Horst/Gu et al., 2010
1
SUPPLEMENTAL MATERIALS
Supplemental Figure 1. Immunostaining specificity for Spdef and lack of expression in Spdef‐/‐
mice. (A) Spdef is not expressed in the gastric forestomach, as shown by absence of nuclear
immunostaining. (B) Quantitative real‐time RT‐PCR with primers spanning Spdef exons 2 and 3
confirms absence of the deleted exons in Spdef‐/‐ (KO) animals. (C‐E) Spdef protein is absent in
Spdef‐/‐ mice, as shown by lack of nuclear immunostaining in mutant (KO) samples compared to
the wild‐type (WT) gastric corpus (C), antrum (D), and Brunner’s glands (E). Scale bars, 50 µm
(A‐D), 100 µm (E).
Horst/Gu et al., 2010
2
Supplemental Figure 2. Antral hyperplasia in Spdef‐/‐ mice. The spectrum of hyperplastic
changes in Spdef‐/‐ antra includes focal cyst formation (A, arrow) and tubular to cribriform
growth patterns (B), with broad extension of the epithelial proliferative zone, as indicated by
Ki67 immunostaining (C). Inset in C shows a higher magnification of the boxed area.
Immunostaining for the intestinal marker Cdx2 (D), the chief cell product gastric intrinsic factor
(E), and the parietal cell marker Atp4b (F) demonstrate absence of heterotopia or metaplasia in
the mutant hyperplastic antrum. Insets show positive staining controls. Scale bars, 250 µm.
Horst/Gu et al., 2010
3
Supplemental Figure 3. Phenotypic changes in Spdef‐/‐ gastric corpus and Helicobacter testing.
(A) Histologically intact corpus mucosa in Spdef‐/‐ mice when hyperplastic changes of the gastric
antrum are absent. (B) Inflammatory infiltrates appeared beneath the mucosa of the corpus‐
antrum junction (arrows) coincident with antral hyplerplasia. (C) Warthin‐Starry staining
displays absence of Helicobacter in inflammation and hyperplasia affected antrum mucosa of
Horst/Gu et al., 2010
4
Spdef‐/‐ (KO) mice (mid panel shows magnification of boxed area); right panel shows a positive
staining control (Ctrl) of Helicobacter (arrows) infected antrum mucosa. (D) PCR testing for
Helicobacter species (HP spp) was negative in wild‐type (WT) as well as in Spdef‐/‐ stomachs
with inflammation (KOinf) and hyperplasia (KOhyp). Helicobacter infected antrum mucosa (Ctrl)
and Helicobacter pylori DNA extracts (H) were used as positive controls. Suitable quality of
template DNA for PCR was confirmed by amplification of genomic Cdx1. Size marker (M). Scale
bars, 100 µm (A, B), 50 µm (C).
Horst/Gu et al., 2010
5
Supplemental Figure 4. Specificity of Spdef effects on antral cell lineages. Before onset of
inflammation or hyplerplasia, Spdef‐/‐ (KO) and wild‐type (WT) mice showed no differences in
(A) proliferation, as quantified from Ki67 immunostaining; (B) maturation of Muc5ac‐expressing
foveolar pit cells; or (C) distribution and localization of gastrin‐expressing antral G cells. Scale
bars, 100 µm.
Horst/Gu et al., 2010
6
Supplemental Figure 5. Gene expression analysis in
stomach and intestine. Heat map showing the
overlapping down‐ and up‐regulated Spdef‐regulated
transcripts in the gastric antrum and colon of Spdef‐/‐
(KO) mice compared to WT and Spdef+/‐ (HET) mice.
Columns represent samples and rows represent genes.
Gene expression is shown with a pseudocolor scale (‐2
to 2), with red denoting high and green denoting low
relative expression levels.
Horst/Gu et al., 2010
7
Suppl. Table 1. PCR primers used in this study
Primers were selected from the Universal Probe Library (Roche) or designed using Primer3
software S1.
Gene Expression (real‐time RT‐PCR)
Gene Forward Primer Reverse Primer
Spdef (exon 2/3) ttggatgagcactcgctaga agccggtactggtgttctgt
Spdef (5’ UTR) gtggccctgagcttctgac ggtcactgctgggtctcagt
Spdef (3’UTR) ggtatcccagaacccaaggt actgtccggtgagctgactt
Gapdh accacagtccatgccatcac tccaccaccctgttgctgta
Muc6 ctcctcaccttctaccccagt tctggtgctcttcctcctgt
Tff2 ccagtgagcagtgctttgat tgacacactgctccgattct
Pthrp caagtccatccaagacttgc cgtgtccttggaagatcttc
Dmbt1 caagtccatccaagacttgc agaccgcccacctgcc
Thrsp catgctcaagagcatctgtgtagaagtg agggctttggattccgtgtttgcttttag
Cfd atgacgactctgtgcaggtg ctcgtattgcaagggtaggg
Adipoq aaggacaaggcccttctct cgcacgatttccctctcagctg
Mlph cggcctcagaagtccagcaggca agctttgcagacgaagaggg
Creb3l4 gtggactgccctccgattcg cgtgtccttggaagatcttc
Mouse genotyping (genomic PCR)
Common reverse primer: ctgtgtcagagtttgcagttttag
Forward primer for the wild type allele (300‐bp product): gaactgacgttgattcctggagg
Forward primer for the targeted mutant allele (720‐bp product): gacatagcgttggctacccgtg
Helicobacter testing (genomic PCR)
Gene Forward Primer Reverse Primer
HP spp tatgacgggtatccggc attccacctacctctccca
Cdx1 gtttactttgcgctccttgg ggggaggaaagaggtttcag
Horst/Gu et al., 2010
8
Suppl. Table 2. Antibodies (Ab) used for immunohistochemistry
Antigen (Ab species) Ab source Dilution
Spdef (guinea pig) Dr. J. Whitsett, Cincinnati Children's Hospital 1:5000
H/K‐ATPase (mouse) MBL International, Woburn, MA 1:1000
Muc5ac (mouse) Vision Biosystems, Norwell, MA (NCL‐HGM‐45M1) 1:200
Cdx2 (mouse) Bio Genex, San Ramon, CA (clone CDX2‐88) 1:50
α‐smooth muscle actin (mouse) Bio Genex, San Ramon, CA (clone 1A4) 1:1000
Tff2 (mouse) Prof. Sir N. Wright, London School of Medicine, UK 1:100
Ki67 (mouse) Vector Laboratories (clone MM1) 1:500
B220 (mouse) B‐D Pharmingen, San Jose, CA (clone RA3‐6B2) 1:200
Intrinsic factor (rabbit) Dr. D. Alpers, Washington University, St. Louis 1:10,000
CD3 (rabbit) Cell Marquee, Rocklin, CA (CMC363) 1:1000
Gastrin (rabbit) Vision Biosystems, Norwell, MA (NCL‐GASp) 1:1000
Metalloperoxidase (rabbit) Dako, Carpinteria, CA (A0398) 1:2000
Horst/Gu et al., 2010
9
Suppl. Table 3. Yield of mice by genotype from Spdef heterozygote crosses
Spdef+/+ (%) Spdef+/‐ (%) Spdef‐/‐ (%)
Male 28 (17) 36 (22) 12 (7)
Female 30 (19) 38 (24) 18 (11)
Total 58 (36) 74 (46) 30 (18)
Expected (Mendelian) ratios 40.5 (25) 81 (50) 40.5 (25)
Horst/Gu et al., 2010
10
Suppl. Table 4. Overlap of dysregulated genes in Spdef‐/‐ small intestine and antrum with the
25‐gene list reported as downregulated in the small intestine of an independent knockout
mouse strain 19.
Small intestine
Probe Gene symbol WT1 WT2 WT3 KO1 KO2 KO3
Fold change in KO
1417735_at 1810030J14Rik 2324.57 2501.44 2073.25 484.19 540.17 1071.21 ‐3.29
1417266_at Ccl6 2755.19 2239.85 2358.54 909.64 432.91 335.74 ‐4.38
1420249_s_at Ccl6 975.4 847.24 826.51 220.38 154.02 92.12 ‐5.68
1417936_at Ccl9 264.37 165.44 201.33 42.26 53.54 36.95 ‐4.75
1448898_at Ccl9 135.03 82.31 101.13 23.74 17.44 22.46 ‐5
1424218_a_at Creb3l4 43.1 44 36.72 16.96 18.85 20.26 ‐2.21
1416913_at Es1 122.59 129.3 146.78 54.46 59.55 55.03 ‐2.36
1431900_a_at Foxa3 65.04 93.33 91.71 33.4 47.18 39.36 ‐2.08
1418405_at Hgfac 106.78 132.24 115.66 62.64 67.2 57.28 ‐1.9
1449478_at Mmp7 780.97 558.11 747.23 495.2 296.63 197.48 ‐2.11
1428443_a_at Rap1gap 62.94 64.06 75.44 40.01 40.15 40.59 ‐1.68
1427119_at Spink4 4323.71 3930.33 4613.75 2702.01 2715.63 2050.3 ‐1.72
1449564_at Tpsg1 82.05 102.21 63.08 32.43 29.68 36.59 ‐2.51
Antrum
Probe Gene symbol WT1 WT2 KO1 KO2 HET1 HET2
Fold change in KO
1417266_at Ccl6 72.19 95.46 40.69 56.46 56.01 83.76 ‐1.73
1448898_at Ccl9 37.08 39.93 29.9 25.19 27 49.79 ‐1.4
1424218_a_at Creb3l4 121.24 137.28 13.24 18.42 130.41 125.86 ‐8.16
1416913_at Es1 78.85 21.04 15.49 13.41 31.02 15.49 ‐3.46
1418405_at Hgfac 76.9 81.28 43.11 44.18 66.35 85.69 ‐1.81
1428443_a_at Rap1gap 467.36 513.22 372.82 377 429.07 455.37 ‐1.31
Horst/Gu et al., 2010
11
Suppl. References S1. Rozen S, Skaletsky H. Primer3 on the WWW for general users and for biologist programmers. In: Krawetz S, Misener S (eds) Bioinformatics Methods and Protocols: Methods in Molecular Biology. Humana Press 2000; Totowa, NJ, pp 365‐386