RNAi in S2 Cells

77

CHAPTER FOUR

RNAi IN S2 CELLS

RNAi in S2 Cells

78

4.1 Introduction

RNA interference (RNAi) is one of the most exciting discoveries of the

past decade in functional genomics. RNAi is rapidly becoming an important

method for analyzing gene functions in eukaryotes and holds promise for the

development of therapeutic gene silencing (Cheng et al., 2003). In 2006, Andrew

Fire and Craig C. Mello shared the Nobel Prize in Physiology or Medicine for

their work on RNA interference in the nematode worm C. elegans (Fire et al.,

1998).

RNA interference (RNAi) is a recent technological advance that allows the

reduction of the expression of a gene of interest at the posttranscriptional level.

Initially discovered in Caenorhabditis elegans, its use has been extended to

Drosophila embryos and cell lines, mammalian embryos and cell lines, plants,

fungi, and eukaryotic pathogens such as trypanosomes (DaRocha et al., 2004).

Recent findings indicate that RNA silencing is an evolutionarily conserved

pathway that participates in the regulation of gene expression and that protects

genomes from genomic parasites such as viruses and transposons.

RNAi is an RNA-dependent gene silencing process that is controlled by

the RNA-induced silencing complex (RISC) and is initiated by short double-

stranded RNA molecules in a cell's cytoplasm, where they interact with the

catalytic RISC component argonaute. When the dsRNA is exogenous (coming

from infection by a virus with an RNA genome or laboratory manipulations), the

RNA is imported directly into the cytoplasm and cleaved to short fragments by

the enzyme dicer (Macrae et al., 2006). The initiating dsRNA can also be

endogenous (originating in the cell), as in pre-microRNAs expressed from RNA-

coding genes in the genome. The primary transcripts from such genes are first

processed to form the characteristic stem-loop structure of pre-miRNA in the

nucleus, and then exported to the cytoplasm to be cleaved by dicer. Thus, the

two dsRNA pathways, exogenous and endogenous, converge at the RISC

complex (Bagasra and Prilliman, 2004).

RNAi in S2 Cells

79

Exogenous dsRNA initiates RNAi by activating the ribonuclease protein

Dicer (Bernstein et al., 2001), which binds and cleaves double-stranded RNAs

(dsRNA)s to produce double-stranded fragments of 20–25 base pairs with a few

unpaired overhang bases on each end (Zamore et al., 2000 and Vermeulen et

al., 2005). Bioinformatics studies on the genomes of multiple organisms suggest

this length maximizes target-gene specificity and minimizes non-specific effects

(Qiu et al., 2005). These short double-stranded fragments are called small

interfering RNAs (siRNAs). These siRNAs are then separated into single strands

and integrated into an active RISC complex. After integration into the RISC,

siRNAs base-pair to their target mRNA and induce cleavage of the mRNA,

thereby preventing it from being used as a translation template (Ahlquist, 2002).

RISC activation and catalysis

The active components of an RNA-induced silencing complex (RISC) are

endonucleases called argonaute proteins, which cleave the target mRNA strand

complementary to their bound siRNA. As the fragments produced by dicer are

double-stranded, they could each in theory produce a functional siRNA.

However, only one of the two strands, which is known as the guide strand, binds

the argonaute protein and directs gene silencing. The other anti-guide strand or

passenger strand is degraded during RISC activation (Gregory et al., 2005).

Although it was first believed that an ATP-dependent helicase separated these

two strands (Lodish et al., 2004), the process is actually ATP-independent and

performed directly by the protein components of RISC (Matranga et al., 2005 and

Leuschner et al., 2006). The strand selected as the guide tends to be the one

whose 5' end is least paired to its complement (Schwarz et al., 2003), but strand

selection is unaffected by the direction in which dicer cleaves the dsRNA before

RISC incorporation (Preall et al., 2006). Instead, the R2D2 protein may serve as

the differentiating factor by binding the more-stable 5' end of the passenger

strand (Tomari et al., 2004).

The hallmark of RNAi is its specificity. dsRNA reduces expression of the

gene from which the dsRNA sequence is derived, without detectable effect on

the expression of genes unrelated in sequence (Fire et al., 1998; Montgomery

RNAi in S2 Cells

80

and Fire, 1998). The gene silencing induced by RNAi is reversible and thus does

not appear to reflect a genetic change (Fire et al., 1998). Evidence that RNAi

functions post-transcriptionally is as follows: dsRNA corresponding to intron

sequences does not produce RNAi (Montgomery and Fire, 1998), and dsRNA

corresponding to exon sequences does not affect pre-mRNA levels (Ngo et al.,

1998). Only a few molecules of dsRNA per cell are required to produce RNAi

(Fire et al., 1998; Kennerdell and Carthew, 1998). The small amount of dsRNA

required for silencing and the spreading of the silencing through a broad region

of the organism suggests that the dsRNA either acts catalytically or is amplified

(Fire et al., 1999).

Figure 4.1: Simplified schematic diagram of the proposed RNA interference mechanism.

Invertebrate cell culture systems, particularly those from Drosophila

melanogaster, that are well established and grow easily and economically in the

laboratory have become a valuable tool in analyzing biological function. The fact

that RNAi can be done in cultures of Drosophila cell lines, together with its

RNAi in S2 Cells

81

specificity, dose dependence, and ability to use more than one species of dsRNA

at the same time, allows a range of applications, including analysis of a

phenotype due to the reduction in the expression of a particular gene product;

analysis of protein complexes in the absence of a subunit; study of downstream

targets of enzymes by proteomics and epistasis analysis; pooling of different

dsRNAs in screens; and targeting of specific alternatively spliced mRNA

isoforms. All of these properties and the availability of fully sequenced and

annotated genomes make RNAi in Drosophila-cultured cells a powerful tool for

rapid screens of several genes for a common function (e.g., cell cycle genes) or

a particular biological or biochemical property. In fact, screens have been

published for a wide range of processes from cell cycle to morphogen signaling.

The S2 cell line was derived from a primary culture of late stage (20-24

hours old) Drosophila melanogaster embryos (Schneider, 1972). Many features

of the S2 cell line suggest that it is derived from a macrophage-like lineage. S2

cells grow at room temperature without CO2 as a loose, semi-adherent

monolayer in tissue culture flasks and in suspension in spinners and shake

flasks.

In this chapter, RNAi strategy has been utilized for regulating expression

of DAP in Drosophila cultured S2 cells. DAP protein was knocked down by

transfecting the S2 cells with dsRNA. 2D proteomic analysis followed by MALDI

TOF TOF was employed for identification of differentially expressed proteins in

these RNAi experiments.

4.2 Materials and methods: 4.2.1 Cell culture:

S2 cells derived from ORK embryos were used. Cells were propagated in 1X

Schneider’s Drosophila media (Hi Media) supplemented with 10% FBS, 50units

penicillin and 50μg/ml streptomycin in 25cm2 T flasks (Tarson) at room

temperature.

RNAi in S2 Cells

82

4.2.2 PCR amplification for making the template: PCR was carried as described in Annexure using gene genomic DNA as the

template and the primers designed to amplify the 516bp unique region in the

center of DAP. Both the primers were tagged with T7 polymerase binding site at

the 5’ end.

Forward primer: GTCTTCTTCTCCTACTTGATTG (ds1with T7 pol site) Reverse primer: TTCTTTGGGTGATAGTGAATAAC (ds2 with T7 pol site) 4.2.3 Template purification: The amplified PCR fragment was sodium acetate precipitated as described in

Annexure. The concentration was spectrophotometrically checked and the quality

of the DNA was checked on an agarose gel.

4.2.4 In vitro transcription: In vitro transcription was carried out as described in 2.2.5.1. RiboMAX(TM) In

Vitro Transcription Systems from Promega was used. 10ug of DNA template was

used for in vitro transcription. The reaction components were added according to

manufacturer’s instructions, mixed gently and incubated at 37°C for 4hours.

DNase (10units for 10ug DNA) was added and incubated at 37°C for 15mins.

The RNA was precipitated with 1/10 volume of 3M Sodium Acetate (pH 5.2) and

2.5 volumes of 95% (v/v) ethanol. Pellet was resuspended in 100μl nuclease-free

water. To anneal the RNA strands, the reaction mix was heated to 70°C for

30min and cooled down slowly overnight. dsRNA concentration was then

quantified by measuring the absorbance of 1/500th of the volume of dsRNA at

260nm and calculated the concentration (one A260 unit equals~40μg/ml of

dsRNA). The concentration was adjusted to 3ug per ul. Quality of the dsRNA was

checked on 1.5% agarose gel.

4.2.5 Transfection of S2 cells Exponentially growing S2 cells (passaged in Gibco Schneider’s medium + 10%

Gibco FBS) just about to peak confluence were used. The cell density was

counted and calculated using a hemocytometer. 1 × 106 cells in 1 ml of Invitrogen

RNAi in S2 Cells

83

serum free medium was added to each well of a 6-well plate. The cells were

allowed to settle for 30mins. dsRNA (516bp) to a concentration of 30ug was

added to each experimental well, mixed evenly by swirling the plate. The plate

was incubated at 25°C for 1h. 3ml of Gibco Schneider’s medium + 10% Gibco

FBS medium was added to each well. The plate was then further incubated at

25°C for 2 days. Cell density was counted before using the cells for RNA

isolation.

4.2.6 mRNA isolation mRNA was isolated using micro to midi RNA isolation kit from Invitrogen. Cells

were pelleted, washed with PBS, lysed in the lysis solution and homogenized in

the eppendorff using eppendorff homogenizer. Then this was centrifuged at

2600g for 5 min at 4°C. To the supernatant one volume of 70% ethanol was

added. This was then transferred to the RNA spin cartridge and centrifuged at

12000 g for 15 sec at RT. The spin cartridge was washed with wash buffer.

DNase was added to the spin cartridge at the center and incubated at RT for 15

min. The spin cartridge was then washed twice with wash buffer I and once with

wash buffer II. Then a dry spin was given to the spin cartridge and the RNA was

eluted in 100ul RNase free water. Absorbance at 260/280 was taken to quantify

the RNA.

4.2.7 cDNA synthesis cDNA was synthesized using Invitrogen First strand synthesis kit. 1ug mRNA of

each, experimental and control was used. All the ingredients were added

according to the manufacture’s instructions along with the random hexamers.

The reaction was incubated at 42°C for 2min and then the reverse transcriptase

enzyme was added and further incubated at 42°C for 50min. The cDNA was

used for RT PCR.

RNAi in S2 Cells

84

4.2.8 RT- PCR Equal amount of cDNA synthesis reaction product was used for the RT- PCR

reaction and the PCR was carried out as described in the Annexure. The PCR

product was checked on 1.5% agarose gel by loading equal amounts of control

and experimental.

4.2.9 Total protein extraction After treatment of the S2 cells with dsRNA for 48hr, the cells were pelleted and

washed with PBS. The cells were homogenized in homogenization buffer and

then centrifuged at 13000rpm for 30min. Supernatant was treated as the total

protein extract. The protein concentration was calculated by Bradford’s method

and equal amount of the protein from experimental and control cells was used for

2D gel electrophoresis.

4.2.10 Two Dimensional gel electrophoresis (Garrels,. 1979):

Protein samples (120-130µg) were solubilized in 125μl of IPG strip rehydration

buffer (8M urea, 2%CHAPS, 10mM DTT, 0.2%Ampholyte) at room temperature.

The resulting protein solution was used to rehydrate each ReadyStrip IPG, pH

range 3–10, 7cm (BioRad Laboratories, USA) under passive conditions at room

temperature in the focusing tray (Mini-PROTEAN 3 cell). The strip was left

overnight for rehydration. Subsequently, IEF was carried out as recommended by

the manufacturer (following three steps: conditioning (20min at 250V), voltage

ramping (250–4,000V in 2h for 7-cm strips), and focusing (2.5h at 4,000V, 10,000

Vhrs for 7-cm strips). The current was limited to 50µA/strip). The strips were

removed from the focusing tray and incubated for 10min in 1ml equilibration

buffer I (50mM Tris-HCl, pH 8.8, 6M urea, 2%SDS, 30% glycerol, 1%DTT) and

then in equilibration buffer II (6M urea, 0.375M Tris-HCl, pH8.8, 2%SDS, 20%

glycerol, 2.5%w/v iodoacetamide)for 10min. The strip was placed on the top of

the second dimension gel (12.5% SDS-PAGE). A well was made next to each

strip on the top of the gel with small piece of plastic comb for the Molecular

weight marker then the strips and markers were sealed with ReadyPrep Overlay

RNAi in S2 Cells

85

Agarose (0.5% low melting point agarose in 1X Tris/Glycine/SDS and 0.003%

Bromophenol Blue). The second dimension was carried out at a constant 30mA

(Mini Protean 3, BioRad Laboratories, USA). The gels were processed for silver

staining.

4.2.11 Tryptic digestion and MALDI TOF/TOF (Speicher et al., 2000):

The acrylamide gel pieces were cut into 1 mm3 small pieces and washed with

50% acetonitrile and 50% ammonium bicarbonate. The gel pieces were

dehydrated by 100% acetonitrile and reduced by reduction solution (10mM DTT,

100mM ammonium bicarbonate) for 30 min at 56oC. Alkylation was carried out

using alkylation solution (50mM iodoacetamide, 100mM ammonium bicarbonate)

and incubated at room temperature in dark for 30 min. The gel pieces were

washed with wash solution (50% actonitrile, 50mM ammonium bicarbonate) and

dehydrated. They were further treated with 400ng of modified sequencing grade

trypsin (Promega) overnight at 37oC. Supernatant containing tryptic peptides

were collected and gel pieces were reextracted twice using extraction solution

(60% acetonitrile, 1% TFA). Pooled supernatant were dried and resuspension

solution (50% acetonitrile, 0.1% TFA) was added to it. This sample was spotted

on the MALDI plate along with equal volume of matrix.

4.2.12 Analysis of MALDI TOF/TOF data The list of peptide masses obtained from MALDI TOF/TOF was used to compare

with peptide database using online MASCOT search tool

(www.matrixscience.com). This tool gives a list of proteins from various

organisms as an output. Appropriate assignment to Drosophila melanogaster

was matched with molecular weight and pI from the respective gels before

finalizing identity of the specific polypeptide. All the samples showing sequence

coverage above 30% were chosen.

RNAi in S2 Cells

86

4.3 Results: 4.3.1 Preparation of ds RNA: PCR was carried as using the primers designed to amplify a unique region from

the center of the DAP gene. Both the primers were tagged with T7 polymerase

binding site at the 5’ end. Genomic DNA was used as the template. A PCR

product of 516bp was obtained.

Figure 4.2: PCR amplification for making the template. Using the primers tagged with T7 polymerase binding site at the 5’ end PCR was carried out to amplify the 516bp unique region in the center of DAP gene. 4.3.2 In vitro transcription: Using 516bp DNA template and in vitro transcription kit from promega RNA was

transcribed from both the strands. Both the sense and antisense RNA were

annealed by heating them at 70°C for 30 min. This double stranded RNA was

checked on the 1.5% agarose gel.

Figure 4.3: dsRNA for in vitro transcription 516bp DNA template was used for in vitro transcription. Both the sense and antisense RNA were annealed at 70°C for 30 min.

RNAi in S2 Cells

87

4.3.3 RT PCR Using equal amount of cDNA from the experimental and control cells, RT PCR

was carried out. 48hrs treatment of S2 cells with DAP dsRNA reduced the mRNA

for DAP gene upto 97.74 % as compared to the untreated cells. The mRNA

levels increased at 72hrs compared to the 48hrs treatment but were still less as

compared to the control.

Figure 4.4: RT PCR for DAP gene. After treatment of the S2 cells with dsRNA for 48 and 72 hrs mRNA was isolated and RTPCR was carried out using equal amount of cDNA from the experimental and control cells and the ds1 and ds2 primers. 97.74 % reduction in the mRNA levels was seen in case of 48hr treatment and 86.09 % reduction in case of 72hrs.

4.3.4 Proteomic analysis of effect of ds RNA on S2 cells in culture dsRNA was introduced in the Drosophila cell line and the total protein was

extracted from the 48 hr dsRNA treated cells and the control cells as described in

(Ling et al., 2006). The protein concentration was estimated by Bradford’s

method and equal amount of protein (both experimental and control) was used

for 2D gel electrophoresis. 7cm IEF strips of 3-10 range were used for focusing.

The focused strips were loaded on 12.5% SDS-PAGE. The gels were silver

stained and were analyzed by PDQuest software from BioRad. The spots

showing differences in the intensity were chosen for MALDI analysis (Fig 4.5 and

Table 4.1

RNAi in S2 Cells

88

A CONTROL

31

2

1

4

5

23

4

5pH 3 pH 10

97kDa

66kDa

43kDa

20kDa

1

23

4

5

1

2

3

4

5

B DAP RNAi

pH 3 pH 10

97kDa

66kDa

43kDa

20kDa

Figure 4.5: 2-D gels of total protein extracted from S2cells after 48 h treatment with DAP siRNA. Control, (A) or DAP dsRNA (B). Enlarged images of selected areas show differentially expressed protein spots (1–5). Spot 6 (encircled) showed similar intensities in both gels and served as a reference and was identified as HSP60.

RNAi in S2 Cells

89

Table No. 4.1 Differentially expressed proteins from DAP dsRNA treated Drosophila S2 cells identified by MALDI TOF. Sr. No.

Gene Identity

Protein Name

pI Mol.Wt (kDa)

score Percent

Down regulated from calculated fold fig mass decrease

1 Q7KF42

Forkhead box protein O

5.41

66 / 67 41 1.105

2 T47122 cell division protein pelota

5.43 41 / 44 38 1.416666667

Up regulated fold Increase

3 CG4376 Alpha-actinin, sarcomeric

5.48 50 / 107 40 1.315789474

4 AAF57565

Protein hu-li tai shao

5.97 125 / 127 40 1.4

5 CG9388

Clathrin- associated adaptor

complex AP-1 medium chain

6.70 26 / 48 41 2.285714286

Proteins identified by MALDI TOF: Exposure of S2 cells to DAP ds RNA showed changes in protein pattern. These

proteins were identified as Alpha-actinin- sarcomeric, Protein hu-li tai shao, Clathrin-

associated adaptor complex AP-1 medium chain, Forkhead box protein O and cell

division protein pelota The characteristic features of the proteins which showed altered expression have

been described:

The Drosophila Fork head (fkh) protein participates in salivary gland formation,

since salivary glands are missing in fork head mutant embryos. fork head drives

the anterior and posterior loci of invagination. From these loci are formed the

anterior midgut and posterior midgut primordia, which give rise to the endoderm.

Two roles for fkh in the formation of the embryonic salivary glands: an early role

in promoting survival of the secretory cells, and a later role in secretory cell

RNAi in S2 Cells

90

invagination, specifically in the constriction of the apical surface membrane

(Myat, 2000). fkh is a transcription factor involved in the regulation of the insulin

signaling pathway. It activates downstream and upstream targets of the pathway.

fkh is involved in negative regulation of the cell cycle, modulating cell growth and

proliferation. Foxo is activated in response to cellular stresses, such as nutrient

deprivation or increased levels of reactive oxygen species. Also regulates Lip4,

homolog of human acid lipases, thereby acting as a key modulator of lipid

metabolism by insulin signaling and integrates insulin responses to glucose and

lipid homeostasis (Carlsson and Mahlapuu, 2002).

The pelota gene of Drosophila encodes a protein that was found to be included

in cell cycle regulation. Mutations were found to result in spermatogenic arrest,

female sterility and disturbances in the patterning of the eye. It is required prior to

the first meiotic division for spindle formation and nuclear envelope breakdown

during spermatogenesis. It is also required for normal eye patterning and for

mitotic divisions in the ovary. Pelo protein is required for ovarian germ line stem

cell self-renewal. Pelo may also have ribonuclease activity. This protein is known

to interact with cg7386 which in turn interacts with ftz f2 (ttk) (Chen and

McKearin, 2003; Song et al., 2004).

Drosophila females bearing mutations in a previously undescribed gene, hu-li tai

shao [(hts) too little nursing], produced egg chambers that contained fewer than

the normal 15 nurse cells and that usually lacked an oocyte. The hts locus was

found to encode a homolog of the mammalian membrane skeletal protein

adducin. During oogenesis, hts mRNA becomes localized at the anterior of the

oocyte and subsequently is expressed in a variety of embryonic tissues. These

studies suggest that Drosophila adducin is needed to assemble actin at

specialized regions of cell-cell contact in developing egg chambers and may also

function at other times during the Drosophila life cycle (Yue et al., 1992; Ding et

al., 1993; Zaccai and Lipshitz, 1996).

RNAi in S2 Cells

91

Alpha actinins belongs to the spectrin gene superfamily which represents a

diverse group of cytoskeletal proteins, Alpha actinin is an actin-binding protein

with multiple roles in different cell types. In nonmuscle cells, the cytoskeletal

isoform is found along microfilament bundles and adherens-type junctions, where

it is involved in binding actin to the membrane. In contrast, in skeletal, cardiac,

and smooth muscle they help in anchoring the myofibrillar actin filaments. In

Drosophila, one non-muscle and two muscle-specific α-actinin isoforms are

produced by alternative splicing of a single gene. In wild-type ovaries, α-actinin is

ubiquitously expressed (Wahlström et al., 2004). In ovaries, non-muscle a-actinin

was localized in the nurse cell subcortical cytoskeleton, cytoplasmic actin cables

and ring canals. Moreover, a-actinin interacts with several signalling molecules,

suggesting an additional role as a scaffold bringing interacting proteins together

(reviewed by Otey and Carpen, 2004).

Adaptor protein complex-1 (AP-1) plays a central role in the sorting and

packaging of membrane proteins into clathrin-coated vesicles (CCVs) at the

trans-Golgi network (TGN) and endosomes (Klumperman et al., 1993; Meyer et

al., 2000). AP-1 is a heterotetrameric complex composed of 100-kD subunits, 47-

kD subunit and a 20-kD subunit.

AP complexes are important for sorting in neurons as well. A study by

Dwyer et al. (2001) found that AP-1 medium subunit μ1/unc-101 is required for

the localization of odorant receptors to the olfactory cilia in Caenorhabditis

elegans, because in the absence of UNC-101, these proteins are distributed

uniformly on the plasma membrane. A similar phenotype was observed for the

polycystin TRPP2/PKD-2, which normally localizes to the cilia of male sensory

neurons and is delocalized in unc-101 mutants (Bae et al., 2006). A recent study

showed that a disruption of another adaptor complex, AP-4, leads to the

accumulation of AMPA-type glutamate receptors in axonal autophagosomes in

mice (Matsuda et al., 2008).

RNAi in S2 Cells

92

4.4 Discussion One of the most informative experimental strategies to determine the

function of a protein is to remove it from a biological system in which it normally

functions and study the resulting effects. Over the past few years, however,

double-stranded RNA-induced gene silencing (RNAi) has emerged as a powerful

tool for the functional characterization of proteins at the cellular level. In essence,

RNAi blocks production of a specific protein and induces loss-of-function. (Fire et

al., 1998 and Elbashir et al., 2001).

double-stranded RNA interference (RNAi) was utilized to examine the effects of

reduced expression of DAP protein in Drosophila S2 cells. RNAi significantly

decreased mRNA levels in S2 cells after treatment for 48hrs. The cell number or

morphology of S2 cells however did not change. Thus inhibition of DAP by RNAi

was not lethal in S2 cells. Total protein profile of the treated and untreated cells

showed several differentially expressed proteins, out of which five were identified

by MALDI TOF TOF. Down regulated proteins include Forkhead box protein O,

cell division protein pelota, while the up-regulated were identified as Clathrin-

associated adaptor complex AP-1 medium chain, Alpha-actinin, sarcomeric and

Protein hu-li tai shao.

AP-P is known to degrade collagen (Dehm and Nordwig 1970) and actin

filaments & integrins are involved in the binding step in collagen phagocytosis by

human fibroblasts (Segal et al., 2000) thus knock down of DAP protein in S2 cells

might lead to the up regulation of the proteins like Alpha-actinin, sarcomeric and

Protein hu-li tai shao that are involved in actin binding or assembly.

Alpha-actinin, sarcomeric and Protein hu-li tai shao which are up regulated are

involved in actin binding or assembly during oogenesis. Earlier report shows that

DAP is expressed in the ovary (Kulkarni and Deobagkar, 2002). Poly U-binding

splicing factor half pint (Van Buskirk and Schuepbach, 2002 and Page-McCaw et

al, 1999) interacting with DAP protein is known to regulates oogenesis and

controls both mitosis and mRNA localization in the germline. In human, small

deletion in the XPNPEP2 gene is shown to be a major cause for premature

RNAi in S2 Cells

93

ovarian failure (POF) (Prueitt et al., 2000). Thus this strongly suggest a role of

DAP protein in the oogenesis.

Clathrin- associated adaptor complex, AP-1 which was also found to be up

regulated in response to DAP RNAi, is important in sorting the neurons and is

required for the localization of odorant receptors to the olfactory cilia in

Caenorhabditis elegans (Dwyer et al., 2001). Also DAP protein localization has

been shown in the olfaction canal of the Microhyla orneta (Bhargava et al., 2006).

60S ribosomal protein L15 (RpL15) found as DAP interacting protein in the

STRING analysis, is also reported to be associated with external compound

sense organ; wing hair and metatarsus development (Schulze et al., 2005 and

Brogna, 2002). DAP upstream DNA sequence has a motif to which snail

transcription factor can bind. This factor snail is known to take part in the sensory

organ development. Since AP-1 is upregulated by DAP, DAP along with AP-1

might have some role in olfaction or involved in olfaction signaling pathway and

may be regulated by snail in this process.

Forkhead box protein O and cell division protein pelota are known to play

a role in eye patterning and morphogenesis. Roadblock protein interacting with

DAP is also known to be involved in the eye patterning. Snail is also known to be

involved in the eye morphogenesis. DAP protein and RNA transcripts are found

in the eye-antennal disc (Figure 2.5 and Figure 2.6). Thus this indicate a

possibility of involvement of DAP protein in the eye development.

Integrin alpha-PS2 which is shown to interact with DAP protein in the

STRING analysis is known to be involved salivary gland development. Forkhead

is also involved in salivary gland formation, thus pointing towards the involvement

of DAP in the development of salivary gland.

Thus this data suggest few possible roles for DAP protein which can be

summarized as follows:

1. In the development of salivary gland

2. In the development of eyes

3. In the olfaction signaling pathway

4. In the oogenesis

General discussion

94

GENERAL DISCUSSION

Expression pattern analysis is the first step to fully understand and

characterize the gene function. From the expression pattern analysis of DAP

gene, it appears that, regardless of tissue or cell types, DAP is predominantly

detected in primordial nervous system and gut region, thus suggesting that this

gene might have different roles in different tissues.

DAP expression in the developing nervous system and the gut region

resembles with the expression pattern of many transcription factors known to be

expressed in these regions. Out these, DAP gene expression is similar to snail,

fushi tarazu, deformed, tll and caudal TFs, which are found to have binding

motifs in the DAP upstream region. These transcription factors are known to be

involved in the development of nervous system. Also, these factors are inter-

linked and known to be involved in various signaling pathways like MAPK

signaling pathway, TORSO signaling pathway, NOTCH signaling pathway and

dorsal–ventral axis formation pathway. Two of the DAP interacting proteins are

also involved in the development of nervous system. DAP protein has many

phosphorylation sites, indicating that DAP must be getting phoshorylated in the

signaling or processing pathways. Knock down of DAP protein in S2 cells led to

the up regulation of proteins like Clathrin- associated adaptor complex AP-1

medium chain, Alpha-actinin, sarcomeric and Protein hu-li tai shao and down

regulation of Forkhead box protein O and cell division protein pelota. Snail was

isolated as the DAP upstream DNA binding proteins. Also, fushi tarazu

homozygous mutants show loss of DAP staining pattern.

Many neuropeptides like neuropeptide F, tachykinin and FMRamide

peptides are known to have X-pro bond at their N-terminal, which is a crucial

requirement for the enzymatic action of aminopeptidase P. These peptides are

shown to be expressed in the brain and gut region like that of DAP protein

(Brown, 1999; Lundquist and Nassel, 1990; Nicholas et al., 1988). Thus DAP

must be playing a role in their processing.

General discussion

95

Absence of DAP protein led to the up regulation of proteins associated

with actin binding during oogenesis. The enzymatic action of APP is required in

the collagen degradation (Dehm and Nordwig, 1970). Since actin and collagen

are linked (Segal et al., 2000), actin associated proteins might be up regulated.

Also, DAP is shown to be present in the ovary (Kulkarni and Deobagkar, 2002).

Thus DAP may be involved in the actin binding or assembly during oogenesis

along with these proteins.

Cause of several neurodegenerative diseases is accumulation of

unprocessed proteins/ peptides in the normal cells. Processing of such peptides

require unique enzymes like PSA (Bhutani et al., 2007 and Stanislav et al., 2006)

and may be AP-P also in some cases. Thus, DAP expression found in the

developing nervous system supports the involvement of AP-P in such diseases.

Chromatin remodeling and histone modifications have emerged as the

main mechanisms of the control of gene expression. Histone deacetylase

complex subunit SAP30 homolog was isolated as a DAP DNA binding protein

from the embryoinic nuclear extract. Pile et al. (2003) showed that SIN3-deficient

cells generated by RNA interference led to the repression of DAP protein along

with 35 different proteins known to be involved in cell cycle regulation. Most of

the repression activity of the SIN3 complex is attributed to the histone

deacetylase activity of RPD3 (Ahringer, 2000). RPD3 mutants show impaired

function of ftz transcription factor (Mannervik and Levine, 1999). Snail also

requires histone deacetylase for its activity (Peinado et al., 2004). Thus DAP may

be involved in transcription repression.

Small deletion in the XPNPEP2 gene is major cause for premature ovarian

failure (POF) (Prueitt et al., 2000). DAP expression in the ovary, involvement of

its interacting proteins in oogenesis and up regulation of proteins associated with

actin binding during oogenesis when DAP is knocked down, strongly suggest a

role of DAP protein in the oogenesis.

Tissue-specific endothelial molecules to which phage peptides home (in a

phage display) may serve as receptors for metastasizing malignant cells.

(Ruoslahti and Rajotte 2000). Membrane APP was identified as its receptors.

General discussion

96

Snail transcription factor found to have a binding sequence in the DAP upstream

DNA and also isolated as a DAP upstream DNA binding protein is known to be

associated with tumorigenesis. Snail seems to be a key regulator involved in the

suppression of E-cadherin in carcinoma (Batlle et al., 2000; Comijn et al., 2001;

Nieto, 2002). Snail requires histone deacetylase (HDAC) activity to repress E-

cadherin (Peinado et al., 2004). Thus DAP protein may have a role in cancer as

well.

Aminopeptidase P is an enzyme which cleaves the N-terminal bond when

proline is the penultimate amino acid. Other than the enzymatic activity, this

protein is known to have different physiological roles like collagen degradation,

kinin degradation and processing of the neurotransmittors and neuromodulators.

In addition to the embryonic stages, the imaginal disc tissue which leads to the

formation of adult structure also showed expression of DAP in selected areas

and cells which correspond to the adult sensory system on differentiation. Thus

association between DAP and the nervous system seems as an important

feature.

Figure 4.6: DAP upstream and down stream proteins: showing its possible functions.

Summary

97

SUMMARY

DAP protein and transcripts are distributed ubiquitously in the initial

stages. Later, they become more specific in the developing nervous system and

the mesodermal region. Expression is seen in the cells of developing

stomatogastric nervous system, midgut, in the procephalic lobe, mandibular and

maxillary buds, developing brain and gut region. It is seen in the wing pouch and

ventral hinge of the wing imaginal disc, in the ocelli & frons of the eye portion and

in the A1 & A2 lobes of the antennal portion of the eye-antennal imaginal discs.

Dap is also detected in the coxa region of the leg imaginal disc. DAP upstream

DNA containing LacZ / GFP reporter gene construct was used to make a

transgenic fly. LacZ expression pattern in these transgenic flies mimic the DAP

expression pattern suggesting that this upstream sequence contains the

regulating elements or the enhancer required for its regulation. Bioinformatics

analysis of DAP upstream shows that it has about 22 sequence motifs to which

transcription factors can bind. Out of these, sna, dfd, tll and cad bind with a high

affinity and there are four motifs in this region to which ftz can bind. Also, ftz

homozygous mutants show loss of DAP staining pattern. RNAi for DAP shows

that actin binding proteins like Alpha-actinin, sarcomeric and Protein hu-li tai

shao are up regulated and Forkhead box protein O, cell division protein pelota

are down regulated. Snail was the common transcription factor eluted from the

DNA cellulose column chromatography. Taking together these entire

observations, possible role for the DAP protein might be in the development of

nervous system by either processing the neuropeptides or signaling molecules,

which may be regulated by the TFs like snail and fushi tarazu. These finding may

give an idea of a possible role for this clinically and industrially important enzyme.

Further confirmation of this role in nervous system development might be useful

in considering AP-P as a drug target in many neurodegenerative diseases.

Thus Drosophila aminopeptidase P a developmental protein, through its enzymatic action, may be involved in differentiation and morphogenesis in embryonic stages and imaginal discs as well.