fraser AG, Marmion BP et al. (1996): Tests

for the identification of bacteria In: Machie and Mc

Carteny Practical Medical Microbiology, 14th edition;

p. 413-424, Churchill Livingstone.

10. Decembrino L; De Amici , M; Pozzi, M; et al. (2015):

Serum Calprotectin: A Potential Biomarker for Neo-

natal Sepsis. Journal of Immunology Research; 10(8):

e0136250-e0136254.

11. Gerdes, J. S (2004): Diagnosis and management of

bacterial infections in the neonate. Pediatric Clinics of

North America; 51(4): 939.

12. Gomella T.L, Cunningham M.D., Eyal F.G, et al. .

(2009): Neonatal sepsis. In: Lange Clinical Manual of

Neonatology, 6th ed., Lang Medical Books/McGraw-

Hill; 130: 865.

13. Hornik CP, Fort P, Clark RH, et al. (2012 ): Early

and late onset sepsis in very-low-birth-weight infants

from a large group of neonatal intensive care units.

101(11):1121.

14. Klinger G, Levy I, Sirota L, et al. (2009): Epidemiology

and risk factors for early onset sepsis among very-low-

birthweight infants. Am J Obstet Gynecol; 201(1):38.

e1.

15. Klouwenberg P. K and. Bont L. (2008): Neonatal and

infantile immune responses to encapsulated bacteria

and conjugate vaccines, Clinical and Developmental

Immunology; Article ID 628963: 10 pages,

16. Manucha V, Rusia U, Sikka M, et al. ( 2002): Utility of

haematological parameters and C reactive protein in the

detection of neonatal sepsis. J Paediatr Child Health;

38(5):459.

17. Morgenthaler NG, Muller B, Struck J, et al. (2007):

Copeptin, a stable peptide of the arginine vasopressin

precursor, is elevated in hemorrhagic and septic shock.

Shock, 28(2):219.

18. Muller B, Morgenthaler N, Stolz D, et al. (2007): Circu-

lating levels of copeptin, a novel biomarker, in lower re-

spiratory tract infections. Eur J Clin Invest, 37(2):145.

19. Ng, P. C (2004): Diagnostic markers of infection in neo-

nates, Archives of Disease in Childhood; 89(4): F229.

20. Nilsen T, Sunde K, and Larsson A (2015): A new turbi-

dimetric immunoassay for serum calprotectin for fully

automatized clinical analysers. Journal of Inflamma-

tion; 45(12)90.

21. Nupponen, I Turunen R., Nevalainen T.et al. (2002):

Extracellular release of bactericidal/permeability-in-

creasing protein in newborn infants, Pediatric Research,

vol. 51, no. 6, pp. 670.

22. Roberts I, and Murray NA. (2003): Neonatal throm-

bocytopenia causes and management. Arch Dis Child

Fetal Neonatal Ed.; 88(5):F359.

23. Russell JA(2009): Vasopressin and its co-pilot copeptin

in sepsis and septic shock. Crit. Care Med, 37(2):749.

24. Schlapbach L. J., Frey S, Bigler S, et al. (2011): Co-

peptin concentration in cord blood in infants with early-

onset sepsis, chorioamnionitis and perinatal asphyxia.

BMC Pediatrics, 11:38

25. Stoll BJ, Hansen N, Fanaroff AA, , et al. (2002): Chang-

es in pathogens causing early-onset sepsis in very-low-

birth-weight infants. N Engl J Med, 347(4):240.

26. Struck J, Morgenthaler NG, Bergmann A (2005): Co-

peptin, a stable peptide derived from the vasopressin

precursor, is elevated in serum of sepsis patients. Pep-

tides, 26(12):2500.

27. Terrin, G; Passariello, A; Comanguso,F;, et al (2011):

Serum calprotectin: An antimicrobial peptide as a new

marker for the diagnosis of sepsis in very low birth

weight newborns. Clin Devel Immun. 2011, Article Id

291085, 6 Gesdoi: 10. 1155 /2011 / 291085.

28. Vaos ,G; . Kostakis, I .D; Zavras, N. et al. (2013): The

Role of Calprotectin in Pediatric Disease. Bio Med Re-

search International; volume 2013 ID 542363: 8 pages.

29. Werner EF, Savitz DA, Janevic TM, et al. (2012):

Mode of delivery and neonatal outcomes in preterm,

small-for-gestational-age newborns. Obstet Gynecol;

120(3):560.

Mohsen, M. , et al.30

قياس معدل الكوبيبتن و الكالبروتيكتين الموجود في دم الحبل السرى كعوامل حيوية لتشخيص التسمم الدموى المبكر في االطفال حديثي الوالدة

منال محسن- وفاء خليل زكى - رانيا إسماعيل – نهال الرجال – محمد عبد الوهاب

يعتبر التسمم الدموى عند االطفال حديثى الوالدة من المشاكل االساسية التى تتسبب فى ارتفاع معدل المرض و الوفيات عند هؤالء االطفال الى حد كبير.ولذلك فان التشخيص المبكر وتوفير العالج المناسب أمر بالغ األهمية ويعتبر سببا فى إنقاذ حياة هؤالء االطفال . و علي الرغم من ان مزرعة الدم هو اختبار قياسي لتشخيص تسمم الدم في حديثي الوالدة فإن نتيجتها ال تكون متاحة قبل 48-24 ساعة وقد تكون سلبية في كثير من االحيان.,وحيث انه غالبا ما يصاحب التسمم الدموى عند حديثى الوالدةرد فعل التهابي مفرط مع المضيف والتي تقابل بتنشيط الجهاز المناعي. ولذلك تم اقتراح مجموعة واسعة من الدالالت االلتهابية لتشخيص تسمم الدم في حديثي الوالدة. وقد قمنا في دراستنا هذo بقياس اثنين من العوامل الحيوية والتى تم التعرف حديثا و هما الكوبيبتن والكالبروتيكتين بغرض معرفة القيمة التشخيصية لهما كعوامل حيوية لتشخيص حاالت التسمم الدموى المبكر عند االطفال حديثي الوالدة. تم تنفيذ هذo الدراسة في وحدة العناية المركزة لحديثي الوالدة حيث تم تقسيم األطفال إلى مجموعتين:المجموعة االولى :وتشمل يعانون من تسمم دموى مبكر وعددهم 78طفال والمجموعة الثانية:وتشمل اطفال اصحاء ظاهرياوعددهم 60 طفال. وقد أظهرت نتائج البحث وجود إرتفاع ذو داللة إحصائية

فى مستوى الكوبيبتن و الكالبروتيكتين فى مصل األطفال حديثى الوالدة المصابين بالتسمم الدموى المبكرمقارنة باألطفال األصحاء فى المجموعة الضابطة,كما أظهرت الدراسة إرتفاع معدل إكتشاف مستوى الكالبروتيكتين فى حاالت التسمم الدموى المصاحبة لعزل ميكروبات من مزارع الدم ولم يتم تسجيل ذلك مع مستوى الكوبيبتن والذى لم يسجل إرتفاع بشكل ملحوظ مع حاالت المزارع اإليجابية. كذلك أظهرت الدراسة وجود عالقة وطيدة بين إرتفاع مستوى الكوبيبتن و الكالبروتيكتين ومقياس رودويل عند حديثى الوالدة مما يدل على إمكانية إستخدامهما كداللة حيوية أولية لتشخيص التسمم الدموى المبكر لدى هؤالء االطفال.كما أظهرت مستويات الكوبيبتن و الكالبروتيكتين إرتفاع ذو داللة إحصائية مع حاالت التسمم الدموى الشديد الذى قد يؤدى إلى الوفاة. وبقياس الدالئل األحصائية لهذان العامالن الحيويين فأشارت النتائج إلى وجود حساسية وخصوصية عالية فى تشخيص حاالت التسمم الدموى المبكر عند االطفال حديثى الوالدة. ومما سبق نستنتج أن قياس مستوى الكوبيبتن و الكالبروتيكتين يعتبر معيارا حيويا جيدا وحساسا لتشخيص حاالت التسمم الدموى المبكر لدى األطفال حديثى الوالدة خاصة فى الحاالت التى يتعذر تشخيصها بواسطة نتائج مزارع الدم المستخدمة لعزل الميكروب

المسبب للمرض.

THE STUDY OF BCR-ABL TRANSCRIPT VARIANTS (B2A2 AND B3A2)

RELATION TO DIFFERENT RISK SCORES Hisham Abdelaziz*, Ahmed Omar** , Ali Alshemary**and Mohamed Keshk***

ABSTRACT

Background: The exact role of the different transcript variants of BCR-ABL in the pathogenesis of chronic myeloid leu-

kemia (CML) and their impact on prognosis is yet to be definitely enumerated. Aims: In this study, we have tried to correlate

the presenting features, risk scores and treatment response with the BCR-ABL variants detected in our patients. Settings and

Design: A cross-sectional unicentric hospital-based study on 80 patients in Dammam University Hospital, Saudi Arabia, diag-

nosed to have CML by bone marrow cytogenetics and confirmed by reverse transcriptase-polymerase chain reaction (RT-PCR).

Materials and Methods: RT-PCR for BCR-ABL was performed on consecutive patients with CML attending the CML clinic

from January 2010 to December 2010.The medical charts of these patients were analyzed after a follow-up of 18 months in

a retrospective manner. Statistical Analysis: Box plot and histogram were used to see the distribution of variables. t-test was

performed to enumerate the difference between risk scores in two populations of patients carrying two different BCR-ABL

transcript variants. Results: Nearly 56.25% of patients had b3a2 (e14a2) while 41.25% of patients showed b2a2 (e13a2) tran-

scripts. The rest 2.5% (two patients) expressed the rare e19b2 variant. Patients with b2a2 presented with higher Sokal, Hasford

and European Treatment and Outcomes Study score than their b3a2 counterpart. Different parameters such as the platelet

count, leukocyte count, hemoglobin and splenomegaly showed a minor difference between the groups. More patients in the

b2a2 group achieved complete hematologic response at 3 months, but it was not significant. Conclusions: Patients with b2a2

variant CML tend to present with higher risk score, but do not behave in a vastly different manner than their b3a2 counterparts.

Key words: BCR-ABL transcript variants, chronic myeloid leukemia, chronic myeloid leukemia risk scores, imatinib mesylate

Departments of Hematology*, National Cancer Institute, University of Cairo, Egypt, Clinical Hematology**,

University of Dammam, KSA and Molecular Biology***, University of Dammam, KSA.

Egypt. J. Lab. Med. Vol.(27) No.3, October, 2015, 31 - 37

INTRODUCTION

Philadelphia chromosome i.e., the chromo-

some originating from the reciprocal transloca-

tion between long arms of chromosome 9 and

chromosome 22 t(9;22)(q34;q11), along with

its product BCR-ABL oncogene is perhaps the

most extensively studied oncoprotein. Since its

discovery in 1960(13), its different variants in dif-

ferent types of leukemia has been recorded and

analyzed. In chronic myeloid leukemia (CML)

BCR-ABL fusion oncogene translates chimeric

protein p210, which exerts its oncogenic role

by activating the tyrosine kinase, which does

not block differentiation but leads to the devel-

opment of malignancy by enhancing prolifera-

tion of myeloid cell line(15). In CML, most of the

cases of p210 constitutes principally of two vari-

ants: b3a2 or e14a2 and b2a2 or e13a2(4,11). The

b3a2 variant is produced by the fusion of exon

14 of BCR gene with exon 2 of ABL gene while

the other variant, i.e., b2a2 is produced by fusion

of exon 13 of BCR and exon 2 of ABL(18). These

transcripts variants are produced as the result of

alternate splicing. Many studies had been per-

formed to find interrelation between the particu-

lar variant of p210 BCR-ABL and the etiology,

pathogenesis, prognosis of the disease. What our

study constitutes is the endeavor to find the in-

terrelation between these two principal transcript

variants of p210 and its association with differ-

ent aspects of the disease such as white blood

cell (WBC) count, platelet count, organomegaly,

prognostic markers of the CML (Sokal score(19),

Hasford/ Euro score(8), European Treatment and

Outcomes Study (EUTOS) score(7)) along with

the response to the modern day mainstay thera-

py of CML through Imatinib mesylate. Reverse

transcriptase polymerase chain reaction (RT-

PCR) chosen as the method of choice to deter-

mine the transcript variant of BCR-ABL, is one

of the most sensitive methods for this purpose.

MATERIALS AND METHODS

The study was approved by the ethics com-

mittee of the Dammam University Hospital.

Abdelaziz H., et al.32

Patients

A total of 80 consecutive patients who were

diagnosed to be suffering from CML in our clin-

ic over the period of January 2010 to December

2010 were selected for the study and followed up

for18 months.

Sample collection

Blood samples were collected from 80 pa-

tients from the Out-Patient Clinic (3 ml for each

patient), in a proper aseptic manner, into prop-

erly labeled ethylene diaminetetraacetic acid

vacuum tubes. Processing of the collected blood,

i.e., beginning of ribonucleic acid (RNA) isola-

tion from the collected blood sample, was started

immediately, thus evading any chance of mes-

senger RNA degradation. Proper consent from

each patient was taken at the time of sample col-

lection.

RNA isolation

Total RNA was isolated from a blood sample

by using the QIAGEN RNA isolation kit (Qia-

gen, Germany) by following the protocol pro-

vided by the manufacturer. RNA quantity was

determined by spectrophotometry.

Complementary DNA (cDNA) synthesis

RNA was reverse transcribed into cDNA

for using as template in PCR reaction. RT reac-

tion was performed by using Transcriptor First

Strand cDNA Synthesis Kit, Roche applied sci-

ence, USA.

Six microliter of RNA (~2.4 µg RNA) was

added to 14 µL of mix containing 2 µL of 10x RT

reaction buffer (40 mM Tris-HCL, 100 mM KCl,

20 mM DTT), 10 mM dNTP, 10 mM oligo-dT,

20 units of RNase inhibitor and 40 units of Re-

verse Transcriptase. Next the mix was incubated

in 42°C for 45 min, 99°C for 3 min and finally

held at 4°C for 20 min. Manufacturer provided

RNA is used as a positive control.

PCR amplification

The primers of standardized PCR protocol of

BIOMED1(Europe against Cancer)(21) were used

to amplify the cDNA (Except the shifted primer

ABL-a3-E3’). The sequences of the primers are

given as follows:

• BCR-b1-A 3086 (22): GAAGT-

GTTTCAGAAGCTTCTCC

• ABL-a3-B 458 (21): GTTTGGGCTTCA-

CACCATTCC

• BCR-b2-C 3126 (21): CAGATGCTGAC-

CAACTCGTGT

• ABL-a3-D 441 (23): TTCCCCATTGT-

GATTATAGCCTA.

The cDNA product of the former reaction

was amplified with PCR reaction in two rounds

(nested PCR), 150 mM primers, 1 U/ml Taq Poly-

merase, 10 mM dNTP mix and ×10 PCR buffer

with 25 mM MgCl2 was used in each round.

Initial denaturation was performed at 95°C for

3 min followed by 35 cycles of denaturation at

94°C for 20 s; annealing at 55°C for 15 s; exten-

sion at 72°C for 15 s with a total 35 cycles using

thermocycler. Final extension was performed at

72°C for 5 min. After performing the PCR reac-

tion, the products were checked through agarose

gel electrophoresis in 2% of agarose gel medi-

um.

RESULTS

The b3a2 transcript variant was recognized as

417 base pair long product and b2a2 was recog-

nized as 342 base pair long product when primers

A and B were used [Figure 1] and as 360 and 285

bp products when primers C and D were used.

The baseline characteristics of patients are

shown in table 1. Amongst 80 patients (includ-

ing 24 females) 45 (56.25%) of patients showed

the presence of b3a2 and 33 (41.25%) of patients

showed the presence of b2a2 transcript variant.

The rest 2.5% (numerically, 2 cases) showed the

expression of rare e19b2 variety, recognized as

a 243 base pair long product in agarose gel elec-

trophoresis. However, there was no case of b3a2

and b2a2 co-expression in any patient. Bone

marrow cytogenetics did not reveal any abnor-

mality other than the presence of Philadelphia

chromosome in any patient.

Qualitative nested PCR were performed on

the patients at the end of the follow-up period as

it was done at the beginning of the study. All the

patients, including two patients who underwent

complete molecular response, did show qualita-

BCR-ABL Variants Relation to Different Scores 33

tive nested PCR value as positive at the end of

the follow-up period (which is a common occur-

rence).

Hence the first round PCR (at the time of di-

agnosis) and the second round PCR (at the end

of follow-up) did not discriminate the patient

population. From the database of history of the

patients, we had calculated the Sokal score, Has-

ford score and EUTOS score of all patients at

the time of diagnosis and correlated them with

the respective transcript variants of the patients

is given in figure 2.

From figure 2, it is apparent that, according

the Sokal, Hasford and EUTOS score, the pa-

tients with b2a2 transcript variants are present-

ing with higher scores than the patients having

b3a2 variants. Hence we have performed t-test to

test if the risk scores are significantly higher in

patients with b2a2 variants and it was found that

the P < 0.05 in both Sokal and EUTOS score, but

not in Hasford score (P = 0.03 in case of Sokal

score, 0.027 in EUTOS score and 0.24 in Has-

ford score).

We analyzed the correlation between different

transcript variants and the progression of disease

among the patients. We tabulated the transcript

variants of the patients against

their stage of the disease i.e., if they stayed

in chronic phase (CP) all along or progressed to

accelerated phase or blast crisis in tables 2. We

have also tabulated the Platelet count, organo-

megaly and other hematological features against

the transcript variants in table 3, as there are

earlier reports on the correlation between these

two in the form of higher platelet count found in

b3a2 variety.(14,22,9,3) However, we found higher

platelet counts in patients with b2a2 variety of

BCR-ABL than in b3a2.

We also studied and tabulated our patients’

response to the first generation tyrosine kinase

inhibitor Imatinib mesylate and any possible re-

lation with the transcript variants of the patients

in table 4. For this purpose, we had only con-

sidered the data of the patients who presented to

us in the CP of the disease (1st CP of CMLCP)

and are currently being treated by Imatinib me-

sylate (at the standard dose of 400 mg/day) for at

least a period of 6 months. In our population, we

found 30 such cases of b3a2 and 23 such cases of

b2a2. For assessment of the Imatinib response,

we had to depend mostly on the hematological

response as most of the patients could not afford

the recommended bone marrow cytogenetics or

quantitative. RT-PCR (qRT-PCR). Cytogenetic

response (partial, major or complete) and molec-

ular response was assessed for BCRABL in a few

cases where the patient could afford the test.

�������!�$���������� �������������������������������������������������������������������������������� %�� -���������� %���-������������ %��� �

1"�������������������!5�.�������������������������������������������5.����������������������7������������������������6�

1"�������������������!.�.�������������������������������������������.5����������������������2������������������������2� ���/� ����������������������5� 0�/� �������%���5��0�/������������%���5�( �/�(�����������

������ ������������ �������������

����

� ����� �������/&� �������� ��������2�

����

����

����� �������A6/ ���������/''�

������

�������� ����������� �����������

���� ���������� �������

����� ������� �����������

Table 1: Baseline characteristics of patients

WBC – White blood cell

Table 2: Disease stage

CML – Chronic myeloid leukemia; CP – Chronic phase; AP – Accelerated phase; BC – Blast crisis

Parameters

at diagnosis b3a2 b2a2

Median Interquartile Range Median Interquartile Range

Platelet count (103/µl) 206 310 297 326

Hemoglobin (g/dl) 10 2.8 10 2.96

WBC count (103/µl) 37.7 98.3 45 107.98

Splenomegaly (cm) 3.5 6 4 7

Hepatomegaly (cm) 2 3 2 3

Abdelaziz H., et al.34

Table 3: Clinical features of patients with transcript variants

������2!����������������"���� �������������������������������������������������������������������������������������������������������������������������������

������"��������������������#�������������/&��������������������������������������������������������������������������������������������5'�������������������������������������.5�

+�"��� �������������

������*�����5������OO���������������������������������������������������������������.'������������������������������������/7�

�����#���������*�����������������������������������������������������/'��������������������������������������6� � ���������������

�������N���������/�524 ����������������������������������������������������������������5���������������������������������������.�

�����������������53�324 ��������������������������������������������������������������5���������������������������������������.�

�����������������33�724 ���������������������������������������������������������������.��������������������������������������/�

�������������������������������������������������������������������������������������������6��������������������������������������.�

�����1�������� ������������������������������������������������������������������������/&������������������������������������/3�

%����������������

������������������������������������������������������������������������������������������/���������������������������������������/�

�������N������������������������������������������������������������������������������������5���������������������������������������/�

�������� ������� �������������������������������������������������������������������.3�������������������������������������./�.( � /� .����� ������ ����5� !�� /� !������� �������5� 66 �,� / ��%����� ������������ ���������� ������

Table 4: Response to treatment

IM – Imatinib mesylate; **CHR –Complete hematological remission i.e., resolution of splenomegaly (if

previously present), restoration of normal blood counts and loss of marrow hypercellularity (Platelet

<450×109/L; WBC <10×109/L; No immature granulocyte and basophil <5%)(1)

��������� �

�"������

������� �������� ��������� ��%�����

Figure 1: Reverse transcriptase-polymerase chain reaction of

BCR- ABL transcript variants in 2% agarose gel. Lane 1:

100bp ladder, Lane 2: Positive control of b3a2 (417bp);

Lane 3: Positive control of b2a2 (342 bp); Lane 4 and 5:

Patient sample showing b3a2 variant; Lane 6: Patient

sample showing b2a2 variant; Lane 7: Negative control

Characteristic b2a2 b3a2Age 42 32Gender M MHemogram on diagnosis

Tot .Leukocyte count (X103/µl) 112.66 263.6Platelet (X103/µl) 740 210Neutrophil % 38 40Eosinophil % 3 5Basophil % 18 5Blast % 0 7

Organomegaly on diagnosisLiver (cm) 3 4Spleen (cm) 15 7

Hemogram on test dayTotal Leukocytic count (X103/µl) 4.1 6.35platelets (X103/µl) 741 100Neutrophil % 32 44Eosinophil % 12 1Basophil % 32 0Blast % 0 0

Organomegaly on test dayLiver (cm) 4 0Spleen (cm) 13 0

Sokal score 1.17 (int.) 1.22 (high)Hasford score 577.3 (high) 111.3 (int.)EUTOS score 81 (low) 63 (low)

BCR-ABL Variants Relation to Different Scores 35

DISCUSSION

In our study, the frequency of b3a2 and b2a2

was found to be 56.25% and 41.25% respec-

tively which is quite closer to the data derived

in the similar studies performed in the Caucasian

population(22). No co-expression of these two

variants was found in any of the patients. In other

countries, the distribution was also similar to our

findings(6,10). In all the aforementioned studies,

the ratio was roughly calculated to be b3a2:b2a2

= 3:2. However, the role of BCR-ABL transcripts

variants in the prognosis had always been a con-

troversial issue. Although some authors reported

no such role on the part of the transcript vari-

ants, others found data referring to the transcript

variants to have prognostic values(5,16,20). In the

Middle East population, this is perhaps the first

study on the transcript variants and their possible

role on the presenting relative risks (measured

by Sokal, Hasford and EUTOS score) and Ima-

tinib response. Our study does not reveal a sig-

nificant difference of treatment response in the

two patient populations. The patients with b2a2

variants of our population seem to be presenting

with higher relative risk (according to Sokal and

EUTOS score).

In the study by Martínez-Mancilla et al., a

higher leukocyte count in b2a2 patients was

reported(12). The presenting features of the pa-

�Figure 2: Distribution of patients of both the transcript variants b3a2 and b2a2 are shown as in (a) Sokal

score, (b) Hasford score and (c) European Treatment and Outcomes Study score described risk cat-

egories.B2a2 shows higher risk scores than b3a2 variety.

c

b

a

Abdelaziz H., et al.36

tients of these two sub-populations are not stark-

ly different either. Although some of the studies

failed to show any correlation between platelet

count and BCR-ABL transcript variants(17), oth-

ers recognized higher platelet count in patients

carrying b3a2(14,22,9,3). However almost all the

reported studies correlating these two, related

higher platelet count in the b3a2 variety our

study had revealed otherwise [Table 4]. The oth-

er presenting features as Total WBC count, He-

moglobin, hepatomegaly and splenomegaly are

within moderate range of discrimination show-

ing the b2a2 population presenting with relative

organomegaly and slightly lower hemoglobin as

well as lower WBC count.

Due to the issue of affordability of our patients,

the world-wide recommended follow-up proto-

col through qRT-PCR to analyze transcript load

of BCR-ABL every 3 months interval(2,1)could

not be performed. Rather the common practice

is to follow-up patients through checking for

hematological remission. In addition in case of

Imatinib failure, switching over to second gen-

eration tyrosine kinase inhibitor is impossible

for the same reason of affordability.

Conclusion

According to the criterion of achieving and

maintenance of hematological remission, b2a2

patients seem to respond well to the Imatinib

therapy. Patients with b2a2 variant CML tend

to present with higher risk score, but do not be-

have in a vastly different manner than their b3a2

counterparts. Still keeping the small sample size

in mind, it is better to say that further investiga-

tion is required to conclude this aspect as well as

to investigate the association between transcript

variants and treatment response in terms of cyto-

genetic and molecular response.

REFERENCES1. Baccarani M, et al. 2006 Evolving concepts in the man-

agement of chronic myeloid leukemia: Recommenda-

tions from an expert panel on behalf of the European

LeukemiaNet. Blood ;108:1809.

2. Baccarani M, Cortes J, et al. 2009 Chronic myeloid leu-

kemia: An update of concepts and management recom-

mendations of European LeukemiaNet. J Clin Oncol ;

27:6041.

3. Balatzenko G, Vundinti BR, Margarita G. 2011 Correla-

tion between the type of bcr-abl transcripts and blood

cell counts in chronic myeloid leukemia-A possible in-

fluence of mdr1 gene expression. Hematol Rep ;3:e3.

4. Ben-Neriah Y, Daley GQ, Mes-Masson AM, 1986 Witte

ON, Baltimore D. The chronic myelogenous leukemia-

specific P210 protein is the product of bcr/abl hybrid

gene. Science ; 233:212.

5. de Lemos JA, de Oliveira CM, Scerni AC, et al. 2005

Differential molecular response of the transcripts B2A2

and B3A2 to imatinib mesylate in chronic myeloid leu-

kemia. Genet Mol Res; 4:803.

6. Goh HG, Hwang JY, Kim SH, et al. 2006 Comprehensive

analysis of BCR-ABL transcript types in Korean CML

patients using a newly developed multiplex RTPCR.

Transl Res ;148:249.

7. Hasford J, Baccarani M, Hoffmann V, et al. 2011 Pre-

dicting complete cytogenetic response and subsequent

progression-free survival in 2060 patients with CML

on imatinib treatment: The EUTOS score. Blood ;

118:686.

8. Hasford J, Pfirrmann M, Hehlmann R, et al. 1998 A new

prognostic score for survival of patients with chronic

myeloid leukemia treated with interferon Alfa. Writing

Committee for the Collaborative CML Prognostic Fac-

tors Project Group. J Natl Cancer Inst ;90:850.

9. Inokuchi K, Inoue T, Tojo A, et al. 1991 A possible cor-

relation between the type of bcr-abl hybrid messenger

RNA and platelet count in Philadelphia-positive chron-

ic myelogenous leukemia. Blood ;78:3125.

10. Iqbal Z, Manzoor F, Iqbal M, et al. 2011 Frequency of

BCR-ABL Fusion Oncogene Splice Variants Associ-

ated with Chronic Myeloid Leukemia (CML). J Cancer

Ther ; 2:176.

11. Lucas CM, Harris RJ, Giannoudis A, et al. 2009 Chron-

ic myeloid leukemia patients with the e13a2 BCR-ABL

fusion transcript have inferior responses to imatinib

compared to patients with the e14a2 transcript. Haema-

tologica ; 94:1362.

12. Martínez-Mancilla M, Gutiérrez M, de la Rosa GZ,

et al. 2002 Younger age and shorter chronic phase in

b2a2-positive chronic myeloid leukemia adults with

high white blood cell count at diagnosis. Haematolog-

ica ; 87:666.

13. Nowell PC. 1962 The minute chromosome (Phl) in

chronic granulocytic leukemia. Blut ;8:65.

14. Perego RA, Costantini M, Cornacchini G, et al. 2000

The possible influences of B2A2 and B3A2 BCR/ABL

protein structure on thrombopoiesis in chronic myeloid

leukaemia. Eur J Cancer ;36:1395.

15. Ren R. 2005 Mechanisms of BCR-ABL in the patho-

genesis of chronic myelogenous leukaemia. Nat Rev

Cancer ; 5:172.

16. Rosas-Cabral A, Martínez-Mancilla M, Ayala-Sánchez

M, et al. 2003 Analysis of Bcr-abl type transcript and its

BCR-ABL Variants Relation to Different Scores 37

relationship with platelet count in Mexican patients with

chronic myeloid leukemia. Gac Med Mex ;139:553.

17. Shepherd P, Suffolk R, Halsey J, 1995 Analysis of mo-

lecular breakpoint and m-RNA transcripts in a prospec-

tive randomized trial of interferon in chronic myeloid

leukaemia: No correlation with clinical features, cyto-

genetic response, duration of chronic phase, or survival.

Br J Haematol ;89:546.

18. Shtivelman E, Lifshitz B, Gale RP, 1985 Fused tran-

script of abl and bcr genes in chronic myelogenous leu-

kaemia. Nature ; 315:550.

19. Sokal JE, Cox EB, Baccarani M, et al. 1984 Prognostic

discrimination in “good-risk” chronic granulocytic leu-

kemia. Blood ;63:789.

20. Udomsakdi-Auewarakul C, U-Pratya Y, Boonmoh S,

2000 Detection of molecular variants of BCRABL

gene in bone marrow and blood of patients with chronic

myeloid leukemia by reverse-transcriptase polymerase

chain reaction (RT-PCR). J Med Assoc Thai ;83:928.

21. van Dongen JJ, Macintyre EA, Gabert JA, et al. 1999

Standardized RT-PCR analysis of fusion gene tran-

scripts from chromosome aberrations in acute leuke-

mia for detection of minimal residual disease. Report

of the BIOMED-1 Concerted Action: Investigation of

minimal residual disease in acute leukemia. Leukemia;

13:1901.

22. Verschraegen CF, Kantarjian HM, Hirsch-Ginsberg C,

et al. 1995 The breakpoint cluster region site in patients

with Philadelphia chromosome-positive chronic my-

elogenous leukemia. Clinical, laboratory, and prognos-

tic correlations. Cancer ;76:992.

دراسة عالقه بدائل ال بوجودعوامل الخطور

هشام عبد العزيز - أحمد عمر - على الشميرى - محمد كشك

الخلفيه العلميه: الدور الدقيق للبدائل المختلفه ل BCR-ABL فى التسبب فى سرطان الدم الميلودى المزمن (CML) و تأثيرها على ناتج تطور الحاله المرضيه ال يزال يحتاج الى الكثير من الدراسات. األهداف: فى هد الدراسه, حاولنا دراسة وجود عالقه بين االعراض المرضيه و وجود عوامل الخطور و االستجابه للعالج مع بدائل ال BCR-ABL . المواد والطرق: قمنا بدراسه ذات مقطع عرضى فى مركز االورام التابع لمستشفى واحد فى الفتر من يناير 2010 الى ديسمبر 2010 ,على 80 مريض من المترددين على عيادة امراض الدم بمستشفى جامعة الدمام بالمملكه العربيه السعوديه و مصابون

بمرض سرطان الدم الميلودى المزمن. و قد تم التشخيص لجميع المرضى حسب الطرق و المعايير العالميه و ذلك عن طريق دراسة تحليل النخاع العظمى و تحليل العوامل الوراثيه و قد تم التأكد من التشخيص عن طريق تفاعل البلمر العكسى. تم تحليل نتائج المعدالت الطبيه المختلفه و متابعة هؤالء المرضى لمدة 18 شهرا بأثر رجعى. التحليل االحصائى: تم استعمال طريقة ال Box Plot و الرسم البيانى لمعرفة كيفية توزيع العوامل المختلفه. و أيضا تم استعمال ال T-test لدراسة الفرق بين تاثير عوامل الخطورة المختلفه فى مجموعتين من المرضى يحمل كل منهم بديل مختلف لل BCR-ABL. النتائج: ما b2a2 في حين أن ٪41.2 من المرضى أظهرت وجود بديل (b3a2 (e14a2 يقرب من 56.2 ٪ من المرضى يحملوا البديل b2a2 نادرة الحدوث. المرضى الذين يحملون بديل e19b2 الباقي ٪2.5 (اثنين من المرضى) أعربت البديل .((e13a2

أظهروا نسبه أعلى مع تدريج سوكال و تدريج هاسفورد والعالج األوروبي لنظير ممن يحملوا بديل b3a2. وأظهرت معايير المجموعتين. بين بسيط اختالف الطحال وتضخم الدم خضاب البيض، الكريات عدد الدموية، الصفائح عدد مثل مختلفة حقق المزيد من المرضى في المجموعة b2a2 استجابة دموية كاملة في 3 أشهر، ولكنه لم يكن كبيرا أو محقق احصائيا. االستنتاجات: المرضى الذين يحملون البديل b2a2 لل BCR-ABL فى مرضى سرطان الدم الميلودى المزمن تميل إلى

.b3a2 اظهار معدالت أعلى لوجود عوامل الخطور ، ولكن ال تتصرف بطريقة مختلفة إلى حد كبير من نظرائهم

BCR-ABL (b2a2 and b3a2)

CRP AND SERUM AMYLOID A AS MARKERS FOR THE AGGRESSIVENESS OF BREAST CANCER

Rania Elhelely* , Rasha Elzehery* , Mohammed AF Hegazy** and Ramy Faris**

ABSTRACT

Introduction: Chronic inflammation is included in the development and progression of breast cancer. Serum C - reactive

protein (CRP) and serum amyloid A (SAA) are measures of low-grade chronic inflammation. Aim: the present study investi-

gated the possibility to use CRP and SAA as predictors for the aggressiveness of breast cancer. Subjects and methods: serum

CRP and SAA levels were measured in 181 female patients (24-78 years old) with breast cancer and 60 healthy age- matched

control females (33-67years old) using Enzyme-linked Immunosorbent Assay (ELISA) kit. Results: serum CRP levels were

higher in malignant and benign breast lesions than control group but with no statistical significant difference among diseased

groups (P < 0.001). SAA levels were statistically higher in malignant breast lesions than benign and control group (P< 0.001),

but there was no statistical significant difference in its levels between FA and control group (P= 0.57). CRP levels showed no

statistical significant difference between benign breast tumor and stage I cancer breast (P= 0.97). SAA and CRP concentrations

were correlated positively with tumor stages [(r=0.861, P< 0.001) and (r=0.680, P< 0.001)] respectively and with each other

(r=0.628, P< 0.001). Conclusion: SAA can be used as a predictor marker than CRP for malignant breast lesions. Key Words:

Breast Cancer, Serum Amyloid A, C - reactive protein.

Egypt. J. Lab. Med. Vol.(27) No.3, October, 2015 39 - 46

INTRODUCTION

The International Agency for Research on

Cancer (GLOBOCAN 2012) found that breast

cancer (BC) is the world’s most common can-

cer among women, and the most likely cause

of death among them (12). BC is reported as the

most frequent cancer among women in 140 of

184 countries worldwide including China the

world’s most populous country (5). After 1990

the mortality rate of BC has decreased, due to

widespread BC screening and the general use of

anticancer agents (33). The 5-year survival rates

have improved to 98% for early stage and 39%

for late stage BC (28). Thus, early detection is vi-

tal to improve the prognosis of cancer patients

and this requires non-invasive and specific bio-

markers; among them, blood markers may offer

a good surrogate selection.

Chronic inflammation is a key contributor

to cancer development and progression. Cancer

survivors with chronic inflammation may have

an elevated risk of recurrence as a result of the

effects of inflammatory processes on cell growth

or the presence of cancer cells that induce in-

flammation (8).

Clinical and experimental data suggest that

chronic inflammation promotes mammary tu-

mor development through mechanisms involv-

ing chronic activation of humoral immunity and

infiltration of Th2 cells and polarized innate in-

flammatory cells (10) .

Moreover; inflammation associated oxidative

damage could initiate carcinogenesis by causing

inactivating mutations in tumor-suppressor genes

or post-translational modifications in proteins

involved in DNA repair or apoptotic control. In

addition; inflammatory cytokine signaling via

intracellular enzymes and transcription factors

may inhibit apoptosis and promote the growth

and proliferation of cancer cells. Moreover; acti-

vation of inflammatory pathways might enhance

tumor progression by promoting cell motility,

vascular permeability and angiogenesis(8,10,16).

Acute-phase proteins (APPs) generally have

a nonspecific rapid response to such processes as

inflammation/infections, tissue damage, surgery,

myocardial infarction or the presence of tumors.

The relationship between the APPs and cancer

has been well documented in the literature with

numerous investigations reporting an altered

levels of various APPs with different types of

cancers and evidence that many APPs are actu-

ally produced directly by tumor tissue (34).

It has been suggested that APPs were not like-

ly to be specific for any type of cancer and would

be expected to be elevated in all malignancies

Departments of Clinical Pathology* and Surgical Oncology**, Faculty of Medicine, Mansoura University-

Egypt

Elhelely,R. , et al.40

and in inflammatory diseases. Moreover; APPs

were thought unlikely to be tumor-derived and

thus to represent cancer epiphenomena rather

than direct tumor-derived proteins. Proteomics

studies, which profiled the serum proteins of pa-

tients with cancer and those of normal individu-

als, proved that the altered expression of APPs

was different for various types, subtypes, and

even stages of cancer (23).

It is likely that panels of biomarkers in the fu-

ture will be comprised of biomarkers that reflect

tumor-specific proteins together with proteins

from the tumor microenvironment (25).

Serum amyloid A (SAA) is a 12-kD acute-

phase protein which can be induced up to 1000-

fold (22). HDL is the main carrier of SAA in

human(4).

C-reactive protein (CRP) and serum amyloid

A (SAA) are nonspecific, acute-phase, hepatic

proteins secreted in response to cytokines in-

cluding interleukin-1, interleukin-6 and tumor

necrosis factor-α(3).

Previous epidemiologic studies have report-

ed that elevated CRP levels may be associated

with poor prognosis of several types of solid

cancers(1), as endometrial(30), cervical (27), colorec-

tal, pancreatic, hepatocellular, esophageal, renal

cell, bladder, prostate, ovarian, and non-small-

cell lung cancer(24,29).

Up-regulation of SAA was found in a wide

range of malignancies as lung, pancreatic, pros-

tate, colon and gastric cancer(11,19,18,9,7). Previous-

ly; it was considered that the elevation of SAA

in the serum of cancer patients is of liver origin

rather than from tumor cells. However, other re-

searches indicated that some tumor cells (such

as endometrial and colon cancer cells) also syn-

thesize and secrete SAA(7,6). SAA is an inflam-

matory modulator that is involved in cholesterol

metabolism and transport and is important in

cancer progression (21).

The aim of the present study was to deter-

mine whether circulating markers of inflamma-

tion (CRP and SAA) could be used as predictors

for the aggressiveness of breast cancer.

MATERIALS AND METHODS

Materials:

This study was conducted on 181 female

patients (24-78 years old) diagnosed as cancer

breast admitted at Mansoura Oncology Center.

60 healthy age- matched females (33-67) were

taken as a control group. Subjects with a history

of any cancer and those with associated diseases

that might raise serum CRP or SAA (such as in-

fectious diseases, autoimmune conditions, asth-

ma, and osteoarthritis) were excluded.

All studied patients were subjected to full his-

tory taking and thorough clinical examination.

Fine needle aspiration biopsy from breast lesion

was taken for histopathological examination.

Sampling: 5 ml venous blood was obtained

from breast cancer patients and the healthy con-

trols. Serum samples were frozen and maintained

at -80˚C until the assay was conducted. All 120

breast cancer patients and healthy volunteers

signed informed consent forms for sample col-

lection. The study was conducted in accordance

with the guidelines of the Helsinki Declaration.

Methodology: The following investigations

were done to both patients and controls:

*Serum SAA concentrations were determined

using Enzyme-linked immunosorbent assay

(ELISA) kit supplied by Assay pro (3400 Harry

S Truman Blvd St. Charles, MO 63301, USA).

* Serum CRP concentrations were deter-

mined using commercially available ELISA kit

supplied by Abcam (1 Kendall Square, Suite

B2304 Cambridge, MA 02139-1517 USA).

Statistical Analysis: All statistical analyses

were performed using the Statistical Package for

Social Sciences (SPSS) version 17.0 software.

Data were first tested by Kolmogorov-Smimov

test for distribution of data. Description was done

in the form of median and IQR for numerical non-

parametric data, and number and percentage for

categorical data. Kurskal Wallis test was used for

comparison of the studied groups in all variables

followed by comparisons using the Mann Whit-

ney U test. Spearman’s rank correlation was also

used to check the correlation between CRP and

SAA concentrations and stages of breast cancer.

CRP and Amyloid A in Breast Cancer 41

For all tests, p<0.05 was considered to indicate a

statistically significant difference.

RESULTS

According to histopathological examination

of fine needle aspiration biopsy obtained from

different breast lesions included in our study;

we found 44 patients with invasive ductal car-

cinoma (IDC), 43 patients with invasive lobular

carcinoma (ILC), 42 patients with Ductal carci-

noma in situ (DCIS), 32 patients with Mucinous

adenocarcinoma (MC) and 20 patients with Fi-

broadenoma (FA).

Our study found that median CRP levels were

9, 8.3, 7.8, 8.55 and 6.45pg/ml in patients with

IDC, ILC, DCIS, MC and FA respectively vs

3.4 pg/ml in control group (P< 0.001) (Table 1).

When Mann-Whitney test was performed; serum

CRP levels were higher in malignant and benign

breast lesions than control group but with no

statistical significant difference among diseased

groups (Figure 1).

As regards SAA; it was found that its levels

were statistically higher in malignant breast le-

sions than benign and control group. Median

SAA levels were (50, 27, 17.3, 6.95 μg/ml in pa-

tients with IDC, ILC, DCIS and MC vs FA (2.15

μg/ml) and control group (1.9 μg/ml) (P< 0.001)

(Table 1). By Mann-Whitney test; there was a

statistical significant difference among malig-

nant groups and between malignant and both be-

nign and control groups (P ≤ 0.002). In contrast;

there was no statistical significant difference in

SAA levels between FA and control group (P=

0.57). Moreover; SAA levels were directly pro-

portional with aggressiveness of cancer breast

(Figure 1).

According to different stages of cancer

breast; our study included 22 patients in stage

I, 52 patients in stage II, 58 patients in stage

III and 29 patients in stage IV. The results of

the statistical assessment showed the median

serum CRP and SAA concentrations were 6.3

pg/ml and 11μg/ml in stage I, 8.4 pg/ml and

19.7 μg/ml in stage II, 11.2 pg/ml and 31 μg/

ml in stage III and 13 pg/ml and 63.1 μg/ml in

stage IV respectively (P< 0.001) when com-

pared to control group) (Table 2 & Figure 2).

Using Mann-Whitney test; a statistical signif-

icant difference in CRP levels between FA and

control group (P = 0.002) was found, while there

was no statistical significant difference in SAA

between the two groups (P= 0.57). On the other

hand; there were statistical significant differenc-

es as regards SAA levels between benign breast

tumor and cancer breast (P< 0.001). As regards

CRP, there was no statistical significant differ-

ence between benign breast tumor and stage I

cancer breast (P= 0.97), while there were statis-

tical significant differences among higher stages

of cancer breast (P< 0.006).

Moreover; SAA and CRP concentrations

were correlated positively with tumor stages

[(r=0.861, P<0.001) and (r=0.680, P< 0.001)]

respectively (Figure 3&4). CRP levels were cor-

related positively with SAA levels (r=0.628, P<

0.001).

Table (1): Serum levels of SAA and CRP among the studied groups as regard histological type:

Parameter IDC

(n = 44)

ILC

(n = 43)

DC IS

(n = 42)

MC

(n =32 )

FA

(n = 20)

Control

(n = 60) P

SAA (μg/ml)

(median &

Range)

50

( 13 –77)

27

(12-59)

17.3

(8.6-31)

6.95

(3.9-10.5)

2.15

(1.2-3.6)

1.9

(0.9-3.6) < 0.001

CRP (pg/ml)

(median &

Range)

9

(3.1-15.3)

8.3

(4.5-18.2)

7.8

(3.2-14.5)

8.55

(4.5-12)

6.45

(2.4-11)

3.4

(1.1-6.5) < 0.001

Elhelely,R. , et al.42

Table (2): Serum levels of SAA and CRP among different stages of cancer breast:

Parameter IDC

(n = 44)

ILC

(n = 43)

DC IS

(n = 42)

MC

(n =32 )

FA

(n = 20)

Control

(n = 60)

P

SAA (μg/ml)

(median &

Range)

50

( 13 –77)

27

(12-59)

17.3

(8.6-31)

6.95

(3.9-10.5)

2.15

(1.2-3.6)

1.9

(0.9-3.6) < 0.001

CRP (pg/ml)

(median &

Range)

9

(3.1-15.3)

8.3

(4.5-18.2)

7.8

(3.2-14.5)

8.55

(4.5-12)

6.45

(2.4-11)

3.4

(1.1-6.5) < 0.001

Figure (2): Serum levels of CRP and SAA among

different stages of cancer breast.

Figure (3): Concentrations of SAA in controls,

benign breast disease (FA) and breast

cancer patients at various stages of the

disease.

Figure (4): Concentrations of CRP in controls,

benign breast disease (FA) and breast

cancer patients at various stages of the

disease.

Figure (1): Serum levels of CRP and SAA among

different histological types of cancer

breast.

CRP and Amyloid A in Breast Cancer 43

DISCUSSION

Although there have been significant advanc-

es in imaging technology, many breast lesions re-

main indeterminate following conventional eval-

uation. Genomic and proteomic high-throughput

approaches may help in identifying new blood

biomarkers, which provide a convenient, rela-

tively noninvasive approach for diagnosis and

monitoring patients.

Besides the potential of SAA as a cancer

biomarker, the role of SAA in the progression

of neoplastic diseases is of current interest. An

acute immune response may cause an increased

risk of peripheral metastases(17). SAA protein

stimulates the production of various cytokines

by macrophages and can play an important

role in acute immune response, stimulating

tumor metastasis indirectly. It stimulates ma-

trix metalloproteinase- 9 (MMP-9) production

by macrophages(20). These metalloproteinases

(MMPs) are a family of extracellular matrix

degrading proteases that are zinc-dependent

and associated with invasion and metastasis

during tumor progression(31).

In the present study; patients with breast

tumors were classified according to both histo-

pathological examination and clinical staging.

CRP and SAA levels were measured at time of

diagnosis of breast tumor.

According to histopathological classification;

serum CRP levels were higher in malignant and

benign breast lesions than control group but with

no statistical significant difference among dis-

eased groups. These results are not in agreement

with Allin et al(2) who reported that elevated CRP

levels were indeed associated with larger tumor

size, presence of distant metastases, and lower

tumor grade.

Two hypotheses have been proposed to ex-

plain the relationship between CRP level and

cancer. First; it has been suggested that elevated

CRP levels are a result of an underlying cancer.

Second; chronic inflammation and elevated CRP

might have a causal role in carcinogenesis(15).

SAA levels showed statistical significant differ-

ence among malignant groups and between ma-

lignant and both benign and control groups. In

contrast; there was no statistical significant dif-

ference in SAA levels between FA and control

group. Moreover; SAA level was directly pro-

portional with aggressiveness of cancer breast.

Sura et al demonstrated a highly significant in-

crease of SAA concentration in benign and ma-

lignant breast tumors compared to control group

(p<0.001)(32). Chronic inflammation may pro-

mote carcinogenesis through complex processes

such as polarization of M2 tumor-associated

macrophages via cytokines and the subsequent

production of tumor growth factors or promotion

of angiogenesis(10).

Solid tumours typically trigger inflammatory

responses that result in the formation of a pro-

tumourigenic and pro-angiogenic microenviron-

ment around the tumour. Immune and inflamma-

tory cells in the tumour microenvironment inter-

act with malignant cells in a complicated fash-

ion, resulting in stimulation of tumour growth,

invasion, and metastasis(14).

Our study investigated both CRP and SAA

levels in different stages of cancer breast. There

was a statistical significant difference in CRP

levels between FA and control group, while there

was no statistical significant difference between

FA and stage I cancer breast, but statistical sig-

nificant differences appeared in higher stages of

cancer breast.

As regards SAA; there was no statistical

significant difference between FA and control

group, but there were statistical significant dif-

ferences between FA and stage I cancer breast

and the difference increased in higher stages.

These results are nearly similar to a recent study

done by Zhang et al(35) who found no difference

in SAA concentrations among the controls, be-

nign breast lesion and stage I breast cancer pa-

tients, but there was a gradual increase of SAA

concentrations in increasing stages of breast can-

cer patients.

Spearman’s correlation showed that SAA and

CRP concentrations were correlated positively

with tumor stages and with each other.

Other studies have demonstrated that higher

concentrations of SAA were associated with

increasing concentrations of CRP, and that el-

Elhelely,R. , et al.44

evated SAA and CRP were associated with re-

duced disease-free survival and reduced overall

survival in breast cancer patients, regardless of

adjustment for age, tumor stage, race and body

mass index(26,13) .

So, inflammation is closely linked to tumor

progression since inflammation in the tumor

microenvironment stimulates tumor growth,

invasion, and metastasis, inflammation seems

to favors invasion and metastasis more than to

mount an effective host anti-tumour response.(14)

So, inflammatory status may be an important

prognostic factor for breast cancer. Addition-

ally, reduction of the inflammatory reaction by

improving diet quality may benefit breast cancer

survivors(26,13).

Conclusion:

Our results indicated that inflammation plays

a key role in pathogenesis and aggressiveness of

breast cancer. SAA can be used as a predictor

marker than CRP for malignant breast lesions.

Conflict of interests:

The authors have declared no conflict of in-

terest.

Acknowledgments:

We would like to express our sincere grati-

tude to the patients for their co-operation with

us.

REFERENCES 1. Allin KH, Bojesen SE, Nordestgaard BG et al. 2009.

Baseline C-reactive protein is associated with incident

cancer and survival in patients with cancer. J Clin On-

col ; 27:2217.

2. Allin KH, Nordestgaard BG, Flyger H, et al. 2011 Ele-

vated pre-treatment levels of plasma C-reactive protein

are associated with poor prognosis after breast cancer: a

cohort study. Breast Cancer Research ; 13:R55.

3. Arnold PI. 1990 Properties of four acute phase proteins:

C-reactive protein, serum amyloid A protein, alpha

1-acid glycoprotein, and fibrinogen. Semin Arthritis

Rheum.; 20:129.

4. Cabana VG, Feng N, Reardon CA, et al 2004. Influence

of apoA-I and apoE on the formation of serum amyloid

A-containing lipoproteins in vivo and in vitro. J Lipid

Res ; 45: 317.

5. Chen W, Zheng R, Zhang S, et al. 2014 Annual report on

status of cancer in China. Chin J Cancer Res ; 26:48.

6. Cocco E, Bellone S, El-Sahwi K, et al. 2009; Serum

amyloid A (SAA): a novel biomarker for uterine serous

papillary cancer. Br J Cancer 101: 335.

7. Cocco E, Bellone S, El-Sahwi K, et al. 2010 Serum amy-

loid A: a novel biomarker for endometrial cancer. Can-

cer ; 116: 843.

8. Coussens LM, Werb Z .2002 Inflammation and cancer.

Nature ; 420:860.

9. Dai S, Wang X, Liu L, et al .2007 Discovery and iden-

tification of Serum Amyloid A protein elevated in lung

cancer serum. Sci China C Life Sci ;50: 305.

10. De Nardo DG, Coussens LM 2007. Inflammation and

breast cancer: Balancing immune response—Crosstalk

between adaptive and innate immune cells during breast

cancer progression. Breast Cancer Res.; 9:212.

11. Diamandis EP. Identification of serum amyloid a protein

as a potentially useful biomarker for nasopharyngeal

carcinoma. Clin Cancer Res 2004; 5293.

12. Ferlay J, Soerjomataram I, Dikshit R, et al .2015 Cancer

incidence and mortality worldwide: sources, methods

and major patterns in GLOBOCAN 2012 Int J Cancer

; 1;136(5):359.

13. George SM, Neuhouser ML, Mayne ST, et al. 2010;

Postdiagnosis diet quality is inversely related to a bio-

marker of inflammation among breast cancer survivors.

Cancer Epidemiol Biomarkers Prev 19: 2220.

14. Grivennikov SI, Greten FR, Karin M. 2010 Immunity,

inflammation, and cancer. Cell ; 140:883.

15. Heikkila K, Ebrahim S, Lawlor DA. A 2007 systematic

review of the association between circulating concen-

trations of C reactive protein and cancer. J Epidemiol

Community Health ; 61:824.

16. Heikkilä K, Harris R, Lowe G, et al 2009. Associations

of circulating C-reactive protein and interleukin-6 with

cancer risk: findings from two prospective cohorts and

a meta-analysis. Cancer Causes Control; 20 (1):15.

17. Hobson J, Gummadidala P, Silverstrim B, et al.2013

Acute inflammation induced by the biopsy of mouse

mammary tumors promotes the development of metas-

tasis. Breast Cancer Res Treat ; 139: 391.

18. Koomen JM, Shih LN, Coombes KR, et al. 2005 Plas-

ma protein profiling for diagnosis of pancreatic cancer

reveals the presence of host response proteins. Clin

Cancer Res ; 11: 1110.

19. Le L, Chi K, Tyldesley S, et al.2005 Identification of

serum amyloid A as a biomarker to distinguish prostate

cancer patients with bone lesions. Clin Chem ;51: 695.

20. Lee H Y, Kim M K, Park K S, et al. 2005 Serum amy-

loid A stimulates matrix-metalloproteinase-9 upregula-

tion via formyl peptide receptor like-1 mediated signal-

ing in human monocytic cells. Biochem Biophys Res

Commun; 330: 989.

CRP and Amyloid A in Breast Cancer 45

21. Li Y, Cai L, Wang H, et al.2011 Pleiotropic regulation of

macrophage polarization and tumorigenesis by formyl

peptide receptor-2. Oncogene ; 36: 3887.

22. Malle E, Steinmetz A, Raynes JG.1993 Serum amyloid

A (SAA): an acute phase protein and apolipoprotein.

Atherosclerosis ; 102: 131.

23. Miyake H, Muramaki M, Furukawa J, et al.2010 Serum

level of clusterin and its density in men with prostate

cancer as novel biomarkers reflecting disease exten-

sion. Urology ; 75:45.

24. O’Dowd C, McRae LA, McMillan DC, et al. 2010 El-

evated preoperative C-reactive protein predicts poor

cancer specific survival in patients undergoing resec-

tion for non-small cell lung cancer. J Thorac Oncol ;

5:988.

25. Paul D, Colin C, Kim H, et al. 2012 Analysis of acute-

phase proteins, AHSG, C3, CLI, HP and SAA, reveals

distinctive expression patterns associated with breast,

colorectal and lung cancer. Int J Cancer ; 131: 911.

26. Pierce BL, Ballard-Barbash R, Bernstein L, et al .2009

Elevated biomarkers of inflammation are associated

with reduced survival among breast cancer patients. J

Clin Oncol ; 27: 3437.

27. Polterauer S, Grimm C, Tempfer C, et al. 2007 C-reac-

tive protein is a prognostic parameter in patients with

cervical cancer. Gynecol Oncol; 107:114.

28. Redondo M, Rivas-Ruiz F, Guzman-Soler MC, et al.

2008 Monitoring indicators of health care quality by

means of a hospital register of tumours. J Eval Clin

Pract ; 14: 1026.

29. Roxburgh CS, McMillan DC.2010 Role of systemic in-

flammatory response in predicting survival in patients

with primary operable cancer. Future Oncol; 6:149.

30. Schmid M, Schneitter A, Hinterberger S. 2007 Asso-

ciation of elevated C-reactive protein levels with an

impaired prognosis in patients with surgically treated

endometrial cancer. Obstet Gynecol.; 110:1231.

31. Sung H J, Ahn J M, Yoon Y H, et al.2011 Identification

and validation of SAA as a potential lung cancer bio-

marker and its involvement in metastatic pathogenesis

of lung cancer J roteome Res ; 10: 1383.

32. Sura A, Shahla, Aqeel Sh.2014 Inflammatory mark-

ers and risk of breast tumor. J. Chem Pharm Res ;

6(8):357

33. Veronesi U, Boyle P, Goldhirsch A, et al.2005 Breast

cancer. Lancet ; 365: 1727-41.

34. Wood SL, Rogers M, Cairns DA, et al. 2010 Associa-

tion of serum amyloid A protein and peptide fragments

with prognosis in renal cancer. Br J Cancer ; 103:101.

35. Zhang G, Sunx , Lv H, et al. 2012 Serum amyloid A: A

new potential serum marker correlated with the stage of

breast cancer. ONCOLOGY LETTERS; 3: 940.

Elhelely,R. , et al.46

استخدام بروتين ال سي ر بي و بروتين االميلويد A كعالمات لتقدم سرطان الثديرانيا الهاللي - رشا الزهيري - محمد عبد الفتاح حجازي - و رامي فارس

االلتهاب المزمن يعد من االسباب المؤدية لحدوث وتقدم سرطان الثدي. البروتين التفاعلي (CRP) وبروتين األميلويد في الدم (SAA)يمكن استخدامهما كمقياس لدرجة االلتهاب المزمن. تهدف هذI الدراسة الى إمكانية استخدام CRP وSAA كمقياس

لدرجة تقدم سرطان الثدي. تم فى هذI الدراسة قياس مستوى CRP و SAA في الدم في 181 مريضة (78-24 سنة) مصابة بسرطان الثدي و 60 من اإلناث الطبيعيه كمجموعة ضابطة (67-33سنة) باستخدام طريقة االياليزا (ELISA) النتائج :

كانت مستويات CRP أعلى في المرضى الذى لديهم سرطان الثدي وكذلك المرضى اصحاب االورام الحميدة فى الثدى من المجموعة الضابطة ولكن مع عدم وجود فروق ذات داللة إحصائية بين المجموعات المصابة (P <0.001) وكانت مستويات P) أعلى إحصائيا في المرضى اصحاب سرطان الثدي من المرضى اصحاب االورام الحميدة والمجموعة الضابطة SAA

0.001>)، ولكن لم يكن هناك فروق ذات داللة إحصائية في مستوياته بين المرضى اصحاب االورام الحميدة والمجموعة

الضابطة (P = 0.57). أظهرت مستويات بروتين سي التفاعلي CRP)) انه ال يوجد فرق احصائي كبير بين المرضى ذوى االورام الحميدة فى الثدىوى و المرضى ذوى سرطان الثدى مرحلة اولى I (P = 0.97). كما اثبتت الدراسة ان هناك عالقة ايجابية طردية احصائيا بين تراكيزات SAA و CRP مع مراحل الورم المختلفة [(ص = P <0.001 ،0.861) و (ص = P <0.001 ،0.680)] على التوالي ومع بعضها البعض (ص = P <0.001 ،0.628). الخالصة: يمكن استخدام كال من

. CRP اكثر من SAA كمؤشرلدرجة تقدم سرطان الثدى خاصة CRP و SAA

EXPRESSION OF CD69 IN CHRONIC LYMPHOCYTIC LEUKEMIA; RELATION TO PROGNOSIS AND DISEASE PROGRESSION

Mahira I Elmougy* and Ghada M Elgohary**

ABSTRACT

Background: Chronic lymphocytic leukemia (CLL) is a disease characterized by extensive clinical heterogeneity despite a

common diagnostic immunophenotype. CD69 is an integral membrane protein that is expressed in CLL as an early activation

marker. Aim of the work: to evaluate the expression of CD69 in CLL and correlate it with clinical and cytogenetic prognos-

tic markers. Subjects and Methods: the present work was carried on 55 patients diagnosed as CLL in Ain Shams University

Hospitals, 20 hematological matched age and sex normal subjects served as control group. Expression of CD69 was detected

by flow cytometric immunophenotyping. Results: Regarding CD69 expression, there was a significant difference in expression

between patients and control group. 40 patients (73%) out of 55 had positive CD69 expression (≥30%) while 15 patients (27%)

had negative CD69 expression (<30%). Comparative study between positive versus negative expression groups of patients

revealed a significant difference in expression as regarding hemoglobin level, LDH level, CD38 expression, β2 microglobulin

level, advanced disease stage as well as immunoglobulin heavy chain gene mutation. CD69 was significantly associated with

splenomegaly, advanced disease stage, absence of immunoglobulin heavy chain gene mutation as well as increased β2 micro-

globulin level, high CD38 expression and low hemoglobin level. Patients with positive CD69 expression had a significantly

shorter progression free survival than those with negative CD69 expression. Conclusion: CD69 could be considered as a novel

independent prognostic marker which is significantly correlated with poor clinical and biological factors in B-CLL as well as

disease progression. In addition, antiCD69 could be a suitable target for immunotherapeutic intervention.

Departments of Clinical Pathology*, and Clinical Hematology **, Ain Shams University Hospital

Egypt. J. Lab. Med. Vol.(27) No.3, October, 2015, 47 - 55

INTRODUCTION

B-cell chronic lymphocytic leukemia (B-

CLL) is a neoplasm of mature-appearing mono-

clonal B-lymphocytes, it is an incurable disease

characterized by extensive clinical heterogenec-

ity despite a common diagnostic immunophe-

notype (Small mature B cells display CD19+,

CD20+, CD5+, CD23 markers)(32).

Whether defects in the apoptotic pathway

are frequently encountered in a variety of can-

cers, B-CLL represents a paradigm of the tumors

that arise as a consequence of alterations in the

processes leading to programmed cell death(14).

Indeed, B-CLL cells display multiple intrinsic

defects in their apoptotic machinery and dysreg-

ulated production of survival signals from their

microenvironment(4).

The clinical course of patients with B-CLL is

quite variable(33) and the two major clinical stag-

ing systems are unable to prospectively discrimi-

nate an indolent or aggressive course within the

low and intermediate risk categories(1,25). For this

reason, several biological parameters have been

added to the staging systems to differentiate

prognostic subsets (8,9,12,17,22,27).

CD69, also known as activation inducer

molecule (AIM), early activation antigen (EA-

1), is a type II integral membrane protein with

an extracellular C-type lectin domain. CD69 is

not detectable on normal peripheral blood lym-

phocytes, but cell surface expression is upregu-

lated in response to a wide variety of stimuli(20).

CD69 is constitutively expressed on monocytes,

platelets, Langerhans cells and a small percent-

age of resident lymphocytes in the thymus. In

addition CD69 expression is induced very early

upon activation of T and B lymphocytes, NK

cells, macrophages, neutrophils(23). Activation-

induced CD69 expression precedes the expres-

sion of other cell activation markers, such as

CD25(26). Therefore CD69 represents the first

cell surface glycoprotein detected after lympho-

cytes activation. Therefore, the aim of this study

is to investigate the potential merit of detection

of CD69 expression by flowcytometry in B-CLL

as an early activation marker and to correlate it

with other biological and cytogenetic parameters

as well as its independent prognostic value on

disease progression.

El- Mougy, M. & El Gohary,G.M.48

SUBJECTS AND METHODS

Subjects:

The present study was conducted on 55 newly

diagnosed B-CLL patients; who attended to Ain

Shams University Hospitals, during the period

from February 2012 till February 2013. Patients

were 36 males and 19 females with a male to

female ratio of 1.9: 1. Their ages ranged from 53

- 71 years, with a mean of 62±12.73 years. In ad-

dition, twenty hematologically matched age and

sex normal subjects were included as a control

group which included 14 males and 6 females

with a male to female ratio 2.3:1, their ages

ranged from 52-69, with a mean of 60.5±12.02

years. A written consent was obtained from each

patients and control before participation in the

study. Patients were followed up for 30 months.

Methods:

All the patients were subjected to the follow-

ing:

I- Full history and thorough clinical examina-

tion, laying stress on lymphadenopathy, spleno-

megaly and hepatomegaly, Rai staging according

to disease burden and the degree of bone marrow

involvement. II- Abdominal ultrasonography for

spleen, liver and lymph node enlargement.

II- Laboratory investigations: 1- Complete

blood count (CBC) with examination of periph-

eral blood (PB) smears stained with Leishman

stain for lymphocyte count and morphology

(done for both patients and control). 2- Bone

marrow (BM) examination with morphological

examination of Leishman stained smears laying

stress on BM lymphocytes %, 3- immunopheno-

typing (IPT) of bone marrow or whole peripheral

blood using Coulter EPICS-XL flow cytometer,

USA. The following panel of monoclonal anti-

bodies was used: (CD20, CD79b, FMC7, s.IgM,

CD5/CD19, CD10, CD103, CD123, CD23 and

CD38) as well as κ and λ light chains labeled

with either fluorescin isothiocyanate (FITC) or

phycoerythrin (PE). Samples were considered

positive for a marker if ≥ 20% of cells expressed

that marker; except for CD38 positivity which

was considered ≥ 30%, 4- IgVH mutation anal-

ysis by real time polymerase chain reaction 5-

measurement of CD69 expression by flow cy-

tometry using Coulter EPICS-XL, USA (done

for both patients and control).

Sampling:

Two ml peripheral blood were collected

on ethylene diamine tetraacetic “EDTA” (1-2

mg/ml) as an anticoagulant,for complete blood

count (CBC) and Leishman stained smears. One

mL bone marrow or peripheral blood (collected

on EDTA) was used for immunophenotyping

and detection of CD69 expression. For chemical

analysis clotted samples were obtained.

Methods

Surface marker analysis was done on

lysed whole peripheral blood or bone marrow

samples using the following monoclonal antibod-

ies: CD20, CD79b, FMC7, s.IgM, CD5/CD19,

CD10, CD103, CD123, CD23 and CD38) and

Kappa/Lambda light chains as well as CD69.

They were fluorescein isothiocynate (FITC) or

phycoerythrin (PE) labeled supplied by coulter

electronics. Negative isotypic control for deter-

mining the non-specific binding of the MoAbs.

Interpretation:

Positivity threshold for CD69 was defined

as expression of ≥ 30 % of lymphocytes for the

marker(7).

Statistical Analysis:

The processing of data was computed using

SPSS (version 15) IBM compatible PC. Data

were described in the form of number, percentage,

range and median. Student-t test was used to com-

pare two groups regarding quantitative variables.

Receiver operating characteristic (ROC) curve

was used to determine the best cut-off value. Pro-

gression-free survival (PFS) was calculated from

the date of diagnosis to the date of progression(15).

PFS curves were calculated by the Kaplan-Meier

method and comparison between groups was per-

formed by the Log rank test. P values of ≤ 0.05

and ≤ 0.01 were considered significant and highly

significant respectively, in all analyses.

RESULTS

The clinical and laboratory characteristics of

patients are listed in table (1)

Expression of CD69:

Expression Of CD69 in CLL; Relation To Prognosis 49

CD69 was expressed in all B-CLL patients

with a percentage of expression ranged from 4

– 86% with a mean of 44.5±17.5%, in the control

group CD69% expression ranged from 1% - 3%

with a mean of 2.0±1.0% revealing a highly sig-

nificant difference between patients and control

groups (P < 0.001).

A cut off value at 30% was established to

allow the most significant separation and dif-

ferentiation between B-CLL cases with positive

and negative expression. According to this cut

off value, 40 cases (73%) were ≥ 30% for CD69

expression and 15 cases (27%) were < 30% for

CD69 expression.

Comparative study between patients with

positive versus negative CD69 expression:

(Table 2)

A significant difference was detected between

both groups (positive versus negative expression

groups) regarding hemoglobin level (P< 0.001),

LDH level (P= 0.001), CD38% expression (P=

0.022), β2M (P= 0.002), advanced disease stage

(P< 0.001), level as well as IgVH mutation (P<

0.001) while no significant difference could be

detected between both groups regarding other

clinical and laboratory parameters.

Correlation between CD69 expression and

laboratory data among patients (Table 3)

A highly significant positive correlation was

detected between CD69 expression and each of

β2 microglobulin (P=0.013) and CD38 expres-

sion (P= 0.033).

On the other hand, a significantly inverse

correlation was detected between CD69 and Hb

level (p= 0.004).

Relation between CD69 expression and

clinical data as well as Rai stage and IgVH

mutation among patients (Table 4)

A significant relation was detected between

CD69 expression and each of splenomegaly, ad-

vanced Rai stage and absence of IgVH mutation

(P= < 0.001, < 0.001, < 0.001, respectively).

Relation between CD69 expression and

disease progression

Kaplan Meier survival analysis revealed that

patients with positive CD69 expression had a

significantly shorter progression free survival

(PFS) than those with negative CD69 expression

(Log rank 38.860; P< 0.001) (Figure 1).

Combination analysis of CD69 expression

with tumor burden markers (β2M and Rai stage)

revealed that cases with high tumor burden

(β2M > 2 mg/dl, Rai stage III-IV) and negative

CD69 expression had significantly longer PFS

compared to those with high tumor burden and

positive CD69 expression (Log rank 16.728, P<

0.001) (Figure 2).

Table (1): Clinical and laboratory characteristics of studied group of patients

Number of patients 55

Age (years) (53-71), median 60

Males, n(%) 36(65%)

Splenomegaly, n(%) 32(58%)

Lymphadenopathy, n(%) 20(36%)

Hemoglobin (g/dl) 11.095±1.76

Total leucocytic count TLC(x109/L) 90.65±25.5

Platelet count (x109/L) 196.7±56.55

Absolute peripheral blood lymphocyte count (x109/L) 55.975±20.375

Β2-microglobulin (β2M) (mg/dl) 3.725±2.15

Lactate dehydrogenase (LDH) (Iu/L) 401.95±253.15

CD38% 50.05±24.75

IGVH mutation 17(31%)

Rai stage (III-IV) 33(60%)

El- Mougy, M. & El Gohary,G.M.50

Table (2): Comparison between patients with positive versus negative CD69 expression regarding clinical

and laboratory data

ParameterNegative CD69

n = 15

Positive CD69

N = 40

Independent t-test

t p-value

Hemoglobin (g/dl)

Mean±SD12.72±2.60 9.47±0.92 6.917 <0.001

TLC (x109/L)

Mean±SD83.80±20.5 97.5±30.5 1.604 0.115

Platelet count (x109/L)

Mean±SD192.6±54.6 200.8±58.5 0.471 0.639

Peripheral bl. Lymphocyte count (x109/L)

Mean±SD57.56±21.15 54.39±19.6 0.523 0.603

LDH (Iu/L)

Mean±SD271.9±256.3 532±250 3.413 0.001

CD 23%

Mean±SD72.5±16.4 69.3±19.5 0.564 0.575

CD38%

Mean±SD41.6±27.2 58.5±22.3 2.356 0.022

β2M (mg/dl)

Mean±SD2.3 ± 1.1 5.15 ± 3.2 3.359 0.002

Rai stage

I

II

III

IV

12 (80.0%)

2 (13.33%)

1 (6.67%)

0 (0.0%)

0 (0.0%)

8 (20.0%)

20 (50.0%)

12 (30.0%)

42.132 < 0.001

IgVH mutation

Present

Absent

12 (80.0%)

3 (20.0%)

5 (12.5%)

35 (87.5%)23.275 < 0.001

Table (3): Correlation between CD69 expression and laboratory data among patients

ParameterCD69 expression

R P value

TLC (x109/L) 0.054 0.609

Hemoglobin (g/dl) -0.559 0.004

Platelet count (x109/L) 0.244 0.316

Peripheral bl. Lymph (x109/L) 0.211 0.311

β2M (mg/dl) 0.491 0.013

CD23 0.391 0.53

CD38 0.428 0.033

Table (4): Relation between CD69 expression and clinical data as well as Rai stage and IgVH mutation

among patients

Variable No.% of CD69(Mean±SD)

T-test P-value

Splenomegaly

27.810 <0.001Negative 23 18±5.4

Positive 32 69±7.5

Lymphadenopathy

1.624 0.110Negative 35 42±6.9

Positive 20 45±6

Rai stage

21.669 <0.001I, II 22 22±4.3

III, IV 33 65±8.6

IgVH mutation

26.854 <0.001Negative 38 69±6.6

Positive 17 18±6.3

Expression Of CD69 in CLL; Relation To Prognosis 51

Median SE Log rank P-value

Negative CD69 24.0 0.938.860 < 0.001

Positive CD69 10.0 0.3

Fig. (1): Kaplan Meier survival curve showing PFS of CD69 (positive and negative expression)

Median SE Log rank P-value

Negative CD69 18.00 1.8916.728 < 0.001

Positive CD69 9.00 0.38

Fig. (2): Kaplan Meier survival curve showing PFS of CD69 (positive and negative expression) in combina-

tion with tumor burden markers (β2M and Rai stage)

El- Mougy, M. & El Gohary,G.M.52

DISCUSSION

In the present work, regarding CD69 expres-

sion, the threshold of positivity was set at 30%

to identify patients with positive and negative

CD69 expression. Mean CD69% was signifi-

cantly higher in B-CLL patients compared to the

control group. This comes in accordance with a

study done by. Del Poeta et al.(7) who stated that

the optimal cut off for CD69 expression yielding

the best separation of CLL patients into 2 sub-

sets with significantly different prognosis was

fixed at 30% of positive cells (3,7,12,19). The same

comes in accordance with Gattei et al.(12). Krober

et al.(19) and Bomben et al. (3).

In our study 40(73%) patients out of 55 pa-

tients had CD69% expression ≥ 30% and were

identified to have a positive expression, while 15

(27%) patients had < 30% CD69 expression and

were identified as negative expression group.

Similarly, Smilveska et al.(30) showed that

64.3% of their CLL cases were CD69 positive.

In this work, comparative study between

patients with negative versus positive CD69

expression revealed a significant difference de-

tected among them regarding hemoglobin level,

LDH level, CD38 expression, β2M level, IgVH

mutation as well as advanced disease stage. As

patients with positive CD69 expression were as-

sociated with a lower hemoglobin, higher LDH,

β2M levels, CD38 expression, absence of IgVH

mutation as well as advanced disease stage com-

pared to those with negative CD69 expression.

While no significant difference could be detected

regarding other parameters.

Damle et al.(5) and Smilevska et al.(30) stated

in their studies that advanced disease stage is

significantly associated with positive CD69 ex-

pression.

In our study, a highly significant association

was detected between CD69 expression and sple-

nomegaly. This comes in accordance with Del

Poeta et al. (7) who found that CD69 expression is

significantly associated with spelnomegaly.

Also, significant association was detected be-

tween CD69 expression and each of CD38 ex-

pression and unmutated IGVH, this was similarly

detected by Del Poeta et al. (7) who reported that

CD69 expression was significantly related with

CD38, CD49d, ZAP-70 and unmutated IgVH.

In our work, the significant association be-

tween positive CD69 expression and many of

the poor clinical and biological standard prog-

nostic factors as splenomegaly, high CD38 ex-

pression increased β2M level, advanced disease

stage, low Hb level as well as unmutated IgVH

strongly suggests its beneficial utility as an in-

dependent poor prognostic factor in B-CLL. In

agreement with our work, Grund et al.(13) showed

in their study that negative CD69 expression was

associated with mutated IgVH. The concordance

between CD69 positivity and mutation status

was 96%, since it is well known that patients

with unmutated IgVH genes have a worst prog-

nosis and decreased survival compared to those

with mutated IgVH genes.

Herishanu et al. (16) and Walsby et al.(31) stated

that CD69 has been found to be stronger predictor

of CLL prognosis. In our study, patients with pos-

itive CD69 expression had a significantly shorter

PFS than those with negative CD69 expression,

this was in agreement with Del Poeta et al.(7)

who demonstrated that CD69 expression was an

independent risk factor for PFS and OS in their

large series of CLL patients. CD69 was found to

be upregulated on cells in the tissue microenivo-

ronment, both in bone marrow (BM) and lymph

nodes (LN). Interestingly, stronger upregulation

of CD69 was also found in LN-resident com-

pared with BM-resident CLL cells and LN-de-

rived cells showed an increase in BCR signature

genes compared with those from the BM and the

P.B(16). Moreover, because CD69 is involved in

retaining lymphocytes at the site of stimulation (18,28,29), the levels of this molecule on circulating

B-CLL cells might be less than those in the solid

tissue (BM and LN) and, therefore, might indi-

cate that B-CLL cells expressing CD69 are recent

emigrants from such sites. Tumor proliferation,

quantified by the expression of E2F and c-MYC

target genes and verified with Ki67 staining by

flow cytometry was highest in the LN and was

correlated with clinical disease progression (6).

Thus CD69 appear to offer an easy to perform

and reliable marker both of progression and poor

Expression Of CD69 in CLL; Relation To Prognosis 53

outcome in CLL. In the present work, combined

analysis of CD69 expression with tumor burden

markers (β2M and Rai stage) revealed that cases

with high tumor burden (β2M > 2 mg/dl, Rai

stage III-IV) and negative CD69 expression had

significantly longer PFS compared to those with

high tumor burden and positive CD69 expres-

sion (Log rank 16.728, P< 0.001). This comes in

agreement with Del Poeta et al.(7) who had done

a multivariate analysis of PFS and OS, in which

entered Rai stages, ZAP-70 beta-2 microglobu-

lin, CD38 and CD69 resulted to be independent

prognostic factors.

Interestingly, Gattei et al.(12) made a combined

analysis of CD69 with CD38 or CD49d or ZAP

-70 where they demonstrated that CD69 expres-

sion had true additive properties, allowing us

to identify CLL subsets (CD69-CD38-;CD69-

CD49d-, CD69-ZAP-70; CD69-M IgVH) pre-

senting a very good outcome with regard to PFS

and OS. Conversely, double positive (CD69+

CD38+, CD69+ CD49d+, CD69+ ZAP- 70+

subsets) and CD69 positive UM IgVH patients

showed the worst outcome. Moreover, CD69

was also necessary to correctly prognosticate the

active/progressive disease status than CD38 and

ZAP-70. Furthermore, they stated that CD69 is

easily analyzed with flow cytometry and well

suited for routine analysis.

Significant progress is being made in aug-

menting specific immune effector functions in

experimental tumor therapy, particularly using

monoclonal antibodies (mAbs)(24).

Mechanisms of NK-cell cytotoxicity activation

by costimulatory molecules have been described

and new studies reveal novel roles for regulatory

molecules on NK cells. Similarly, mAb CD69

promotes NK cytolytic activity in the presence or

absence of the tumor microenvironment. Conse-

quently, in vivo treatment with anti-CD69 mAbs,

in either preventative or therapeutic settings, is

efficient in promoting NK-cell-dependent tumor

elimination. Importantly, this occurs in the face of

significant levels of TGF-β made by the tumors

themselves (21).

Furthermore, CD69 targeting by a non-de-

pleting anti-CD69 antibody similarly increases

anti-tumor responses by enhancing NK cell ac-

tivity, and treatment of NK cells with this anti-

body results in increased cytotoxic activity and

IFN-γ production, CD69 thus regulates anti-tu-

mor immune responses by modulating the ex-

pression of various cytokines, including TGF-β

and IFN-γ (11).

In conclusion, CD69 is significantly correlat-

ed with poor clinical and biological factors in B-

CLL as well as disease progression which could

be considered as a novel independent prognostic

marker determined by flowcytometry. This sup-

ports its utility in routine laboratory assessment

and, possibly, in a prognostic scoring system for

B-CLL. Moreover, anti-CD69 could be a suit-

able target for immunotherapeutic intervention.

REFERENCES1. Binet, J. L., Auquier, A., Dighiero, G., et al. (1981). A

new prognostic classification of chronic lymphocytic

leukemia derived from a multivariate survival analysis.

Cancer 48, 198.

2. Binet, J. L., Lepoprier, M., Dighiero, G., et al. (1977).

A clinical staging system for chronic lymphocytic leu-

kemia: prognostic significance. Cancer 40, 855.

3. Bomben, R., Dal Bo, M., Zucchetto, A., et al. (2005).

Mutational status of IgV(H) genes in B-cell chronic

lymphocytic leukemia and prognosis: percent muta-

tions or antigen-driven selection? Leukemia 19, 1490.

4. Burger, J. A. (2011). Nurture versus nature: the micro-

environment in chronic lymphocytic leukemia. Hema-

tology Am Soc Hematol Educ Program, 96-103.

5. Damle, R. N., Ghiotto, F., Valetto, A., et al. (2002). B-

cell chronic lymphocytic leukemia cells express a sur-

face membrane phenotype of activated, antigen-experi-

enced B lymphocytes. Blood 99, 4087.

6. Damle, R. N., Temburni, S., Calissano, C., et al. (2007).

CD38 expression labels an activated subset within

chronic lymphocytic leukemia clones enriched in pro-

liferating B cells. Blood 110, 3352.

7. Del Poeta G, D. P. M., Zucchetto A, Buccisano F, et al.

(2010). CD69 and CD79B overexpression identity poor

risk chronic lymphocytic leukemia. (Haematologica,)

95(suppl 2):317.

8. Del Poeta, G., Maurillo, L., Venditti, A., et al. (2001).

Clinical significance of CD38 expression in chronic

lymphocytic leukemia. Blood 98, 2633.

9. Dohner, H., Stilgenbauer, S., Benner, A., et al. (2000).

Genomic aberrations and survival in chronic lympho-

cytic leukemia. N Engl J Med 343, 1910.

10. Dohner, H., and Stilgenbauer, S. (2002). V(H) mutation

status, CD38 expression level, genomic aberrations,

and survival in chronic lymphocytic leukemia. Blood

100, 1410.

El- Mougy, M. & El Gohary,G.M.54

11. Esplugues, E., Vega-Ramos, J., Cartoixa, D., et al.

(2005). Induction of tumor NK-cell immunity by anti-

CD69 antibody therapy. Blood 105, 4399.

12. Gattei, V., Bulian, P., Del Principe, M. I., et al. (2008).

Relevance of CD49d protein expression as overall sur-

vival and progressive disease prognosticator in chronic

lymphocytic leukemia. Blood 111, 865.

13. Grund Sofia, B. O., Margareta Jernas, Stefan Jacobsson

et al (2010). CD69 is a good surrogate marker for IgVH

gene mutation status in Swedish chronic lymphocytic

leukemia (CLL) patients. Acta Haematologica Polonica

41, 57.

14. Haiat, S., Billard, C., Quiney, C., et al. (2006). Role

of BAFF and APRIL in human B-cell chronic lympho-

cytic leukaemia. Immunology 118, 281.

15. Hallek, M., Cheson, B. D., Catovsky, D., et al. (2008).

Guidelines for the diagnosis and treatment of chronic

lymphocytic leukemia: a report from the International

Workshop on Chronic Lymphocytic Leukemia updat-

ing the National Cancer Institute-Working Group 1996

guidelines. Blood 111, 5446.

16. Herishanu, Y., Perez-Galan, P., Liu, D., et al. (2011).

The lymph node microenvironment promotes B-cell

receptor signaling, NF-kappaB activation, and tumor

proliferation in chronic lymphocytic leukemia. Blood

117, 563.

17. Keating MJ, L. S., Kantarjian H, Freireich EJ, et al.

(1995). The serum β2-microglobulin level is more

powerful than stage in predicting response and survival

in chronic lymphocytic leukemia. Paper presented at:

Blood.,86 Abstract 606

18. Kishimoto, T. K., Jutila, M. A., and Butcher, E. C.

(1990). Identification of a human peripheral lymph

node homing receptor: a rapidly down-regulated adhe-

sion molecule. Proc Natl Acad Sci U S A 87, 2244.

19. Krober A, Seller T, Benner A, et al. (2002): V(H) muta-

tion status, CD38 expression level, genomic aberrations,

and survival in chronic lymphocytic leukemia. Blood,

100(4):1410.

20. Lauzurica, P., Sancho, D., Torres, M., et al. (2000). Phe-

notypic and functional characteristics of hematopoietic

cell lineages in CD69-deficient mice. Blood 95, 2312.

21. Lee, K. M., McNerney, M. E., Stepp, S. E., et al. (2004).

2B4 acts as a non-major histocompatibility complex

binding inhibitory receptor on mouse natural killer

cells. J Exp Med 199, 1245.

22. Montserrat, E., Sanchez-Bisono, J., Vinolas, N., et al.

(1986). Lymphocyte doubling time in chronic lympho-

cytic leukaemia: analysis of its prognostic significance.

Br J Haematol 62, 567.

23. Murata, K., Inami, M., Hasegawa, A., et al. (2003).

CD69-null mice protected from arthritis induced with

anti-type II collagen antibodies. Int Immunol 15, 987.

24. Ostrand-Rosenberg, S. (2004). Animal models of tumor

immunity, immunotherapy and cancer vaccines. Curr

Opin Immunol 16, 143.

25. Rai, K. (1987). A critical analysis of staging in CLL.

Chronic Lymphocytic Leukemia, Vol vol 59., (New

York, NY: Liss: UCLA Symposium and Cellular Biol-

ogy New Series).

26. Reddy, M., Eirikis, E., Davis, C., et al. (2004). Compar-

ative analysis of lymphocyte activation marker expres-

sion and cytokine secretion profile in stimulated human

peripheral blood mononuclear cell cultures: an in vitro

model to monitor cellular immune function. J Immunol

Methods 293, 127.

27. Sarfati, M., Chevret, S., Chastang, C., et al. (1996).

Prognostic importance of serum soluble CD23 level in

chronic lymphocytic leukemia. Blood 88, 4259.

28. Shiow, L. R., Rosen, D. B., Brdickova, N., et al..

(2006). CD69 acts downstream of interferon-alpha/beta

to inhibit S1P1 and lymphocyte egress from lymphoid

organs. Nature 440, 540.

29. Simms, P. E., and Ellis, T. M. (1996). Utility of flow

cytometric detection of CD69 expression as a rapid

method for determining poly- and oligoclonal lympho-

cyte activation. Clin Diagn Lab Immunol 3, 301.

30. Smilevska, T., Stamatopoulos, K., Samara, M., et al.

(2006). Transferrin receptor-1 and 2 expression in

chronic lymphocytic leukemia. Leuk Res 30, 183.

31. Walsby, E., Buggins, A., Devereux, S., et al. (2013).

Development and characterization of a physiologically

relevant model of lymphocyte migration in chronic

lymphocytic leukemia. Blood 123, 3607.

32. Wang, L., Lawrence, M. S., Wan, Y., et al. (2011).

SF3B1 and other novel cancer genes in chronic lym-

phocytic leukemia. N Engl J Med 365, 2497.

33. Zwiebel, J. A., and Cheson, B. D. (1998). Chronic

lymphocytic leukemia: staging and prognostic factors.

Semin Oncol 25, 42.

Expression Of CD69 in CLL; Relation To Prognosis 55

ظهور بروتين فى سرطان الدم الليمفاوى المزمن وعالقته بالتنبو بمسار و تقدم المرض مهير@ الموجى - غاد@ الجوهرى

يعتبر سرطان الدم اليمفاوى المزمن احد االمراض التى تتميز بمجموعه متجانسه من الخصائص االكلينيكيه على الرغم من اشتراكها جميعا فى نمط ظاهرى مناعى واحد عند التشخيص ويعد CD69 احد البروتينات الغشائيه المتكامله ويظهر فى حاالت سرطان الدم اليمغاوى المزمن بمثابه عالمه تنشيط مبكرT الهدف من الدراسه : تم اجراء الدراسه بهدف تقيم ظهور الخلويه والوراثيه االكلينيكيه التنبؤ بعالمات ذلك وربط CLL المزمن الليمفاوي الدم سرطان جاالت بروتين CD69في الحاالت وطرق البحث : تم اجراء الدراسه الحاليه علي 55 مريض ممن اكد التشخيص اصابتهم بسرطان الدم الليمفاوي والنوع العمر في المتوافقين االصحاء االشخاص من اخرين 20 الي ,باالضافه شمس عين جامعه بمستشفيات المزمن

كمجموعه ضابطه . وتم الكشف عن ظهور بروتينCD69 بواسطه النمط الظاهري للتدفق الخلوي المناعي .النتائج :كشفت الدراسه عن ظهور بروتين CD69 في جميع مرضي سرطان الدم الليمفاوي المزمن , وكان هناك اختالف كبير في درجه الظهور بين المرضي والمجموعه الضابطه . حيث كانت نسبه الظهور بروتين CD69 مرتفعه (≤ من 30% CD69>) لدي 40 مريضا من بين 55 مريضا (%73) في حين اظهر 15 مريضا (%27 ) انخفاض في نسبه ظهور%30) . وكشفت المقارنه بين مجموعتي الظهور المنخفض والمرتفع اختالفا كبيرا في مستوي الظهور فيما يتعلق بمستوي

الهيموجلبين ومستوي انزيم نازعه الهيدروجين(LDH ) وبروتين CD38 ومستوي الميكروجلوبولين β2ومرحله تقدم CD69 بروتين بين موجبا ارتباطا الدراسه واظهرت . السلسله ثقيل المناعي للجلوبولين الجينيه Tالطفر وكذلك المرض وبين تضخم الطحال , ومستويβ2 الميكروجلوبولين وظهور بروتين CD38 فضال عن المرحله المتقدمه للمرض ,في حين كان هناك ارتباط عكسي مع مستوي الهيموجلوبين وكذلك التحور او الطفرT الجينيه للجلوبولين المناعي ثقيل السلسله .واظهرت الدراسه قصر فترT البقاء علي قيد الحياT مع عدم تقدم المرض لدي المرضي الذين يعانون من ارتفاع ظهور بروتين

عن غيرهم . الخالصه :يمكن اعتبار بروتين CD69 عالمه تنبؤيه مستقله جديدT والتي ترتبط بشكل كبير مع العوامل االكلينيكيه والبيولوجيه السيئه في حاالت سرطان الدم الليمفاوي بي B-CLL)) فضال عن تطور المرض وباالضافه الي

ذلك , يمكن ان اعتبار مضادات بروتين CD69هدقا مناسبا للتدخل بالعالج المناعي

COMBINED ANALYSIS OF LEVELS OF SERUM B-CELL ACTIVATING FACTOR AND A PROLIFERATION INDUCING LIGAND IN B-CELL

CHRONIC LYMPHOCYTIC LEUKEMIA; CORRELATION WITH CLINICAL FEATURES AND DISEASE PROGRESSION

Mahira I Elmougy* and Ghada M. Elgohary**

ABSTRACT Background: B-cell activating factor (BAFF) and a proliferation inducing ligand (APRIL) are involved in normal B-cell

survival and differentiation. Aim of the work: to evaluate the role of BAFF and APRIL in B-CLL and their prognostic relevance.

Subjects and Methods: 50 patients diagnosed as CLL and 30 age and sex-matched healthy controls were enrolled into this study

for assessment of serum BAFF and APRIL levels by enzyme linked Immunosorbent assay (ELISA). Results: In CLL-patients,

median serum BAFF level was significantly lower than in healthy controls, whereas serum APRIL was significantly higher than

in healthy controls. BAFF was significantly correlated to platelet count, CD5 expression, peripheral blood lymphocyte count

and bone marrow infiltration. Moreover BAFF level was significantly lower in patients with stage C Binet staging system than

those in group B and group A. APRIL serum level was significantly correlated with CD38 expression as well as advanced clini-

cal stage. Combined analysis of BAFF and APRIL serum levels emerged as an independent predictor of disease progression.

Conclusion: Our results suggest that the combined analysis of serum BAFF and APRIL seems to be a reliable predictor of B-

CLL, and highlights its importance in identifying patients at a higher risk of progression.

Departments of Clinical Pathology* and Clinical Hematology**, Internal Medicine, Ain shams University

Hospital

Egypt. J. Lab. Med. Vol.(27) No.3, October, 2015, 57 - 64

INTRODUCTION

Chronic lymphocytic leukemia (CLL) is

characterized by the progressive accumulation

of monoclonal B-cells with a distinctive im-

munophenotype (i.e. CD5+ CD19+, CD20 dim,

CD23+, sm Ig dim) in peripheral blood, bone

marrow, and the lymphoid tissues(14). This accu-

mulation is mainly due to a defective regulation

of programmed cell death(5). CLL cells express

high levels of antiapoptotic proteins such as Bcl-

2 and Bcl-xL(28). However, CLL cells undergo

spontaneous apoptosis in vitro, which reflects

the requirement of external factors (i.e. micro-

environment signals for survival of the CLL

clone(6).

Currently, most patients with CLL are diag-

nosed in early, stable phases of their disease, but

all of them eventually progress. Factors that pre-

dict disease progression not only are clinically

useful but also pinpoint biological mechanisms

that underlie the disease process and which may

be amenable to therapeutic intervention.

BAFF (B cell activating factor of the TNF fam-

ily) /BlyS (B lymphocyte stimulator) and APRIL

(a proliferation-inducing ligand) belong to the

TNF ligand superfamily and share several biolog-

ical characteristics and functions (2,18). Both BAFF

and APRIL bind with high affinity two members

of TNF-receptor superfamily), BCMA (B-cell

maturation antigen) and TACI (Transmembrane

activator and calcium modulator and cyclophilin

ligand interactor), BAFF, but not APRIL, inter-

acts with the third receptors named BAFF recep-

tor (BAFF-R/BR3)(30). BAFF, APRIL and their

receptors are crucial for the survival of normal B

lymphocytes. Both factors play an important role

in the control of their maturation and differentia-

tion into Ig-secreting cells. Defects in the synthe-

sis of these molecules or expression of their re-

ceptors have been associated with various B cell

malignancies (18,30). BAFF and APRIL were found

to protect B-CLL cells from spontaneous and

drug-induced apoptosis and to enhance cell sur-

vival (16). These findings suggest that BAFF and

APRIL may be involved in the pathogenesis of

B-cell chronic lymphocytic leukemia (B-CLL).

The aim of our study was to investigate the

role of BAFF and APRIL in the pathogenesis and

prognosis of B-CLL by assessment of correlation

between their expression and clinical and labora-

tory parameters.

Elmougy, M. I & Elgohary G.M.58

Moreover, we have been interested to study

the relationship between BAFF, APRIL and some

prognostic factors as CD38 expression which is

a known poor prognostic factor in B-CLL(7).

SUBJECTS AND METHODS

Fifty patients with B-CLL attending the clini-

cal hematology and oncology unit, Ain Shams

University Hospital, from August 2011 to Febru-

ary 2013, and 30 age- and sex matched healthy

controls were enrolled into this study. Patients

included 32 males and 18 females, with a male to

female ratio of 1.8:1. Their median age at diagno-

sis was 71 years (range 55-86 years). The control

group included 18 males and 12 females (ratio,

1.5:1) with a median age of 65 years (range 51-

79 years). A written consent was obtained from

each patient and control before participation in

the study. All patients were subjected to :

i) Full history and physical examination.

ii) Complete blood count.

iii) Laboratory investigations including blood

urea nitrogen and uric acid.

iv) Pelvi-abdominal ultrasound.

v) Immunophenotyping using flowcytom-

etry.

vi) Bone marrow aspiration and examina-

tion.

vii) Measurement of circulating BAFF and

APRIL serum levels using quantitative ELISA

technique.

§ Patients were followed up for 24 months

The staging of B-CLL was based according

to the Binet staging system.

Methods

Sample collection: Peripheral blood and

BM samples were collected on ethylene diamine

tetra-acetic acid (EDTA) (1.2 mg/ml) for mor-

phological and immunophenotypic determina-

tion. For chemical analyses and assessment of

serum BAFF and APRIL levels, clotted samples

were obtained. Serum was isolated and stored at

-20°C till subsequent use in ELISA for BAFF

and APRIL.

BAFF and APRIL serum concentrations by

enzyme linked immunosorbent assay (ELISA):

Serum samples from B-CLL patients and

healthy controls were analyzed by ELISA kit

for human BAFF and APRIL using commercial

ELISA kits: Quanticine human BAFF immuno-

assay (R&D systems) and human APRIL ELISA

(Bender MED systems). According to manufac-

turer’s instructions. Human BAFF or APRIL

specific-specific polyclonal antibodies were pre-

coated onto 96-well plates. The human specific

detection monoclonal antibodies were biotinyl-

ated. The test samples and biotinylated detection

antibodies were added to the wells subsequently

and then followed by washing with PBS or TBS

buffer, Avidin-Biotin-Peroxidase complex was

added and unbound conjugates were washed

away with PBS or TBS buffer and substrate was

added. The colour developed is proportioned to

the amount BAFF or APRIL bound. The reaction

is stopped and the intensity of the yellow color

is measured Spectrophotometrically at a wave

length of 450 nm. The concentration of BAFF

or APRIL in the samples was then determined

Table (1): Binet clinical stage system (15)

Stage Clinical features Overall survival years

ALymphocytosis in peripheral blood and bone marrow and < 3 lymphoid regions involved. No anemia, no thrombocytopenia

12

B

Lymphocytosis in peripheral blood and bone marrow and > 3 lymphoid regions involved. With or without splenomegaly and/or hepatomegalyNo anemia, no thrombocytopenia

7

CLymphocytosis with anemia (hemoglobin level < 11 g/dL in male and < 10 g/dL in female) or thrombocytopenia (platelet count < 100 x 109/L)

2-4

BAFF and APRIL in CLL; Correlation with Disease Progression 59

by comparing the optical density of the samples

to the standard curve. Results are reported in ng/

ml.

Statistical analysis

The processing of data was computed using

SPSS (version 15) IBM compatible PC. Data

were described in the form of number, percent-

age, range and median. Student-t test was used

to compare two groups. Receiver operating char-

acteristic (ROC) curve was used to determine

the best cut-off value. Progression-free survival

(PFS) was calculated from the date of diagnosis

to the date of progression (1). PFS curves were

calculated by the Kaplan-Meier method and

comparison between groups was performed by

the Log rank test. P values of ≤ 0.05 and ≤ 0.01

were considered significant and highly signifi-

cant respectively, in all analyses.

RESULTS

The clinical characteristics of patients with

CLL are listed in table (2).

BAFF and APRIL serum levels (Table 3)

In patients with CLL, the median serum

BAFF level was 1.12 ng/ml (range 0.10-2.16),

significantly lower than in healthy controls [2.95

ng/ml (range 2.5-3.91); P=0.012]. Whereas se-

rum APRIL was significantly higher than in

healthy controls [11.4 ng/ml (4.8-18.5) versus.

6.54 ng/mL (2.1-10.8); P= 0.042]. The receiver

operating characteristics (ROC) curve identi-

fied a cut-off value equal to 2.15 ng/ml and 4.5

ng/mL to categorize patients with low and high

BAFF and APRIL levels, respectively.

Correlation between BAFF and laboratory data among patients (Table 4)

Table (2): Clinical characteristics of studied group of patients with CLL

Number of patients 50Age (years) 71(55-86)Males, n(%) 32(64%)Hepatomegaly, n(%) 39(78%)Splenomegaly, n(%) 41(82%)Lymphadenopathy, n(%) 12(24%)Hemoglobin (g/dL) 10.21±1.4TLC (x109/L) 77.48±80.21Absolute lymphocytic count (x109/L) 41.32±23.51Platelet count (x109/L) 115.31±60.28Binet stage

A

B

C

22(44%)

13(26%)

15(30%)BUN (mg/dl) 15.50±8.21Uric acid (mg/dL) 6.97±0.71

Table (3): BAFF and APRIL serum levels in patients and control groups.

Parameter Patients group Control group P value

BAFF (ng/ml)

0.012Median 1.12 2.95

Range 0.10-2.16 2.5-3.91

APRIL (ng/ml)

0.042Median 11.4 6.54

Range 4.8-18.5 2.1-10.8

Table (4): Correlation between BAFF level and laboratory data among patients

PatientsBAFF

r P valueHemoglobin (g/dl) 0.088 0.600

Total leucocytic count (x109/L) -0.126 0.430Peripheral blood lymphocyte count -0.419 0.009*

Platelet count (x109/L) 0.905 0.035*BM infiltration (%) -0.450 0.021*

CD5% 0.443 0.005*CD23% -0.187 0.370FMC7% -0.340 0.096CD79% 0.280 0.175

BUN (mg/dl) 0.442 0.457Uric acid (mg/dl) .494 0.398

Elmougy, M. I & Elgohary G.M.60

Table (5): Correlation between APRIL level and laboratory data among patients

PatientsAPRIL

r P value

Hemoglobin (g/dl) -0.025 0.0903

Total leucocytic count (x109/L) 0.118 0.366

Peripheral Blood lymphocyte count 0.185 0.366

Platelet count (x109/L) -0.097 0.637

BM infiltration (%) 0.202 0.322

CD5% -0.204 0.319

CD23% 0.154 0.804

FMC7% 0.136 0.508

CD79% -0.208 0.737

CD38% 0.996 <0.001*

Binet staging system (advanced stage) 0.421 0.004*

Fig. (1): Progression-free survival analy-

sis of combined BAFF and APRIL

serum levels.

There was a significant positive correla-

tion between BAFF values and each of platelet

count and CD5 expression (P=0.012 and 0.001

respectively). While there was a significant in-

verse correlation between BAFF values and each

of peripheral blood lymphocyte count and BM

infiltration (p=0.022 and 0.03 respectively). On

the other hand, there was no significant corre-

lation between BAFF and other parameters as

total leucocyte count, hemoglobin level, CD23,

FMC7, CD79, BUN and uric acid.

According to Binet staging system, B-CLL

patients were subdivided into three subgroups

(A,B,C) BAFF level was highly significantly

lower in group C than group B and A as median

was 0.078 in group C, 0.83 in group B and 2.1 in

group A (P=0.005). This reveals that BAFF level

decreased with advanced stages of CLL.

Correlation between APRIL level and lab-oratory data among patients (Table 5)

High serum levels of APRIL were signifi-

cantly correlated with a high CD38 expression

as well as advanced clinical stage (Binet stag-

ing system) (P=0.03, 0.01 respectively). While,

no significant correlation was detected between

APRIL level and other parameters.

The risk of progression was assessed by

combing BAFF and APRIL serum levels, three

different groups were identified: a low risk group

(high BAFF and low APRIL), a high risk group

(low BAFF and high APRIL), and an intermedi-

ate risk group (not fitting the two former catego-

ries).

Survival analysis (Figure 1) revealed that

high risk group patients had a significantly

shorter PFS [median 5.5 months, 95% CI 4.99-

6.01] compared to those of low and intermediate

risk groups [median 17.15, 10.5 months, 95% CI

14.31-19.99 and 8.22-12.78] respectively (Log

rank 65.11; P < 0.001).

BAFF and APRIL in CLL; Correlation with Disease Progression 61

DISCUSSION

Despite homogenicity of B-CLL at the cel-

lular level, it is clinically heterogenous; some

patients survive for a long time without therapy,

while others progress towards more advanced

stages and die despite aggressive treatment (8).

Several reliable prognostic markers were

found to be capable of predicting the progression

and outcome of the disease from its early stages

including age, sex, lymphocyte morphology,

lymphocyte doubling time, serum factors, im-

munophenotyping and cytogenetic finding (21).

In recent years molecular and cellular mark-

ers have helped to predict the prognosis of CLL

patients. A combined panel of FISH probes are

available now and can identify genomic aberra-

tion in approximately 80% of CLL cases using

a 4-probe panel for the detection of deletion of

13q14, 17p13, 11q22-23 and trisomy 12 (31).

Recent years have witnessed increasing inter-

est in BAFF and APRIL as B-cell survival fac-

tors implicated in the pathogenesis of several B-

cell malignancies (10). In CLL, the biological rel-

evance of both molecules has been demonstrated

in vitro studies, which show that the addition of

exogenous BAFF and APRIL protects neoplastic

CLL cells from apoptosis (9,23). Furthermore, ab-

normal BAFF and APRIL serum levels are found

in CLL and other B=cell malignancies (10,27). Not

surprisingly, there is considerable interest in

finding effective ways to target this system as a

new treatment modality in B=cell lymphoprolif-

erative disorders(4,12).

In our study 64% of cases were males and

36% were females, this come in accordance with

data shown by Okaly et al.(25) who found that

males have higher incidence of CLL compared

with females.

The age range at presentation in our study

was 55-86 years, in contrast to Siegl et al. (29) who

found that the higher incidence of CLL was seen

in age range 75-84 years. This variation could

have been due to the smaller number of cases

that were studied or due to the ethnic differences

in epidemiology.

We compared the level of BAFF and APRIL

in patient’s and control’s groups by quantitative

ELISA kits and we found significantly lower

and higher levels of BAFF and APRIL respec-

tively in the sera of B-CLL patients compared to

healthy controls.

This was in accordance with recent obser-

vations of Planelles et al.(26), Haiat et al. (13) and

Kern et al.(16) showing a decrease in circulating

BAFF levels in B-CLL patients in comparison

with healthy subjects. Which could be related

to the absorption of BAFF by CLL cells (20). An-

other study showed elevated BAFF levels only

in patients with familial B-CLL (24).

On the other hand, plasma APRIL levels in B

CLL patients were significantly higher as com-

pared with healthy subjects. Our results were

similar to those of Planelles et al.(26) showing an

increase in circulating APRIL protein concentra-

tion compared with healthy subjects.

BAFF and APRIL are produced in excess

in patients with various B-lymphoid malignan-

cies, either by the leukemic cells themselves or

by cells in their micro environmental or both (17).

BA variety of tumoral B cells from Non-Hod-

jkin’s lymphoma (NHL) were found to express

receptors for BAFF. Comparable levels were de-

tected in B lymphocytes from normal individu-

als and from patients with diffuse large cell lym-

phoma (DLCL), mantle cell lymphoma (MCL)

and marginal zone lymphoma, whereas those

from B-CLL and follicular lymphoma displayed

somewhat lower expression (3).

Regarding BAFF, there was a significant pos-

itive correlation between BAFF values and each

of platelet count and CD5 expression. Bojarska

et al. (1) found a positive correlation between

percentage of CD5 positive B lymphocytes and

BAFF concentration.

In addition there was a significant inverse cor-

relation between BAFF values and each of pe-

ripheral blood lymphocyte count, bone marrow

infiltration and advanced disease stage, which

was in accordance with Ferrer et al. (11).

It was found that among patients with follicu-

lar lymphoma, those with circulating neoplastic

B-cells had lower serum BAFF compared to

those without detectable neoplastic cells in the

peripheral blood. This suggests that serum BAFF

may be a marker of tumor burden (13).

Elmougy, M. I & Elgohary G.M.62

Regarding serum APRIL levels, there was a

significant correlation with high CD38 expression

as well as advanced clinical stage. This is in agree-

ment with Ferrer et al.(11) who found that APRIL

serum levels were significantly increased in those

cases with high CD38 expression. This may reflect

the dependence on CD38 of the cross-talk between

CLL cells and stromal or nurse-like cells which

are an important source of BAFF and APRIL (22).

Previous studies have suggested that either BAFF

or APRIL serum levels correlate with disease pro-

gression and survival (1,19).

The risk of progression was assessed by com-

bining BAFF and APRIL serum levels, three dif-

ferent risk groups were identified. In our study,

survival analysis revealed that high risk group

patients had a significantly shorter PFS compared

to those of low and intermediate risk groups. This

comes in accordance with a study done by Fer-

rer et al.(11) who demonstrated that the combined

analysis of BAFF and APRIL may provide more

accurate predictive information by separating pa-

tients into three risk groups. Thus subjects show-

ing low BAFF and high APRIL serum levels had

the highest risk of disease progression whereas

those with high BAFF and low APRIL had a very

low progression risk.

In conclusion, this study demonstrated that

BAFF could be a valid marker of leukemic tu-

mor burden and disease progression. Additionally

APRIL strongly correlates with poor prognostic

factors as high CD38 expression. From the clini-

cal stand point, the new and most relevant finding

of our study is that the combined analysis of serum

BAFF and APRIL seems to be a better predictor

of progression. However it should be validated in

further studies including larger series of patients.

REFERENCES1. Bojarska-Junak, A., Hus, I., Chocholska, S., et al.

(2009). BAFF and APRIL expression in B-cell chronic

lymphocytic leukemia: correlation with biological and

clinical features. Leuk Res 33, 1319.

2. Bossen, C., and Schneider, P. (2006). BAFF, APRIL

and their receptors: structure, function and signaling.

Semin Immunol 18, 263.

3. Briones, J., Timmerman, J. M., Hilbert, D. M., et al.

(2002). BLyS and BLyS receptor expression in non-

Hodgkin’s lymphoma. Exp Hematol 30, 135.

4. Burger, J. A., Ghia, P., Rosenwald, A., et al. (2009).

The microenvironment in mature B-cell malignancies:

a target for new treatment strategies. Blood 114, 3367.

5. Chiorazzi, N., Rai, K. R., and Ferrarini, M. (2005).

Chronic lymphocytic leukemia. N Engl J Med 352,

804.

6. Collins, R. J., Verschuer, L. A., et al. (1989). Spontane-

ous programmed death (apoptosis) of B-chronic lym-

phocytic leukaemia cells following their culture in vi-

tro. Br J Haematol 71, 343.

7. Damle, R. N., Wasil, T., Fais, F., et al. (1999). Ig V gene

mutation status and CD38 expression as novel prognos-

tic indicators in chronic lymphocytic leukemia. Blood

94, 1840.

8. Elphee, E. E. (2008). Caring for patients with chronic

lymphocytic leukemia. Clin J Oncol Nurs 12, 417.

9. Endo, T., Nishio, M., Enzler, T., et al. (2007). BAFF

and APRIL support chronic lymphocytic leukemia B-

cell survival through activation of the canonical NF-

kappaB pathway. Blood 109, 703.

10. Ferrer, G., Hodgson, K., Montserrat, E., et al. (2009). B

cell activator factor and a proliferation-inducing ligand

at the cross-road of chronic lymphocytic leukemia and

autoimmunity. Leuk Lymphoma 50, 1075.

11. Ferrer, G., Hodgson, K., Pereira, A., et al. (2011). Com-

bined analysis of levels of serum B-cell activating fac-

tor and a proliferation-inducing ligand as predictor of

disease progression in patients with chronic lympho-

cytic leukemia. Leuk Lymphoma 52, 2064.

12. Guadagnoli, M., Kimberley, F. C., Phan, U., et al.

(2011). Development and characterization of APRIL

antagonistic monoclonal antibodies for treatment of B-

cell lymphomas. Blood 117, 6856.

13. Haiat, S., Billard, C., Quiney, C., et al. (2006). Role

of BAFF and APRIL in human B-cell chronic lympho-

cytic leukaemia. Immunology 118, 281.

14. Hallek, M., Cheson, B. D., Catovsky, D., et al. (2008).

Guidelines for the diagnosis and treatment of chronic

lymphocytic leukemia: a report from the International

Workshop on Chronic Lymphocytic Leukemia updat-

ing the National Cancer Institute-Working Group 1996

guidelines. Blood 111, 5446.

15. Hernandez JA, G. M. a. H. J. (2012). Prognostic fac-

tors in chronic lymphoid leukemia and identification

of new clinically relevant molecular markers, Chronic

lymphcoytic leukemia).

16. Kern, C., Cornuel, J. F., Billard, C., et al. (2004). In-

volvement of BAFF and APRIL in the resistance to

apoptosis of B-CLL through an autocrine pathway.

Blood 103, 679.

17. Mackay, F., and Tangye, S. G. (2004). The role of the

BAFF/APRIL system in B cell homeostasis and lym-

phoid cancers. Curr Opin Pharmacol 4, 347.

BAFF and APRIL in CLL; Correlation with Disease Progression 63

18. Mackay, F., Silveira, P. A., and Brink, R. (2007). B cells

and the BAFF/APRIL axis: fast-forward on autoimmu-

nity and signaling. Curr Opin Immunol 19, 327.

19. Molica, S., Digiesi, G., Mauro, F., et al. (2009). In-

creased serum BAFF (B-cell activating factor of the

TNF family) level is a peculiar feature associated with

familial chronic lymphocytic leukemia. Leuk Res 33,

162.

20. Molica, S., Digiesi, G., Battaglia, C.,et al. . (2010).

Baff serum level predicts time to first treatment in early

chronic lymphocytic leukemia. Eur J Haematol 85,

314.

21. Montillo, M., Hamblin, T., Hallek, M., et al. . (2005).

Chronic lymphocytic leukemia: novel prognostic fac-

tors and their relevance for risk-adapted therapeutic

strategies. Haematologica 90, 391.

22. Nishio, M., Endo, T., Tsukada, N.,et al. (2005). Nurse-

like cells express BAFF and APRIL, which can promote

survival of chronic lymphocytic leukemia cells via a

paracrine pathway distinct from that of SDF-1alpha.

Blood 106, 1012.

23. Novak, A. J., Bram, R. J., Kay, N. E.,et al. (2002).

Aberrant expression of B-lymphocyte stimulator by B

chronic lymphocytic leukemia cells: a mechanism for

survival. Blood 100, 2973.

24. Novak, A. J., Grote, D. M., Ziesmer, S. C.,, et al.

(2006). Elevated serum B-lymphocyte stimulator levels

in patients with familial lymphoproliferative disorders.

J Clin Oncol 24, 983.

25. Okaly, G. V., Nargund, A. R., E, V., Jayanna, P. K., et

al. (2013). Chronic lymphoproliferative disorders at an

Indian tertiary cancer centre - the panel sufficiency in

the diagnosis of chronic lymphocytic leukaemia. J Clin

Diagn Res 7, 1366.

26. Planelles L, C.-G. S., Medema JP, Morales-Luque A,

et al. (2007 ). APRIL but not BLyS serum levels are

increased in chronic lymphocytic leukemia: prognos-

tic relevance of APRIL for survival. Haematologica

September,92, 1284.

27. Sawicka-Powierza, J., Jablonska, E., Kloczko, J., et al.

(2011). Evaluation of TNF superfamily molecules re-

lease by neutrophils and B leukemic cells of patients

with chronic B - cell lymphocytic leukemia. Neoplasma

58, 45.

28. Schena, M., Larsson, L. G., Gottardi, D., et al. (1992).

Growth- and differentiation-associated expression of

bcl-2 in B-chronic lymphocytic leukemia cells. Blood

79, 2981.

29. Siegel, R., Naishadham, D., and Jemal, A. (2013). Can-

cer statistics, 2013. CA Cancer J Clin 63, 11.

30. Tangye, S. G., Bryant, V. L., Cuss, A. K., et al. . (2006).

BAFF, APRIL and human B cell disorders. Semin Im-

munol 18, 305.

31. Zhao, F., Mancuso, A., Bui, T. V., et al. (2011). Ima-

tinib resistance associated with BCR-ABL upregulation

is dependent on HIF-1alpha-induced metabolic repro-

graming. Oncogene 29, 2962.

Elmougy, M. I & Elgohary G.M.64

االتحليل المشترك لمستويات العامل المنشط للخاليا بي في مصل الدم والجين المحفز لالنتشاريه في حاالت سرطان الدم الليمفاوي المزمن مع بيان االرتباط بين السمات االكلينيكيه وتقدم المرض

مهيرM الموجي - غادM الجوهري

!لمق�مه: يشت(; ك9 م5 عام9 تنشي8 !لخاليا بى 7!لجي5 !لمحف1 للتكاث(يه !النتشا(يه فى بقا& !لخاليا بى !لعا�يه 7تميي1ها !له�@ م5 !ل�(!سه تقيي= �7( عام9 تنشي8 !لخاليا بى 7!لجي5 !لمحف1 لالنتشا(يه فى حاال? س(8ا5 !ل�= Cلتشخي! !ك� 50 م(يضا مم5 !ل�(!سه !لبح� شمل? !لحاال? 87(� !لم(� بمسا( !لتنب� فى 7!هميتها !لليمفا�7 !صابته= بس(8ا5 !ل�= !لليمفا�7 !لم1م5 307 !خ(ي5 م5 !الصحا& !لمت7!فقي5 فى !لعم( 7 !لن�7 لتقيي= مست�7 عام9 تنشي8 !لخاليا بى 7مست�7 !لجي5 !لمحف1 لالنتشا(يه فى !ل�= ع5 8(ي� تقنيه قيا� !الن1ي= !لمناعى( !اللي1! !لنتائج: !�ه(? !ل�(!سه !نخفا� مست�7 عام9 تنشي8 !لخاليا بى فى مص9 !ل�= ل�� م(ضى س(8ا5 !ل�= !لليمفا�7 !لم1م5 بكتي( مما !لمحف1 لالنتشا(يه !على !لجي5 !لضاب8ه فى حي5 كا5 مست�7 !لمجم7عه ن�ي(� فى بص7(� ملح�7ه ع5 كا5 عليه فى مجم7عه !الصحا& 7!(تب8 مست�7 عام9 تنشي8 !لخاليا بى !لى ح� كبي( بع�� !لصفائح !ل�م7يه �7ه7( ب(7تيcd5 5 7ع�� !لخاليا !لليمفا7يه !ل8(فيه فى !ل�= 7!(تشا" !لنخا� !لع�مى 7عال�7 على !ل; كا5 مست�7 �ه7( عام9 تنشي8 !لخاليا بى !ق9 م5 !ل; بكثي( ل�� !لم(ضى !ل!ي5 يعان57 م5 !لم(حله � م5 تل; !لم7ج��7 فى !لمجم7عه � 7!لمجم7عه ! 7فقا ل�ا= !لتصني@ بيني? 7!(تب8 مست�7 !لجي5 !لمحف1 لالنتشا(يه فى مص9 !ل�= بشك9 كبي( ب�ه7( ب(7تيcd 38 5فضالع5 !لم(حله !الكلينيكيه !لمتق�مه للم(� �7ه( !لتحلي9 !لمشت(; لك9 م5 عام9 تنشي8 !لخاليا بى 7!لجي5 !لمحف1 لالنتشا(يه فى مص9 !ل�= كم�ش( مستق9 لتق�= !لم(� !لخالصه تشي( !لنتائج !لى !مكانيه !العتما� على !لتحلي9 !لمشت(; لك9 م5 عام9 تنشي8 !لخاليا بى 7!لجي5 !لمحف1 لالنتشا(يه فى مص9 !ل�= كم�ش( مستق9 لتق�= !لم(� !لخالصه :تشي( !لنتائج !لي !مكانيه !العتما� علي !لتحلي9 !لمشت(; لعام9 تنشي8 !لخاليا بي 7!لجي5 !لمحف1 لالنتشا(يه كعام9 تنب� م7ث�7 فيه لحاال? س(8ا5 !ل�= !لليمفا�7 مع !لتاكي� علي !هميته في !لتع(@ علي !لم(ضي !�7 !لخ78(�

!لعاليه لتق�= !لم(�

IN VITRO APOPTOTIC EFFECT OF METFORMIN ON HUMAN

CERVICAL CANCER CELLS Dina Sabry*, Sahar H. Ahmed** and Mohamed A. S. Al-Ghussein***

ABSTRACT

Aim: We aimed to estimate whether metformin treatment against cervical cancer Hela cell line could affect cellular viabil-

ity or not and to evaluate the genes expression of p53, caspase-3, Bcl2, COX-1 and cyclin-D1 as apoptotic and proliferation

markers genes. Methods:Hela cell line was cultured and treated with different concentrations of metformin. Cells viability was

investigated by MTT proliferation assay. Cells was treated by metformin for 48 h and 72 h and harvested for RNA extraction.

RNA was transformed to cDNA and p53, caspase-3, Bcl2, COX-1 and cyclin-D1 genes’ expression was assessed by qPCR.

Results:Metformin was cytotoxic for Hela cervix cancer cells and reduced the survival fraction in a dose response relationship.

Metformin affects many genes’ expression that reflects life and death. P53 and caspase-3 genes’ expression were raised by the

drug effect while Bcl-2, COX-1 and cyclin-D1 genes’ expression levels were reduced. Conclusions:Metformin showed potent

apoptotic activities against cervical cancer Hela cell line through the elevation of p53 and caspase-3 and the elevation of Bcl-

2, COX-1 and cyclin-D1 genes’ expression. Metformin could be the new, safe and effective treatment against cervical cancer.

Keywords Hela,Cervix, p53, caspase-3, Bcl2,COX-1, cyclin-D1

Departments of *Medical Biochemistry and Molecular Biology faculty of Medicine, Cairo University, **Medical

Laboratory Technology, Faculty of Applied Medical Science, Misr University for Science and Technology, Egypt,

***Biochemistry, Faculty of Pharmacy, Al-Azhar University Gaza

Egypt. J. Lab. Med. Vol.(27) No.3, October, 2015, 65 - 72

INTRODUCTION

The second female cancer worldwide is the

cancer of cervix as the most common malig-

nancy in both incidence and mortality(24).Unfor-

tunately, more than 80% of cervical cancer cases

are found in developing countries(34). Many lines

treatments were developed and used for cervical

cancer, but each of them has apparent drawbacks.

Surgical treatment line is restricted only for pa-

tients with early stage and the young patients

who have lost fertility(13). Radiotherapy and che-

motherapy are randomized, not specific to only

cancer cells and often bring severe adverse ef-

fects including bone marrow suppression, nerve

injury,gastrointestinal adverse reactions, renal

impairment and second cancer occurrence(13). In

spite of the advanced technology and methods,

up to one third of patients will still develop per-

sistence/recurrence/metastatic disease when the

treatment results are poor.

New therapeutic strategies must be evalu-

ated to improve survival. Thus, finding a safer

and more efficient treatment remains an arduous

task.

Metformin belongs to a class of compounds

called biguanines that were first isolated from

the plant Galegaofficinalis (French lilac or goat’s

rue) known for its medicinal value(27).

It is the most widely prescribed drug for treat-

ment of diabetes type 2 in the world(20). Metfor-

min’s beneficial effects in diabetic patients have

been shown to be largely through repression of

hepatic gluconeogenesis, which reduces the glu-

cose levels. In addition, it also increases insulin

sensitivity and glucose uptake(30).

In the past decade, metformin had gained

wide attention for its anticancer properties.

Studies have shown that in vitro treatment with

metformin inhibited the growth of myriad cancer

cell lines(37).An early study done in breast cancer

mouse model showed that metformin treatment

significantly decreased the tumor accumulation

of mammary adenocarcinomas accompanied by

increase in the life span of mice(1).

Metformin is also being tested as an adjuvant

cancer therapy(11), studies on both laboratory

animals and humans, showed that metformin

not only exerts a major protective effect against

the development of a wide range of cancers but

also improves prognosis in those found to have

these cancers(12). It was suggested that it inhibits

cancer cell proliferation, tumor growth and pro-

vokes cell-cycle arrest or apoptosis in G0–G(3).

Many genes can be considered as apoptotic

markers such as p53 and caspase-3. Not only

Sabry D., et al.66

p53 can be considered a marker gene for apop-

tosis, but also it controls cellular apoptosis and

proliferation(22).P53 plays a major role in many

cancer cells death specially cancer cervix(31). In

the same way, caspase-3 is considered a death

cascade promoter for cancer cells. The High lev-

els of this gene may demonstrate the degree of

Hela cell death (37).

On Contrarily, The anti-apoptotic Bcl2 gene

expression reflects the cancer cells viability and

vitality(29). Additionally, the novel biomarker

in many types of cancers is COX-1. Recently,

COX-1 gene expression has a vital role as bio-

marker for the detection of cervical cancer de-

velopment and progression (17,29). Moreover, Cy-

clin-D1 gene was observed to be over expressed

in cervical carcinoma(39).

The emergence of metformin as a potential

anticancer and cancer-preventive therapeutic

tool is exciting. With the added benefits of be-

ing readily available, economical, and easily

tolerated with good safety profile, it can be ef-

fortlessly transitioned from bench to bedside for

cancer therapy(39). We aimed to evaluate whether

there is any effect of metformin treatment on the

viability of cervical cancer Hela cell line or not

and to assess the gene expression of p53, cas-

pase-3,Bcl2, COX-1 and cycin-D1 as apoptotic

and proliferation markers genes.

MATERIALS AND METHODS

Dulbecco’s modified Eagle medium (DMEM),

fetal calf serum, and 3-(4, 5-dimethylthiazol-

2-yl)- 2, 5-diphenyltetrazoliunbromide (MTT)

were purchased from GIBCO BRL (Grand Is-

land, NY, USA). Trypsin 2.5%, penicillin, strep-

tomycin, metformin and all other chemicals em-

ployed in this study were of analytical grade and

were purchased from Sigma Chemical Co. (St.

Louis, USA).

Cell culture and cell proliferation assay

Metformin was dissolved in complete

DMEM, the pH value adjusted to 7.2 and steril-

ized through a 0.2 μm filter to the desired work-

ing solutions (equivalent to 15.6–1000 μg/mL,

w/v)(39). Human cervical carcinoma cell line

(Hela) was provided by American Type Cul-

ture Collection (ATCC, Minisota, U.S.A.). Cells

were cultured in DMEM medium supplemented

with 5% fetal bovine serum (FBS), 100 mg/mL

streptomycin and 100 units/mL penicillin at

37°C in a humidified incubator in an atmosphere

of 5% CO2. Hela cells were seeded in 96-well

plates (103- 104 cells/well) for 24 h incubation,

cell viability was evaluated using MTT assay as

described previously (9). In brief, cells were treat-

ed with metformin at a various concentration 0,

15.6, 31.3, 62.5, 125, 250, 500 and 1000 µg/ml

for 48 h and untreated cells served as a control.

Prior to determination, 10 μL MTT (2.5 g/L)

was added to each well. After 4 h incubation, the

culture media were discarded followed by addi-

tion of 100 μL of detergent reagent to each well

and vibration for 10 min. The absorbance (A) in

the experimental wells was measured at 570 nm

with a microplate reader (ELISA reader). The ab-

sorbance in the experimental wells to that of the

control wells (without test compound) is mea-

sured. The percentage of viable cells was calcu-

lated as follows: (A of experimental group/A of

control group) × 100%. Following this, the IC50

(cytotoxic concentration for 50% cell death) was

determined from the dose-response curve.

Total RNA isolation

Cells were detached by trypsin (2.5%) and

total RNA was isolated with RNAeasy Mini Kit

(Qiagen) and further analyzed for quantity and

quality with Beckman dual spectrophotometer

(USA). The RNA integrity and the GAPDH-

RNA (house keeping gene) ratio were used as

the quality control.

Real Time PCR (qRT-PCR) for quantita-

tive expression of p53, Caspase-3, Bcl2, COX-

1 and CyclinD1

The mRNA expression level was quanti-

fied by qRT–PCR (Real time PCR). 1000 ng of

the total RNA from each sample was used for

cDNA synthesis by reverse transcription using

high capacity reverse transcriptase kit (Applied

Biosystem, USA). The cDNA was subsequently

amplified with the Syber Green I PCR Master

Kit (Fermentas) in a 48-well plate using the Step

One instrument (Applied Biosystem, USA) as

follows: 10 minutes at 95oC for enzyme activa-

tion followed by 40 cycles of 15 seconds at 95oC,

20 seconds at 55oC and 30 second at 72oC for the

In Vitro Apoptotic Effect Of Metformin On Human Cervical Cancer Cells 67

amplification step. Changes in the expression of

each target gene were measured relative to the

mean critical threshold (CT) values of GAPDH

housekeeping gene by the ΔΔCt method. We

+��5���

5����

�

�

-��������/�����'�26$ �&6 � �������5�

�����������

� %�������7��

����������

��������

-2&� � -�!(!(���!�!((���!�����

9-�(���(!�(��!((!���(!��

3J��R�

�

�

�

NS7G8JG6*��

������$

&�

�

�

�

-�(��!��(�(!((�((��(��

9-��(�������(!((���(��

37��R�

�

�

�

NS7G.7�8*��

3��"� � -���(���(!(����((���(!!(!!(!(!��

9-�

!!�(�((��(�!(((!�(!((!!!�����!!�

J.��R� � :(T..G$J�*� �

��4$��

�

�

�

-����(��(!��(��(!��!�������

9-�!!(!��!��!�!!!�(�!�(((��

33��R�

�

�

��N���.7G.*��

������$

���

� -�����������((!(�!����

9-���(�!(�!�!!����������

33��R�

�

�

�

:(T..8$83*� �

%-��� � -������!��((�(��(��!!((���

9-�(���!��!��(!�!�(��((�

33��R�

�

�

�

:�T..G83G*�J�

���������������������

Table (1):Primer`s sequence and annealing temperature specific for each gene :

Statistical analysis

Results were disclosed as means ± standard

deviations. One-way ANOVA and Tukey’s mul-

tiple comparison post hoc tests were performed.

P< 0.01 was considered significant.

RESULTS

Metformin cytotoxicity and IC50 against

Hela cell line

Metformin significantly reduced Hela cell line

viability in a dose response relationship after 24

h incubation period (Figure 1). Beginning with

the lowest metformin concentration 15.6 µg/mL,

it decreased the cancer cell line viability signifi-

cantly to 95.25%±2.19%; P< 0.001 against the

untreated control. IC50; the cytotoxicity concen-

tration value that fifty percent of cells were dead;

was calculated and examined to equal 720.5µg/

mL. The maximum cytotoxicity against Hela

cell line effect was reached to 33.75%±4.40%;

P< 0.001 against the untreated control, after the

exposure to 1000 µg/mL.

P53 and caspase-3 elevated genes expres-

sion after metformin treatment

Both apoptotic marker genes were elevated for

Hela cell line 48 h after the metformin treatment

as shown in figure 2. Cells p53 expression

were increased significantly (0.177±0.075;

P< 0.001 compared to untreated control group

0.034±0.012) and remain unchanged after 72

h treatment. Similarly, caspase-3 expression

was increased 2 fold after 48 h drug treatment

(0.77±0.26;P< 0.001) and remained constant

after 72 h when compared to control value

(0.44±0.11).

Bcl-2, COX-1 and Cyclin-D1 reduced genes

expression after metformin treatment

Complementary to the previous results, Bcl-

2; an anti-apoptotic gene for cells viability or

life; expression was significantly reduced in

a time dependent to almost one half fold each

time after 48 h and 72 h metformin treatment

against the control (0.74±0.27 for 48 h and

0.43±0.21 for 72 h; P < 0.001 for both compared

to 0.122±0.17). In the same direction, COX-1

gene expression value was reduced in a time de-

pendent manner after 48 h and 72 h that reflect

the reduction of cancerous effects (1.23 ±1.04 for

48 h and 0.95±0.64 for 72 h; P < 0.001 for both

compared to control3.8±1.3). Parallel to these

results, Cyclin-D1 gene expression was mark-

edly decreased after 48 h and 72 h metformin

treatment when compared to control (5.62±4.4

for 48 h and 2.3±1 for 72 h; P < 0.001 for both

compared to 9.68±4.7).

used 1μM of both primers specific for each tar-

get gene. Primers sequence and annealing tem-

perature specific for each gene demonstrated in

table (1).

` `

Sabry D., et al.68

�

Figure1:Metformin cytotoxicity against

Hela cell line, survival fraction per-

centage of Hela cells were reduced

after treatment of different metfor-

min concentrations. Data are means

± SD,(*) p value value ≤ 0.001versus

untreated control group.

�

Figure2:P53 and caspase-3 elevated

genes expression after metfor-

min treatment of Hela cell line.

Data are means ± SD, (*) p val-

ue value ≤ 0.001versus untreated

control group.

�

Figure3: Bcl-2, COX-1 and Cyclin-D1

reduced genes expression after

metformin treatment of Hela

cell line.Data are means ± SD,

(*) p value value ≤ 0.001versus

untreated control group.

In Vitro Apoptotic Effect Of Metformin On Human Cervical Cancer Cells 69

DISCUSSION

Metformin was significantly cytotoxic for

Hela cervix cancer cell line in a dose dependent

manner as shown in figure 1. This apoptotic ef-

fect conceded with previous anticancer, prophy-

lactic and adjuvant activities against other types

of cancers(37,3). Recently, metformin was effec-

tive against pancreatic(11,32), ovarian(39), breast

cancer(26) melanoma(6) and neuroblastoma(8).

Metformin was not so far from its anti-diabetic

group in cancer treatment (21).

The anticancer effect of metformin was ex-

plained through its relationship and regulation of

the transcriptional certain genes (CHOP, CAV-1,

HO-1, SGK-1 and Par-4) on MCF-7 cell line(28).

Build and complementary for this information

transcriptional, regulator and apoptotic genes’

expression were examined for p53, caspase-3,

Bcl-2, COX-1 and cyclin-D1 genes. Moreover,

each mentioned gene affects cell proliferation or

apoptosis of cancer cells specially Hela cervix

cancer cells (22-39).

Not only p53 gene expression was partici-

pated for cancer cervix cell death (31), but also

metformin affect the cancer cells susceptibility

for p53 gene expression,(10). Even though the

low concentration of metformin induces a p53-

dependent senescence in hepatoma cells via ac-

tivation of the AMPK pathway(35). In the same

direction, caspase-3 was induced in cancer by

metformin(33). Moreover, both p53 and caspase-3

genes were induced by the effect of metformin in

prostate cancer (2).

On the other hand, Metformin reduces growth

of cutaneous squamous cell carcinoma by target-

ing mTOR signalling pathway and the reduction

of Bcl-2 gene expression (7).Furthermore, metfor-

min and aspirin reduced COX-1 gene expression

by targeting AMPK-mTOR and inflammation for

pancreatic cancer prevention and treatment(36).

Confirmed with our cyclin-D1 results, metfor-

min suppresses hepatocellular carcinoma cell

growth through induction of cell cycle G1/G0

phase arrest and p21CIP and p27KIP expression

and downregulation of cyclin D1 in vitro and in

vivo(4).

In vitro cell system analyses have demon-

strated that metformin: i) inhibits the growth of

various endometrial cancer cell lines; ii) attenu-

ates the invasion and metastasis of endometrial

cancer cell lines by modifying the nuclear fac-

tor-κB, matrix metalloproteinase-2/9/Akt and

Erk1/2 pathways; and iii) enhances endometrial

cancer cell chemosensitivity to cisplatin and pa-

clitaxel by reducing glyoxalase I expression and

regulating the mTOR signaling pathway (5). At

the molecular level, the fundamental activity

of metformin inhibits mitochondrial oxidative

phosphorylation, and may exert energy-associ-

ated stress on neoplastic cells (23). This inhibition

of oxidative phosphorylation reduces the produc-

tion of ATP, activating the cellular energy regu-

lator AMPK and its downstream effectors, in-

cluding mTOR(14). At the whole-organism level,

the anti-proliferative effects of metformin may

be attributed to the decrease in circulating insu-

lin levels induced by the reduced hepatic gluco-

neogenesis characteristic of insulin-responsive

tumors (25). Metformin potently inhibits growth

in a dose-dependent manner in endometrial can-

cer cell lines. Metformin resulted in G1 phase

cell cycle arrest, induction of apoptosis and de-

creased human telomerase reverse transcriptase

expression in endometrial cancer cells(5). Treat-

ment with metformin attenuates the estrogen-

dependent proliferative expression of c-myc

and c-fos in the obese rat endometrium, an ef-

fect which was accompanied by inhibition of the

phosphorylation of insulin and IGF1 receptors,

as well as Erk1/2 (38).

Precisely, metformin impairs growth of en-

dometrial cancer cells that neighbouring cervi-

cal cancer via cell cycle arrest and concomitant

autophagy and apoptosis(33).

Accordingly, we recommend metformin to

be a new, safe and effective therapeutic agent

against cervical cancer.

Conclusion

Cervical cancer was the new type of cancer

treated by metformin. Metformin has an apop-

totic potent cytotoxic activities were shown by

the dose response relationship against human

cervical cancer Hela cells. Even if metformin

Hela treatment raised p53 and caspase-3 genes’

Sabry D., et al.70

expression as apoptotic markers, it reduced Bcl-

2, COX-1 and cyclin-D1 genes’ expressions as

proliferation markers.

Acknowledgement

The authors had an acknowledgement for all

staff members at Medical Biochemistry and Mo-

lecular Biology Unit at the Faculty of Medicine,

Cairo University.

Financial Support

No grants and no financial support.

REFERENCES1. Anisimov VN, Berstein LM, Egormin PA, et al. 2005

Effect of metformin on life span and on the develop-

ment of spontaneous mammary tumors in HER-2/neu

transgenic mice. ExpGerontol;40 (8-9):685.

2. Ben Sahra I, Laurent K, Giuliano S, et al., 2010 Target-

ing cancer cell metabolism: the combination of metfor-

min and 2-deoxyglucose induces p53-dependent apop-

tosis in prostate cancer cells.Cancer Res. ;70(6):2465.

3. Ben Sahra I, Le Marchand-Brustel Y, Tanti JF et al.,

2010 Metformin in cancer therapy: a new perspec-

tive for an old antidiabetic drug?.MolCancer Ther;9

(5):1092.

4. Cai X, Hu X, Cai B, et al., 2013 Metformin suppresses

hepatocellular carcinoma cell growth through induc-

tion of cell cycle G1/G0 phase arrest and p21CIP and

p27KIP expression and downregulation of cyclin D1 in

vitro and in vivo.Oncol Rep. ;30(5):2449.

5. Cantrell LA, Zhou C, Mendivil A, et al., 2009 Bae-

Jump VL. Metformin is a potent inhibitor of endome-

trial cancer cell proliferation - implications for a novel

treatment strategy. GynecolOncol. 2010;116:92–98.

doi: 10.1016/j.ygyno..09.024.

6. Cerezo M, Tomic T, Ballotti R, et al., 2015 Is it

time to test biguanide metformin in the treatment of

melanoma?Pigment Cell Melanoma Res. ;28(1):8.

7. Chaudhary SC, Kurundkar D, Elmets CA, et al., 2012

AtharM.Metformin, an antidiabetic agent reduces

growth of cutaneous squamous cell carcinomaby tar-

geting mTORsignalingpathway.PhotochemPhotobiol.

;88(5):1149.

8. Costa D, Gigoni A, Würth R, et al., 2014 Metformin

inhibition of neuroblastoma cell proliferation is dif-

ferently modulated by cell differentiation induced by

retinoic acid or overexpression of NDM29 non-coding

RNA.Cancer Cell Int ;14:59.

9. Cui FJ, Li Y, Xu YY, et al., 2007 Induction of apoptosis

in SGC-7901 cells by polysaccharide-peptide GFPS1b

from the cultured mycelia of Grifolafrondosa GF9801.

Toxicol In Vitro. ; 21(3):417.

10. Do MT, Kim HG, Choi JH, et al., 2014 Metformin in-

duces microRNA-34a to downregulate the Sirt1/Pgc-

1α/Nrf2 pathway, leading to increased susceptibility of

wild-type p53 cancer cells to oxidative stress and thera-

peutic agents.FreeRadicBiol Med;74:21.

11. Donghui LH. 2011 Metformin as an antitumor agent in

cancer prevention. J Diabetes ;3:320.

12. Duncan BB, Schmidt MI 2009. Metformin, Cancer,

Alphabet Soup, and the Role of Epidemiology in Etio-

logic Research. Diabetes Care;32 (9):1748.

13. Fujimoto J 2009. Novel strategy of anti-angiogenic

therapy for uterine cervicalcarcinomas. Anticancer Res,

29:2665.

14. Hardie DG, Ross FA, Hawley SA. et al,. 2012 A nutri-

ent and energy sensor that maintains energy homeosta-

sis. Nat Rev Mol Cell Biol. ;13:251–262. doi: 10.1038/

nrm3311.

15. Hirchaud F, Hermetet F, Ablise M, et al,. 2013

Isoliquiritigenin induces caspase-dependent apoptosis

via downregulation of HPV16 E6 expression in cervi-

cal cancer Ca Ski cells.Planta Med. ;79(17):1628.

16. Jang SY, Kim A, Kim JK, et al,. 2014 Metformin inhib-

its tumor cell migration via down-regulation of MMP9

in tamoxifen-resistant breast cancer cells.Anticancer

Res. ;34(8):4127.

17. Jung YW, Kim SW, Kim S, et al., 2010 Prevalence and

clinical relevance of cyclooxygenase-1 and -2 expres-

sion in stage IIB cervicaladenocarcinoma.Eur J Obstet-

GynecolReprod Biol. ;148(1):62.

18. Kim TH, Suh DH, Kim MK, 2014 Metformin against

cancer stem cells through the modulation of energy

metabolism: special considerations on ovarian cancer.

Biomed Res Int2014;:132702.

19. Koay MH, Crook M, Stewart CJ 2012.Cyclin D1, E-

cadherin and beta-catenin expression in FIGO Stage

IA cervical squamous carcinoma: diagnostic value

and evidence for epithelial-mesenchymal transition.

Histopathol;61(6):1125.

20. Kourelis TV and Siegel RD. 2012 Metformin and

cancer: new applications for an old drug. Med

Oncol;29(2):1314.

21. Menendez JA, Quirantes-Piné R, Rodríguez-Gallego

E, et al., 2014 Oncobiguanides: Paracelsus’ law and

nonconventional routes for administering diabetobigu-

anides for cancer treatment.Oncotarget. ;5(9):2344.

22. Mollereau B, Ma D.2014 The p53 control of apoptosis

and proliferation: lessons from Drosophila.Apoptosis.

;19(10):1421.

23. Owen MR, Doran E, Halestrap AP 2000:. Evidence that

metformin exerts its anti-diabetic effects through inhi-

bition of complex 1 of the mitochondrial respiratory

chain. Biochem J. ;348:607–614. doi: 10.1042/0264-

6021:3480607.

In Vitro Apoptotic Effect Of Metformin On Human Cervical Cancer Cells 71

24. Parkin DM. 2001 Global cancer statistics in the year

2000. Lancet Oncol ,2:533.

25. Pollak M 2012. The insulin and insulin-like growth fac-

tor receptor family in neoplasia: An update. Nat Rev

Cancer. ; 12:159.

26. Radilova H, Libra A, Holasova S, et al., 2009 COX-1

is coupled with mPGES-1 and ABCC4 in human cervix

cancer cells.Mol Cell Biochem. ;330(1-2):131.

27. Rattan R, Ali Fehmi R, and Munkarah A 2012 Met-

forminan emerging new therapeutic option for tar-

geting cancer stem cells and metastasis. J Oncol;

2012:928127.

28. Salis O, Bedir A, Ozdemir T, 2014 The relationship

between anticancer effect of metformin and the tran-

scriptional regulation of certain genes (CHOP, CAV-1,

HO-1, SGK-1 and Par-4) on MCF-7 cell line.Eur Rev

Med Pharmacol Sci;18(11): 1602.

29. Sharawat SK, Bakhshi R, Vishnubhatla S, 2015 High

receptor tyrosine kinase (FLT3, KIT) transcript versus

anti-apoptotic (BCL2) transcript ratio independently

predicts inferior outcome in pediatric acute myeloid

leukemia.Blood Cells Mol Dis. Blood Cells Mol Dis. ;

54(1):56.

30. Shaw RJ, Lamia KA, Vasquez D, et al. 2005 The kinase

LKB1 mediates glucose homeostasis in liver and thera-

peutic effects of metformin. Science; 310 (5754):1642.

31. Shukla S, Dass J, Pujani M. 2014 p53 and bcl2 expres-

sion in malignant and premalignant lesions of uterine

cervix and their correlation with human papilloma virus

16 and 18.South Asian J Cancer. ; 3(1):48.

32. Snima KS, Jayakumar R, LakshmananVK.2014 In Vitro

and In Vivo Biological Evaluation of O-Carboxymeth-

yl Chitosan Encapsulated MetforminNanoparticles for

Pancreatic Cancer Therapy.Pharm Res. ;31(12):3361.

33. Takahashi A, Kimura F, Yamanaka A, et al., 2014 Met-

formin impairs growth of endometrial cancer cells via

cell cycle arrest and concomitant autophagy and apop-

tosis.Cancer Cell Int. ;14:53.

34. World Health Organization 2006. Comprehensive cer-

vical cancer control: A guide toessential practice. Ge-

neva: WHO; .

35. Yi G, He Z, Zhou X, et al., 2013 Low concentration

of metformin induces a p53-dependent senescence in

hepatoma cells via activation of the AMPK pathway.

Int J Oncol.;43(5):1503.

36. Yue W, Yang CS, DiPaola RS, 2014 Tan XL.Repurposing

of metformin and aspirin by targeting AMPK-mTOR

and inflammation for pancreatic cancer prevention and

treatment.CancerPrev Res (Phila). ;7(4):388.

37. Zakikhani M, Dowling R, Fantus IG, 2006 Metformin

is an AMP kinase-dependent growth inhibitor for breast

cancer cells. Cancer Research ;66:10269.

38. Zhang Q, Celestino J, Schmandt R, et al. 2013 Che-

mopreventive effects of metformin on obesity-associ-

ated endometrial proliferation. Am J Obstet Gynecol.

2013;209:e1–e24. doi: 10.1016/j.ajog..03.008.

39. Zhao H, Zhang M, Zhao L, 2011 Changes of constitu-

ents and activity to apoptosis and cell cycle during fer-

mentation of tea.Int J Mol Sci. ;12(3):1862.

Sabry D., et al.72

تاثبر المتقورمبن علي موت الخالبا المبرمج لسرطان عنق الرحم

دينا صبري - سحر حسن احمد - محمد الغسين

الهدف من هذC الدراسة هو تحديد ما إذا كان العالج بالميتفورمين ضد خط خاليا سرطان عنق الرحم Hela له تأثير على حيوية Cyclin D1 ، كجينات دالة على موت الخاليا المبرمج و التعبير الجينى لـ P53 ، Caspase الخاليا ام ال وتقييم التعبير الجينى لـCox-1 BCL2 كجينات داله على تكاثر وانتشار الخاليا. تم زرع خاليا Hela ومعامالتها بتركيزات مختلفة من الميتفورمين وكانت

RNA لقياس التكاثر وتمت معالجة الخاليا بالميتفورمين 48، 72 ساعة ثم تم الحصاد الستخراج MTT حيوية الخاليا تقاس عن طريقالذى تم تحويله إلى cDNA ثم التقييم الجينى لـ P53 ، Caspase ، BCL2 ، Cox-1 و و Cyclin D1 باستخدام PCR. النتائج: الميتفورمين أثبت انه ذو تأثير سام على خاليا سرطان عنق الرحم Hela وتقليل حيويتها فى عالقة معتمدة على الجرعات وللميتفورمين Cy- 3 أماCaspase ، P53 تأثير على عدد من الجينات التى تعكس حياة الخاليا او موتها. ارتفع التعبير الجينى باستخدام الميتفورمين لـclin D1، Cox-1 ، BCL2 انخفض التعبير الجينى. الخالصة: أظهرت نتائج معالجة خاليا سرطان عنق الرحم Hela بالميتفورمين

ارتفاع نسبة موت الخاليا السرطانية المبرمج من خالل زيادة التعبير الجينى لكال من 3Caspase ، P53 وانخفاض التعبيرالجينى Cyclin D1، Cox-1 ، BCL2 كجينات مسؤولة عن تكاثر الخاليا وانتشارها وعلى هذا يمكن ان يكون الميتفورمين عالج جديد و

mمن وفعال ضد سرطان عنق الرحم.

ROLE OF INTERCELLULAR ADHESION MOLECULE-1 (ICAM-1) G241R AND K469E GENE POLYMORPHISM AND SOLUBLE ICAM-1 SERUM

LEVELS IN THE DEVELOPMENT OF ISCHEMIC STROKE IN EGYPTIAN PATIENTS

Abeer Mohamed Mohy*, Ahmed Abd Allah Hassan Ali **and Heba Omar***

ABSTRACTBackground: Stroke is currently the third leading cause of death worldwide. Intercellular adhesion molecule-1 (ICAM-1)

was involved in the pathogenic mechanisms responsible for ischemic stroke. Objectives: To determine the association of ICAM-1 G241R and K469E polymorphisms and soluble ICAM-1 level with ischemic stroke in Egyptian patients. Subjects and Methods: ICAM-1 G241R and K469E, were detected by allele specific polymerase chain reaction (ASP) and polymerase chain reaction-restriction fragment length polymorphism (PCR – RFLP) techniques respectively, in 40 Egyptian patients with ischemic stroke and 40 healthy subjects as a control group. Serum sICAM-1 was measured by enzyme linked immunosorbent assay (ELISA). Results: ICAM-1 241R allele and 469E allele were significantly associated with increased risk of ischemic stroke. The median sICAM-1 levels were significantly higher in cases than control group. Conclusion: These results suggest that ICAM-1 G241R and K469E gene polymorphism may influence the susceptibility to acquire ischemic stroke in a sample of Egyptian population Keywords:Ischemic stroke - ICAM-1 - K469E - G241R - gene polymorphism - PCR-RFLP

INTRODUCTION

Stroke is currently the third leading cause of death and the biggest single cause of major dis-ability worldwide. Each year more than 700 000 people experience a new or recurrent stroke and on average someone dies every 4 minutes of a stroke. Despite the diagnostic and treatment de-velopment in medicine, the recovery rate from stroke is poor (9).

The commonest type of stroke is an ischemic stroke, resulting from disruption of blood flow within the brain caused by occlusion of an artery. This deprives the brain of oxygen and nutrients and initiates a dynamic sequence of pathophysi-ological events (12).

Intercellular adhesion molecule-1 (ICAM-1) is a member of immunoglobulin (Ig) superfam-ily of cell adhesion molecules with glycoprotein structure. The ICAM-1 gene is located on chro-mosome 19 P13.2-13.3 and includes 7 exons that code a protein with five extracellular Ig-like domains, a transmembrane domain and a short cytoplasmic tail (1).

ICAM-1 is expressed on vascular endothe-lium, macrophages and activated lymphocytes

and is up-regulated by inflammatory cytokines. It plays an important role in the adhesion and subsequent transendothelial migration of circu-lating leukocytes into the vascular endothelium which is one of the earliest events in the patho-genesis of atherosclerosis (3, 13).

Proteolytic cleavage of ICAM-1 near its membrane region leads to production of a solu-ble form, sICAM-1, which is partially detectable in the serum of healthy subjects, but its level is elevated in inflammatory and malignant disor-ders, also associated with increased risk of future ischemic stroke (1).

Two single-nucleotide polymorphisms (SNPs) in the ICAM-1 gene have been rec-ognized, first at position +241 (+241 G/A or G241R) (rs 1799969) located in exon 4 coding Ig-like domain 3 of the ICAM-1 protein (GGG → AGG; Glycine → Arginine) and the second one at position +469 A/G or K469 E) (rs 5498) located in exon 6 coding Ig-like domain 5 of the ICAM-1 protein (AAG → GAG; lysine → Glu-tamic acid)(1,10) .

The Ig-like domain 3 mediates binding to macrophage antigen-1 (Mac-1) and may also af-fect accessibility of leukocyte function associat-

Egypt. J. Lab. Med. Vol.(27) No.3, October, 2015, 73 - 80

Departments of Clinical & Chemical Pathology*, Internal Medicine** and Biochemistry***, Faculty of Medicine, Cairo University, Egypt .

Mohy, A.M. et al.74ed – antigen-1 (LFA-1) binding to the Ig-like do-main-1. ICAM-1 mediates adhesion interactions of circulating leukocytes to the blood vessel wall by binding to Mac-1 and LFA-1, and increased expression of ICAM-1 has been found during all phases of atherogenesis(5, 14).

The Ig-like domain 5 was reported to involve in cell adhesion. This region seems to be particu-larly important for maintaining normal protein structure, affecting the adhesion of circulating leukocytes to the activated endothelium. This domain is of crucial importance for the activ-ity of the ICAM-1 protein because it modulates the interactions between ICAM-1 and LFA-1(8,11)

and the influences the adhesion of B-cells (14).

These variations have been reported to be related to some inflammatory and autoimmune diseases and atherosclerosis (1, 10).

The purpose of the present study was to de-termine the association of ICAM-1 G241R and K469E polymorphisms and solule ICAM-1 level with ischemic stroke in Egyptian patients.

SUBJECTS AND METHODS

Subjects:

The study population included 40 ischemic stroke patients (21 males and 19 females; mean age 49 ± 3.1 years) from Neurology Depart-ment, Kasr Al-Aini Hospital, Cairo University, Egypt. They were diagnosed by neurological examination and CT scan. Patients with hemor-rhagic stroke, cancer, autoimmune disease were excluded from this study. As controls, 40 healthy subjects were considered, similar to the patients for age and sex distribution (20 males and 20 fe-males; mean age 49.5 ± 4.0 years). The controls had no clinical evidence or history of neurologi-cal diseases, no history of stroke. All controls came from the same geographical area as the patients. Besides neurological history, history of hypertension, diabetes mellitus (DM) and smok-ing were recorded for all participants.

The study was conducted at period from Sep-tember 2013 to July 2014. Patients and controls were enrolled in this study after giving informed

consent to the use of part of their blood samples for an experimental study. The study was ap-proved by the local ethical committee.

Biochemical variables and ICAM-1 genotyping:

Six ml venous blood samples were collected from all subjects after at least 12-hours fast. Se-rum total cholesterol, triglyceride (TG) levels were measured by standard enzymatic meth-ods. Serum high-density lipoprotein cholesterol (HDL-C) level was determined by direct as-say. Serum low-density lipoprotein cholesterol (LDL-C) level was calculated by Friedwald for-mula(6). Plasma fasting glucose was measured by a glucose oxidase procedure. These biochemical parameters were measured using Dimension R X L automatic analyzer (Siemens Healthcare Di-agnostics, USA). Serum sICAM-1 was assayed using enzyme-liked immunosorbent assay (ELI-SA) (Biovision, Egypt).

Molecular analysis: All kits were supplied by (Thermo-Scientific, USA)

Genomic DNA from EDTA-treated venous blood was extracted by standard techniques us-ing a DNA spinspacecolumn extraction kit.

G241R polymorphisms:

To detect the G241R polymorphism, an al-lele-specific polymerase chain method (ASP) was performed using two sets of specific prim-ers (G for nucleotide G, R for nucleotide A) and one common primer(1). The sequence of these primers is shown in Table 1. PCR reaction was performed in a total volume of 25 µl, which in-cluded 12.5 µl 2 x PCR master mix {0.05 units/μl Taq DNA polymerase, 2 x PCR buffer, 3 mM MgCl2 and 400 μM of each dNTP (dATP, dCTP, dGTP, dTTP)}, 1 µl of either G or R primer, 1 µl common primer, 1µl of each µ-globin primer F and R as the internal control, 6 µl nuclease free water and 2.5 µl genomic DNA.

PCR program included an initial denaturation at 95oC for 5 minutes followed by 30 cycles con-sisting of 95oC for 1 minute, 62oC for 1 minute, 72oC for 1 minute, and a final extension at 72oC for 10 minutes.

Role of ICAM-1 and sICAM-1 in Ischemic Stroke 75Then the 137bp PCR amplification prod-

ucts were run electrophoretic on 2% ethidium bromide-stained agarose gel and the bands were visualized under UV light.

K469E polymorphisms:For this polymorphism, the PCR-RFLP meth-

od was used on two forward (K) and reverse (E) primers (Table 1) and Fast Digest Bst UI restric-tion enzyme(1). The PCR reaction was performed in a total volume of 25µl that contained 8 µl nuclease free water, 12.5 µl 2 x PCR mater mix, 1 µl of each primer and 2.5 µl genomic DNA. The cycling conditions consisted of an initial de-naturation of 5 minutes at 94oC followed by 35 cycles of 45 seconds at 96oC, 1 minute at 59oC and 1 minute at 72oC. The reaction was termi-nated after a final extension of 5 minutes at 72oC.

Then 7 µl of the 223bp PCR products were then digested with 1µl (5 units) of Fast Digest Bst UI enzyme at 37oC for 15 minutes. The Bst UI restriction enzyme was able to cut the E469 allele but not K469.

RESULTS

Characteristics of the subjects:

The clinical and laboratory data of the pa-tients and controls are presented in table (2).

Distribution of the ICAM-1 polymorphism in pa-tients and control group

The ICAM-1 G241R and K469E polymor-phism distributed in accordance with Hardy-Weinberg equilibrium (HWE) in both studied

After digestion, the fragments were run on 3.5% ethidium bromide – stained agarose gel and visualized under UV light. The EE genotype corresponded to the presence of 136 and 87bp fragments. The KE genotype corresponded to presence of 223, 136 and 87bp fragments. The KK genotype corresponded to a 223bp fragment.

Statistical Analysis

Data was analyzed using SPSS version 15 (Chicago, IL, USA). Quantitative data was pre-sented as mean ±SD. For comparison of two groups, Student’s t -test was used. Non paramet-ric quantitative data was expressed as median (25th – 75th percentile); Mann-Whitney test was used for comparison of medians between two groups. Qualitative data was expressed as frequency and percentage. Association between qualitative data was done using Chi-square test. Odds Ratio (OR) was calculated. P-value < 0.05 was significant.

groups. The distribution of G241R and K469E genotypes in exons 4 and 6 of ICAM-1 gene are shown in tables 3 and 4.

Association of genotypes with the risk of isch-emic stroke:

By logistic regression analysis adjusted for age, sex, smoking, diabetes, hypertension, fasting blood glucose, lipid profile, sICAM-1, ICAM-1 469 KE + 469 EE genotypes were sig-

Table (1): The primers sequence of ICAM-1 G241R and K469E polymorphisms

Mohy, A.M. et al.76

Table (2): Clinical and laboratory data of ischemic stroke patients and control group

- Qualitative data is presented as number (%) * Data presented as mean +SD+ Data presented as median (25th – 75th percentile) ** P-value < 0.05 is statistically significant

Table (3): Frequency distribution of ICAM-1 K469E genotypes and alleles among the studied groups

Role of ICAM-1 and sICAM-1 in Ischemic Stroke 77

Table (4): Frequency distribution of ICAM-1 G241R genotypes and alleles among the studied groups

Table (5): ICAM-1 genotypes and allele frequencies among males and females ischemic stroke patients

nificantly associated with increased risk of de-veloping ischemic stroke (OR: 7.857, 95% CI (2.786-22.158), p= 0.000). Carriers of 469E al-lele or 241R allele had significantly increased risk of developing ischemic stroke (OR: 3.37, 95% CI (1.650-6.885); p= 0.001, OR= 3.769, 95% CI (1.683-8.441); p= 0.001, respectively).

In the current study it was found that the me-dian sICAM-1 levels were significantly higher in combined 469 KE + 469 EE genotypes; 390.8 (363.2-577.2 ng/l) as compared to 469 KK geno-type; 368.5 (305.02-418.8 ng/l); p=0.046.

There was no statistical significant difference between sICAM-1 levels in different G241R genotypes, p= 0.229.

Regarding sex, it was found that the frequen-cies of 469 KE and EE genotypes were higher in females than males, but it didn’t reach statistical

significance as shown in table (5).

Haplotype analysis:

The genotype combination of K469E and G241R polymorphisms of the ICAM-1 gene re-vealed that the frequency of the E/R haplotype (+469 K/E and +241 G/R, respectively) signifi-cantly increased in patients compared to control group (18.8% vs 5%). Then individuals with E/R haplotype had a significantly increased risk of ischemic stroke (OR = 4.385, 95% CI = 1.942-9.898, p= 0.000).

DISCUSSION

A cross sectional study was performed to asses the role of genetic variation of ICAM-1 G241R and K469E and serum sICAM-1 levels on risk of ischemic stroke in Egyptian patients and compared the results with healthy individuals.

Mohy, A.M. et al.78The 469 KE + EE genotypes and 469 E allele

were more frequent in ischemic stroke patients than control. Also the mutant 469 E allele was found to be a significant risk factor for develop-ing ischemic stroke (OR = 3.37, 95% CI (1.650-6.885; p= 0.001), it was found that 469 EE genotype was higher in females than males but it didn’t reach statistical significance (p= 0.06).

The 241 GR + RR genotypes and 241R allele were significantly increased in ischemic stroke patients than control. Also the mutant 241R al-lele was found to be a significant risk factor for development of ischemic stroke (OR= 3.769, 95%, CI (1.683-8.441); p=0.001. Our results also indicate that the (469 E / 241 R) haplotype was significantly higher in patients (18.8%) than in controls (5%) p= 0.000.

This agrees with the study done by Li et al.(10) which was conducted on 309 Chinese patients with ischemic stroke and 309 elderly apparently healthy subjects serving as control group, they reported that KE and EE genotype frequencies were significantly higher in patients than con-trol, with KK genotype as a reference genotype. Also E allele had a significantly increased risk of ischemic stroke in overall population (OR= 1.79, 95% CI = 1.30-2.46; p=0.000) and in fe-males (OR= 2.36, 95% CI= 1.41-3.96, p=0.001), but not in males (OR= 1.48, 95%, CI= 0.98-2.22; p=0.062).

Similar results were obtained by another Chinese study (17) who had found that carriers of 469E allele had a higher risk of ischemic stroke. Similarly, a German study had shown that 469E allele was a genetic factor that may determine an individual susceptibility for coronary heart dis-ease and myocardial infarction (7).

Consistent with our results, Volcik et al.,(16) showed that ICAM-1 241RR genotype was as-sociated with significantly increased risk of isch-emic stroke in both Whites (hazard rate ratios HRR=2.18 (1.01-4.68), (p= 0.05) and African Americans (HRR = 7.04 (3.7-13.3), p< 0.001), However there was no significant findings ob-served for the ICAM-1 K469E polymorphism and incident ischemic stroke.

The current study showed that the median sICAM-1 levels were significantly higher in

ischemic stroke patients than in control group, p= 0.001. Similar to these results, the study done by Volcik et al., (16) and Tanne and Coworkers (15)

who found that mean sICAM-1 concentrations were significantly higher in ischemic stroke cas-es (379±100 ng/l) compared to controls (350±97 ng/l), p= 0.02, a marker of inflammation, are as-sociated with increased risk of ischemic stroke, independent of other traditional cerebrovascular factors. Also they stated that these high levels of sICAM-1 were found to significantly predict fu-ture ischemic stroke.

Our results showed that median triglyceride levels were significantly higher in patients than in the control group, p= 0.013, while other rou-tine laboratory parameters didn’t show any sig-nificance.

These results agree with those reported by Li et al. (10) and Bansal et al. (2), who found triglyc-erides to be an important risk factor for ischemic stroke and also for coronary heart disease as re-ported by Criqui (4).

It is therefore conceivable that polymor-phisms in the ICAM-1 gene might increase the risk of stroke; the observed association with stroke risk is potentially due to the functional impact on the binding affinity of ICAM-1 to both Mac-1 and LFA-1, thus possibly affecting adhesion and further interactions of circulating leukocytes to the vascular wall. Individuals car-rying ICAM-1 241R allele, 469E allele and the 241R/469E haplotype might be more susceptible for developing ischemic stroke. More impor-tantly, the linkage disequilibrium of the ICAM-1 gene with other ischemic stroke predisposing genes should be taken into accounts.

REFERENCES1. Arandi N., Talei A., Erfani N., et al (2008). Intercellular

adhesion molecule-1 genetic markers (+241 G/A and +469 A/G) in Iranian women with breast cancer; cancer genet cytogene 184 : 9.

2. Bansal S., Buring JE., Rifai N et al (2007). Fasting compared with non-fasting triglycerides and risk of cardiovascular events in women. J AMA; 298:309.

3. Buraczynska M., Zaluska M., Buraczynska G., et al (2012). The intercellular adhesion molecule-1 (ICAM-1) gene polymorphism K469E in end-stage renal dis-ease patients with cardiovascular disease. Hum Immu-nol 37: 824.

Role of ICAM-1 and sICAM-1 in Ischemic Stroke 794. Criqui MH. et al (2007) Triglycerides and coronary

heart disease revisited (again). Ann Intern Med; 147: 425.

5. Diamond MS., Staunton DE., deFougerolles AR., et al (1990). JCAM-1: a counter-receptor for Mac-1. J Cell Biol 111: 3129.

6. Friedwald WT., Levy RI., Fredrickson DS (1972). Esti-mation of the concentration of low density lipoprotein cholesterol in plasma, without use of the preparative ultracentrifuge. Clin Chem 18: 499.

7. Jiang H., Klein RM., Niederacher D (2002). C/T poly-morphism of the intercellular adhesion molecule-1 gene (exon6, codon 469). A risk factor for coronary heart disease and myocardial infarction. In J Cardiol 84: 171.

8. Joling P., Boom S., Johnson J (1994). Domain 5 of the intercellular adhesion molecule-1 (ICAM-1) is in-volved in adhesion of B-cells and follicular dendritic cells. Adv Exp Med Biol; 344: 131.

9. Lerant and Csiba (2012). The role of extracranial ul-trasound in the prevention of stroke based on the new guidelines. Perspect Med 1-12: 94.

10. Li XX., Liu JP., Cheng IQ., et al (2009). Intercellular adhesion molecule-1 gene K469E polymorphism and ischemic stroke: a case-control study in a Chinese pop-ulation. Mol Biol Rep; 36: 1565.

11. Reilly PL., Woska JR., Jeanfavre DD (1995). The native structure of intercellular adhesion molecule-1 (ICAM-1) is a dimmer. Correlation with binding to LFA-1. J Immunol; 155: 529.

12. Rekik I., Allassonniere S., Carpenter TK., et al (2012). Medical image analysis methods in MR/CT-imaged acute-subacute ischemic stroke lesion. Segmentation, prediction and insight into dynamic evolution simula-tion models. A critical appraisal; Neuroimage: Clinical 1:164.

13. Risk NM., Derbala MF (2013). Genetic polymorphisms of ICAM-1 and IL28 as predictors of liver fibrosis se-verity and viral clearance in hepatitis C genotype 4. Clin Res Hepatol Gas 37(3): 262.

14. Staunton DE., Dustin ML., Erickson HP., et al (1990). The arrangement of the immunoglobulin-like domains of ICAM-1 and the binding sites for LFA-1 and rhino-virus. Cell; 61: 243.

15. Tanne D., Haim M., Boyko V (2002). Soluble intercel-lular adhesion mdecule-1 and long term risk of acute coronary events in patients with chronic coronary heart disease. J Am Coll Cardiol; 39: 1133.

16. Volcik KA., Ballantyne CM., Hoogeveen R., et al (2010). ICAM-1 G241R polymorphism predicts risk of incident ischemic stroke: the atherosclerosis risk in communities (ARIC) study. Stroke; 41(5): 1038.

17. Wei YS., Liu YU., Huang RY (2005). Intercellular adhesion molecule-1 gene K469E polymorphism and genetic susceptibility of ischemic stroke in Chinese Zhuang populations. Zhonghsa Yi Xue Yi Chuen Xue Za Zhi; 22: 305.

Mohy, A.M. et al.80

sICAM-1 ومستوى , K469E)و (G241R ICAM-1 1-دور تعدد األشكال لجين جزيء االلتصاق الخلوىفى المصل في تطوير السكتة الدماغية في المرضى المصريين

عبير محمد محي - أحمد عبد اهلل حسن علي -هبة عمرالعالم. وشارك جزيء االلتصاق الخلوى-ICAM-1( 1( في للوفاة في الدماغية هي حاليا ثالث سبب رئيسي خلفية: السكتة االلتصاق جزيء لجين األشكال تعدد بين العالقة لتحديد األهداف: الدماغية. السكتة ظعن المسؤولة لألمراض المسببة اآلليات الخلوى-G241R ICAM-1 1) و(K469E , ومستوى sICAM-1فى المصل في تطوير السكتة الدماغية في المرضى المصريين المواضيع وطرق:تحليل الحمض النووى ل G241R ICAM-1 وK469Eتعدد االشكال الجينى بواسطة تقنية )ASP( وتفاعل البلمرة المتسلسل )PCR - RFLP( ، في 40 مريض يعانون من السكتة الدماغية و 40 اصحاء كمجموعة ضابطة. وقد تم قياس 469Eأليل و ICAM-1 241R النتائج: فى الدراسة الحالية تم الكشف عن ان .)ELISA( فى المصل عن طريق تقنية sICAM-1أليل مرتبطان بشكل كبير بزيادة مخاطر السكتة الدماغية. وكانت مستويات sICAM-1 فى المصل أعلى بكثير في مجموعة المرضى. االستنتاج: هذه النتائج تشير إلى أن G241R ICAM-1 وK469E تعدد األشكال الجيني قد تؤثر على قابلية الكتساب السكتة الدماغية

فى المجتمع المصرى.

γ- GLOBIN GENE XMN1 POLYMORPHISM-158 AND ITS CORRELATION TO THE RESPONSE TO HYDROXYUREA IN βTHALASSEMIA MAJOR

PATIENTS IN BENISUEF GOVERNORATE(EGYPT)Abdel Meged A. Abdel Meged*, Dalia G. Amin**, Dalia S. Morgan*and Safwat L. Shaker*

ABSTRACTβ-thalassemia is an inherited disorder characterized by a deficient or absent β-globin chain production, resulting in hypo-

chromic microcytic hemolytic anemia. Xmnl polymorphism has been reported to increase the level of hemoglobin F (HBF) and to give a better response to Hydroxyurea (HU) therapy in B-thalassemia patients. This study was conducted on 80 randomly selected cases of ß-thalassemia major patients and 40 age and sex matched controls; to study the prevalence of γ- globin gene Xmn1 polymorphism -158 in β- thalassemia patients by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP), results were correlated with percent of HBF, response to HU, and other clinical and hematological variables. Nine out of 80 ß-thalassemia major patients (11.25%) were heterozygous for Xmn1 polymorphism, homozygous Xmn1 poly-morphism was not detected in any of the included patients. The frequency of Xmn1 polymorphism in males and females showed no significant difference. Nearby frequency for heterozygous Xmn1 polymorphism was found among control subjects (5 out of 40, 12.5%), none was homozygous for Xmn1 polymorphism. Among the ß-thalassemia major group, a significant association was found between the presence of Xmn1 polymorphism and older age at first blood transfusion (p value = 0.02), higher Hb F levels (p value = 0.04), lower incidence of splenectomy (p value = 0.04) and decreased frequency of blood transfusion after HU treatment (p value = 0.03). The frequency of blood transfusion before HU treatment was lower in the presence of Xmn1 polymorphic site, however, statically it was not significant (p value = 0.76). Key wards: β-Thalassemia, Xmn1 polymorphic site, Hydroxyurea.

INTRODUCTION

In patients with β-thalassemia, blood trans-fusion at regular intervals eliminates anemia-related complications, compensatory marrow expansion and extends survival(11). Iron chela-tion reduces the accumulation of iron secondary to multiple transfusions, thereby dramatically improving the prognosis(12). However, adequate iron chelation is expensive; therefore alterna-tives to blood transfusion and chelation would be valuable to increase the safety and decrease the cost of thalassemia treatment and to provide effective treatment for patients who do not have access to blood transfusions(9).

Hydroxyurea is a pharmacological inducer of fetal hemoglobin (HbF) that significantly in-creases Hb levels and reduces transfusion needs in patients with thalassemia(14). Hydroxyurea induced increase in γ-chain synthesis may de-crease the imbalance between α and non α chain inβ-thalassemia patients.

It has been reported that in patients with β-thalassemia the presence of Xmnl polymor-

phic site, is associated with higher level of HbF(6), and better effect of Hydroxyurea(14).Also, there is strong evidence that the homozygous state of Xmn1 polymorphic site which is associ-ated with increased expression of Gγ gene may play an important role among other factors in ameliorating the clinical features of homozygous β -thalassemia intermedia(14).

Aim of the Work

The aim of this study is to determine the prevalence of Xmnl polymorphic site (C/T) 5’ to the Gγ gene in position -158 in a group of Egyptian β-thalassemia major patients as well as another group of healthy subjects, also to study its co-relation to the age of receiving first blood transfusion, rate of splenectomy, level of Hb F and response to HU in β-thalassemia major pa-tients in Egypt.

SUBJECTS AND METHODS

The present work is a prospective study con-ducted on 80 cases of β-thalassemia major and 40 age and sex matched control subjects; patients

Egypt. J. Lab. Med. Vol.(27) No.3, October, 2015, 81 - 88

Departments of Pediatrics*, Faculty of Medicine, Beni-Suef University and Clinical & Chemical Pathology**, Faculty of Medicine , Cairo University.

Abdel Meged, A. A. et al.82were randomly selected from the Hematology Clinic of follow up and blood transfusion;Beni-Suef University Hospital in collaboration with the Clinical Pathology Department, Faculty of Medicine, Cairo University. The study was ap-proved by the Ethics Committee of Cairo Uni-versity as well as Beni-Suef University and all procedures performed in studies involving hu-man participants were in accordance with their Ethical Standards. Informed Consent was ob-tained from each participant’s guardian.

Patients were subjected to full medical histo-ry and thorough physical examination stressing on the following points: age of presentation of anemia, age of first blood transfusion, frequency of blood transfusion, history of splenectomy, ad-ministration of HU, and facial bony deformities.

For both groups venous blood samples were collected in EDTA containing vacutainers to be used for performing: complete blood picture (CBC), high performance liquid chromatography (HPLC) for proper determination of HbF percent using variant II TM Hb testing system, Bio-Rad and study of single-nucleotide Xmn1 polymor-phism (C/T) in γ- globin gene position -158 in β- thalassemia patients, which was performed by polymerase chain reaction-restriction fragment length polymorphism assay (PCR-RFLP).

Statistics:The data was analyzed with the Sta-tistical Package for Social Science (SPSS)pro-gram version 16 under windows 7 in the form of description of qualitative variables by frequency and percentage, description of quantitative vari-ables in the form of mean and standard devia-tion (mean ± SD), Chi-square ( )test was used for comparison of qualitative variables with each other, comparison between quantitative variables was carried by using: Student unpaired t-test of two independent samples, and Significance level

For PCR-RFLP; genomic DNA was extracted from peripheral blood leukocytes, and stored at -80o C. Amplification of a 650-bp fragment 5’ to the γ- globin gene that contains the Xmn1poly-morphism was done by PCR using the primers and technique that were described before(14). The 25µl reaction mixture contained 1x PCR Buffer (100 mMTris HCL, 500 mMKCl, 0.8% Nonidet P40) 1mM MgCl2, 100µM dNTPs (dATP, dGTP, dCTP, dTTP), 10 pm/µl PCR primers, 3 units/µl Taq DNA polymerase (Fermentas life Science, USA) 100 ng of genomic DNA and the final vol-ume was made up with autoclaved MilliQ water. Working conditions were as follows: the initial denaturation at 94oC for 5 minutes, and then 30 cycles of: denaturation at 94oC for 1 minute, an-nealing at 55oC for 1 minute and extension at 72oC for 1.5 minutes followed by a final exten-sion step at 72oC for 5 minutes.

Genotyping of wild type and mutant allele of Xmn1 was carried out using RFLP method; about 10µ of the amplified PCR product was digested with five units of Xmn1 restriction en-zyme and electrophoresed on a 2% agarose gel. In the presence of T allele (mutant), two frag-ments of 450- and 200-bp were produced. The presence of the normal allele (C) loses cleavage site for Xmn1 and thus an intact 650-bp frag-ment was produced (Fig. 1).

(p) was expressed as following: P value > 0.05 is insignificant, P value < 0.05 is significant and P value < 0.001 is highly significant.

RESULTSThis study included 80 patients with β thal-

assemia major 48 (60%) were males and 32 (40%) were females. The age of the study group ranged from 3 year to 16 years, with a mean of 8.4 ±2.98.Nine out of 80 ß-thalassemia major patients (11.25%) were heterozygous for Xmn1

Table (1): Primer sequence and restriction enzymes used in the PCR-RFLP reaction

ᵒ

ᵒ

ᵒ

γ- Globin Gene Xmn1 Polymorphism and Response to HU in βThalassemia 83polymorphism (+/-), homozygous Xmn1 poly-morphism (+/+) was not detected in any of the included patients. Nearby frequency for hetero-zygous Xmn1 polymorphism was found among control subjects (5 out of 40, 12.5%), none was homozygous for Xmn1 polymorphism.

The frequency of Xmn1 polymorphic site in males and females was 10 %(5 out of 48) and 12.5 % (4 out of 32) respectively with no signifi-cant difference (p value = 0.589).

Pre transfusion Hb ranged from 6 g. /dl to 9 g. /dl. with a mean value 7.56 ± 0.52 and the age of first blood transfusion ranged from 5 months of age to 30 months old.

Although, Hb levels were higher in the group of patients with Xmn1 polymorphism compared to the group without Xmn1 polymorphism, how-ever that difference was not statistically signifi-cant (p value = 0.78).

A statisticallysignificant correlation was found between the presence of Xmn1 polymor-phic site and the age of first blood transfusion (P = 0.02). In the presence of Xmn1 polymor-phic site, the need for blood transfusion was at an older age.

The frequency of blood transfusion before HU, showed a mean value of 13.46 ±2.53 times/year as it ranged from 8 to 20 times/year, while after HU the mean value became 3.89 ± 4.98 as

it ranged from 0 to 15 times/year.

The frequency of blood transfusion before HU treatment was decreased in the presence of Xmn1 polymorphic site,however, statistically it was not significant (p value = 0.76), while after HU treatment a significant correlation was found between the presence of Xmn1 polymorphic site and the frequency of blood transfusion. The fre-quency of blood transfusion after HU treatment was decreased in the presence of Xmn1 poly-morphic site (p value = 0.03).

A significant correlation between Xmn1 polymorphic site and Hb F level was detected. Hb F levels were higher in the presence of Xmn1 polymorphic site compared to the absence of Xmn1 polymorphic site (p value = 0.04).

A significant negative association was found between the presence of Xmn1 polymorphic site and splenectomy (p value = 0.04). Splenectomy-was done for 23 patient among our studied group none of them was carrying the Xmn1 polymor-phism.

No significant correlation was found between the presence of Xmn1 polymorphic site with his-tory of consanguinity, family history of similar condition, duration of illness, or incidence of chelation therapy.

Table (2): Parameters associated withγ- globin gene -158Xmn1 polymorphism

Abdel Meged, A. A. et al.84

DISCUSSION

Beta-Thalassemia major has a spectrum of clinical severity which is associated with inef-fective erythropoiesis, bone marrow expansion and rapid destruction of erythrocytes. Anemia demands frequent blood transfusion to maintain life while hemosiderosis and other complications of the disease require a continuous and distress-ing treatment regimen that includes iron chela-tion treatment, regular medical supervision, and frequent admission to the hospital and on many occasion surgeries. The only curative treatment for this disease is bone marrow transplantation (BMT) which is expensive and has a variable success rate of 60-70%(2).

Patients with severe β-thalassemia are usu-ally diagnosed between 6 months and 2 years of age when the normal physiological anemia of the newborn fails to improve. Sometimes, the patients cannot be recognized until the child reaches 3 to 5 years of age because the infant is able to partially compensate for the marrow’s inability to produce hemoglobin A by prolonged production of Hb F(23).

In the present study the frequency of pres-ence Xmn1 polymorphic site in 80 patients with β-thalassemia major was found to be 11.25%, the prevalence of Xmn1 polymorphic site 5′ to the Gγ gene is different among various populations.

Among Egyptians, a frequency of 6.25%,9%, 4%and 8.3 have been reported for Xmn1 poly-morphism among Egyptians with β-thalassemia, respectively(18, 10, 21, 20).

In agreement Wong et al. (2006)(24) found that the frequency in Chinese β-thalassemia ma-jor patients was 10.3%, a nearby frequency was reported by Geoffrey etal(8). in Hong Kong who demonstrated that the frequency of Xmn1 poly-morphism (at nucleotide 158 bp5`) was 13%.

On the other hand, Mehrnoosh et al(11). report-ed that 76% of Iranians β-thalassemia major pa-tients had positive Xmn1 polymorphism, while a frequency of 25% for Xmn1 polymorphic site in 64 β-thalassemia patients from India has been reported(18,24).

Regarding the current study, the most fre-quent genotype observed was homozygosity for the absence of the XmnI site (-/-) in 88.75% of cases, heterozygosity (+/-) genotype was detect-ed in 11.25 % of cases, while homozygosity for the XmnI polymorphic site (+/+) genotype was absent.

The 158 (C-T) polymorphism of the Gγ-globin gene (Xmn1 polymorphism) is known to ameliorate the severity of the disease because of its strong association with an increased pro-duction of HbF(1).HbF production can partially compensate for the lack of adult hemoglobin (Hb A) in patients with β-thalassemia major or intermedia, and ameliorate the clinical severity of these diseases(8). The presence of Xmn1 poly-morphic site 5′ to the Gγ-globin promoter region was positively correlated with elevated synthe-sis of fetal Hb and its Gγ-globin component in term newborn infants and is associated with de-layed switch over from fetal to adult hemoglo-

Fig. 1 An agarose gel electrophoresis pattern of some of PCR products with 650 bp from patients digested with Xmn1.Lane 1: DNA ladder (100, 200, 300, 400 bp,…), Lanes 2, 4, 6, 7, 9 and 10 are homozygous for the wild allele Xmn1(-/-); showing one band at 650 bp.Lanes 3, 5, 8 and 11 are heterozygous for Xmn1 polymorphism (+/-); showing three bands (one at 450 bp and the second at 200 bp and the third at 650 bp).

γ- Globin Gene Xmn1 Polymorphism and Response to HU in βThalassemia 85bin. It is unknown that how Xmn1 polymorphic site influences the expression of the Gγ-globin gene. It seems that interaction of a multi-protein transcription complex to be involved. In a ge-nome-wide linkage study of large Asian Indian kindred, a genetic interaction between the Xmn1 polymorphic site and a locus on chromosome 8q was reported to have influence on adult F cell (FC) levels(22).

Analysis of β-globin gene cluster showed a strong association between the Xmn1 polymor-phic site and FC levels. Unlike the rare mutations in the γ-globin promoter that are consistently as-sociated with large discrete effects of increased Hb F levels of 10-35% in heterozygote, the so-called pan cellular hereditary persistence of fetal hemoglobin (HPFH), the change at Gγ-158 does not always raise the Hb F levels in otherwise normal individuals. The Xmn1 polymorphic site is not a recognized binding motif for any of the known transcription factors. Nonetheless, al-though it has little effect in normal individuals, clinical studies have shown that, under condi-tions of hemopoietic stress, for example in ho-mozygous β-thalassemia and sickle cell disease, the presence of Xmn1 polymorphic site favors a higher Hb F response. This may explain why the same mutations on different β-chromosomal backgrounds (some with and others without the Xmn1 polymorphic site) are associated with dif-ferent clinical severity.

However, Hb F response associated with the Xmn1 polymorphic site is usually moderate and may not be sufficient to explain the wide differ-ence in phenotype observed in some cases(13, 20).

Rahimi et al. in a study on sickle cell patients from Southwest Iran, showed that in the pres-ence of Xmn1 polymorphic site the Hb F levels and Gγ: Aγ ratio were increased(15).

One more study demonstrated that in patients with hypoplastic syndromes the presence of Xmn1 polymorphic site, significantly correlated with Hb F levels(19).

Ballas et al., revealed that there was a signifi-cant correlation between the presence of Xmn1 polymorphic site and increased Gγ: Aγ ratio. However, the Hb F level was not significantly-

increased in the presence of Xmn1 polymorphic site in their study. Although Xmn1 polymorphic site maintains a Gγ: Aγ ratio typical of fetal life but does not necessarily cause elevation of Hb F. The latter seems to depend on factors other than the Xmn1 polymorphic site(3).

The present study demonstrated that cases with Xmn1 Gγ (+/-) showed higher Hb F, as Hb F level was 76.38 % in comparison with the mean Hb F in Xmn1 Gγ (-/-) cases which was 26.55%. This agrees with the finding of Garner et al.(7) they reported that the β-thalassemia patients who had also co-inherited the Xmn1 polymorphism in the Gγ-globin gene promoter had higher mean HbF than non carriers of this polymorphism, also Majid et al.,(25) found that C-T polymorphism at 158 upstream of the Gγ globin gene, has been shown to be responsible for high HbF levels in β-thalassemia and sickle cell disease. This was strengthened byMehrnoosh et al.(11) they postu-lated that the presence of the Xmn1 marker un-der the condition of hematopoietic stress might contribute to over production of Hb F causing persistence of high fetal hemoglobin HPFH. It seems that this phenomenon carries mild feature of the disease.

In the present study 29% of β-thalassemia pa-tients had been splenectomized. All of them were negative for Xmn1 polymorphic site. We found that there is a significant negative association be-tween the presences of Xmn1 polymorphic site and splenectomy. Splenectomy indicated when massive splenomegaly causes hypersplenism, which aggravates anemia, thrombocytopenia, and leucopenia and increases transfusion re-quirements. Removing of the spleen often brings the situation back to what it was earlier in life. The anemia gets better, so some people can stop transfusions again after splenectomy(5).

In this study the frequency of blood transfu-sion after HU treatment was significantly de-creased in the presence of Xmn1 polymorphic site Xmn1 +/- in comparison to Xmn1 -/-, hy-droxyurea enhances fetal hemoglobin produc-tion.

In agreement, Mehrnoosh et al.(11) reported that β-thalassemia major or intermedia with Xmn1 polymorphism showed better response of

Abdel Meged, A. A. et al.86HU than Xmn1 -/- genotype. In consolidation, it is reported that treatment of β-thalassemia patients with hydroxyurea, in the presence of Xmn1 polymorphic site has affected the clinical response to hydroxyurea therapy and a better re-sponse has been achieved(16).

An increase in total Hb level has been re-peatedly reported during hydroxyurea treat-ment in patients with sickle cell disease and β-thalassemia. A marked elevation of total Hb levels with hydroxyurea can eliminate trans-fusion requirements in children with severe β-thalassemia(4).

Majid et al.(25) studied the response of hy-droxyurea treatment in Iranian transfusion de-pendent β-thalassemia patients and found that erythroid cultures from different thalassemia pa-tients showed different results in the presence of hydroxyurea. The number of HbF-cells and the Hb F content per cell increased in some individ-uals, while in others, only the HbF-cell number increased with a moderate rise in HbF content per cell, whereas in other studies only a minimal effect was observed. This variation in response to HU suggested that one or more genetic factors are involved.

The present study revealed that in the pres-ence of Xmn1 polymorphic site, the average age at first blood transfusion was increased com-pared to the absence of a polymorphic site. A significant correlation was identified between Xmn1 polymorphic site and age at first blood transfusion in the present study. It seems that in the presence Xmn1 polymorphic site the need to blood transfusion is decreased.

This was in agreement with Nemati et al.(14) who reported that transfusion dependency start-ed fairly late in the presence of Xmn1 polymor-phic site and thus increased the age at first blood transfusion in patients

REFERENCES1) Agouti I, Badens C, Abouyoub A et al. (2007): Genotypic

correlation between six common beta-thalassemia mu-tation and the Xmn I polymorphism in Moroccan popu-lation. Hemoglobin 31(2):141.

2) Anita Saxena (2003): Growth retardation in thalassemia major patients. Int J Hum Genet. 3 (4): 237.

3) BallasS K, Talacki CA, Adachi K, et al (1991): The Xmn1 site(-158,c→T) 5′ to the G gamma gene: cor-

relation with the Senegalese haplotype and G gamma globin expression. Hemoglobin 15(5):393.

4) Bradai M, Pissard S, Abad MT, et al (2007): Decreased transfusion needs associated with hydroxyurea therapy in Algerian patients with thalassemia major or interme-dia. Transfusion 47(10):1830.

5) Cohen A.R., Galanello R., Pennell D.J. et al. (2004): Thalassemia. Hematol.2004 (1):14.

6) Creary, L.E., Ulug, Menzel, S., Mckenzie, C.A, et al (2009): Genetic variation on chromosome 6 influences F. cell levels in healthy individuals of African descent and HbF levels in Sickle cell patients. Plos One, .4(1): e 4218.

7) Garner C., Tatu T., Best S., et al. (2002): Evidence for ge-netic interaction between the beta-globin complex and chromosome 8q in the expression of fetal hemoglobin. Am J. Hum Gent. 70(3):793.

8) Gibney GT, Panhuysen CI, So JC, et al. (2008): Variable and heritability of HbF and F-cells among β-thalassemia heterozygotes in Hong Kong. Am. J. Hematol. 83(6): 458.

9) Goldstein,D.B. (2009): Common genetic variation and human trials . N_Engl_J_Med. 360 (17): 1696 .

10) Kaddah N, Rizk S, Kaddah A.M., et al (2009): Study of Possible Genetic Factors Determining the Clinical Pic-ture of Thalassemia Intermedia. J. Med. Sci., 9(3): 151.

11)Kosaryan M, VahidshahiK, KaramiH,Ehteshami S. (2009):Effect of Hydroxyurea on Thalassemia major and Thalassemia Intermedia in Iranian patients. Pak. J. Med.Sci., 25(1):74.

12)Mohamed B, Serge P, Moohand TA et al. (2007): De-creased transfusion needs associated with hydroxyurea therapy in Algerian patients with thalassemia major and intermedia. Transfusion 47(10):1830 .

13) Najmabadi H, Karimi-Nejad R, Sahebjam S, et al (2001): The β-thalassemia mutation spectrum in the Iranian population. Hemoglobin 25(3):285.

14)Nemati H, Rahimi Z and Bahrami G. (2010): The Xmn-lpolymorphic site 5’ to theGγ gene and its correlation to theGγ :Aγ ratio, age at first blood transfusion and clinical features in β- Thalassemia patients from West-ern Iran. Mol. Biol. Rep., 37(1):159.

15) Rahimi Z, Karimi M, Haghshenass, et al (2003): Beta globin gene cluster haplotypes in sickle cell patients from Southwest Iran. Am J Hematol., 74(3):156.

16) Rund D and Rachmilewitz.E (2005): β-thalassemia. N. Engl. J. Med., 353(11): 1135.

17) Said F and Abdel-Salam A (2015):XmnI polymor-phism: Relation to b-thalassemia phenotype and gen-otype in Egyptian Children. The Egyptian Journal of Medical Human Genetics 16, 123.

γ- Globin Gene Xmn1 Polymorphism and Response to HU in βThalassemia 8718) Serafi TI, Ismail EF, Mahmoud MA, et al (2008): Ef-

fect Alpha Globlin Gene Deletion And Gamma Globin Gene -158 (C/T) Polymorphism In Beta-Thalassemic Patients. Egyptian Journal of Biochemistry and Mo-lecular Biology Vol. 26 (2): 85.

19) Shimmoto MM, Vicari P, Fernandes AC, et al (2006): Xmn1 polymorphism is associated with fetal hemoglo-bin levels in hypoplastic syndromes. Sao Paulo Med J 124(2):110.

20) Steinberg MH, Forget BG, Higgs DR, et al (2001): Disorders of hemoglobin: genetics, pathophysiology, and clinical management. Cambridge University press, Cambridge,pp 356.

21) Tantawy AAG, Andrawes NG, Ismaeli A, et al (2012): Prevalence of Xmn l G gamma polymorphism in Egyp-tian patients with beta-thalassemia major. Ann Saudi

Med 32(5): 487.

22) Thein SL. (2002): β-thalassemia prototype of a single gene disorder with multiple phenotypes. Int. J. Hema-tol., 76 (Suppl 2) : 96-.

23)Weatherall DJ (2001): Phenotype-genotype relation-ships in monogenic disease.Lessons from the thalas-semias. Nat. Rev. Genet., 2(4): 245.

24)Wong YH, George E, Kim Lian, et al. (2006): Molecular characterization and frequency of XmnI polymorphism in Chinese and Malay β-thalassemia patients in Malay-sia. Malaysian J.Pathol., 28(1): 17.

25)Yavarian M, Karimi M, Bakker E, et al (2004): Re-sponse to hydroxyurea treatment in Iranean trans-fu-sion-dependent β-thalassemia patients. Haematologica 89(10): 1172 .

Abdel Meged, A. A. et al.88

تعدد أشكال γ غلوبين جين Xmn1 -158 وعالقتها باالستجابة لعالج الهيدروكسييوريا

في مرضى الثالسيميا الكبرىβ – في محافظة بني سويف (بمصر)

عبدالمجيد ابوالمجد عبدالمجيد - داليا جميل امين - داليا صابر مرجان - صفوت لطفي شاكر

البيتاثالسيمياهومرض وراثي يتميزبنقص إنتاج أوغياب سلسلة β- غلوبين، مما يؤدى إلى فقرالدم االنحاللي صغير الكريات. تم دراسة تعدد األشكال في جين Xmnl وعالقته بزيادة مستوىالهيموجلوبين ((HBF وإعطاءاستجابة أفضل للعالج بالهيدروكسي يوريا (HU) في المرضى الذين يعانون من الثالسيميا الكبرى β وقد أجريت هذه الدراسة على 80 حالة تم اختيارها عشوائيا من بين مرضى الثالسيميا الكبرىβ و 40 شخص متجانسين في العمر والنوع كمجموعة ضابطه لدراسة انتشار γ تعدد األشكال في الجين γ غلوبين (PCR-RFLP) بواسطة تفاعل البلمرة المتسلسل متبوعا بالتقطيع المحدد االطوال. تعدد األشكال -β في مرضىالثالسيميا Xmn1 -158تم دراسة االرتباط بينه وبين نتائج النسبه المئويه لHBF، االستجابه للعالج بالHU، وغيره امن المتغيرات االكلينكيه والمعمليه. تسعة منأصل ß 80 مرضىالثالسيميا الكبرى (٪11.25) متخالف لXmn1 تعدد األشكال. أظهرXmn1 تعدد األشكال في الذكورواإلناث اليوجد فرق احصائي. تم العثورعلى نسبه متقاربهXmn1تعدد األشكال بين المجموعه الضابطة (5 منأصل 40، ٪12.5). من بين مجموعة كبيرة-ß الثالسيميا تم العثورعلى ارتباط كبير بين وجودXmn1 تعدد األشكال وكبرالسن في نقل الدم للمره األولي ( القيمة = 0.02)،وارتفاع مستويات الهيموجلوبين F (قيمةP = 0.04)، انخفاض نسبة استئصال الطحال (قيمة = 0.04) ، وانخفضت وتيرة نقل الدم بعد العالج HU (قيمةP = 0.03). وكان تواترنقل الدم قبل العالج HUأقل في وجودXmn1موقع متعدد األشكال، ولكن، بشكل ثابت

لم يكن ذو دالله احصائيه (قيمةP = 0.76). كلمات مفتاحيه: β-الثالسيميا،Xmn1متعدد األشكال، هيدروكسي يوريا.

Modern Commercial Press22, Idress Ragheb St., - El Daher -Ramsis

Tel.: 2590 33 64 - 2590 23 67 , Fax : 2590 23 68-cairo

Email : esamragab28@gmail.com Mobil: 01001400710

Modern Commercial Press22, Idress Ragheb St., - El Daher -Ramsis

Tel.: 2590 33 64 - 2590 23 67 , Fax : 2590 23 68-cairo

Email : esamragab28@gmail.com