1

ACTIVATION OF THE RNA-DEPENDENT PROTEIN KINASE PKR PROMOTER IN THE

ABSENCE OF INTERFERON IS DEPENDENT UPON SP PROTEINS

Sonali Das1, Simone V. Ward1,¶, Robert S. Tacke1, Guntrum Suske2,and Charles E Samuel1,§

From the Department of Molecular, Cellular and Developmental Biology,University of California, Santa Barbara, CA 931061, and the Institute of Molecular Biology andTumor Research, Philipps-University, Emil-Mannkopff-Strasse 2, D-35033 Marburg, Germany2

Running title: Regulation of the PKR promoter.§Corresponding Author: C.E. Samuel Tel. 805-893-3097 E-mail: samuel@lifesci.ucsb.edu.

The protein kinase regulated by RNA

(PKR) is interferon (IFN) inducible and playsimportant roles in many cellular processesincluding virus multiplication, cell growth andapoptosis. The TATA-less PKR promoterpossesses a novel 15-bp DNA element (KCS)unique to the human and mouse PKR genes thatis conserved in sequence and position. Wefound that two Sp-family of transcriptionfactors, Sp1 and Sp3, bind at the KCS element.Their involvement was analyzed in theactivation of basal and IFN inducible P K Rpromoter activity. Both the small and largeisoforms of Sp3 co-purified with KCS proteinbinding activity (KBP) using nuclear extractsfrom HeLa cells not treated with IFN. Twoforms of KBP complex were demonstrated byEMSA analysis; one contained Sp1 and theother Sp3. In mouse cells null for all Sp3isoforms, PKR expression was reduced to ~50%that of wild-type cells in the absence of IFN.The IFN inducible expression of PKR, however,was Sp3-independent, but STAT1- and JAK1-dependent. Over-expression of Sp1 in human Ucells resulted in increased PKR promoteractivity. In Drosophila SL2 cells lacking Spproteins, both Sp1 and Sp3 large but not smallisoforms activated PKR promoter expression,with the Sp1-mediated activation dominant.Mutational analysis of the P K R promoterregion indicated a cooperative interactionbetween two different Sp sites, one of which is

within the KCS element. These resultsestablish that, in the absence of IFN treatment,activation of PKR basal expression is mediatedby Sp1 and Sp3 proteins in a cooperativemanner.

Among the interferon (IFN) inducibleproteins that play an important role in the innatedefense against viral infection and pathogenesis isPKR, the protein kinase regulated by RNA (1).PKR catalyzes the phosphorylation of the alphasubunit of eukaryotic protein synthesis initiationfactor eIF-2 on serine residue 51 (2,3). Thismodification alters the translation pattern withincells and leads to an inhibition of protein synthesisin virus-infected, IFN-treated cells (3,4). PKRalso plays a role in signaling pathways (5-7). Arange of biological processes is affected by thePKR protein, including cell growth, differentiationand apoptosis, in addition to virus multiplication.Because of these broad and basic functionsaffected by PKR, an understanding of themolecular mechanisms that control the amount andactivity of the PKR protein, including thetranscriptional activation of the PKR gene, is offundamental importance.

Unlike many genes that are IFN-inducible,a significant basal expression level of PKR is seenin many cell lines and most animal tissues (8-10).The human P K R gene, located on humanchromosome 2p, spans ~50 kb and possesses 17exons (10,11). Study of deletion reporter

http://www.jbc.org/cgi/doi/10.1074/jbc.M510612200The latest version is at JBC Papers in Press. Published on December 8, 2005 as Manuscript M510612200

Copyright 2005 by The American Society for Biochemistry and Molecular Biology, Inc.

by guest on March 26, 2020

http://ww

w.jbc.org/

Dow

nloaded from

2

constructs derived from 5’-flanking region of PKRgene identified a 503-bp DNA sequence thatpossesses the DNA elements necessary andsufficient for both basal and IFN-inducibletranscription in transfected cells. These elementsinclude a consensus 13-bp ISRE (InterferonStimulated Response Element) responsible for IFNinducible transcription (10,12), and a novel 15-bpelement designated KCS (Kinase ConservedSequence) that is exactly conserved between themouse and human P K R promoters in bothsequence and position relative to the ISRE (10,13).The KCS element is required for optimal basal aswell as IFN-inducible PKR expression (10). The503-bp PKR promoter region lacks consensussequences often associated with initiation oftranscription such as the TATA box (10,14) andCTCANTCT initiator positioning sequences(10,15).

Activation of transcription of genesinducible by type I IFNs such as PKR is bestunderstood in the context of the heteromerictranscription factor ISGF3 (STAT1, STAT2,IRF9) that binds to the ISRE DNA element(1,10,12,16). But in the case of the PKR gene, the15-bp KCS element is necessary for both basal andIFN-inducible transcriptional activity (10,16,17).The KCS DNA element selectively binds proteinsthat are constitutively present in cells in theabsence of IFN treatment, and in a manner whichcorrelates with transcriptional activity intransfection reporter assays (16-18). Purificationstudies, KCS DNA element pull-down assays andEMSA antibody supershift analyses haveidentified Sp1, DDB1 and DDB2 as trans-actingprotein factors that bind the KCS element (18-20).Chromatin immunoprecipitation assays haveimportantly established in vivo binding of Sp1,Sp3, DDB2, STAT1 and STAT2 to the P K Rpromoter region (19,20). The 5’-flanking region of human PKRpromoter includes five Sp-binding sites (fouroverlapping) upstream of the KCS and ISREelements (10). In addition, the 5’-portion of the15-bp KCS DNA element corresponds to an Sp1-binding site (18,19). The specificity protein (Sp)family of transcription factors that recognize theGC-rich Sp binding-sites present in the promoter5’-flanking region includes nine known membersthat share the zinc finger structural motif found inthe C-terminal DNA binding region (21-24).

Among the Sp factors, Sp1 and Sp3 are expressedubiquitously and bind common DNA targetsequences. The activating or repressing activity ofSp-factors appears dependent upon multiplemicroenvironment parameters including therelative abundance of the factors, the type of post-translational modification if any, the nature of thecell, and the specific promoter involved (21-23).For example, a higher level of Sp1 compared toSp3 is thought to be important in the activation ofthe promoter for the vascular endothelial growthfactor receptor gene (25), both Sp1 and Sp3activate transcription of the human dopaminetransporter gene (26), and the uteroglobin genepromoter is upregulated by Sp1 but repressed bySp3 (27). Sp1 and Sp3 are also reported to actsynergistically to enhance transcription in the caseof c-met gene (28). However, little is knownabout the role of Sp factors in the constitutiveexpression of genes such as PKR that are alsoinducible by IFN.

Here we establish that activation of theprotein kinase PKR promoter in the absence ofinterferon is mediated by Sp factor proteins thatare constituent components of the heteromerictranscriptional activator (KBP) complex that bindsat the KCS DNA element. Protein purification,immunochemical and mutational analysesestablished that both the large (li) and small (si)isoforms of Sp3 are KBP complex components.Sp3li and the previously identified Sp1 proteinboth activate the PKR promoter in mammalian andinsect cells. In Drosophila cells devoid of Spfactors, the PKR promoter is silent but is activatedby both Sp1 and Sp3li, whereas Sp3si neitheractivates nor antagonizes Sp1-mediatedtransactivation of the PKR promoter. Theseresults provide new mechanistic insight into theactivation of the PKR gene, and unequivocallydemonstrate that members of the Sp protein familyof transcription factors are fundamentallyimportant determinants of basal promoter activityof the PKR gene in the absence of IFN treatment.

EXPERIMENTAL PROCEDURES

Cell maintenance and interferon treatment.Human amnion U cells and mouse embryofibroblast (MEF) cells were maintained inDulbecco’s modified Eagle’s medium (DMEM)with 5% or 10% (v/v) fetal bovine serum

by guest on March 26, 2020

http://ww

w.jbc.org/

Dow

nloaded from

3

(Hyclone), respectively, and 1% sodium pyruvate(Cambrex Bio Science), 100µg/ml of penicillinand 100 units/ml streptomycin (GIBCO) aspreviously described (16,18,19,29). Wild-type(WT), Stat1-/- (30), Jak1-/- (31), and Pkr-/- (8) MEFcells were generously provided by Dr. RobertSchreiber (Washington University, St. Louis) andA. Koromilas (Lady Davis Institute, Montreal).Sp3 (WT) and Sp3-/- MEFs were as described (32).Interferon treatment was with 1000 units/ml ofalpha IFN for 24 h, using either recombinant IFN-αA/D (33) or natural leukocyte IFN. DrosophilaSchneider line SL-2 cells (D r o s o p h i l amelanogaster embryo, SL-2) were kindly providedby Dr. Stephen Poole of this institution, and weregrown in Schneider’s Drosophi la medium(Invitrogen) at ambient room temperature (22oC to25oC).Plasmid constructions. The pCAT-Basicpromoter-less plasmid (Promega) containing thechloramphenicol acetyltransferase (CAT) genewas used for construction of reporter plasmidscontaining wild-type (WT) and mutated KCS andISRE elements as well as constructs with 5’-deletion in the minimal promoter region. Theconstruction of human PKR promoter plasmidsp 5 0 3 ( W T ) , p 6 3 ( W T ) , p 1 3 0 ( W T ) ,p 5 0 3 ( K C S m t 6 A ) , p 5 0 3 ( K C S m t 9 T ) ,p503(ISREmt8T) were as previously described(18). The construct p503(KCSdelISRE mt8T)double mutant construction was generated byinsertion of a 130 bp BamHI/XbaI fragmentderived from p503 (ISREmt8T) into pBluescript(Stratagene) with the PstI site in the MCS deleted(pBluescriptΔPstI). The KCS element was deletedusing PstI and StyI, followed by filling in with T4DNA polymerase (NEB) and plasmid closure withT4 DNA ligase. The resulting BamHI/X b aIfragment containing KCSdelISREmt8T wasexchanged for the corresponding BamHI/XbaI ofp503 (ISREmt8T). pGL2-basic promoter-lessplasmid (Promega) containing the fireflyluciferase (LUC) gene as the reporter was used forconstruction of the p503(WT)LUC promoterplasmid which was generously provided by Dr.Ping Zhang of this laboratory. pRSV-βgal wasgenerously provided by Dr. Joe Nevins (DukeUniversity, Durham).

The mammalian expression plasmidspCMVSp1 and pCMVSp3 (34) were generously

provided by Dr. Jonathan Horowitz (NorthCarolina State, Raleigh). The pCMV vectorwithout insert was generated by deleting the Sp1insert from the pCMVSp1 construct. TheDrosophila actin promoter driven expressionplasmids pPacSp1 and pPacSp3 for WT Sp1 andSp3, respectively, were gifts from Dr. Robert Tjian(University of California, Berkeley) and Dr. GraceGill (Harvard Medical School, Boston). The pPacvector without insert was generated by deleting theSp3 insert from the pPacSp3 construct.pPacSp3(Δ1.+2.AUG) was as recently described(35).Transient transfection assays. Human U cellswere transfected with the PKR promoter plasmidcontructs with either the CAT or LUC reporter bythe DEAE-dextran-chloroquine phosphatetransfection method (36) as described previously(10,16,37), using either pRSVβgal or pGL2 as theinternal reference. All DNA plasmids used intransfections were purified either by cesiumchloride equilibrium centrifugation or by using aQIAfilter plasmid maxi kit (Qiagen); plasmidintegrity was analyzed by agarose gelelectrophoresis. Varying amounts of pCMVSp1and pCMVSp3 expression plasmids together withadded empty pCMV-4 vector to give a total of 5µg pCMV DNA were used for cotransfections.IFN treatment was initiated 24 h after transfection.Cells were harvested 48 h post-transfection,extracts prepared, and luciferase, CAT and β-galactosidase activities determined as previouslydescribed (10,16,37,38). Luciferase assays werequantified using an OPTOCOMP I luminomter,and CAT assays were quantified after thin-layerchromatography by use of a BioRAD GS525molecular imager system. Protein concentrationsof extracts were determined by the modifiedBradford method (BioRAD). The data presentedare the average values derived from three to fiveindependent experiments.

Drosophila SL-2 cells were transfectedusing Cellfectamine (Invitrogen) according to themanufacturer’s recommendations. Sf-900 II SMFmedium (Invitrogen) was used to dilute the DNAas well as Cellfection reagent. Briefly, SL-2 cellswere plated in 60 mm dishes at ~4 x 106 cells/dishone day prior to transfection. Cells were thentransfected with 3 µg of CAT reporter plasmid andthe indicated amounts of pPacSp1 or pPacSp3

by guest on March 26, 2020

http://ww

w.jbc.org/

Dow

nloaded from

4

expression constructs and pPac empty vector asnecessary to maintain constant DNA amounts.Fresh media was added to the cells 24 h post-transfection, cells were harvested 48 h post-transfection, and extracts prepared by repeatedfreeze-thaw cycles followed by determination ofCAT activity as previously described (10,37).Nuclear extract preparation. Nuclear extractswere prepared as previously described (19,39)Briefly, cells were scraped into ice-cold PBS,collected by centrifugation and cell pellets weresuspended in 3 volumes of lysis buffer [20 mMHepes, pH 7.9; 10 mM KCl; 1 mM EDTA, pH 8.0;0.2% NP-40 (vol/vol); 0.1 mM Na3VO4; 1 mMPMSF; 1 mM DTT; 10% glycerol (vol/vol) and1% protease inhibitor cocktail (vol/vol; Sigma)],followed by incubation on ice for 10 min. Cellsuspensions were gently pipetted up and down andthen the lysates were centrifuged at 14,000 x g for5 min at 4oC to obtain nuclear pellets. Nuclearpellets were washed two times with cell lysisbuffer [lacking NP-40 and protease inhibitorcocktail], followed by resuspension in 2 volumesof nuclear extract buffer [20 mM Hepes, pH 7.9;10 mM KCl; 1 mM EDTA, pH 8.0; 1 mM PMSF;1 mM DTT; 1 mM Na3VO4; 420 mM NaCl; 20%glycerol (vol/vol) and 10% protease inhibitorcocktail (vol/vol; Sigma)]. Nuclei were extractedby incubation at 4oC for 30 min with gentleagitation followed by centrifugation at 14,000 x gat 4oC for 5 min; the resultant supernatant fractionwas used as nuclear extracts.Whole cell extract preparation. Whole cellextracts were prepared as previously described(19). Cells were washed, scraped and pelleted asdescribed above. Cell pellets were suspended in2-3 volumes of whole cell extract buffer [20 mMHepes, pH 7.9; 10 mM KCl; 1 mM EDTA, pH 8.0;1 mM PMSF; 1 mM DTT; 1 mM Na3VO4; 5 mMNaF; 400 mM NaCl; 0.5% NP-40; 20% glycerol(vol/vol) and 1% protease inhibitor cocktail(vol/vol; Sigma)], incubated on ice for 10 min andgently pipetted up and down. Cell suspensionswere transferred to 4oC for 30 min with gentleagitation, followed by centrifugation at 14,000 x gat 4oC for 5 min to obtain whole cell extracts.Electrophoretic mobility shift assay. Thesequence of the double-stranded PKR promoter

KCS oligonucleotide 32P-end-labeled probe was5’CTGCAGGGAAGGCGGAGTCCAAGG 3’ (+-

strand). For protein-DNA binding reactions, 10µg of nuclear extract protein was incubated with32P-labeled probe for 25 min at room temperaturein a 25 µl reaction containing 1 µg poly dI:dC; 20mM Hepes, pH 7.9; 1 mM MgCl2; 40 mM KCl;0.1 mM EGTA, pH 8.0; 1 mM DTT and 10%glycerol (vol/vol). Electrophoresis using 5% nativepolyacrylamide gels with 0.5X Tris-borate-EDTAbuffer was as previously described (16,19,20). Forsupershift analyses, rabbit polyclonal antiseraagainst Sp1 (07-645) and Sp3 (07-107 ) werepurchased from Upstate Biotechnology.Incubation with antibodies was carried out on ice

for 45 min prior to addition of 32P-labeled probe.

Western immunoblot assays. Proteins werefractionated on 10% SDS-PAGE gels, transferredto nitrocellulose membranes, and then probed withan appropriate dilution of primary antibody inphosphate-buffered saline containing 3% skimmilk. Western blot detection was done withhorseradish peroxidase conjugated anti-rabbit IgGor anti-mouse IgG secondary antibody using anECL detection reagent kit (Amersham) orSuperSignal West Pico Chemiluminescentsubstrate (Pierce), according to manufacturer’sprotocol. Immunoreactive bands were visualizedusing a VersaDoc (Bio-RAD) imaging system andquantitation was done using the Quantity Onesoftware program. Rabbit polyclonal antibodieswere used to detect Sp1 protein (UpstateBiotechnology 07-645), mouse Sp3 protein (SantaCruz Biotechnology sc-644), and human Sp3protein (Upstate Biotechnology 07-107).Monoclonal antibody anti-HA from Roche (clone12CA5) was used to detect HA-tagged Sp1 andSp3 proteins in extracts of transfected U-cells, andrabbit polyclonal antibody against recombinantmouse PKR expressed as a GST fusion wasprepared by our laboratory. When NP-40 lysateswere used for western analysis, they were preparedas previously described (40). Mouse monoclonalantibody against β-actin was from Sigma (A-5441).Materials. Unless otherwise specified, allmaterials and reagents were as describedpreviously (10,16-19).

by guest on March 26, 2020

http://ww

w.jbc.org/

Dow

nloaded from

5

RESULTS

Sp3 co-purifies with KCS DNA-bindingActivity. We established earlier that Sp1, Sp3,DDB1 and DDB2 are components of a complexformed between the 15-bp DNA element, KCS, ofthe PKR promoter and proteins present in crudenuclear extracts (19,20). Using as startingmaterial nuclear extracts prepared from humanHeLa cells not treated with IFN, proteins bindingthe KCS element were purified by a multi-stepscheme that included DEAE-cellulose, CM-Sepharose and sequential DNA-Sepharose affinitychromatography steps with wild-type, then mutant,and again wild-type KCS DNA affinity columns(20). When the fractions possessing KCS-bindingactivity (KBP) were now monitored by westernimmunoblot assay using antibody against the Sp3transcription factor, two size forms of Sp3 proteinwere detected (Fig. 1A). These correspond to thelong (Sp3li) and short (Sp3si) isoforms of Sp3 thatderive from alternative tranaltion initiaton sites(35,41,42), both of which co-purified with KBPactivity. The Sp1 protein also co-purified withKBP activity (Fig. 1B) as earlier reported (20).Because the purification of KCS-binding proteinswas from cells not treated with IFN, the Sp1 andSp3 proteins interacted with the KCS DNAelement in the absence of an IFN-mediatedactivation signal. This finding is consistent withour earlier observations that both Sp1 and Sp3bound to KCS DNA linked to Sepharose beadscomparably using nuclear extracts prepared fromuntreated or IFN-treated cells and that KBPactivity was IFN-independent (17,19).

The factors Sp1 and Sp3 independentlybind to the KCS element of the PKR promoter.To assess the importance of the Sp3 transcriptionfactor in the context of protein complex formationwith the KCS DNA element of the PKR promoter,we carried out electrophoretic mobility shift assays(EMSAs) using extracts prepared from either wild-type MEF cells or MEF cells genetically deficientin Sp3 protein expression (32). When the KCS

element was used as the 32P-labeled DNA probein EMSA analyses with extracts prepared fromwild-type cells, a KBP complex was detected as apoorly resolved doublet band (Fig. 2A, lane 1).Treatment of extracts with antibody against Sp1eliminated the upper KBP complex band-shift,

leaving only the lower band of the KBP complex(Fig. 2A, lane 2). By contrast, when extracts weretreated with antibody against Sp3, the lower regionof the KBP band-shift complex was eliminated(Fig. 2A, lane 3). Finally, in the presence ofantibodies against both Sp1 and Sp3, both theupper and lower complexes were eliminated (Fig.2A, lane 4). Taken together, these results are inagreement with the notion that two resolvablecomplexes constitute KBP, one containing Sp1and the other containing Sp3.

When extracts prepared from Sp3 nullMEF cells were analyzed (Fig. 2A, right, lane 5-8), a prominent band-shift complex formation was

still seen with 32P-labeled KCS probe and thatcorresponded to the upper region of the KBPcomplex mobility (Fig. 2A, lane 5). Antibodyagainst Sp1 eliminated entirely the formation ofthis band-shift complex observed with extracts

prepared from Sp3-/- cells (Fig. 2A, lane 6). Bycontrast, as a control, antibody against Sp3 had noeffect on that complex formation (Fig. 2A, lane 7).Antibodies against both Sp1 and Sp3, likeantibody against only Sp1, eliminated allcomplexes formed with nuclear extracts preparedfrom the Sp3 null cells (Fig. 2A, lane 8).

Because the amount of the Sp1-containingcomplex formed was significantly enhanced withextracts prepared from Sp3 null MEF cells (Fig.2A, lanes 5,7) compared to wild-type MEF cells(lanes 1,3), we examined the mutant and wild-typeextracts for the relative levels of Sp1 and Sp3proteins present in them. As measured by westernimmunoblot analysis (Fig. 2B), when equalamounts of nuclear extract protein were assayed,far more Sp1 was found in extracts prepared fromSp3 null MEFs (lanes 3,4) compared to wild-typeMEFs (lanes 1,2). By contrast, when probed withanti-hnRNPA1 as a loading control, similaramounts of the hnRNP protein were found (datanot shown). The Sp3 null mutant cells did notexpress either the small or large isoform of Sp3,whereas both Sp3li and Sp3si isoforms werepresent in wild-type MEF nuclear extracts.Finally, neither protein, Sp1 or Sp3, was altered inamount by IFN treatment (Fig. 2B).

Sp3 is necessary for optimal basal PKRexpression but interferon inducible expression isSp3-independent in mouse embryo fibroblastcells. While PKR is inducible by IFN, basal PKR

by guest on March 26, 2020

http://ww

w.jbc.org/

Dow

nloaded from

6

protein expression is readily detected in mousecell lines and tissues (1,9). In light of thisobservation, and because untreated nuclearextracts were used in the purification studies thatestablished the presence of Sp3 as a component ofthe KBP complex, we examined the effect of Sp3on both basal and IFN inducible PKR expression.Sp3 null MEFs, along with MEF lines withdefined genetic disruptions of genes that encodeproteins involved in IFN signal transduction andtranscriptional activation (J a k 1 and Stat1)wereused. As controls, P k r null MEFs andindependently derived wild-type MEF lines alsowere included in the immunoblot assays.

As shown in Figure 3A, the IFN inducibleexpression of the PKR protein was Sp3independent (lanes 2,4), but dependent upon theSTAT1 factor (lane 8) and JAK1 kinase (lane 12),known type I IFN signal transduction pathwaycomponents. However, the basal expression of the

PKR protein observed in the Sp3-/- MEF cells(lane 3) was less than that seen in all other MEF

cell lines (Fig. 3A) except the Pkr-/- mutant thatlacked detectable PKR (lanes 13,14).Interestingly, basal expression of PKR in mutantMEFs lacking either JAK1 or STAT1 wascomparable to that of wild-type MEFs (Fig. 3A).Control western immunoblots were performedwith anti β-actin antibody (Fig. 3A, lower) andanti-Sp3 antibody (Fig. 3B) using the same set ofextracts shown for the PKR immunoblot (Fig. 3A,upper). For Sp3 western blot nuclear extractswere used. Sp3 protein levels were found to besimilar in all of the MEF lines examined, other

than the Sp3-/- MEFs that did not express eithersize isoform of Sp3 (Fig. 3B, lanes 3,4).

Quantitation of PKR protein expression inseveral independent experiments showed asignificant reduction (p = 0.023) in basalexpression of about 50% in Sp3 null mutantMEFs compared to wild-type MEFs (Fig. 3C).Somewhat surprisingly, the IFN-inducibleexpression of PKR did not differ significantly (p =0.127) between the mutant cells lacking Sp3 andwild-type cells. This observation is consistentwith a role for Sp3 in the regulation of basal PKRexpression.

Effect of Sp factor over-expression onPKR promoter activity in human cells. As oneapproach to assessing the role of Sp1 and Sp3

proteins in the regulation of PKR expression, weexamined the effect of their over-expression on theactivity of the PKR promoter in transfected animalcells. Human U cells were co-transfected withSp1 or Sp3 cDNA expression plasmids, eitherpCMVSp1 or pCMVSp3 respectively, along withthe PKR promoter construct p503(WT) thatcontains the minimal PKR promoter region drivingexpression of a luciferase reporter. Increasingconcentrations of Sp cDNA expression plasmidswere used. Over-expression of Sp1 protein led toan increase in basal as well as IFN-induciblepromoter activity (Fig. 4A, center) relative to thatseen in the absence of Sp1 co-transfection. Over-expression of Sp3, however, did not significantlyaffect promoter activity (Fig. 4A) compared to thatseen with an empty vector control lacking a SpcDNA insert (Fig. 4A, left). Sp1 and Sp3expression in the transfected cells was confirmedby western immunoblot analysis (Fig. 4B). ForSp3, only the large isoform (35) was detectable(Fig. 4B, lane 3; data not shown).

PKR promoter activity is Sp factor-dependent and differentially regulated by Sp1and Sp3 in Drosophila cells. Drosophila SL2cells lack mammalian Sp-like homologues capableof activating Sp-factor responsive promoters(43,44). These insect cells, completely null forboth Sp1 and Sp3, provide a useful systemexamining the ability of the Sp1 and Sp3 factors toactivate PKR promoter activity when expressedeither alone or together, but importantly in theabsence of endogenous Sp factors.

The minimal PKR promoter p503(WT)construct, which includes the KCS and ISRE DNAelements and upstream 5’-flanking sequence (17)displayed very low basal activity in transfectedSL2 Drosophila cells (Fig. 5, left) as compared totransfected human cells in the absence of IFNtreatment (Fig. 4; (18,19). However, co-expression of the Sp1 factor greatly activated thep503(WT) PKR promoter in SL2 cells. Whenincreasing concentrations of pPacSp1 cDNAexpression plasmid containing the mammalian Sp1cDNA insert under the control of an actinpromoter were co-transfected along with the PKRp503(WT) reporter construct, PKR promoteractivity was increased greatly in an Sp1 dose-dependent manner that saturated around one µg ofSp1 expression plasmid (Fig. 5, center). Co-expression of the pPacSp3 cDNA expression

by guest on March 26, 2020

http://ww

w.jbc.org/

Dow

nloaded from

7

plasmid encoding mammalian Sp3 also activatedthe p503(WT) PKR promoter in Drosophila cellsin a dose-dependent manner (Fig. 5). However,Sp3 activated the P K R promoter much lessefficiently than Sp1 in SL2 cells. Co-expressionwith three µg of pPacSp3 plasmid resulted in lessactivation of the PKR promoter (Fig. 5 right) thanthat seen with 0.5 µg of pPacSp1 plasmid (Fig. 5center), even though the expression levels of theSp1 and Sp3 proteins from the pPac actinpromoter driven plasmids were comparable (45,data not shown).

Sp1 and Sp3 proteins can actsynergistically or can antagonize one another,depending upon the nature of the cell and thecontext of the promoter binding site (42,46,47).Because co-transfection of Sp3 did not increasePKR promoter activity in animal cells (Fig. 4A)and only modestly increased activity in insect cells(Fig. 5), we examined the effect of expression ofSp3 together with Sp1 in the SL2 insect cells thatlack both proteins endogenously. As shown inFigure 6, co-expression of Sp3 with Sp1 did notsuppress the level of PKR promoter activationobtained with Sp1 alone. Rather, we observed thatthe Sp1-mediated transactivation of the P K Rpromoter was increased synergistically by co-expression with Sp3 (Fig. 6).

Short isoforms of Sp3 do not affect PKRpromoter activity. Both short (si) and long (li)isoforms of Sp3 protein co-purified with KCSDNA binding activity (Fig.1A). Because Sp3siproteins lack one of the activation domain presentin Sp3li (35,48), we tested the ability of the shortisoforms to transactivate or antagonize activationof P K R promoter driven reporter genetranscription. Varying amounts of thep P a c S p 3 (Δ 1.+2.AUG) cDNA expressionconstruct, which expresses only the short isoformsof Sp3 protein (Sp3si) (35), were co-transfected inDrosophila SL2-cells along with minimal PKRpromoter construct p503(WT) driving theluciferase reporter gene. As shown in Figure 7,Sp3si did not transactivate the PKR promoter, andSp3si did not repress Sp1-mediatedtransactivation. Similarly, Sp3si did not repressSp3-mediated activation of the PKR promoter(data not shown). Finally, the SV40 promoter wasnot activated by Sp3si in Drosophila cells (datanot shown), consistent with recent observations(35).

Sp1 and Sp3-mediated activation of thePKR promoter is independent of the ISREelement but dependent upon the KCS element.Two DNA elements identified that play a role indetermining basal and IFN-inducible activity ofthe PKR promoter, the 15-bp KCS element and the13-bp ISRE element (10,16). The ISRE element isimportant in conferring IFN-α/β responsiveness oftranscription and is found in the promoter regionsof most all genes transcriptionally induced by typeI IFN (1,12) including PKR (10,13). The KCSelement is conserved exactly in sequence andposition between the mouse and human PKRpromoters, so far is unique to them, and plays animportant role in both basal and IFN inducibletranscription of PKR (10,16). To determine thecontribution of the KCS and ISRE elements to theSp-mediated increase in basal PKR promoteractivity, four mutants in the p503 minimal PKRpromoter background that possess changesaffecting the ISRE or KCS element, or bothelements (Fig. 8A), were examined in co-transfection experiments using human U cells(Fig. 8B) and Drosophila SL2 cells (Fig. 9).

The ISREmt8T mutation greatly reducedIFN-inducible and basal transcription intransfected U cells (Fig. 8B) as previouslyreported because of impaired binding of the IFN-activated ISGF3 factor to the ISRE element (18).The 5’-region of the KCS element includes a GCbox, a binding site for Sp1 and Sp3. Two KCSpoint mutants, KCSmt6A and KCSmt9T thatpossess changes in the GC box of KCS bothdisplayed greatly reduced basal and IFN-inducibleactivities in transfected U cells (Fig. 8B) thatcorrelated with impaired formation of the KBPprotein complex as previously described (16,17).Finally, both basal and IFN-inducible promoteractivities were abolished in case of the p503double mutant (KdelISREmt8T) in which the KCSelement was deleted in the background of theISREmt8T mutation (Fig. 8B).

The four p503 mutant constructs also werecompared to p503(WT) in Drosophila SL2 cells,either alone or with increasing concentrations ofpPacSp1 or pPacSp3 expression plasmid (Fig. 9).In the absence of either Sp1 (Fig. 9A) or Sp3 (Fig.9B), all four mutants as well as the WT p503construct showed very low promoter activity inSL2 cells. When Sp1 was co-expressed, thepromoter activity of the KCSmt9T and ISREmt8T

by guest on March 26, 2020

http://ww

w.jbc.org/

Dow

nloaded from

8

mutants increased in a comparable dose-dependentmanner to that of the WT construct (Fig. 9A).However, this was not the case with the KCSmt6Aand KdelISREmt8T mutants, where Sp1-mediatedpromoter activation in SL2 cells was reduced toabout one third of the activity seen for WT p503(Fig. 9A). Although Sp3 is a poorer activator ofthe PKR promoter compared to Sp1 (Fig. 5), thepattern of the responsiveness of the four mutantp503 constructs to co-expressed Sp3 (Fig. 9B) wassimilar to that seen for co-expressed Sp1 (Fig.9A), with one exception; the activity of theKCSmt9T was reduced relative to p503(WT).These results, taken together, indicate that bothKCSmt9T and ISREmt8T retain an intact Sp1binding site and that the Sp3 binding site withinKCS is positioned more 3’ toward the ISREelement. In addition, since none of the mutationsin the KCS or ISRE element completely destroyedresponsiveness to Sp factor co-expression, theremay be additional GC boxes involved in Spactivation of the PKR promoter.

PKR promoter sequence immediatelyflanking the KCS element affects Sp1- and Sp3-mediated activation. The p503 minimal P K Rpromoter sequence includes additional candidateSp factor binding GC box sites within the 5’-flanking region of p503, upstream of the Sp- boxin the KCS element. To examine the potentialinvolvement of upstream GC box sites in the Spfactor-mediated activation of the PKR promoterseen in Drosophila cells, and to determine whetheror not the KCS and ISRE elements were sufficientto support PKR promoter activity mediated by Spfactors, the activities of two deletion constructs(p130, p63) were compared to that of the p503construct (Fig. 10). The p503, p130 and p63constructs all possess the wild-type 15-bp KCSand 13-bp ISRE elements (Fig. 10A). The threeconstructs displayed comparable activity to eachother in transfected mammalian cells, both basalactivity and IFN-induced activity (data not shown,18). In Drosophi la SL2 cells, none of theconstructs showed significant activity in theabsence of Sp1 (Fig. 10B). When Sp1 was co-expressed, comparable strong promoter activitywas seen with the p503 and p130 constructs inSL2 cells. However, with the p63 deletionconstruct, activity was significantly reduced at allconcentrations of the co-transfected Sp1expression plasmid (Fig. 10B). These results

indicate that the one additional Sp binding sitepresent in p130 immediately upstream from thesite in KCS is important for Sp1-mediated PKRpromoter activation, but that the four Sp bindingsites present at the 5’ region of p503 (and absent inp130 and p63) are dispensable. Again, while Sp3-mediated promoter activation (Fig. 10B) wasmuch less than Sp1-mediated activation, unlikeSp1 activation, the p130 construct possessed lowerresponsiveness to Sp3 than did the p503 construct(Fig. 10C).

DISCUSSION

The transcription of the type-I IFN-inducible genes such as PKR is best understood inthe framework of the ISRE DNA element and theheteromeric transcription factor complex ISGF3composed of STAT1, STAT2 and IRF9 (1,12).Indeed, the PKR promoter possesses a consensusISRE element that binds ISGF3 (16) and thatconfers IFN inducibility (18). Although PKR isIFN-inducible, PKR gene expression is notrestricted to IFN-treated cells or tissues. Unlikemany IFN-inducible genes, significant basalexpression of PKR is observed in cultured cellsand mouse tissues in the absence of either IFNtreatment or pathogen infection (1,9,49,50). Thepronounced basal expression seen for PKR nodoubt reflects the broad physiologic roles playedby PKR in a variety of fundamental cellularprocesses including cell growth and differentiationand apoptosis, in addition to the well establishedrole of PKR in the IFN-induced inhibition of virusgrowth (1). Little is known about the factors thatmediate basal PKR expression. Our study wasundertaken to gain understanding of thetranscriptional activation of the PKR promoter inthe absence of IFN treatment. Several importantpoints emerge from our findings.

There is only one known PKR promoter,and in mouse and in human cells it is a TATA-lesspromoter (10,13). While the 13-bp ISRE DNAelement is required for IFN-inducible but not basaltranscription (18), the 15-bp KCS DNA elementconserved exactly in sequence and positionrelative to the ISRE is required for both basal andIFN-inducible PKR promoter activity (10,16-18).The basal expression of PKR observed in MEFcells as shown herein was not dependent uponeither the STAT1 factor or the JAK1 kinase, two

by guest on March 26, 2020

http://ww

w.jbc.org/

Dow

nloaded from

9

proteins normally involved in signal transductionin response to type I and type II IFNs (1,51).These observations argue that the expression ofPKR seen in the absence of exogenous treatmentwith IFN is not simply the result of endogenousautocrine IFN signaling. What then is themechanistic explanation for the basal PKRexpression observed in cells not treatedexogenously with IFN?

One critically important element thatprofoundly affects both basal and IFN-induciblePKR promoter activity is the 15-bp KCS element(10,16,17). Transcriptional activation in reporterassays with the PKR promoter correlates withprotein binding at the KCS element (17). Theprotein-DNA complex formed at the KCSelement, the KBP (KCS binding protein) complex,is independent of IFN treatment (16,18).Furthermore, electrophoretic mobility shift andantibody supershift analyses with KCS DNAprobe, and pull-down assays utilizingoligomerized KCS DNA linked to Sepharosebeads, indicated that two Sp factors (Sp1 and Sp3)were components of the KBP complex (18,19).Although GC-rich elements like that in KCS bindregulators of transcription in addition to Sp familyfactors, the GC sequence within the KCS elementbinds predominantly if not exclusively Sp1 andSp3. In extracts from wild-type MEF cells, KBPcomplex formation was effectively abolished by amixture of antibodies against Sp1 and Sp3.Antibody cross-reactivity was not responsible forthe observed inhibition of complex formation. TheSp1 and the Sp3 containing complexes werepartially resolved from each other on the EMSAgels, and when the antibodies were testedindividually, only the Sp1 or the Sp3 containingcomplex was eliminated by the cognate antibody.Furthermore, with extracts prepared from Sp3 nullcells, antibody against Sp1 was sufficient toeliminate all KBP complex formation.

Purification of the KBP complex utilizinganionic and cationic ion exchange and wild-typeand mutant DNA-affinity chromatographic stepsearlier identified Sp1 as a component of the KBPcomplex (20). Further analysis of the fractionsobtained from the KBP complex purificationscheme described for human HeLa cells (20)revealed that in addition to Sp1, the four knownisoforms of the Sp3 transcription factor also co-purified with KBP binding activity. The results

from the biochemical purification identifying Sp3as a component of the KBP complex are consistentwith our earlier EMSA and pull-downexperimental findings (19,20). While theubiquitous expression patterns, the domainstructures and the DNA binding properties of theSp1 and Sp3 factors are similar, theirtranscriptional properties and physiologic rolescan differ significantly (42,46). How then is basaltranscription from PKR promoter affected by theseconstitutively expressed components of KBPcomplex?

One approach that we undertook was toassess the basal activity of the PKR promoter inreporter assays following co-transfection with Sp1and Sp3 transcription factor expression vectors,individually and in combination with each other.Human U cells, like most cultured cell lines,possess significant endogenous levels of Sp1 andSp3. Nevertheless, co-transfection with Sp1further increased both basal and IFN-inducibleminimal promoter activity, whereas co-transfection with Sp3 did not. But whenDrosophila SL2 cells that are naturally deficient inSp factors and do not express either Sp1 or Sp3(43) were examined, both Sp1 and the large formof Sp3 activated PKR promoter activity in a dose-dependent manner. Sp1 was significantly morepotent than Sp3li, which mediated much lessactivation of the PKR promoter. However, theshort form of Sp3 alone was completely inactive;Sp3si neither activated the PKR promoter whentested alone, nor suppressed the Sp1-mediatedactivation when tested in combination with Sp1.Prior studies with other promoters established thatSp1 acts as a transcriptional activator, whereasSp3 can act either as a transcriptional activator andrepressor (42). Our findings from transfectionstudies with SL2 cells and western immunoblotanalyses with Sp3 null MEFs establish that Sp1clearly is capable of activating PKR promoteractivity, and that IFN-inducible PKR expressioncan occur in the absence of Sp3. Furthermore,our data suggest that the relative abundance ofdifferent Sp family factors is an importantdeterminant in modulating the level of PKRtranscription in the absence of IFN, with theactivity of Sp1 > Sp3li >>>Sp3si, where Sp3si isincapable of either activation or repression of PKRat least in SL2 cells. Conceivably the modestactivity or no activity observed for the Sp3

by guest on March 26, 2020

http://ww

w.jbc.org/

Dow

nloaded from

10

isoforms on the PKR promoter reflects the needfor an additional Sp-interacting protein that isabsent in SL2 cells or a post-translationalmodification such as acetylation or sumoylationthat does not happen in SL2 cells (35).

The two Sp3si factors are derived fromtwo adjacent internal translation initiation sites(35). They are N-terminally truncated, and lackthe N-terminal transactivation A domain present inthe two larger forms of Sp3li (22,35). Sp3sifactors can act as competitive inhibitors of Sp1-mediated transcription (48). However, we did notobserve that Sp3si overexpression in SL2 cellsinhibited Sp1-mediated activation of the P K Rpromoter. Similarly, the SV40 promoter was notinhibited by Sp3si in SL2 cells in our hands(unpublished). By contrast, long isoforms of Sp3having two glutamine-rich activation domains doactivate the SV40 promoter (which has six GC-boxes) while the short isoforms do not (35),similar to what we observed for the P K Rpromoter. For some promoters that possessmutiple adjacent GC sites, Sp3li also has beenreported to compete with Sp1 activation andfunction as a negative regulator (41,48,52), butthis was not found for the PKR promoter.

Comparison of different wild-type andmutant MEF cell lines revealed that in the absenceof IFN treatment, the steady-state level of PKR inthe Sp3 null cells was reduced relative to that seenin different WT MEF lines, and also in Stat1- andJak1- null MEF lines. Yet, the level of PKR in Sp3null cells following IFN treatment was comparableto that of IFN-treated wild-type cells. Onepossible interpretation from these observations isthat Sp3 plays a role in basal transcription. Butchromatin immunoprecipitation assays revealedthat the binding of Sp3 at the PKR promoterregion was IFN dependent, whereas the binding ofSp1 was independent of IFN treatment (19,20).How may the apparent discordance be explained?One possibility is that the increased amount of Sp1can compensate for the absence of Sp3 in the nullcells under conditions of IFN treatment.Additional possibilities are that the chromatinstructure of the PKR promoter region is alteredfollowing IFN treatment to become moreaccessible to Sp3 binding directly or that thepresence of the ISGF-3 complex in IFN-treatedcells facilitates recruitment of Sp3 to the P K Rpromoter.

We found that PKR promoter activityincreased about two-fold in the presence of Sp1expression in transfected human cells. Up-regulation of IFN inducible promoter activityunder similar conditions may be due in part toincreased recruitment of the ISGF3 complexcomponents to the PKR promoter region by theSp1 protein. Consistent with this possibility arethe observations that STAT1 has been reported tointeract with Sp1 (53), that both STAT1 andSTAT2 are capable of interacting with proteincomponents of the KBP complex (19), and that theKCS element functions in concert with the ISREelement as revealed by protein binding thatrequires both the KCS and ISRE elementsequences (16). Although STAT1/2 interactionsinvolving the ISRE could be directly with Sp1 (orother known KBP complex protein constituents atthe KCS element), we cannot exclude thepossibility of indirect interactions through yet asunidentified components (Fig. 11).

The minimal promoter region of PKRgene contains six potential Sp-binding sites, withfour of them positioned as overlapping Sp-sites.The importance of the multiple Sp-binding sitesfound in the minimal PKR promoter was assessedusing deletion and substitution mutant constructs.It is evident from reporter assays that the two mostdownstream Sp-sites (Sp-sites 1 and 2 shown inthe Fig. 10 schematic), one within the KCSelement and the other positioned just upstream ofKCS, play critical roles in Sp1-mediated P K Rpromoter activation. Using the p130(WT)promoter construct which lacked the upstream fouroverlapping Sp-sites, we observed similar Sp1-mediated promoter activity in SL2 cells as thatseen for p503(WT). Sp3-mediated promoteractivity displayed by p130(WT) was about halfthat of p503(WT), indicating that unlike Sp1, theSp-site immediate upstream of KCS (Sp-site 2 inFig. 10) was insufficient for complete Sp3activation. The mutant KCSmt6A promoterconstruct showed that disruption of the Sp-sitewithin the KCS region caused a significantreduction in Sp factor-mediated promoter activity.A mutant with a non-functional ISRE element,however, showed similar activity as the p503(WT)for both Sp1 and Sp3, further establishing that thebinding of Sp1 and Sp3 to the PKR promoter andbasal transcriptional activation by these factors areindependent of the ISRE element. Sp1 has been

by guest on March 26, 2020

http://ww

w.jbc.org/

Dow

nloaded from

11

shown to function as gene activator by recruitingTFIID (54), and the TBP associated factor 1(TAF1) activates TATA-less cyclin D1 promoterby interacting with Sp1 protein (55). The PKRpromoter likewise is TATA-less (10,13)

A major limitation in understanding howcells produce PKR in the absence of IFN has beenthe inability to identify the factors involved, andthe inability to demonstrate activation oftranscription in the absence of IFN signaling.This has now been accomplished for the PKRpromoter (Fig. 11). We have demonstrated that

both Sp1 and Sp3 function as activators of thePKR promoter through utilization of acombination of Sp1/Sp3 binding sites. Sp1 was amuch more potent activator than Sp3. Our studyestablishes a new role for Sp-family oftranscription factors in the basal expression ofPKR which is otherwise an IFN-inducible gene.Regulation of the PKR gene, a gene that plays amajor role in regulating cell growth and apoptosis,by Sp1 and Sp3 emphasizes the importance ofthese Sp transcription factors broadly in biology.

REFERENCES

1. Samuel, C. E. (2001) Clin. Microbiol. Rev. 14, 778-8092. Samuel, C. E. (1979) Proc. Natl. Acad. Sci. U. S. A. 76, 600-6043. Samuel, C. E., Duncan, R., Knutson, G. S., and Hershey, J. W. (1984) J. Biol. Chem. 259,

13451-134574. Moldave, K. (1985) Annu. Rev. Biochem. 54, 1109-11495. Williams, B. R. G. (1995) Semin. Virol. 6, 191-2026. Williams, B. R. (1999) Oncogene 18, 6112-61207. Kumar, A., Haque, J., Lacoste, J., Hiscott, J., and Williams, B. R. (1994) Proc. Natl.

Acad. Sci. U. S. A. 91, 6288-62928. Abraham, N., Stojdl, D. F., Duncan, P. I., Methot, N., Ishii, T., Dube, M., Vanderhyden,

B. C., Atkins, H. L., Gray, D. A., McBurney, M. W., Koromilas, A. E., Brown, E. G.,Sonenberg, N., and Bell, J. C. (1999) J. Biol. Chem. 274, 5953-5962

9. Shtrichman, R., Heithoff, D. M., Mahan, M. J., and Samuel, C. E. (2002) Infect. Immun.70, 5579-5588

10. Kuhen, K. L., and Samuel, C. E. (1997) Virology 227, 119-13011. Kuhen, K. L., Shen, X., Carlisle, E. R., Richardson, A. L., Weier, H. U., Tanaka, H., and

Samuel, C. E. (1996) Genomics 36, 197-20112. Darnell, J. E., Jr. (1997) Science 277, 1630-163513. Tanaka, H., and Samuel, C. E. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 7995-799914. Breathnach, R., and Chambon, P. (1981) Annu. Rev. Biochem. 50, 349-38315. Smale, S. T., Schmidt, M. C., Berk, A. J., and Baltimore, D. (1990) Proc. Natl. Acad. Sci.

U. S. A. 87, 4509-451316. Ward, S. V., and Samuel, C. E. (2002) Virology 296, 136-14617. Kuhen, K. L., Vessey, J. W., and Samuel, C. E. (1998) J. Virol. 72, 9934-993918. Kuhen, K. L., and Samuel, C. E. (1999) Virology 254, 182-19519. Ward, S. V., and Samuel, C. E. (2003) Virology 313, 553-56620. Das, S., Ward, S. V., Markle, D., and Samuel, C. E. (2004) J. Biol. Chem. 279, 7313-

732121. Black, A. R., Black, J. D., and Azizkhan-Clifford, J. (2001) J. Cell. Physiol. 188, 143-16022. Suske, G., Bruford, E., and Philipsen, S. (2005) Genomics 85, 551-55623. Li, L., He, S., Sun, J. M., and Davie, J. R. (2004) Biochem. Cell Biol. 82, 460-471

by guest on March 26, 2020

http://ww

w.jbc.org/

Dow

nloaded from

12

24. Kawakami, Y., Esteban, C. R., Matsui, T., Rodriguez-Leon, J., Kato, S., and Belmonte, J.C. (2004) Development 131, 4763-4774

25. Hata, Y., Duh, E., Zhang, K., Robinson, G. S., and Aiello, L. P. (1998) J. Biol. Chem.273, 19294-19303

26. Wang, J., and Bannon, M. J. (2005) J. Neurochem. 93, 474-48227. Dennig, J., Hagen, G., Beato, M., and Suske, G. (1995) J. Biol. Chem. 270, 12737-1274428. Zhang, X., Li, Y., Dai, C., Yang, J., Mundel, P., and Liu, Y. (2003) Am. J. Physiol. Renal

Physiol. 284, F82-9429. Samuel, C. E., and Knutson, G. S. (1983) Virology 130, 474-48430. Meraz, M. A., White, J. M., Sheehan, K. C., Bach, E. A., Rodig, S. J., Dighe, A. S.,

Kaplan, D. H., Riley, J. K., Greenlund, A. C., Campbell, D., Carver-Moore, K., DuBois,R. N., Clark, R., Aguet, M., and Schreiber, R. D. (1996) Cell 84, 431-442

31. Rodig, S. J., Meraz, M. A., White, J. M., Lampe, P. A., Riley, J. K., Arthur, C. D., King,K. L., Sheehan, K. C., Yin, L., Pennica, D., Johnson, E. M., Jr., and Schreiber, R. D.(1998) Cell 93, 373-383

32. Bouwman, P., Gollner, H., Elsasser, H. P., Eckhoff, G., Karis, A., Grosveld, F.,Philipsen, S., and Suske, G. (2000) EMBO J. 19, 655-661

33. Samuel, C. E., and Knutson, G. S. (1982) J. Biol. Chem. 257, 11791-1179534. Udvadia, A. J., Templeton, D. J., and Horowitz, J. M. (1995) Proc. Natl. Acad. Sci. U. S.

A. 92, 3953-395735. Sapetschnig, A., Koch, F., Rischitor, G., Mennenga, T., and Suske, G. (2004) J. Biol.

Chem. 279, 42095-4210536. Luthman, H., and Magnusson, G. (1983) Nucleic Acids Res. 11, 1295-130837. George, C. X., and Samuel, C. E. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 4621-462638. George, C. X., and Samuel, C. E. (1999) Gene 229, 203-21339. Bromberg, J. F., Wrzeszczynska, M. H., Devgan, G., Zhao, Y., Pestell, R. G., Albanese,

C., and Darnell, J. E., Jr. (1999) Cell 98, 295-30340. Samuel, C. E. (1981) Methods Enzymol. 79, 168-17841. Hagen, G., Dennig, J., Preiss, A., Beato, M., and Suske, G. (1995) J. Biol. Chem. 270,

24989-2499442. Suske, G. (1999) Gene 238, 291-30043. Courey, A. J., and Tjian, R. (1988) Cell 55, 887-89844. Santoro, C., Mermod, N., Andrews, P. C., and Tjian, R. (1988) Nature 334, 218-22445. Chamboredon, S., and Castellazzi, M. (2005) Oncogene 24, 2547-255746. Bouwman, P., and Philipsen, S. (2002) Mol. Cell. Endocrinol. 195, 27-3847. Kaczynski, J., Cook, T., and Urrutia, R. (2003) Genome Biol. 4, 20648. Kennett, S. B., Udvadia, A. J., and Horowitz, J. M. (1997) Nucleic Acids Res. 25, 3110-

311749. Samuel, C. E. (1991) Virology 183, 1-1150. Icely, P. L., Gros, P., Bergeron, J. J., Devault, A., Afar, D. E., and Bell, J. C. (1991) J.

Biol. Chem. 266, 16073-1607751. Platanias, L. C. (2005) Nat. Rev. Immuno. 5, 375-38652. Yu, B., Datta, P. K., and Bagchi, S. (2003) Nucleic Acids Res. 31, 5368-537653. Look, D. C., Pelletier, M. R., Tidwell, R. M., Roswit, W. T., and Holtzman, M. J. (1995)

J. Biol. Chem. 270, 30264-3026754. Dorris, D. R., and Struhl, K. (2000) Mol. Cell. Biol. 20, 4350-4358

by guest on March 26, 2020

http://ww

w.jbc.org/

Dow

nloaded from

13

55. Hilton, T. L., and Wang, E. H. (2003) J. Biol. Chem. 278, 12992-13002

ACKNOWLEDGMENTS

This work was supported in part by Research Grant AI-20611 from the National Institute ofAllergy and Infectious Diseases, U.S. Public Health Service.

FOOTNOTES

§To whom correspondence should be addressed: Tel.: 805-893-3097; Fax: 805-893-5780;samuel@lifesci.ucsb.edu

¶Present address: Laboratory of Genetics, Salk Institute for Biological Studies, 10010 NorthTorrey Pines Road, La Jolla, CA 92037

1Abbreviations used: bp, basepair; EMSA, electrophoretic mobility shift assay; IFN, interferon;PKR, the RNA-dependent eIF-2α protein kinase inducible by interferon; PKR, gene encodingthe PKR kinase; DDB, DNA damage binding protein; Sp, Specificity protein transcription factor.

FIGURE LEGENDS

FIGURE 1. Sp3 protein isoforms copurify with KCS DNA binding activity. Samples fromsteps of the purification scheme for KCS binding activity (20) were analyzed on a 10%polyacrylamide gel containing SDS, transferred to a nitrocellulose, and then probed separatelywith antibodies specific for (A) Sp3 and (B) Sp1. Fractions analyzed contained ~two µg of totalprotein as follows: lane 1, nuclear extract starting material; lane 2, flow-through (FT) fromDEAE-cellulose chromatography step; lane 3 in A, 0.35 M KCl eluate from the CM-Sepharose(CM-Seph) chromatography step; and lane 4 (lane 3 in B), 0.6 M KCl eluate from the wild-type(WT) KCS DNA-sepharose affinity chromatography step.

FIGURE 2. Sp3 and Sp1 independently bind to the KCS element. (A) EMSA supershiftanalysis of constitutive protein binding to the KCS element of the PKR promoter. Nuclear

extracts (~10 µg protein) from either (lanes 1-4) wild-type (WT) or (lanes 5-8) Sp3-null (Sp3-/-)

MEF cells were incubated with 32P-labeled KCS probe in the absence (lanes 1, 5) or presence ofantibody against Sp1 (lanes 2,6) or Sp3 (lanes 3,7) or a combination of both Sp1 and Sp3 (lanes4,8). The KBP complexes are indicated by brackets. (B) Western immunoblot analysis of Sp1(upper panel) and Sp3 (lower panel) protein expression in WT (lanes 1,2) and Sp3-/- (lanes 3,4)cells using 10 µg of nuclear extract and polyclonal antibody against Sp1 or Sp3 as indicated.

FIGURE 3. Sp3 is necessary for optimal basal PKR expression but not interferon inducibleexpression which is dependent upon JAK1 and STAT1. (A) Western immunoblot analysis ofPKR protein expression in WT and mutant MEF cell lines genetically deficient in Sp3, Stat1,Jak1, and Pkr as indicated. Cells were treated with 1000 units per ml recombinant IFN (+) or

by guest on March 26, 2020

http://ww

w.jbc.org/

Dow

nloaded from

14

left untreated (-), NP40 cell-free extracts were prepared and then analyzed (5 µg extract protein)as described under Materials and Methods using rabbit polyclonal antibody against mouse PKR(upper panel) or monoclonal antibody against β-actin (lower panel). (B) Western immunoblotanalysis of Sp3 protein expression in WT and mutant MEF cell lines. Nuclear extracts (10 µgprotein) were analyzed using polyclonal antibody against Sp3; both the (li) long and the short (si)isoforms of Sp3 were detected. (C) Quantitation of PKR protein expression in untreated (-) andIFN-treated (+) cells, either WT or Sp3 null MEFs as indicated. PKR quantitation is relative toβ-actin for five independent experiments, presented as mean ± SD and normalized to untreated

wild-type cells. Student t test,*, p = 0.023, untreated Sp3 -/-

compared to untreated wild-type.

FIGURE 4. Effect of Sp factors on PKR promoter activity in human U cells.(A) Transactivation of PKR promoter in human U cells. Varying amounts (µg) of pCMVSp1 orpCMVSp3 expression plasmid construct, as indicated, were co-transfected individually with thereporter construct containing the p503(WT) minimal PKR promoter driving expression of theLUC reporter gene. The pRSV-βgal plasmid was included as an internal control for transfectionefficiency and all data were normalized to β-galactosidase. U cells were treated with IFN-α (+)or left untreated (-) as indicated. Results shown are the mean ± SD determined from fiveindependent experiments. (B) Expression of Sp factors in transfected cells measured byimmunoblotting with anti-HA antibody. Whole cell extracts were prepared from U cellstransfected with pCMVSp expression constructs for Sp1 (lane 2) and Sp3 (lane 3) proteins, orempty pCMV-4 vector (lane 1) as a negative control.

FIGURE 5. PKR promoter transactivation by Sp factors in Drosophila SL2 cells. Varyingamounts (µg) of pPacSp1 or pPacSp3 expression plasmid construct, as indicated, were co-transfected individually with the reporter construct containing the p503(WT) minimal PKRpromoter driving expression of the CAT reporter in Drosophila SL2 cells. CAT activitymeasured 48 h after transfection was normalized to protein content and the percentageconversion of [14C]chloramphenical to acetylated derivatives was determined. Results shown arethe mean ± SD determined from five independent experiments.

FIGURE 6. Sp1 and Sp3 act synergistically to transactivate the PKR promoter in DrosophilaSL2 cells. pPacSp1 and pPacSp3 were co-transfected along with the reporter constructcontaining the p503(WT) minimal PKR promoter driving expression of the CAT reporter inDrosophila SL2 cells. Varying amounts (µg) of pPacSp1expression plasmid were tested eitheralone or with a constant amount of pPacSp3 as indicated. CAT activity was determined as forFigure 5; results shown are the mean ± SD determined from three independent experiments.

FIGURE 7. Sp3si does not transactivate the PKR promoter nor antagonize Sp1-mediatedtransactivation in Drosophila SL2 cells. pPacSp1 and pPacSp3si were co-transfected alongwith the reporter construct containing the p503(WT) minimal PKR promoter driving expressionof the LUC reporter in Drosophila SL2 cells. Varying amounts (µg) of pPacSp3si expressionplasmid were tested either alone or with a constant amount of pPacSp1 as indicated. LUCactivity was determined as described under the Methods section. Results shown are the mean ±SD determined from three independent experiments.

by guest on March 26, 2020

http://ww

w.jbc.org/

Dow

nloaded from

15

FIGURE 8. The KCS DNA element is necessary for optimal basal and interferon induciblePKR promoter activity in human U cells. (A). Schematic representation of four mutant p503PKR promoter constructs. For KCSmt6A and KCSmt9T, the indicated G6-to-A6 and G9-to-T9substitutions are within the KCS motif (17). For ISREmt8T, the G8-to-T8 substitution is withinthe ISRE element (10). For KdelISREmt8T, the KCS motif was completely deleted in theISREmt8T background. (B) Promoter activities were determined in human U cells transfectedwith the indicated wild-type (WT) or mutant p503 reporter construct. Cells were either leftuntreated (-) or treated with 1000 units per ml IFN-α (+). Relative promoter activity is shownnormalized to basal activity of the p503 (wt) construct. Cells were cotransfected with the pGL2-LUC control plasmid as an internal reference to control for transfection efficiency.

FIGURE 9. Sp1- and Sp3-mediated transactivation of the PKR promoter in Drosophila SL2cells is dependent upon the KCS element but independent of the ISRE element. Varyingamounts of pPacSp1 (A) or pPacSp3 (B) were cotransfected with the indicated p503 WT ormutant promoter construct depicted in the Figure 7 schematic. CAT activity was measured as forFigure 5 and the results shown are the mean ± SD determined from three independentexperiments.

FIGURE 10. Sequence immediately 5’ of the KCS element affects Sp1- and Sp3-mediatedtransactivation of the PKR promoter in Drosophila SL2. (A). Schematic representation ofthe three CAT reporter plasmid constructs, p503(WT) and two derived 5’-deletions, p130(WT)and p63(WT) (18). The filled boxes numbered 1 to 6 indicate the positions of the six Sp-siteswithin the p503 minimal promoter. Varying amounts of pPacSp1 (B) or pPacSp3 (C) were co-transfected with the indicated promoter construct, p503, p130 or p63 depicted in the schematicshown in (A). CAT activity was measured as for Figure 5 and the results shown are the mean ±SD determined from three independent experiments.

FIGURE 11. Model of PKR promoter elements and interacting protein factors. The KBPprotein complexes bound at the 15-bp KCS element include Sp1, Sp3, DDB1 and DDB2.Proteins that bind the13-bp ISRE element include ISGF3 (STAT1, STAT2, IRF9) and IRF1.Arrows indicate the possible interactions between the protein components bound at the KCS andISRE elements, either direct or indirect through additional as yet unidentified (X) components.Results from protein purification, electrophoretic mobility shift analysis, EMSA supershiftanalysis, Sepharose-bead DNA pull-down, chromatin immunoprecipitation, reporter transfection,promoter mutagenesis, and use of genetically deficient cell lines suggest that activator proteinsbound at the KCS element function in concert with proteins bound at the ISRE element (SeeDiscussion).

by guest on March 26, 2020

http://ww

w.jbc.org/

Dow

nloaded from

by guest on March 26, 2020

http://ww

w.jbc.org/

Dow

nloaded from

by guest on March 26, 2020

http://ww

w.jbc.org/

Dow

nloaded from

by guest on March 26, 2020

http://ww

w.jbc.org/

Dow

nloaded from

by guest on March 26, 2020

http://ww

w.jbc.org/

Dow

nloaded from

by guest on March 26, 2020

http://ww

w.jbc.org/

Dow

nloaded from

by guest on March 26, 2020

http://ww

w.jbc.org/

Dow

nloaded from

by guest on March 26, 2020

http://ww

w.jbc.org/

Dow

nloaded from

by guest on March 26, 2020

http://ww

w.jbc.org/

Dow

nloaded from

by guest on March 26, 2020

http://ww

w.jbc.org/

Dow

nloaded from

by guest on March 26, 2020

http://ww

w.jbc.org/

Dow

nloaded from

by guest on March 26, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Sonali Das, Simone V. Ward, Robert S. Tacke, Guntrum Suske and Charles E. Samuelinterferon is dependent upon Sp proteins

Activation of the RNA-dependent protein kinase PKR promoter in the absence of

published online December 8, 2005J. Biol. Chem. 

  10.1074/jbc.M510612200Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

by guest on March 26, 2020

http://ww

w.jbc.org/

Dow

nloaded from