supplementary information - nature · 2016-02-16 · isoprenoids sample prepared from s. aureus...
TRANSCRIPT
![Page 1: Supplementary Information - Nature · 2016-02-16 · isoprenoids sample prepared from S. aureus Newman (c), ispA mutant (d), and its complementary strain ispA-C (e), and wild-type](https://reader033.vdocuments.us/reader033/viewer/2022041810/5e5717d0ed237d1721008bee/html5/thumbnails/1.jpg)
1 / 28
Supplementary Information
Small molecule targeting of a diapophytoene desaturase inhibits S. aureus
virulence
Feifei Chena, Hongxia Di
a, Youxin Wang
c, Qiao Cao
a, Bin Xu
a, Xue Zhang
a, Nana
Yanga, Guijie Liu
a, Cai-Guang Yang
a, Yong Xu
d, Hualiang Jiang
a, Fulin Lian
b, Naixia
Zhangb, Jian Li
c*, Lefu Lan
a*
aState Key Laboratory of Drug Research, Shanghai Institute of Materia Medica,
Chinese Academy of Sciences, Shanghai 201203, China;
bShanghai Institute of Materia Medica, Chinese Academy of Sciences, Shanghai
201203, China;
cShanghai
Key Laboratory of New Drug Design, School of Pharmacy, East China
University of Science and Technology, Shanghai 200237, China;
dHumanwell Healthcare (Group) Co. Ltd., Wuhan 430075, China.
F.C., H.D., and Y.W. contributed equally to this work.
*Address correspondence to Lefu Lan, [email protected], or Jian Li,
Nature Chemical Biology: doi:10.1038/nchembio.2003
![Page 2: Supplementary Information - Nature · 2016-02-16 · isoprenoids sample prepared from S. aureus Newman (c), ispA mutant (d), and its complementary strain ispA-C (e), and wild-type](https://reader033.vdocuments.us/reader033/viewer/2022041810/5e5717d0ed237d1721008bee/html5/thumbnails/2.jpg)
2 / 28
Supplementary Results
TABLES
Supplementary Table 1. Plasmids and strains used in this study
Strains or plasmids Relevant genotype or characteristic Source
Plasmids
pYJ335 E. coli-S. aureus shuttle vector, Cmr,
Ermr
1
pCL-LacZ E. coli-S. aureus shuttle cloning vector,
single-copy integration vector in S.
aureus
2
pCL-crtO-lacZ pCL-lacZ derivative carrying crtO
promoter
3
pET28a Kmr, protein expression vector Novagen
pTX15 Xylose-inducible and glucose-repressible
expression vector, Tcr
4,5
pTXcrtMN pTX15 derivative carrying crtMN gene 4
pYJ335::crtN pYJ335 derivative carrying crtN gene of
S. aureus Newman in the downstream of
the xyl/tetO promoter
This study
pYJ335::ispA pYJ335 derivative carrying ispA gene of
S. aureus Newman in the downstream of
the xyl/tetO promoter
This study
pET28a::crtM pET28a derivative carrying crtM gene
of S. aureus Newman
This study
pET28a::crtN pET28a derivative carrying crtN gene
of S. aureus Newman
This study
pET28a::crtMN pET28a derivative carrying crtMN of S.
aureus Newman
This study
pET28a::ispA pET28a derivative carrying ispA of S.
aureus Newman
This study
pCL-crtN pCL-lacZ derivative carrying crtN gene
under control by the xyl/tetO promoter of
pYJ335
This study
Staphylococcus aureus
Newman Wild-type, S. aureus ATCC 25904 6
RN4220 Derivative of 8325-4 that accepts
plasmids
7
USA300 LAC A representative CA-MRSA isolate,
which was first isolated in Los Angeles,
8
Nature Chemical Biology: doi:10.1038/nchembio.2003
![Page 3: Supplementary Information - Nature · 2016-02-16 · isoprenoids sample prepared from S. aureus Newman (c), ispA mutant (d), and its complementary strain ispA-C (e), and wild-type](https://reader033.vdocuments.us/reader033/viewer/2022041810/5e5717d0ed237d1721008bee/html5/thumbnails/3.jpg)
3 / 28
Calif.
USA400 MW2 MW2 is PFGE type USA400, the
prototype CA-MRSA strain type endemic
in the U.S. Midwest.
8
NRS1 (Mu50) A HA-MRSA/VISA strain isolated in
Japan
9
Newman crtM A transposon insertion in the crtM gene
of Newman strain
10,11
Newman crtN A transposon insertion in the crtN gene of
Newman strain
10,11
LAC crtN Transduction of crtN::erm allele from
Newman crtN mutant into USA300 LAC
This study
MW2 crtN Transduction of crtN::erm allele from
Newman crtN mutant into USA400 MW2
This study
Newman::pCL Wild-type S. aureus Newman carrying an
empty integration vector pCL-lacZ
3
Newman crtN:: pCL Newman crtN mutant carrying an empty
integration vector pCL-lacZ
This study
Newman crtN::pCL-crtN crtN::C strain, Newman crtN mutant
carrying integration vector pCL-crtN
This study
LAC::pCL Wild-type S. aureus USA300 LAC
carrying an empty integration vector
pCL-lacZ
This study
LAC crtN:: pCL LAC crtN mutant carrying an empty
integration vector pCL-lacZ
This study
LAC crtN::pCL-crtN crtN::C strain, LAC crtN mutant carrying
an integration vector pCL-crtN
This study
MW2::pCL Wild-type S. aureus USA400 MW2
carrying an empty integration vector
pCL-lacZ
This study
MW2 crtN:: pCL MW2 crtN mutant carrying an empty
integration vector pCL-lacZ
This study
MW2 crtN:: pCL-crtN crtN::C strain, MW2 crtN mutant
carrying an integration vector pCL-crtN
This study
Newman:: crtO-lacZ Wild-type Newman carrying an
integration vector pCL-crtO-lacZ
This study
Newman/pYJ335 Wild-type Newman carrying plasmid
pYJ335
This study
Newman/pYJ335::crtN Wild-type Newman carrying plasmid
pYJ335::crtN
This study
crtN/pYJ335 Newman crtN mutant carrying plasmid
pYJ335
This study
crtN/pYJ335::crtN crtN-C strain, Newman crtN mutant
carrying plasmid pYJ335::crtN
This study
Nature Chemical Biology: doi:10.1038/nchembio.2003
![Page 4: Supplementary Information - Nature · 2016-02-16 · isoprenoids sample prepared from S. aureus Newman (c), ispA mutant (d), and its complementary strain ispA-C (e), and wild-type](https://reader033.vdocuments.us/reader033/viewer/2022041810/5e5717d0ed237d1721008bee/html5/thumbnails/4.jpg)
4 / 28
Newman ispA A transposon insertion in the ispA gene of
Newman strain
10,11
ispA/pYJ335 Newman ispA mutant carrying plasmid
pYJ335
This study
ispA/pYJ335::ispA ispA-C strain, Newman ispA mutant
carrying plasmid pYJ335::ispA
This study
Staphylococcus carnosus
TM300::pTX15 Staphylococcus carnosus TM300
carrying plasmid pTX15
4
TM300::pTXcrtMN Staphylococcus carnosus TM300
carrying plasmid pTXcrtMN
4
E. coli
BL21(DE3) F− ompT hsdSB (rB
− mB
−) gal dcm met
(DE3)
Laboratory
stock
DH5α
endA hsdR17 supE44 thi-1 recA1 gyrA
relA1Δ(lacZYA-argF)U169 deoR
(φ80dlacΔ(lacZ)M15)
Laboratory
stock
Cmr, chloroamphenicol resistance; Erm
r, erythromycin resistance; Tc
r, tetracycline
resistance; Kmr, kanamycin resistance.
Supplementary Table 2. Primers used in this study.
Primers Sequence (5′to 3′)
crtN-F TAAATATCATAGAATATAGGTGGTTG
crtN-R CCCTTATACTTTTCTCACATCT
IspA-F AAAGAAGAAGCTGAGGATGTAAAAA
IspA-R TTGCTTTTAGTGATCCCTGCTA
IspA-PF CGCGGATCCATGACGAATCTACCGATGAATAAAT
IspA-PR CCCAAGCTTTTAGTGATCCCTGCTATAAAATAAA
crtM-PF CGCGGATCCATGACAATGATGGATATGAATTTTAA
crtM-PR CCGCTCGAGCTATATTCTATGATATTTACTATTT
crtN-PF CGCGGATCCATGAAGATTGCAGTAATTGGTGCAG
crtN-PR CCGCTCGAGTTATACGCCCCGCTCAATATCTTTA
crtN-pCL-F CCGGAATTCCTTGGTTACCGTGAAGTTACCATCACGG
crtN-pCL-R CGGGGTACCCTTTCTCTTAGACTACTCCCTTATACG
Nature Chemical Biology: doi:10.1038/nchembio.2003
![Page 5: Supplementary Information - Nature · 2016-02-16 · isoprenoids sample prepared from S. aureus Newman (c), ispA mutant (d), and its complementary strain ispA-C (e), and wild-type](https://reader033.vdocuments.us/reader033/viewer/2022041810/5e5717d0ed237d1721008bee/html5/thumbnails/5.jpg)
5 / 28
FIGURES
Supplementary Figure 1. The proposed staphyloxanthin biosynthetic pathway
and the gene cluster organization of staphyloxanthin biosynthesis genes in S.
aureus. IPP, isopentenyl diphosphate; DMAPP, γ,γ-dimethylallyl pyrophosphate; OPP,
O-linked pyrophosphate; GPP, geranyl pyrophosphate; FPP, farnesyl diphosphate;
IspA, FPP synthase. The lines show the interaction between the players: hammerheads,
Nature Chemical Biology: doi:10.1038/nchembio.2003
![Page 6: Supplementary Information - Nature · 2016-02-16 · isoprenoids sample prepared from S. aureus Newman (c), ispA mutant (d), and its complementary strain ispA-C (e), and wild-type](https://reader033.vdocuments.us/reader033/viewer/2022041810/5e5717d0ed237d1721008bee/html5/thumbnails/6.jpg)
6 / 28
repression; solid line with arrow, a direct influence or direct connection; dotted line
with arrow, a putative or indirect connection. BPH652 is a known inhibitor of CrtM12
.
Nature Chemical Biology: doi:10.1038/nchembio.2003
![Page 7: Supplementary Information - Nature · 2016-02-16 · isoprenoids sample prepared from S. aureus Newman (c), ispA mutant (d), and its complementary strain ispA-C (e), and wild-type](https://reader033.vdocuments.us/reader033/viewer/2022041810/5e5717d0ed237d1721008bee/html5/thumbnails/7.jpg)
7 / 28
Supplementary Figure 2. Effect of naftifine on the bacterial growth and pigment
production of S. aureus. (a,b) Effect of naftifine on the bacterial growth of S. aureus
Newman. Data shown represent the mean SD from quadruplicate experiments. (c–e)
The dose-response curves and IC50 value of naftifine hydrochloride in the pigment
production of S. aureus USA300 LAC (c), USA400 MW2 (d), and Mu50 (e). Data
shown represent the mean SEM from triplicate experiments. The level of the
pigment production by untreated wild-type S. aureus bacteria are set to 100%,
respectively. Naftifine was used in the forms of hydrochloride salt.
Nature Chemical Biology: doi:10.1038/nchembio.2003
![Page 8: Supplementary Information - Nature · 2016-02-16 · isoprenoids sample prepared from S. aureus Newman (c), ispA mutant (d), and its complementary strain ispA-C (e), and wild-type](https://reader033.vdocuments.us/reader033/viewer/2022041810/5e5717d0ed237d1721008bee/html5/thumbnails/8.jpg)
8 / 28
Supplementary Figure 3. Effect of naftifine on crtOPQMN operon promoter
activity, pigment production, and the isoprenoids production of S. aureus
Newman. (a) Bacteria were cultured in Tryptone Soya Broth (TSB) medium at 37 C
for 6 h, and after that the bacterial cultures were treated with naftifine hydrochloride
(100 μM), and sampled at different time points thereafter. LacZ activity was
normalized by cell density at 600 nm (OD600). Data shown represent the mean SD
from triplicate experiments. (b) Photographs showed the pigmentation of S. aureus
cells (harvested by centrifugation) untreated or treated by naftifine hydrochloride (100
μM) for 12 h. (c–f) RP-HPLC chromatograms (absorption at 210 nm) of the
Nature Chemical Biology: doi:10.1038/nchembio.2003
![Page 9: Supplementary Information - Nature · 2016-02-16 · isoprenoids sample prepared from S. aureus Newman (c), ispA mutant (d), and its complementary strain ispA-C (e), and wild-type](https://reader033.vdocuments.us/reader033/viewer/2022041810/5e5717d0ed237d1721008bee/html5/thumbnails/9.jpg)
9 / 28
isoprenoids sample prepared from S. aureus Newman (c), ispA mutant (d), and its
complementary strain ispA-C (e), and wild-type S. aureus Newman treated by
naftifine hydrochloride (f). Wild-type Newman and ispA mutant harbor plasmid
pYJ335. The details of the information of S. aureus strains are shown in
Supplementary Table 1. Inset photographs showed the pigmentation of indicated S.
aureus cells harvested by centrifugation. Arrows indicate two HPLC peaks, which are
absent from the HPLC profiles due to the inactivation of ispA involved in the
isoprenoid biosynthetic pathway.
Nature Chemical Biology: doi:10.1038/nchembio.2003
![Page 10: Supplementary Information - Nature · 2016-02-16 · isoprenoids sample prepared from S. aureus Newman (c), ispA mutant (d), and its complementary strain ispA-C (e), and wild-type](https://reader033.vdocuments.us/reader033/viewer/2022041810/5e5717d0ed237d1721008bee/html5/thumbnails/10.jpg)
10 / 28
Supplementary Figure 4. Fluorescence-based thermal shift assay and HPLC
analysis. (a) Thermal denaturation curves for purified 6His-ispA alone (3 μM,
approximately 2 μg) or in the presence of variable concentrations (30, 150, and 300
μM) of ibandronate sodium (Iban). (b) HPLC chromatogram (absorption at 210 nm)
of the isoprenoids sample prepared from S. aureus Newman treated with ibandronate
sodium (100 μM).
Nature Chemical Biology: doi:10.1038/nchembio.2003
![Page 11: Supplementary Information - Nature · 2016-02-16 · isoprenoids sample prepared from S. aureus Newman (c), ispA mutant (d), and its complementary strain ispA-C (e), and wild-type](https://reader033.vdocuments.us/reader033/viewer/2022041810/5e5717d0ed237d1721008bee/html5/thumbnails/11.jpg)
11 / 28
Supplementary Figure 5. HPLC analysis of carotenoids samples prepared from E.
coli expressing either crtM or crtMN. (a) HPLC chromatograms of the carotenoid
extracts derived from E. coli/pET28a. (b,c) HPLC chromatograms of the carotenoid
extracts derived from E. coli expressing either S. aureus crtM (b) or crtMN (c).
Bacteria were grown in LB medium for 24 h. The pigmentation of the indicated
bacteria cells harvested by centrifugation is illustrated. The inset shows the
absorbance spectrum of the indicated HPLC peak. mAu, milli absorbance units. Abs
(absorbance), representing the amount of light absorbed by the sample.
Nature Chemical Biology: doi:10.1038/nchembio.2003
![Page 12: Supplementary Information - Nature · 2016-02-16 · isoprenoids sample prepared from S. aureus Newman (c), ispA mutant (d), and its complementary strain ispA-C (e), and wild-type](https://reader033.vdocuments.us/reader033/viewer/2022041810/5e5717d0ed237d1721008bee/html5/thumbnails/12.jpg)
12 / 28
Supplementary Figure 6. Experiments show that CrtN is the target for naftifine
activity. (a) The dose-response curves and IC50 value of nafitine hydrochloride in the
pigment production of Newman/pYJ335::crtN strain (crtN+++
). (b,c) The
dose-response curves and IC50 value of BPH-652 in the pigment production of
Newman (harboring pYJ335) (b) and Newman/pYJ335::crtN strain (crtN+++
)(c). In
(a–c), data shown represent the mean SEM from triplicate experiments. The level of
the pigment production by untreated S. aureus bacteria is set to 100%. (d) Effect of
naftifine hydrochloride treatment on S. aureus Newman crtN mutant bacteria survival
in the kidneys, hearts, and livers of mice. BALB/c mice received mock (n = 11) or
naftifine hydrochloride (n = 8) treatment. Each symbol represents the value for an
individual mouse. Horizontal bars indicate observation means and dashed lines mark
limits of detection. n.s. indicates no significant difference determined by
Mann-Whitney Test (two-tailed).
Nature Chemical Biology: doi:10.1038/nchembio.2003
![Page 13: Supplementary Information - Nature · 2016-02-16 · isoprenoids sample prepared from S. aureus Newman (c), ispA mutant (d), and its complementary strain ispA-C (e), and wild-type](https://reader033.vdocuments.us/reader033/viewer/2022041810/5e5717d0ed237d1721008bee/html5/thumbnails/13.jpg)
13 / 28
Supplementary Figure 7. SDS-PAGE protein gel image. The purified 6His-crtN
protein, and the protein samples of lysates derived from either E. coli/pET28a or E.
coli/pET28a::crtN induced by IPTG were resolved on 8% polyacrylamide Tris-tricine
gel followed by Coomassie blue staining.
Nature Chemical Biology: doi:10.1038/nchembio.2003
![Page 14: Supplementary Information - Nature · 2016-02-16 · isoprenoids sample prepared from S. aureus Newman (c), ispA mutant (d), and its complementary strain ispA-C (e), and wild-type](https://reader033.vdocuments.us/reader033/viewer/2022041810/5e5717d0ed237d1721008bee/html5/thumbnails/14.jpg)
14 / 28
Supplementary Figure 8. CrtN enzyme activity assays. (a) The lysates of E.
coli/pET28a and E. coli/pET28a::crtN were incubated in an CrtN enzyme activity
reaction and extracted with methanol/chloroform. The yellow color in the aqueous
epiphase is FAD. (b) The absorption spectrum of the yellow-colored carotenoid.
Nature Chemical Biology: doi:10.1038/nchembio.2003
![Page 15: Supplementary Information - Nature · 2016-02-16 · isoprenoids sample prepared from S. aureus Newman (c), ispA mutant (d), and its complementary strain ispA-C (e), and wild-type](https://reader033.vdocuments.us/reader033/viewer/2022041810/5e5717d0ed237d1721008bee/html5/thumbnails/15.jpg)
15 / 28
Supplementary Figure 9. Lineweaver–Burk plots of CrtN activities in the
presence of the nafitine hydrochloride. A double reciprocal plot (1/V versus 1/[S])
where V is reaction velocity and [S] is the substrate concentration was plotted. Km is
the Michaelis-Menten constant, Vmax is the maximal velocity, [S] is the substrate
concentration, and V is the rate of reaction. Data shown represent the mean SEM
from triplicate experiments. Enzyme activity was determined as described in the
Methods.
Nature Chemical Biology: doi:10.1038/nchembio.2003
![Page 16: Supplementary Information - Nature · 2016-02-16 · isoprenoids sample prepared from S. aureus Newman (c), ispA mutant (d), and its complementary strain ispA-C (e), and wild-type](https://reader033.vdocuments.us/reader033/viewer/2022041810/5e5717d0ed237d1721008bee/html5/thumbnails/16.jpg)
16 / 28
Supplementary Figure 10. Effect of naftifine hydrochloride on the
ligand-induced destabilization of CrtN protein. SDS-PAGE protein gel image (a)
and thermal shift assay curves (b) illustrated that naftifine hydrochloride (100 μM)
decreases the Tm value of CrtN protein in the cell lysates of E. coli/pET28a::crtN
strain. Experiments were performed on two independent occasions with similar results
and shown is a representative profile.
Nature Chemical Biology: doi:10.1038/nchembio.2003
![Page 17: Supplementary Information - Nature · 2016-02-16 · isoprenoids sample prepared from S. aureus Newman (c), ispA mutant (d), and its complementary strain ispA-C (e), and wild-type](https://reader033.vdocuments.us/reader033/viewer/2022041810/5e5717d0ed237d1721008bee/html5/thumbnails/17.jpg)
17 / 28
Supplementary Figure 11. Western blot images. Uncut Western blot images
illustrated that naftifine hydrochloride (100 μM) decreases the Tm value of CrtN
protein in S. carnosus TM300 cells. Experiments were performed on five independent
occasions, as indicated. The uncut Western blot image in the uppermost portion of this
Figure has been cut for use in the Figure 3c within the main text.
Nature Chemical Biology: doi:10.1038/nchembio.2003
![Page 18: Supplementary Information - Nature · 2016-02-16 · isoprenoids sample prepared from S. aureus Newman (c), ispA mutant (d), and its complementary strain ispA-C (e), and wild-type](https://reader033.vdocuments.us/reader033/viewer/2022041810/5e5717d0ed237d1721008bee/html5/thumbnails/18.jpg)
18 / 28
Supplementary Figure 12. Naftifine inhibits the pigment production of S.
carnosus TM300::pTXcrtMN. Effect of naftifine hydrochloride (100 μM) on the
pigmentation of Staphylococcus carnosus expressing crtMN (TM300::pTXcrtMN, see
Supplementary Table 1). Bacteria were grown at 37 C in TSB medium without
glucose for 24 h and harvested by centrifugation.
Nature Chemical Biology: doi:10.1038/nchembio.2003
![Page 19: Supplementary Information - Nature · 2016-02-16 · isoprenoids sample prepared from S. aureus Newman (c), ispA mutant (d), and its complementary strain ispA-C (e), and wild-type](https://reader033.vdocuments.us/reader033/viewer/2022041810/5e5717d0ed237d1721008bee/html5/thumbnails/19.jpg)
19 / 28
Supplementary Figure 13. Ligand observed 1H NMR experiment implicates the
binding of naftifine hydrochloride to CrtN. T1ρ spectra were acquired by using
naftifine hydrochloride (200 M) alone (colored in maroon), naftifine hydrochloride
(200 M) in the presence of 1 M (colored in blue ), 2 M (colored in purple), and 5
M CrtN protein (colored in green). NMR resonances for protons in the structure of
naftifine hydrochloride were generally assigned (Supplementary Figure 14).
Nature Chemical Biology: doi:10.1038/nchembio.2003
![Page 20: Supplementary Information - Nature · 2016-02-16 · isoprenoids sample prepared from S. aureus Newman (c), ispA mutant (d), and its complementary strain ispA-C (e), and wild-type](https://reader033.vdocuments.us/reader033/viewer/2022041810/5e5717d0ed237d1721008bee/html5/thumbnails/20.jpg)
20 / 28
Supplementary Figure 14. Nuclear magnetic resonance spectroscopic data.
Nuclear magnetic resonance (NMR) spectroscopic data of nafitine hydrochloride in
D2O solution (a) or MeOD solution (b). NMR spectroscopy was performed on a
Bruker AMX-400 NMR with tetramethylsilane (TMS) as an internal standard.
Chemical shifts were reported in parts per million (ppm, δ) downfield from
tetramethylsilane. Proton coupling patterns, as well as the proton chemical shifts,
were in agreement with the structure of naftifine hydrochloride. *: solvent residual
peak of MeOD. **: solvent residual peak of D2O. Spectroscopic data was given as
Nature Chemical Biology: doi:10.1038/nchembio.2003
![Page 21: Supplementary Information - Nature · 2016-02-16 · isoprenoids sample prepared from S. aureus Newman (c), ispA mutant (d), and its complementary strain ispA-C (e), and wild-type](https://reader033.vdocuments.us/reader033/viewer/2022041810/5e5717d0ed237d1721008bee/html5/thumbnails/21.jpg)
21 / 28
below, and proton coupling patterns were described as singlet (s), doublet (d), triplet
(t), double triplets (dt), quartet (q), double quartets (dq), multiplet (m).
1H NMR (400 MHz, MeOD) δ 8.22 (d, J = 8.5 Hz, 1H), 8.09 (d, J = 8.2 Hz, 1H), 8.04
(d, J = 8.1 Hz, 1H), 7.80 (d, J = 7.0 Hz, 1H), 7.71 (t, J = 7.6 Hz, 1H), 7.68 – 7.59 (m,
2H), 7.55 (d, J = 7.6 Hz, 2H), 7.39 (dq, J = 13.6, 6.8 Hz, 3H), 6.99 (d, J = 15.8 Hz,
1H), 6.51 – 6.33 (m, 1H), 5.07 (s, 1H), 4.78 (s, 1H), 4.13 (d, J = 14.8 Hz, 2H), 2.88 (s,
3H).
1H NMR (400 MHz, D2O) δ 7.96 – 7.83 (m, 3H), 7.55 (t, J = 7.2 Hz, 1H), 7.54 – 7.43
(m, 3H), 7.40 (d, J = 7.4 Hz, 2H), 7.37 – 7.24 (m, 3H), 6.76 (d, J = 15.9 Hz, 1H), 6.20
(dt, J = 15.4, 7.5 Hz, 1H), 4.82 (d, J = 13.1 Hz, 1H), 4.46 (d, J = 13.4 Hz, 1H), 3.89 (t,
J = 7.3 Hz, 2H), 2.73 (s, 3H).
Nature Chemical Biology: doi:10.1038/nchembio.2003
![Page 22: Supplementary Information - Nature · 2016-02-16 · isoprenoids sample prepared from S. aureus Newman (c), ispA mutant (d), and its complementary strain ispA-C (e), and wild-type](https://reader033.vdocuments.us/reader033/viewer/2022041810/5e5717d0ed237d1721008bee/html5/thumbnails/22.jpg)
22 / 28
Nature Chemical Biology: doi:10.1038/nchembio.2003
![Page 23: Supplementary Information - Nature · 2016-02-16 · isoprenoids sample prepared from S. aureus Newman (c), ispA mutant (d), and its complementary strain ispA-C (e), and wild-type](https://reader033.vdocuments.us/reader033/viewer/2022041810/5e5717d0ed237d1721008bee/html5/thumbnails/23.jpg)
23 / 28
Supplementary Figure 15. The substrate and the amino acid sequence of either
squalene epoxidase (SE) or CrtN. (a) SE is an epoxidase13
while CrtN is capable of
desaturating squalene into dehydrosqualene14
and catalyzes the formation of the first
deep yellow-colored carotenoid intermediate product (4,4′-diaponeurosporene) which
is formed via successive three dehydrogenation reactions4,15,16
. (b) Sequence
alignment of S. aureus Newman CrtN, Saccharomyces cerevisiae S288c squalene
epoxidase (YGR175C), and Candida albicans SC5314 squalene epoxidase
(CaO19.406) using the ClustalW program. Stars indicate identical amino acids,
double dots (:) indicate conserved amino acids, and single dots (.) indicate that
residues are more or less similar.
Nature Chemical Biology: doi:10.1038/nchembio.2003
![Page 24: Supplementary Information - Nature · 2016-02-16 · isoprenoids sample prepared from S. aureus Newman (c), ispA mutant (d), and its complementary strain ispA-C (e), and wild-type](https://reader033.vdocuments.us/reader033/viewer/2022041810/5e5717d0ed237d1721008bee/html5/thumbnails/24.jpg)
24 / 28
Supplementary Figure 16. Structure-activity relationship analysis of naftifine
analogs. Shown are analogue structures of naftifine and their pigment inhibition or
CrtN inhibition profiles. Four distinctive moieties were included in the chemical
structure of naftifine: naphthyl (yellow color), N-methyl substituent (blue color), allyl
(black color), and phenyl (red color). IC50 values represent the average of three
independent experiments. Naftifine (compound 1), terbinafine (compound 2),
butenafine (compound 3), JX04 (compound 4), and JX07–JX09 (compound 7–9) were
used in the forms of hydrochloride salt. JX05 (compound 5), JX06 (compound 6),
JX10 (compound 10), and JX11 (compound 11) were used in the forms of
1,5-naphthalene sulfonate. Compound 12 (JX07-a) was the key intermediate for the
synthesis of JX07-JX11 (Supplementary Note).
Nature Chemical Biology: doi:10.1038/nchembio.2003
![Page 25: Supplementary Information - Nature · 2016-02-16 · isoprenoids sample prepared from S. aureus Newman (c), ispA mutant (d), and its complementary strain ispA-C (e), and wild-type](https://reader033.vdocuments.us/reader033/viewer/2022041810/5e5717d0ed237d1721008bee/html5/thumbnails/25.jpg)
25 / 28
Supplementary Figure 17. Images illustrate that crtN is essential for the pigment
production of S. aureus Newman, USA300 LAC, and USA400 MW2 strains. S.
aureus bacteria were grown in TSB medium at 37 C with shaking, 250 rpm of
aeration for 24 h, and then harvested by centrifugation.
Nature Chemical Biology: doi:10.1038/nchembio.2003
![Page 26: Supplementary Information - Nature · 2016-02-16 · isoprenoids sample prepared from S. aureus Newman (c), ispA mutant (d), and its complementary strain ispA-C (e), and wild-type](https://reader033.vdocuments.us/reader033/viewer/2022041810/5e5717d0ed237d1721008bee/html5/thumbnails/26.jpg)
26 / 28
Supplementary Figure 18. Naftifine blocks the virulence of MRSA strains. (a)
Effect of naftifine in protecting mice (n = 15) from lethal S. aureus infection
challenged with 2.5 108 CFU MW2 bacteria. The statistical significance was
examined with the log-rank test (mock vs. naftifine, ***p< 0.001). (b) Effect of
naftifine on S. aureus survival in the kidneys, hearts, and livers of mouse (n = 13)
challenged with 1.2 108 CFU Mu50 bacteria. The statistical significance was
determined by Mann-Whitney Test (two-tailed): **p<0.01; n.s. indicates no
significant difference; each symbol represents the value for an individual mouse;
horizontal bars indicate observation means and dashed lines mark limits of detection.
Nature Chemical Biology: doi:10.1038/nchembio.2003
![Page 27: Supplementary Information - Nature · 2016-02-16 · isoprenoids sample prepared from S. aureus Newman (c), ispA mutant (d), and its complementary strain ispA-C (e), and wild-type](https://reader033.vdocuments.us/reader033/viewer/2022041810/5e5717d0ed237d1721008bee/html5/thumbnails/27.jpg)
27 / 28
SUPPLEMENTARY DATA SET
Supplementary Data Set 1 lists marked drugs used for the screening in this study.
References
1. Ji, Y., Marra, A., Rosenberg, M. & Woodnutt, G. Regulated antisense RNA eliminates
alpha-toxin virulence in Staphylococcus aureus infection. Journal of bacteriology 181,
6585-6590 (1999).
2. Sun, F., et al. In the Staphylococcus aureus two-component system sae, the response
regulator SaeR binds to a direct repeat sequence and DNA binding requires phosphorylation
by the sensor kinase SaeS. Journal of bacteriology 192, 2111-2127 (2010).
3. Ding, Y., et al. Metabolic sensor governing bacterial virulence in Staphylococcus aureus.
Proceedings of the National Academy of Sciences of the United States of America 111,
E4981-4990 (2014).
4. Pelz, A., et al. Structure and biosynthesis of staphyloxanthin from Staphylococcus aureus. The
Journal of biological chemistry 280, 32493-32498 (2005).
5. Wieland, K.P., Wieland, B. & Gotz, F. A promoter-screening plasmid and xylose-inducible,
glucose-repressible expression vectors for Staphylococcus carnosus. Gene 158, 91-96 (1995).
6. Duthie, E.S. & Lorenz, L.L. Staphylococcal coagulase; mode of action and antigenicity. Journal
of general microbiology 6, 95-107 (1952).
7. Kreiswirth, B.N., et al. The toxic shock syndrome exotoxin structural gene is not detectably
transmitted by a prophage. Nature 305, 709-712 (1983).
8. Bubeck Wardenburg, J. & Schneewind, O. Vaccine protection against Staphylococcus aureus
pneumonia. The Journal of experimental medicine 205, 287-294 (2008).
9. Kuroda, M., et al. Whole genome sequencing of meticillin-resistant Staphylococcus aureus.
Lancet 357, 1225-1240 (2001).
10. Bae, T., et al. Staphylococcus aureus virulence genes identified by bursa aurealis mutagenesis
and nematode killing. Proceedings of the National Academy of Sciences of the United States
of America 101, 12312-12317 (2004).
11. Lan, L., Cheng, A., Dunman, P.M., Missiakas, D. & He, C. Golden pigment production and
virulence gene expression are affected by metabolisms in Staphylococcus aureus. Journal of
bacteriology 192, 3068-3077 (2010).
12. Liu, C.I., et al. A cholesterol biosynthesis inhibitor blocks Staphylococcus aureus virulence.
Science 319, 1391-1394 (2008).
13. Belter, A., et al. Squalene monooxygenase - a target for hypercholesterolemic therapy.
Biological chemistry 392, 1053-1075 (2011).
14. Furubayashi, M., Li, L., Katabami, A., Saito, K. & Umeno, D. Construction of carotenoid
biosynthetic pathways using squalene synthase. FEBS letters 588, 436-442 (2014).
15. Kim, S.H. & Lee, P.C. Functional expression and extension of staphylococcal staphyloxanthin
biosynthetic pathway in Escherichia coli. The Journal of biological chemistry 287,
21575-21583 (2012).
Nature Chemical Biology: doi:10.1038/nchembio.2003
![Page 28: Supplementary Information - Nature · 2016-02-16 · isoprenoids sample prepared from S. aureus Newman (c), ispA mutant (d), and its complementary strain ispA-C (e), and wild-type](https://reader033.vdocuments.us/reader033/viewer/2022041810/5e5717d0ed237d1721008bee/html5/thumbnails/28.jpg)
28 / 28
16. Raisig, A. & Sandmann, G. 4,4'-diapophytoene desaturase: catalytic properties of an enzyme
from the C(30) carotenoid pathway of Staphylococcus aureus. Journal of bacteriology 181,
6184-6187 (1999).
Nature Chemical Biology: doi:10.1038/nchembio.2003