rights / license: research collection in copyright - non ...48077/et… · prof. dr. m. zinn,...
TRANSCRIPT
Research Collection
Doctoral Thesis
Biosynthesis of polyhydroxyalkanoates (PHAs) from low-costgrowth carbon substrates in recombinant bacterial strains
Author(s): Le Meur, Sylvaine G.A.
Publication Date: 2015
Permanent Link: https://doi.org/10.3929/ethz-a-010515010
Rights / License: In Copyright - Non-Commercial Use Permitted
This page was generated automatically upon download from the ETH Zurich Research Collection. For moreinformation please consult the Terms of use.
ETH Library
Diss. ETH No. 22715
Biosynthesis of polyhydroxyalkanoates (PHAs) from
low-cost growth carbon substrates in recombinant
bacterial strains
A thesis submitted to attain the degree of
DOCTOR OF SCIENCES OF ETH ZURICH
(Dr. sc. ETH Zurich)
presented by
SYLVAINE GISELE AURELIE LE MEUR
M. sc. Biotechnology, University of La Rochelle (FR)
Born on 24.02.1984
Citizen of France
Accepted on recommendation of
Prof. Dr. M. Ackermann, examiner
Prof. Dr. T. Egli, examiner
Prof. Dr. M. Zinn, co-examiner
Prof. Dr. S. Panke, co-examiner
Dr. Q. Ren, co-examiner
2015
1
Acknowledgements
First of all, I am extremely grateful to my direct supervisor, Dr. Qun Ren for choosing me as
PhD student for this project and for always being there for me. Qun was a fabulous advisor:
insight, sharp, indulgent and involved. She gave me the confidence to explore my research
interests and the guidance to avoid getting lost in my exploration. Thanks to Qun for her
encouragement, support and continuous optimism and for generally being a great person with
whom working was great. She is an inspiration.
I would like to take this opportunity to thank Prof. Dr. Thomas Egli for giving me the
opportunity to perform this PhD work under his supervision and for his very helpful comments
and suggestions. I am very fortunate to have had co-supervisor Prof. Dr. Manfred Zinn with his
brilliant ideas, advices and support. I am grateful to Prof. Dr. Linda Thöny-Meyer to accept me
in her laboratory and for her interest in my doctoral researches. I thank Prof. Dr. Sven Panke
and Prof. Dr. Martin Ackermann greatly for their agreement to be my external examiner and
my new supervisor, respectively.
I express my warm gratitude to Dr. Stéphanie Follonier for her support at several points
throughout my doctoral studies, for proofreading some parts of this thesis and for giving me
great technical advices.
Life would not have been so nice without the good friends I met at EMPA. I would like to
extend my thanks to the whole Laboratory especially Jasmin, Nicolas, Pantelis, Melisa,
Bernhard, Steffi, Maite, Sabrina and the people from other Labs: Agathe, Marek, Andrej,
Joanna and Ana-Maria. I thank also my French friends, especially, Léna and Annaïk for her
support and optimism.
2
I also would like to thank my parents: Mireille and Jean-Charles Le Meur, who through my
childhood and study career had always encouraged me to follow my scientific interest.
My deepest thanks go to my husband, Julien, for his patience during my writing of this
dissertation, and for always supporting me during these PhD years when we were far away from
each other and now for the wonderful life that we share together with our 6-month-old son,
Ewen.
The presented work was carried out at EMPA St. Gallen and financed by the Swiss National
Science Foundation (SNSF).
3
Table of Contents
Acknowledgements ................................................................................................................... 1
Abbreviations ............................................................................................................................ 5
Summary ................................................................................................................................... 7
Résumé .................................................................................................................................... 11
General introduction .............................................................................................................. 15
Background .......................................................................................................................... 16
History of polyhydroxyalkanoates (PHAs) ........................................................................... 21
Diversity and chemical structure of PHAs ........................................................................... 22
Properties of PHAs ............................................................................................................... 25
Biochemical synthesis of PHAs ............................................................................................ 28
Reducing costs of PHA production ...................................................................................... 35
PHA applications ................................................................................................................. 42
Aim and scope of this thesis ................................................................................................. 44
Production of medium-chain-length polyhydroxyalkanoates by sequential feeding xylose
and octanoic acid in engineered Pseudomonas putida KT2440 .......................................... 47
Abstract ................................................................................................................................ 48
Background .......................................................................................................................... 49
Methods ................................................................................................................................ 51
Results .................................................................................................................................. 58
Discussion ............................................................................................................................ 67
Conclusions .......................................................................................................................... 71
Construction and expression of recombinant plasmids encoding for orfZ and phaC genes
into an inducible vector .......................................................................................................... 73
Abstract ................................................................................................................................ 74
Introduction .......................................................................................................................... 74
Materials and methods ......................................................................................................... 77
Results .................................................................................................................................. 81
Conclusions .......................................................................................................................... 91
Poly(4-hydroxybutyrate) (P4HB) production in recombinant Escherichia coli: P4HB
synthesis is uncoupled with cell growth ................................................................................ 93
Abstract ................................................................................................................................ 94
Background .......................................................................................................................... 95
Methods ................................................................................................................................ 98
Results ................................................................................................................................ 102
4
Discussion .......................................................................................................................... 113
Conclusions ........................................................................................................................ 116
Improved productivity of poly(4-hydroxybutyrate) (P4HB) in recombinant Escherichia
coli using glycerol as the growth substrate with fed-batch culture ................................. 119
Abstract .............................................................................................................................. 120
Background ........................................................................................................................ 121
Methods .............................................................................................................................. 123
Results and Discussion ....................................................................................................... 130
Conclusions ........................................................................................................................ 145
The effect of molecular weight on the material properties of biosynthesized poly(4-
hydroxybutyrate) .................................................................................................................. 147
Abstract .............................................................................................................................. 148
Introduction ........................................................................................................................ 148
Experimental ...................................................................................................................... 150
Results and discussion ........................................................................................................ 153
Conclusions ........................................................................................................................ 162
General discussion ................................................................................................................ 163
Overview of the main research topics of this thesis ........................................................... 164
Mcl-PHAs from xylose ....................................................................................................... 165
Bioprocess optimization approaches ................................................................................. 168
Potential strategies to further optimize P4HB production ................................................. 170
Conclusions ........................................................................................................................ 173
References ............................................................................................................................. 175
Curriculum vitae ........................................................................ Error! Bookmark not defined.
5
Abbreviations
Abbreviations Names Units
PHAs: Polyhydroxyalkanoates
scl-PHAs: Short-chain-length PHAs
mcl-PHAs: Medium-chain-length PHAs
P3HB: Poly(3-hydroxybutyrate)
P4HB: Poly(4-hydroxybutyrate)
P3HV: Poly(3-hydroxyvalerate)
P3HH: Poly(3-hydroxyhexanoate)
P3HP: Poly( 3-hydroxyheptanoate)
P3HO: Poly(3-hydroxyoctanoate)
RHA-CoA: (R)-hydroxyacyl-coenzyme A
PLA: Polylactic acid
PCL: Polycaprolactone
PEA: Polyesteramide
PBSA: Polybutylene succinate-co-adipate
PBAT: Polybutyrate adipate terephthalate
GRP: Glycerol-rich-phase
Na-4HB: Sodium 4-hydroxybutyrate
NH4OH: Ammonium hydroxide
H2SO4: Sulfuric acid
CDW: Cell dry weight (biomass) g L-1
Y P4HB/Na-4HB: Production yield of P4HB from Na-4HB g g-1
F0: Initial substrate feeding/ flow rate g L-1 h-1
F: Substrate feeding/flow rate g L-1 h-1
µ: Specific growth rate h-1
µmax: Maximum specific growth rate h-1
s0: Initial substrate concentration in batch g L-1
s: Actual l substrate concentration g L-1
YX/S: Growth yield for the limiting substrate g g-1
qs: Specific substrate consumption rate g g-1 h-1
x0: Initial actual biomass concentration g L-1
V0: Initial volume of the culture L
x: Actual biomass concentration g L-1
V: Actual volume of the culture L
6
Summary
7
Summary
Owing to the involved volume and the environmental impact of petroleum-based
plastics, the development of biodegradable ecofriendly plastics from renewable sources
becomes a crucial global issue with time.
To compete with conventional synthetic plastics, biodegradable and bio-based plastic
materials should mimic the desired physical and chemical properties of their chemical
homologues. Polyhydroxyalkanoates (PHAs) offer a promising alternative because they
possess similar properties to current synthetic thermoplastics and elastomers. Furthermore,
PHAs are completely degraded by microorganisms under both aerobic and anaerobic conditions
upon disposal. These natural polyesters are produced by a number of bacteria as intracellular
storage materials of carbon and energy, under nutrient limiting conditions and carbon in excess.
Given that the price of carbon source represents about 50% of the total PHA production cost,
the development of strains and fermentation processes allowing to produce PHAs from a cheap
carbon source is necessary to compete with chemically synthesized plastics.
The aim of this doctoral thesis is to use inexpensive carbon sources to produce high
added-value PHAs such as medium-chain-length (mcl-PHAs) or poly(4-hydroxybutyrate)
(P4HB). Various investigations were performed in bioreactors using recombinant strains of
Pseudomonas putida or Escherichia coli, in defined media with low-cost growth carbon
substrates such as xylose, a hemicellulose derivative or glycerol, a waste byproduct from the
biodiesel industry.
Utilization of xylose was investigated for mcl-PHA production and is described in
chapter 2. A mcl-PHA producing strain, P. putida KT2440, was used as the host to express
genes from E. coli W3110 encoding xylose isomerase (XylA) and xylulokinase (XylB). These
Summary
8
genes gave the recombinant P. putida KT2440 (pSLM1) the ability to grow on xylose. The cells
reached a maximum specific growth rate of 0.24 h-1 and a maximal yield of 0.41 g cell dry
weight per g xylose. Since biosynthesis of mcl-PHAs from only xylose was not possible,
sequential feeding strategy was applied using xylose and octanoic acid, leading to tailor-made
PHAs. Biopolymer content up to 20% w w-1 of mcl-PHAs was achieved with a yield of 0.4 g
mcl-PHA per g octanoic acid. For the first time, a process using xylose as growth carbon
substrate and fatty acids as polymer precursor for the accumulation of tailor-made PHAs is
reported here.
Utilization of xylose was investigated to produce P4HB, another type of high added-value PHA
with high potential in medical applications. In chapter 3 different plasmid constructs
containing genes for biosynthesis of P4HB were introduced into recombinant E. coli and their
effect on plastic production was studied. pKSSE5.3 plasmid harboring a PHA synthase gene
(phaC) from Ralstonia eutropha and a 4-hydroxybutyric acid-coenzyme A transferase gene
(orfZ) from Clostridium kluyveri gives the ability to recombinant E. coli to convert 4-
hydroxybutyric acid to P4HB when the precursor is supplemented in the medium broth. Three
different plasmids containing phaC and orfZ genes with or without their respective promoters
(i.e. inducible or not) were constructed through classical DNA manipulation. P4HB
accumulation was investigated in various batch studies; however, low P4HB accumulation was
observed in all tested strains.
In chapter 4, six different E. coli strains were transformed with plasmid pKSSE5.3
carrying phaC and orfZ. P4HB accumulation and cell growth were compared to identify the
best E. coli recombinant. The impact of various cultivation parameters and physiological stage
at which Na-4HB precursor should be added was investigated. For the first time, P4HB
biosynthesis was revealed to be separated from the growth of E. coli JM109 (pKSSE5.3) and
Summary
9
to mainly take place after the end of the exponential growth phase. P4HB production by simple
batch culture using xylose and Na-4HB was achieved with a high conversion yield of 92% g g
-1 based on carbon.
In chapter 5, the impact of N, C, Mg and amino acid limitation, as well as the utilization of
acetate as a stimulator to enhance the P4HB accumulation, was studied in recombinant E. coli
JM109 (pKSSE5.3). Efficient P4HB accumulation stimulated by amino acid limitation (NZ-
amines) and by addition of acetic acid was obtained when glycerol was used as the carbon
source for growth. High cell density cultures using glycerol with various feeding modes were
performed. A fed-batch with an exponential feeding regime gave the highest productivity for
P4HB reported so far.
P4HBs with different molecular weight were characterized with respect to their material
properties in chapter 6. Acid-catalyzed hydrolysis allowed the preparation of P4HBs with
tunable molecular weight, which leads to different thermal and mechanical properties. A
decrease in the molecular weight led to an increase in the degree of crystallinity of the polymer.
It was also found that the molecular weight, rather than the degree of crystallinity, played role
in the tensile mechanical properties. The developed method allows the preparation of polymer
fractions for biomedical applications with easier processability and still adequate thermal and
mechanical properties. In chapter 7, various options for further research are discussed which
would allow sustainable PHA production.
Results of this doctoral thesis demonstrate that PHAs as a high value added product can be
efficiently biosynthesized from inexpensive carbon sources using optimized strains and
fermentation conditions. These biotechnological explorations will lead to new prospects for
industrial production of PHAs.
10
Résumé
11
Résumé
Le développement de plastiques biodégradables provenant de matières premières
renouvelables « bio-sourcés » devient un enjeu planétaire majeur au vu de l’accroissement des
volumes et de l’impact environnemental des plastiques issus de la pétrochimie. Afin de rivaliser
et remplacer, à terme, ces plastiques conventionnels, les nouveaux matériaux plastiques
biodégradables et bio-sourcés devront conserver des propriétés rhéologiques similaires à leurs
homologues chimiques. Les polyhydroxyalcanoates (PHAs) offrent une alternative prometteuse
aux plastiques conventionnels car ils possèdent des propriétés rhéologiques similaires aux
thermoplastiques et élastomères actuels. De plus, ils peuvent être totalement dégradés par les
microorganismes en conditions aérobies ou anaérobies. Autre aspect prometteur, les PHAs sont
biocompatibles et extrêmement bien tolérés in vivo, ce qui ouvre la voie à de nombreuses
applications médicales.
Ces biopolyesters naturels sont produit par de nombreuses bactéries, comme matériel de
réserve intracellulaire, offrant ainsi une source de carbone et d’énergie lors de conditions
déficitaires en nutriments et d’un excès de source carbonée. Leurs biosynthèses s’effectuent
lors d’une limitation en azote, en phosphate ou en oxygène et lorsque d’un excédent de source
carbonée est encore présent dans le milieu de culture. Mais pour s’imposer comme alternative
durable aux plastiques conventionnels, il convient également de minimiser le coût de
production des PHAs et notamment celui du substrat carboné qui représente 50% du coût de
production total. Pour ce faire, il convient de développer et d’optimiser des souches
bactériennes et des procédés de fermentation en utilisant un substrat carboné bon marché. Le
but de cette thèse de doctorat est donc d’utiliser une source de carbone peu onéreuse pour
produire des PHAs de haute valeur-ajoutée, tels que les PHAs à moyenne longueur de chaine
carbonée (mcl-PHAs) et les Poly(4-hydroxybutyrate) (P4HB). Dans cet objectif, diverses
Résumé
12
investigations ont été réalisées en bioréacteurs en utilisant des souches recombinantes de
Pseudomonas putida ou d’Escherichia coli dans un milieu de culture défini, contenant un
substrat de croissance carboné peu couteux : le xylose, un dérivé d’hémicellulose, ou le
glycérol, un sous-produit inutilisé issue de l’industrie du biodiesel.
Le chapitre 2 de cette thèse décrit l’utilisation de xylose comme substrat carboné lors
de la production de mcl-PHAs. P. putida KT2440, une souche bactérienne naturellement
productrice de mcl-PHA, ne possédant pas le métabolisme nécessaire à la dégradation de
xylose, fut utilisée comme hôte pour exprimer les gènes d’E. coli W3110 encodant pour les
enzymes xylose isomerase (XylA) et xylulokinase (XylB). Ces gènes ont permis à la souche
recombinante de cataboliser le xylose présent dans le milieu de culture.
Les cellules bactériennes recombinées ont atteint un taux de croissance spécifique de
0.24 h-1 et un rendement maximal de 0.41 g (CDW) g-1 sur xylose. La biosynthèse de mcl-PHAs
n’a pas été constatée lorsque le xylose était l’unique source de carbone. Pour y remédier, une
stratégie d’alimentation séquencée a été employée en utilisant du xylose et un acide gras, l’acide
octanoïque, permettant la biosynthèse d’un PHA « sur-mesure ». Une accumulation jusqu’à
20% w w-1 de mcl-PHAs a été atteinte avec un rendement 0.4 g de mcl-PHA par g d’acide
octanoïque. Pour la première fois dans un travail de recherche, un bioprocédé permettant
l’accumulation de mcl-PHAs spécifiques utilisant le xylose comme substrat de croissance et de
l’acide octanoïque comme précurseur de la biosynthèse de polymère est présenté.
Dans le chapitre 3, l’utilisation de xylose comme substrat a également été étudié pour
produire un autre type de PHAs à haute valeur ajoutée: le P4HB. Ce polyester biocompatible et
biodégradable possède un haut potentiel dans le domaine biomédical puisqu’il est d’ores et déjà
autorisé comme suture résorbable par la « U.S. Food and Drug Administration » (FDA). Le
Résumé
13
plasmide pKSSE5.3 portant le gène de PHA synthase (phaC) de Ralstonia eutropha et le gène
de 4-acide hydroxybutyrique -coenzyme A transferase (orfZ) de Clostridium kluyveri permet à
la souche recombinante d’E. coli de convertir l’acide 4-hydroxybutyrique en P4HB lorsque le
précurseur est ajouté dans le milieu de culture. L’induction de ces gènes de biosynthèse du
P4HB a été étudiée à travers différentes constructions génétiques. Trois plasmides contenant
les gènes phaC et orfZ avec ou sans leurs promoteurs respectifs ont été transformés dans une
souche recombinante d’E. coli BL21 (DE3). De nombreuses études de croissances ont été
réalisées et l’accumulation du biopolymère après induction a été analysée.
Dans le chapitre 4, différentes souches d’E. coli ont été transformées avec le même
plasmide pKSSE5.3. L’accumulation de biopolymère et les croissances cellulaires ont été
comparées pour identifier la meilleure souche recombinante d’E. coli. L’impact de plusieurs
paramètres de cultures et l’état physiologique lors de l’ajout du précurseur a été examiné. Il a
été démontré pour la première fois que la biosynthèse de P4HB est séparée de la phase de la
croissance d’E. coli JM109 (pKSSE5.3) et s’effectue principalement pendant la fin de la
croissance exponentielle. La production de P4HB par une simple culture en batch en utilisant
du xylose et du Na-4HB a été obtenue avec un haut rendement de conversion de 92% g g-1.
Le chapitre 5 vise à optimiser la production de P4HB, par la souche recombinante E.
coli JM109 (pKSSE5.3), en étudiant l’impact de différentes limitations nutritionnelles et
l’utilisation d’acétate comme stimulateur de biosynthèse de P4HB. L’accumulation de P4HB a
été stimulée par la limitation en acides aminées (NZ-amines) et par l’addition d’acide acétique
lors de cultures sur glycérol. Des cultures à haute densité cellulaire ont été réalisées avec du
glycérol comme source carbonée de croissance. Un procédé de « Fed-Batch » avec une
alimentation microbienne exponentielle a permis d’aboutir à la plus haute productivité de P4HB
publiée à ce jour.
Résumé
14
Les propriétés rhéologiques du P4HB à faible poids moléculaire ont été étudiées dans le
chapitre 6. Des échantillons contenant un polymère à faible poids moléculaire ont été réalisés
par une méthode d’hydrolyse catalysée par de l’acide, décrite dans cette thèse. Cette méthode a
permis l’obtention d’un polymère facilement transformable et possédant des caractéristiques
mécaniques adéquates pour de futures applications médicales.
Diverses perspectives de recherches ont été discutées dans le chapitre 7, pour améliorer
la production de P4HB dans une optique de développement durable. Les résultats de cette thèse
de doctorat démontrent que des biopolymères tel que les PHAs peuvent être synthétisés à
moindre coût en utilisant des substrats carbonés peu onéreux combinés à des procédés de
fermentations optimaux. Ces avancées biotechnologiques apportent de nouvelles perceptives
industrielles dans le domaine de la production de PHAs.
Chapter 1
General introduction
Chapter 1 : General introduction
16
Background
Terminology of polymeric materials
To avoid misunderstandings, the terms plastic, polymer and biopolymer must be defined.
Plastic is a generic term used for polymeric materials and it is defined, according to the
American Chemistry Council, as a “synthetic or semi-synthetic man-made organic polymer,
capable of being molded, extruded, cast into various shapes and films, or drawn into filaments.
Plastics are typically of high molecular mass, and most commonly derived from
petrochemicals” [1]. According to the American Chemistry Council (ACC), polymer is defined
as a “chemical made of many repeating units” [1], and according to the International Union of
Pure and Applied Chemistry (IUPAC), a biopolymer is a “polymer which is produced by living
organisms” [2].
From petroleum-based plastic to bio-based plastic
Despite the numerous possible applications, production and use of plastics become increasingly
problematic. The most conventional types of plastics are petroleum-based plastics, which
means they are manufactured from fossil fuels, like polyethylene terephthalate (PET),
polyethylene (PE) and polypropylene (PP). The conventional petroleum-based plastics are
currently faced with two critical main issues: i) fossil resources will become scarce in the world,
which will increases the oil price; and ii) most of these petroleum-based plastics are non-
biodegradable and accumulate in the environment creating a huge pollution over time (Fig. 1.1).
Resource depletion may become a determining factor in future plastic production, but for a
numbers of raisons the exact time point is difficult to predict. For example, the total extent of
estimated fuel reserves is still uncertain, new extraction technics are being developed and
economical and political obstacles influence this process. Furthermore, since the 1950s when
Chapter 1 : General introduction
17
the massive plastic production started, plastic debris have accumulated in the environment
causing severe pollution and threat to the wildlife on land as well as in the Sea (Fig. 1.1).
Figure 1.1: On the left, plastic pollution on beaches of Hong Kong in July 2012 [3], on the right,
a marine turtle eating plastic in Florida [4].
The longevity of conventional plastic is estimated to be hundreds to thousands of years, but it
seems to be even longer in the Deep Sea [5]. Conventional petrochemically produced plastics
accumulate in Nature leading to a pollution of 165 million tons of plastics in the world's oceans
[6]. This pollution calls for the development of biodegradable substitutes.
To minimize plastic pollution, recycling would be an option but presently this seems to be
unrealistic because the plastic waste is too disseminated, the people’s involvement is too weak
and the recycling profit is too low. The development of “green materials” from renewable
resources is an attractive option. Bio-based polymers are considered to be ecofriendly versions
for replacing petroleum-based plastics. They could decrease the long-term pollution and our
dependency on fossil fuel thereby adding to global sustainability. Bio-based polymers represent
an appropriate answer to the conventional plastics issues because they are renewable, most of
them are biodegradable and some of them have very similar properties as conventional
petroleum-based polymers.
Chapter 1 : General introduction
18
Global problem of plastic waste
The worldwide conventional plastic production increased from 1.5 million of tons per year in
the 1950’s to 245 million in 2008 [7]. It is predicted that this output could triple by 2050 [7]. In
2008 around 25 million tons of plastic waste was generated in European Union (EU) and only
5.3 million tons were recycled [7]. Currently, burying in landfills and burning are the
predominant waste treatment practices applied to plastics. The trends of plastic waste
generation observed in the EU will probably be more pronounced in fast growing countries like
India, China, Brazil and Indonesia as well in developing countries [8]. Plastic waste is an
international problem which that needs concrete action as mentioned in the Rio+20 United
Nation Conference on Sustainable Development in June 2012. One of the solutions for this
problem can be the development of innovative materials that possess similar properties to
conventional plastics but which are environmentally friendly.
Market projections for bio-plastics
The biodegradable polymer market increased in the last years and reached 10% of the total
market in Europe in 2009. Europe is responsible for half of the global bio-plastic consumption
[9]. According to recent reports from “European Bioplastics” [8], a strong growth of bio-based
polymers is predicted for the near future. This source forecasted that global bio-plastic
production would increase from 1.2 million of tons in 2011 to 5.8 million tons in 2016 which
would represent a five-fold increase over 5 years. By 2016, polylactic acid (PLA) and
polyhydroxyalkanoate (PHA) based materials are predicted to contribute to this growth with an
expected annual production of 298,000 tons and 142,000 tons, respectively. However, PLAs
and PHAs will have to share this market with bio-based PET synthesized from ethanol produced
from sugar cane (but chemically polymerized) with 250,000 tons [8]. According to a European
Chapter 1 : General introduction
19
Commission study in 2005 [10], the maximal substitution of conventional plastic by bio-plastic
is estimated to be around 33% of the total actual production by 2020.
One of the most critical obstacles to enter the global market is the production cost of bio-
plastics. In 2006, biopolymers were on average 1.5 to 4 times more expensive than conventional
plastics [11], but in 2010, P3HB known as MirelTM was commercialized at 1.50€ kg-1 [12]. At
this price, P3HB can compete with most of the produced petroleum-based plastics [12]. But
assuming that petroleum prices will continuously increase and that research on bio-based
plastics will contribute to reducing production cost, the bioplastics can be expected to become
more and more competitive.
Commercially available bio-plastics
Currently, different kinds of bio-based plastics are available. These polymers are defined as
“bio-based” when they are manufactured from a renewable carbon source such as cellulose,
vegetable fats, corn starch, pea starch or organic waste (Table 1.1). However, on the one hand
not all bio-based plastics are biodegradable (and on the other hand some petroleum-based
plastics can be biodegradable). Table 1.1 shows different possible combinations. As defined
later on, plastics are biodegradable when they can be decomposed to CO2 and biomass by
bacteria or others microorganisms in a favorable environment.
Chapter 1 : General introduction
20
Table 1.1: Examples of bio-plastics in the notion of biodegradability and bio-based materials.
(Based on [13]).
Substrate source Biodegradability Example
Renewable Biodegradable Polyhydroxyalkanoates (PHAs); polylactic acids
(PLAs); starch
Non-Renewable Biodegradable Polycaprolactone (aliphatic polyester )
Renewable Non-Biodegradable Vegetable-based polyethylene
Non-Renewable Non-Biodegradable Polyether etherketone (PEEK, biocompatible)
Classification of biodegradable polymers
Biodegradable polymers can be classified into two groups [14].
Figure 1.2: Classification of biodegradable polymers according to their monomer sources
(adapted from [14]).
The first group represents polymers extracted directly from agricultural resources (Fig. 1.2). In
this group, we can find polysaccharides, ligno-cellulosic products, and proteins. The second
group contains three categories of polymers (Fig. 1.2). First, polymers from bacterial
fermentations such as polyhydroxyalkanoates (PHAs), second, polymers resulting from
chemical polymerization using monomers from biomass such as polylactic acids (PLAs), and
third, polymers made of fossil resources, meaning they are not bio-based but still biodegradable.
Biodegradable
polymers
Biodegradable
polymers
Agropolymers Biopolymers
Polymers from
bacterial
fermentation
Polymers from
biotechnology
Polymers from
petrochemical
resources
Chapter 1 : General introduction
21
This last group includes polycaprolactones (PCL), polyesteramides (PEA) and other aliphatics
or aromatic copolyesters such as polybutylene succinate-co-adipate (PBSA) and polybutyrate
adipate terephthalate (PBAT).
The advantage of renewable and biodegradable bioplastics is to reduce the global amount of
persisting waste materials. They also allow to save fossil resources and to decrease our
dependence on petroleum. According to the advantages presented for bio-plastics, PHA
represents a promising candidate. However, the main problem that limits the utilization and the
development of PHAs is presently the production cost.
History of polyhydroxyalkanoates (PHAs)
In 1926, the French scientist Maurice Lemoigne at the Pasteur Institute observed P3HB granules
under the microscope in cells of Bacillus megaterium. After isolation, he found that the granules
to consist of poly(3-hydroxybutyrate) (P3HB); this was the first discovered member of PHA
family [15].
In 1958, a functional role of P3HB was proposed by Macrae and Wilkinson as they observed
that in carbon and energy limiting medium, the granules were degraded, which suggested that
the component acted as an intracellular reserve material [16]. The first heteropolymeric chain
of PHAs was described in 1974; it was assembled of 3-hydroxyvaleric acid (3HV) and 3-
hydroxybutyric acid (3HB) as the major components, 3-hydroxyhexanoic acid (3HH) and
probably also 3-hydroxyheptanoic acid (3HP). It was isolated from activated sludge and its
physical and chemical properties were similar to that of P3HB [17]. After the oil crisis in 1973,
interest for such storage components increased and they were assumed to become the future of
polymer industry because they have similar physical properties as conventional plastics. In
addition, they exhibit other features like biodegradability, biocompatibility and piezoelectric
Chapter 1 : General introduction
22
properties, but also the potential to serve as a source of optically active molecules kept the
interest growing even after the end of the oil crisis [18].
A wide range of microorganisms, including Gram-negative and Gram-positive bacteria, is able
to accumulate various kinds of PHAs as intracellular carbon and energy reserve material. PHAs
are even synthesized in photosynthetic bacteria under aerobic (cyanobacteria) and anaerobic
(non-sulfur and sulfur purple bacteria) conditions, as well as in some archaebacteria [19]. Also
recombinant Escherichia coli is able to accumulate PHA in its cytoplasm as shown in the
fluorescence microscopy picture below (Fig. 1.3). Since Lemoigne’s discovery, 125 different
hydroxyalkanoic acids (HA) were identified [20, 21].
Figure 1.3: Recombinant E. coli JM109 (pKSSE5.3) cells accumulating PHAs as granules in
their cytoplasm. PHA granules are visible as fluorescent bright spots after staining with Nile
red. The bar scale corresponds to 10 µm. (Picture S. Le Meur)
Diversity and chemical structure of PHAs
PHAs are polyesters consisting of hydroxyalkanoic acids that are linked through ester bonds
between the hydroxyl group and the carboxylic group of the next monomer (Fig. 1.4). Up to
now, in all described PHAs, the carbon atom of the hydroxyl group is in R configuration, except
for P4HB which has no chirality. In the P4HB polymer, the monomer units are linked between
PHA granule
Cell wall of bacteria 10 µm
Chapter 1 : General introduction
23
the 4-hydroxyl group and the next carboxylic group. In contrast to P4HB, most of the PHA
polymers have the alkyl group in beta position, which can range from a methyl (C1) to a
pentadecanoyl (C15) residue.
m=1
PHA-scl
R=H Poly(3-hydroxypropionate) P3HP
R=CH3 Poly(3-hydroxybutyrate) P3HB
R=C2H5 Poly(3-hydroxyvalerate) P3HV
PHA-mcl
R=C3H7 Poly(3-hydroxyhexanoate) P3HHx
R=C5H11 Poly(3-hydroxyoctanoate) P3HO
R=C7H15 Poly(3-hydroxydecanoate) P3HD
PHA-lcl R=C11H23 Poly(3-hydroxytetradecanoate) P3HTD
R=C15H31 Poly(3-hydroxyoctadecanoate) P3HOD
m=2 PHA-scl R=H Poly(4-hydroxybutyrate) P4HB
Figure 1.4: General chemical structure of polyhydroxyalkanoates. m = 1, 2, 3 but m = 1 is most
common, n can range from 100 to several thousands. R is variable as shown in the examples.
Based on the chain length of the fatty acid monomers, PHAs can be classified into three
categories: short-chain-length (scl) PHAs with 3 to 5 carbon atoms, medium-chain-length (mcl)
PHAs with 6 to 14 carbon atoms, and long-chain-length (lcl) PHAs with more than 14 carbon
atoms [22] (Fig. 1.4).
In most cases, the structural composition of PHA polymers varies as function of the skeleton of
the carbon compound supplied as the growth substrate and the bacterial strain used [23]. The
side chain can be saturated or not, and can possess branched, aromatic, halogenated, and even
Chapter 1 : General introduction
24
epoxidized monomers (Fig. 1.5). Functionalized side-chains containing for example a bromine
or aromatic group, have been found in PHA polymer produced by Pseudomonas putida [24,
25] (Fig. 1.5). As another example, a carbon source containing the functional group 6-para-
methylphenoxyhexanoic acid led to the production of PHA containing the corresponding 3-
hydroxy aromatic acid [26].
Figure 1.5: Examples of various monomers units present in mcl-PHAs accumulated in P.
putida.
As additional option, chemical modifications can be used to introduce the desired functional
group into PHAs [27]. Various hydroxyalkanoate monomers with functional groups have been
described leading to many possible chemical modifications of natural PHAs [28]. The
difference in length and/or chemical structure of the alkyl side chain of the PHAs influences
the material properties of the polymers to a great extent [29].
3-(R)-
hydroxyoctanoate
3-(R)-
hydroxy-7-
octenoate
3-(R)-
hydroxy-6-
methyl-
octanoate
3-(R)-
hydroxy-5-
phenyl-
valerate
3-(R)-
hydroxy-6-
bromo-
hexanoate
Chapter 1 : General introduction
25
Properties of PHAs
Biodegradability
A polymer is classified by ISO norm as biodegradable when “the breakdown by
microorganisms in the presence of oxygen leads to carbon dioxide, water and mineral salts of
any other elements present and new biomass” [30, 31]. As mentioned above, PHAs have the
advantage of being completely biodegradable [32]. The degradation rate depends on many
factors. First, it is related to the physical properties of the polymer itself, in particular to its
surface area, its molecular weight, its monomeric composition, and its crystallinity. Second, it
depends on environmental conditions such as temperature, moisture level, pH and available
nutrients [33-35]. In nature, specialized microorganisms are able to degrade PHA using secreted
PHA depolymerase [36].
Biocompatibility
Polymers must be biocompatible to be used as medical materials, i.e. they must not cause severe
immune reactions when introduced to soft tissues or blood of a host organism. Recently, PHAs
have attracted much attention due to their many different potential applications in the medical
field [37]. For example, P4HB and P3HB are biocompatible and extremely well tolerated in
vivo given that their hydrolysis yields 4-hydroxybutyric acid (4HB) and 3-hydroxybutyric acid
(3HB), respectively, which are common metabolites occurring naturally in the human body and
suggests nontoxicity of implanted biopolymers [38, 39]. In vitro tests have shown that P3HB
was non-toxic in various human cell lines, including osteoblasts, fibroblasts, epithelial cells,
and ovine chondrocytes [40, 41].
PHAs are generally biodegradable in vivo, with good biocompatibility, making them attractive
as tissue engineering biomaterials [34, 42]. Furthermore, release of bioactive compounds can
Chapter 1 : General introduction
26
be triggered by PHA degradation. In addition, PHAs are of hydrophobic nature and can be used
to delivered drugs such as antibiotic or anti-tumor agents. Potential delivery systems are
subcutaneous implants, compressed tablets for oral administration, and microparticulate
carriers for intravenous use [37].
Material properties
Since the 80’ies, extensive studies were performed to improve the mechanical properties of
PHAs [43]. The three-dimensional order of PHAs at the molecular level determines the physical
properties resulting in partially crystalline and partially amorphous regions [44]. In general,
polymers are characterized by their thermal properties using differential scanning calorimetry
(DSC); the glass transition temperature (Tg) of the amorphous phase is measured as well as the
melting temperature (Tm) of the crystalline phase. Most of PHAs behave as thermoplastics with
melting temperatures between 50 and 180°C (Table 1.2). The length of the side chain and the
presence of functional groups influence the physical properties, i.e., melting point, glass
transition temperature, and crystallinity [45]. When polymer composition changes, the
mechanical properties are also modified as well as the degradation rate and the biocompatibility
under specific physiological conditions [46].
Chapter 1 : General introduction
27
Table 1.2: Thermal and mechanical properties of PHAs compared with conventional synthetic
plastics. (Poly(3-hydroxybutyrate): P3HB; Poly(3-hydroxyvalerate): P3HV; Poly(4-
hydroxybutyrate): P4HB; mcl-PHAs copolymer (P(3HO-co-3HH)) containing 88% of 3-
hydroxyoctanoate and 12% of 3-hydroxyhexanoate monomers: (mcl-PHAs). From [37, 47].
Melting
temperature
Tm (°C)
Glass-
transition
temperature
Tg (°C)
Tensile
strength
(MPa)
Young’s
modulus
(GPa)
Elongation
at break
(%)
Reference
P3HB 180 4 40 3.5 5 [48]
P(3HB-co-20%
3HV) 145 -1 9 1.2 50 [48]
P4HB 53 -48 104 0.15 150 [49]
mcl-PHAs
(P(3HO-co-
12%3HH))
61 -35 9 0.008 380 [50]
Polyacrylate – -106 68 2.2 50 [51]
Polyethylene 100 -78 23 1.13 200 [51]
Polypropylene 176 -10 38 1.7 400 [48]
Polystyrene 240 100 60 3 7 [51]
The molecular weight (Mw) of PHAs is generally between 50,000 and 1,000,000 Da. It varies
with the bacterial growth condition, the producer strain, and the downstream processing. After
extraction, the polymer can appear in various forms according to its composition and process
of purification. Usually, increased crystallinity is associated with an increase in rigidity, tensile
strength and opacity [52]. Amorphous polymers are usually more transparent, less rigid, weaker
and more easily deformable [52]. P3HB has properties similar to polypropylene due to a similar
melting point, tensile strength and glass transition temperature (Table 1.2). It is a stiff and brittle
plastic material due to its high crystallinity. Material properties also depend on isolation
procedures. For example, purified P3HB looks fibrous after solvent extraction and precipitation
in ice cold methanol whereas purified P4HB behaves similar to elastic-like paper when treated
identically (Fig. 1.6).
Chapter 1 : General introduction
28
Figure 1.6: Purified P3HB (a) and P4HB (b) biopolymer. (Picture S. Le Meur)
In contrast to P3HB, P4HB material is strong and flexible, with a colossal tensile strength
leading to a 10 times elongation before breaking [53]. This allows a wide range of medical
applications like tissue engineering and drug delivery [53]. Its solubility in a range of polar
solvents (e.g., acetone), its elastomeric character at room and body temperature and its high
molecular weight are the ideal features for many biomedical applications [53]. Furthermore, its
lower melting temperature compared to PHB allows an easier processability [53].
Biochemical synthesis of PHAs
In 1958, Macrae and Wilkinson discovered that the amount of stored PHAs increased with the
carbon to nitrogen ratio in the growth medium. Generally, accumulation occurs when an excess
of carbon is available in the environment and when at least one other nutrient is
stoichiometrically limiting growth [16]. Initiation of PHA biosynthesis is often triggered by a
lack of either nitrogen, magnesium, sulfate, phosphate [54, 55] or oxygen [56].
The main physiological role of PHAs is as a storage of carbon and energy in the form of
intracellular granules [19]. Other reserve compounds, known to be accumulated in microbes
are glycogen, neutral lipids, starch as carbon source [57]. Similarly, nitrogen and phosphorus
can be store in the form of cyanophycine [58] and volutin, respectively [59]. PHAs constitute
a b a b
Chapter 1 : General introduction
29
an ideal carbon and energy storage material due to their low solubility and high molecular
weight. When polymerized, such compounds apply negligible osmotic pressure to the bacterial
cell. For many bacteria PHA polymer, once accumulated, acts also as a storage reducing-power
[60, 61].
Short-chain-length polyhydroxyalkanoates (scl-PHAs)
Poly(3-hydroxybutyrate)
Biosynthesis of PHAs was intensively studied in the past decades. This applies especially for
the scl-PHA poly(3-hydroxybutyrate) (P3HB), which is the most common type of PHAs found
in bacteria. Three genes, phaC, phaA and phaB, encode the essential enzymes for P3HB
accumulation in Ralstonia eutropha (Fig.1.7). They are organized in an operon named phaCAB.
These genes encode a PHA synthase (phaC), a β-ketothiolase (phaA) and a NADP-dependent
acetoacetyl-CoA reductase (phaB) [62, 63]. PHA synthase polymerizes (R)-3-hydroxyacyl-
coenzyme A (RHA-CoAs) into PHA with the concomitant release of coenzyme A. This is the
key step for PHA biosynthesis.
Figure 1.7: Pathway for P3HB biosynthesis in R. eutropha.
Acetyl-CoA
Acetoacetyl-CoA
(R)-3-hydroxybutyryl-CoA
P3HB
phaA
phaB
phaC
Chapter 1 : General introduction
30
Poly(4-hydroxybutyrate)
One of the most promising scl-PHAs for medical applications is poly(4-hydroxybutyrate)
(P4HB) due to its FDA approval as suture. Hein and coworkers reported that the introduction
of the plasmid pKSSE5.3 carrying PHA synthase gene (phaC) from Ralstonia eutropha and a
4-hydroxybutyric acid-coenzyme A transferase gene (orfZ) from Clostridium kluyveri enabled
E. coli strains to produce P4HB when 4HB was supplied in the culture medium as a precursor
[64] (Fig. 1.8).
Figure 1.8: P4HB metabolic pathway in recombinant E. coli. OrfZ: 4-hydroxybutyric acid CoA
transferase; PhaC: PHA synthase.
First, OrfZ catalyzes a coenzyme A transferase reaction from 4HB to 4HB-CoA using free
coenzyme A or acetyl-CoA as donor [64]. Then, the PhaC polymerizes 4HB-CoA into P4HB
with the concomitant release of CoA (Fig. 1.8). The product is P4HB homopolyester.
OrfZ
PhaC
SH-CoA
SH-CoA
4HB
4HB-CoA
P4HB
n
Chapter 1 : General introduction
31
Based on the initial study of Hein and coworkers in 1997, four studies were published that
reported on the increase P4HB homopolymer accumulation, and an increase in productivity and
an elucidation its metabolic pathway [64-67]. In these papers, the production of P4HB in
recombinant E. coli was investigated using glucose as growth substrate and Na-4HB as
precursor [64, 65]. Song and coworkers succeeded in producing 4.4 g L-1 P4HB using
recombinant E. coli XL1-Blue (pKSSE5.3) under fed-batch conditions with glucose as growth
carbon substrate and Na-4HB as precursor. A recent study reported the accumulation of P4HB
using only glucose as carbon substrate in fed-batch cultivation. An engineered E. coli was
obtained by inactivation of genes encoding succinate semialdehyde dehydrogenase, sad and
gabD, and by expressing the PHA binding proteins as well as the PHB synthase genes from R.
eutropha, allowing a P4HB production of 7.8 g L-1 [67]. In chapter 5 of this thesis, we obtained
15 g L-1 of P4HB from glycerol and stimulated by acetate with Na-4HB precursor [68].
Medium-chain-length polyhydroxyalkanoates (mcl-PHAs)
β-oxidation and de novo fatty acid biosynthesis pathways (see Figure 1.9) generate many
intermediates which are activated by coenzyme A or acyl carrier protein (ACP). These
metabolites are possible precursors for PHA biosynthesis because they can easily be converted
into RHA-CoAs. Biosynthesis of these thioesters can be performed via two different metabolic
routes in Pseudomonas putida [69].
When fatty acids are used as carbon source, the main pathway is the β-oxidation allowing a
biosynthesis of structurally related mcl-PHAs (Fig. 1.9). Fatty acid de novo biosynthesis is the
main route when P. putida is growing on carbon sources like gluconate, acetate, or ethanol
allowing accumulation of the structurally non-related carbon source as mcl-PHAs (Fig. 1.9).
Different enzymes generate RHA-CoAs from intermediates of metabolic pathways such as the
PhaA and the 3-ketoacyl-coenzyme A reductase (FabG) [62]. The wide substrate specificity of
Chapter 1 : General introduction
32
PhaC allows incorporating various monomers. However, occasionally the substrate specificity
of the PhaC had to be modified using site-specific mutagenesis to produce, for example, scl-
mcl PHA copolymer in a recombinant E. coli strain [70].
Chapter 1 : General introduction
33
Figure 1.9: Pathways for mcl-PHA synthesis. Synthesis of mcl-PHA in P. putida can be accomplished either through the use of intermediates of the fatty
acid β-oxidation cycle (left) or of the de novo fatty acid biosynthetic pathway (right).
Acetyl-CoA
Mcl-PHA
Malonyl-ACP
R-3-Hydroxyacyl-CoA
CO2
+
ACP
Acyl-
CoA
S-3-
Hydroxyacyl
-CoA
3-Ketoacyl-
CoA
Trans-2-
enoyl-CoA
acyl-CoA
dehydrogenase
Alkanoic
acid
Fatty acid
acetoacetyl-CoA
reductase
S-3-hydroxyacyl-CoA
dehydrogenase
3-ketoacyl-
CoA thiolase
epimerase
Trans-2-enoyl-
ACP
3-ketoacyl-CoA
reductase
acyl-CoA synthetase
3-Ketoacyl-ACP
Acyl-ACP
R-3-hydroxyacyl-
ACP dehydratase
2-enoyl-ACP
reductase 3-ketoacyl-ACP synthase
3-ketoacyl-ACP
reductase R-3-
Hydroxyacyl
-ACP
3-hydroxyacyl-ACP-
CoA transacylase PHA synthase
Fatty acid
β-oxidation
Fatty acid
de novo
synthesis
Acetyl-CoA Malonyl-
CoA
Carbohydrate
s
ACP-SH
CoA-SH
malonyl-CoA-ACP
transacylase
Chapter 1 : General introduction
34
Mcl-PHA accumulation from fatty acids in Pseudomonas putida
During growth of P. putida on fatty acids, PHAs biosynthesis is directly related to the carbon
source supplied in the medium as the products of the cyclic β-oxidation pathway are
incorporated into PHA polymer chain [23] (Fig. 1.9). After activation of a fatty acid by ATP
via the acyl-CoA synthase, it goes through a series of enzymatic reactions which produce after
each cycle an acetyl-CoA, decreasing the number of carbon atoms of the fatty acid by two [71].
For example, during growth on decanoic acid, P. putida accumulates PHA containing 3-
hydroxydecanoates, 3-hydroxyoctanoates and 3-hydroxyhexanoates monomers [23]. In dual
(i.e. carbon and nitrogen) limited fed-batch cultures of P. putida KT2442, co-feeding of two
different fatty acids led to the biosynthesis of mcl-PHA copolymer containing a similar ratio of
the corresponding fatty acid monomers, which suggested that both substrates were consumed
at similar rates [72]. The cellular content of mcl-PHAs can be enhanced using engineered
bacterial strains that have knocked out fadAB (3-ketoacyl-CoA thiolase and 3-hydroxyacyl-
CoA dehydrogenase) (Fig. 1.9), leading to an increased precursor pool for the polymerase [73].
Further knockouts of β-oxidation genes led to biosynthesis of PHA homopolymers [74].
Mcl-PHA accumulation from other carbon sources in Pseudomonas putida
Accumulation of PHAs during growth on carbon sources structurally not related to mcl fatty
acids such as glucose, acetate, and ethanol, proceeds through acetyl-CoA and fatty acid de novo
biosynthesis. In contrast to the β-oxidation pathway which shortens the fatty acyl substrates by
two carbon atoms, the fatty acid de novo biosynthesis builds up fatty acids by incorporating
malonyl-CoA per cycle via acyl carrier protein (ACP). The key enzyme linking fatty acid de
novo synthesis and β-oxidation for the accumulation of mcl-PHAs from unrelated carbon
sources is PhaG (3-hydroxy-acyl carrier protein (ACP)-CoA transacylase). As an exception, P.
Chapter 1 : General introduction
35
putida GPo1 is not able to produce mcl-PHAs from unrelated carbon source due to a cryptic
PhaG [75].
Regulation of PHA biosynthesis
PHA synthesis is regulated at the enzymatic level. The intracellular concentrations of acetyl-
CoA and free coenzyme A play a central role in the regulation of polymer synthesis. P3HB
synthesis is regulated by both high intracellular concentrations of NAD(P)H and high ratios of
NAD(P)H/NAD(P) [76]. Different enzymes are involved in PHA degradation such as PHA
depolymerase, dimer hydrolase, 3-hydroxybutyrate dehydrogenase [77]. In case of P. putida,
PhaC activity was found to be sensitive to the ratio of [R-3- hydroxyacyl-CoA]/[CoA)] in which
free CoA was a mild competitive inhibitor [78].
Reducing costs of PHA production
Sources of carbon
PHAs can be synthesized from sugars [79], free fatty acids [80], alkanes and alkanols [81],
triacylglycerols [82] but also from CO2 [83]. As mentioned above, the type of carbon source
supplied in the growth medium affects the nature of PHAs as well as productivity and
production cost. Much effort has been put into the search for inexpensive carbon substrates
because the latter contribute up to 50% of the total PHA production cost [84].
Low-cost carbon sources: an overview
In most large-scale PHA production studies, sugars such as glucose, gluconate, sucrose and
fructose were employed as carbon sources. The first report published in 1987 described growth
of Cupriavidus necator (earlier Ralstonia eutropha) on fructose to produce P3HB at an
industrial scale. Later on, Aeromonas hydrophila 4AKA was cultivated on glucose in a 20,000
Chapter 1 : General introduction
36
L bioreactor to produce a copolymer of poly(3-hydroxybutyrate-co-3-hydroxyhexanoate) [85].
However, the high cost of these sugars makes the production of PHAs too expensive compared
to conventional plastics. In comparison to carbohydrates, fatty acids are energetically
advantageous substrates because more energy is delivered in form of ATP per mole of fatty
acid [86]. In order to decrease the substrate cost, utilization of plant oils has been investigated
to produce PHAs. A broad range of vegetable oils from coconut, corn, olive, palm, soybean,
palm kernel was found to be feasible for biosynthesis of scl-PHAs [86].
As mentioned above, the carbon substrate cost represents up to approximately 50% of the PHA
production cost [86, 87], therefore, utilization of low-price substrates can decrease the
production cost. A report from Lee and coworkers summarized the effect of substrate cost and
production yield on the P3HB production cost [87]. Table 1.3 demonstrate that for the same
production yield, the final product P3HB can be seven times more expensive depending on the
substrate used. Historically, fatty acids were the preferred substrates for mcl-PHA production.
Recently, the use of waste streams or by-products from industries as fermentative carbon
substrates has generated real interest. Consequently, other sources were investigated to
synthesize mcl-PHAs such as a combination of soybean oil-based biodiesel and pure glycerol.
Soy molasses was also tested to produce mcl-PHAs but only low productivities was achieved
[88, 89].
Chapter 1 : General introduction
37
Table 1.3: Effect of substrate cost and P3HB yield on the P3HB production cost (from [87]).
Substrate Substrate cost (US
$ kg-1)
Yield (g P3HB g
substrate -1)
Product cost (US $
kg-1 P3HB)
Glucose 0.493 0.38 1.35
Sucrose 0.295 0.40 0.72
Methanol 0.180 0.43 0.42
Acetic acid 0.595 0.38 1.56
Ethanol 0.502 0.50 1.00
Cane molasse 0.220 0.42 0.52
Cheese whey 0.071 0.33 0.22
Hydrolyzed corn starch 0.220 0.185 0.58
Hemicellulose hydrolysate 0.069 0.20 0.34
The use of cheese whey, xylose, molasses, bagasse, starch hydrolysate which are inexpensive
and renewable carbon substrates, has been investigated for the production of P3HB. According
to Table 1.3, cheese whey and hemicellulose hydrolysates represent the least expensive
carbonaceous compounds for bacterial biopolymer production even when compared to very
cheap substrates like methanol. Comparing the benefit generated by the utilization of
hemicellulose hydrolysate instead of glucose, the P3HB production cost decreases by four,
although the conversion yield is lower for hemicellulose hydrolysate (Table 1.3). A maximum
P3HB yield of 25 g L-1 was reached using Bacillus sp. JMa5 growing in medium containing
sugar cane molasses and sucrose, making the process economically feasible [86].
Hemicellulose hydrolysate as a carbon source
Annually, 60 billion tons of hemicelluloses accumulate and remain mostly unused [90].
Hemicellulose is the third most abundant polymer in nature and can be hydrolyzed into
fermentable sugars by either chemical or enzymatic hydrolysis [91]. The dominant building
block of hemicelluloses is xylose. In some plants, xylose comprises up to 40% of the total dry
Chapter 1 : General introduction
38
plant material. Xylose is an industrially relevant carbon source for bacterial growth [92]. P3HB
was synthesized from xylose in Pseudomonas pseudoflava or Pseudomonas cepacia up to 22%
(w w-1) and 50% (w w-1), respectively [93-95]. In other studies, P3HB polymer was
accumulated up to 74% (w w-1) from xylose into E. coli harboring the PHA biosynthesis genes
of Ralstonia eutropha with a yield of 0.23 g PHB per g xylose [96]. Usually, P. putida is not
able to utilize xlose as growth substrate. But, it has been shown by Meijnen and cowokers that
an engineered strain of P. putida S12 can utilize D-xylose and L-arabinose by introducing xylA
(encoding xylose isomerase) and xylB (encoding xylulokinase) from E. coli, but PHA
accumulation was not studied [97]. This is why we investigated the production of mcl-PHAs
from xylose by P. putida in the chapter 2 [98].
Glycerol as carbon source
A particularly interesting carbohydrate for cultivating microbial cells is glycerol. It is a waste
byproduct in the biodiesel industry which is expanding very fast, reaching 22.5 billion liters per
year with growth rate of 17% between the end of 2007 and 2012 [99-101]. Glycerol-rich-phase
(GRP) from biodiesel industries has a low value due to the presence of impurities (such as
methanol, salts, mono- and di-glycerides and fatty acids). Nevertheless, it has a high potential
to be converted into a wide variety of value-added products [102]. Recently, glycerol has been
proposed for microbial bulk products such as 1,3-propanediol, dihydroxyacetone, ethanol,
succinate, propionate [103]. In E. coli, glycerol uptake occurs by facilitated diffusion across the
inner membrane via an integral membrane protein, the glycerol facilitator GlpF [104-106]. The
ability to metabolize glycerol via both oxidative and reductive pathways under anaerobic
conditions is a feature of many microbial strains including Klebsiella, Citrobacter, Clostridium
and Enterobacter [103].
Chapter 1 : General introduction
39
With respect to bioplastics the production of copolymers and terpolymers, respectively P(3HB-
co-4HB) and P(3HB-co-4HB-co-3HV), was reported recently using high-cell density fed-batch
cultures of Cupriavidus necator DSM 545 grown on waste glycerol (GRP) [107]. Recently,
mcl-PHA production was shown to be increased nearly two fold when the GlpR protein
(glycerol regulator) is knocked out [108].
Fermentation processes
Microorganisms can be basically grown using three different cultivation modes for PHA
production: batch, fed-batch or continuous culture. According to the objectives, one of these
fermentation systems will be chosen.
Batch process
Batch fermentation is an old process used to produce wine, beer, whiskey, pickles, or sauerkraut
and it is still the standard of most industrial bioprocesses. Batch cultivation is the simplest
process which is characterized by a constant culture volume. All necessary medium components
and the inoculum are added at the beginning of the cultivation period. The concentrations of
substrates and products are not controlled and therefore vary as the process proceeds. The
biomass concentration increases exponentially during unrestricted growth and levels off when
one of the nutrients becomes limiting. This process normally does not lead to significant
accumulation of mutations because of the low number of generations in batch cultivation cycle.
Furthermore, the contamination risk is small because few manipulations are necessary.
However, inhibitory or even toxic effects can occur due to high initial substrate concentration
or accumulation of toxic products. Moreover, many times only low cell densities are obtained
using this technique and oxygen limitation can prevent the exponential growth. This technically
simple method is usually used to produce small amounts of PHAs and to perform preliminary
studies.
Chapter 1 : General introduction
40
Fed-batch process
To overcome substrate inhibition, nutrients can be supplemented into the cultivation medium
during the process; in this case the process is called fed-batch (Fig. 1.10). This process is widely
used in industry, and it is characterized by an increasing biomass over time. It starts as a normal
batch with a small volume and then concentrated fresh medium is supplemented at a specific
feeding rate to keep the cells in the required physiological state. This process is very useful to
avoid initial substrate inhibition because the feeding rate can be adjusted by pulse, linear or
exponential feeding to fit to the substrate consumption rate of the culture. In this way, the
productivity is higher than for a batch because higher cell density can be reached. Fed-batch
processes have been used to produce biopolymers at a large scale. For instance, mcl-PHAs were
synthetized using P. putida GPo1 which resulted in a final cell dry weight (CDW) of 53 g L-1
containing about 55% (w w-1) of poly(3-hydroxyoctanoate) (PHO) in a 400 L bioreactor [109].
Figure 1.10 illustrates bioreactors used for fed-batch culture.
Chapter 1 : General introduction
41
Figure 1.10: Parallel Multifors benchtop bioreactors (Infors AG, Bottmingen, CH) used for fed-
batch cultivations (pulse feeding) of P. putida KT2440 (pSLM1). (Picture S. Le Meur)
Chemostat process
For investigating physiological question of PHA accumulation, the chemostat, a special type of
continuous cultivation, is the only method that allows to study microbial growth under defined
conditions for a prolonged period of time [110]. Continuous cultivation is characterized by a
constant volume, where fresh medium is supplemented at a constant flow rate and an equivalent
volume of spent medium is concomitantly removed. The system can reach a steady state
(chemostat conditions) in which concentrations of all nutrients and biomass remain constant.
This process provides controlled and reproducible conditions and allows variation of one
parameter at a time so that cause-and-effect relationships can be established. However, it is
rarely used in industry because of the difficulty of maintaining the culture uncontaminated, the
potential selection of mutants and plasmid loss during long cultivation period. Loss of substrate
Chapter 1 : General introduction
42
by the outflow is inevitable which can lead to a lower product yield. Therefore, this cultivation
method is less profitable and secure for industrial PHA production than fed-batch processes.
Studies of mcl-PHA accumulation in chemostat cultures were previously described in number
of reports [111-114]. PHA production cost is also linked to productivity, i.e. the ability of a
strain to both grow fast and to convert the carbon source efficiently into product [115]. The
downstream processing seems to represent a smaller part of the total production cost which
explains why much efforts were devoted to reach higher productivity using different
fermentation systems [115] and low-cost substrate [86].
PHA applications
Initially, main applications of PHAs were considered to be in the packaging field as everyday
consumables to produce shopping bags, paper coatings and disposable items [116]. In 1990,
Wella AG sold shampoo bottles made of copolymers of 3HB and 3HV (PHBV), named
Biopol®. Over the last decades, the production of PHAs with different chemical structures
supplied us with polymers of various mechanical properties. This open the way to many more
different applications. Many medical devices were developed using PHA materials, which is
not surprising considering the favorable mechanical properties, biocompatibility and its
biodegradability. With their low crystallinity, mcl-PHAs have interesting potential as coatings
and as medical implants including scaffolds or artificial organ constructions in tissue
engineering, implantable drug carriers as well as nutritional and therapeutic composites that
exhibit a defined degradation rate [34, 117]. Furthermore, some PHA monomers and oligomers
were reported to stimulate cell proliferation [118, 119]. Due to their chirality, PHA monomers
can be also used as starting chemicals (synthons) for chemical reactions [120]. Moreover, new
mechanical properties can be obtained by blending PHA with others polymers [34].
Chapter 1 : General introduction
43
P4HB is biocompatible and extremely well tolerated in vivo given that the P4HB hydrolysis
yields 4HB which is a common metabolite in the human body [38]. Not surprisingly, the first
and only PHA-based product approved by the FDA in 2007 for clinical application is an
absorbable suture from P4HB (TephaFLEX®) [53]. P4HB is a strong, biodegradable and
flexible material (Fig. 1.11) which is used also for a variety of other medical applications like
engineered issues and drug delivery systems [53].
Figure 1.11: Purified P4HB homopolymer from E. coli JM109 (pKSSE5.3) grown on xylose. (Picture S. Le Meur)
The monomer of P4HB was initially used as an intravenous anesthetic agent in Europe and
Japan because it can cross the blood and brain barrier rapidly to produce a sedative effect or to
induce a form of anesthesia with cardiovascular stability [121, 122]. In 2000, therapeutical
utilization of P4HB oligomers and 4HB monomers was patented by Williams and coworkers to
treat neuropharmacological illnesses like narcolepsy, schizophrenia and psychoses [123]. The
oligomers and monomers may be used to produce absence seizures. 4HB is an illegal drug in
many countries and known as “date rape drug” [124]. 4HB causes rapid unconsciousness at
doses above 3500 mg and with a single dose over 7000 mg often causes life-threatening
respiratory depression. Higher doses induce bradycardia and cardiac arrest [125]. However,
Chapter 1 : General introduction
44
lower concentrations of P4HB monomers are not be hazardous and showed some therapeutical
or nutritional benefits [126].
Taking advantage of its FDA approval, many medical applications of P4HB can be considered.
P4HB-based devices are tested in many diverse clinical applications including wound
management, tendon and ligament repair, hernia repair, and plastic and reconstructive surgery
in animal models, mainly in pigs [127]. In cardiovascular research, a tissue engineering tri-
leaflet heart valve was produced based on a PGA/P4HB composite scaffold. This engineered
tissue showed morphological features and mechanical properties of human native-heart-valve
tissue [128]. P4HB can also be used as patch material in the pulmonary circulation and after
169 days, a near-complete resorption of the biopolyester and formation of organized and
functional tissue was observed in ovine pulmonary artery [96].
To date, P4HB has both a high value and a large market potential amounting to several hundred
kilograms annually for sutures only. The current tissue engineering and regenerative medicine
global market, which represents only a fraction of the potential P4HB market, is estimated to
be about $1.5 billion and was projected to grow with a 16.2% compound annual growth rate
[129].
Aim and scope of this thesis
In this thesis, we aim to use xylose or glycerol instead of common carbohydrates such as glucose
as carbon source for growth by P. putida KT2440 (pSLM1) or E. coli JM109 (pKSSE5.3) in
combination with PHA precursors to reduce the total production cost of mcl-PHAs or P4HB,
respectively. In chapter 2, utilization of xylose as a growth carbon source in the controlled
production of mcl-PHA by recombinant P. putida KT2440 was examined. P. putida KT2440,
Chapter 1 : General introduction
45
which is one of the best-characterized pseudomonads for good mcl-PHA production [130] [30]
unfortunately, cannot metabolize xylose. Therefore, the xylAB genes from E. coli W3110 were
cloned into P. putida KT2440 and the obtained recombinant was studied for its ability to grow
on xylose. Since no mcl-PHA was accumulated from xylose only, we achieved mcl-PHA
production by the addition of fatty acids. For tailor-made mcl-PHA production, a sequential
feeding strategy was applied using xylose as the growth substrate and octanoic acid as the
precursor.
Since scl-PHAs offer different material properties compared to mcl-PHAs, it is interesting to
employ xylose as growth carbon substrate to produce high added value scl-PHAs such as P4HB.
To be able to manipulate the expression of P4HB biosynthesis genes and to control
accumulation of P4HB in E. coli we constructed a numbers of inducible vectors (chapter 3).
These plasmids were constructed using an inducible pET22b vector for expression of phaC
gene from R. eutropha and orfZ gene from C. kluyveri. The three plasmids constructed through
classical DNA manipulations, containing phaC and orfZ genes with or without their respective
promoter regions, were transformed in E. coli strains. The mutants were tested in various
growth studies for their ability to produce P4HB after induction of phaC and orfZ expression.
To decrease the production cost of P4HB it was also fundamental to understand the P4HB
biosynthesis in recombinant E. coli in order to improve the key steps as well as the recombinant
host. In chapter 4, different E. coli strains were transformed with the pKSSE5.3 plasmid and
P4HB accumulations and cell growths were compared to identify the best recombinant host.
The effect of growth conditions in batch culture was studied for the following parameters:
cultivation temperature, concentration of the xylose as carbon source for growth and the
concentration of the precursor Na-4HB. Furthermore, the best physiological stage at which Na-
4HB precursor should be added was investigated. P4HB synthesis was found to be separated
Chapter 1 : General introduction
46
from the cell growth, i.e. P4HB synthesis mainly took place after the end of the exponential
growth phase.
The P4HB bioprocess was further optimized in high cell density cultivations of recombinant E.
coli and results are reported in chapter 5. In this study, we analyzed the impact of different
nutrient limitations and the utilization of acetate as a stimulator to enhance P4HB accumulation
in recombinant E. coli. We observed that P4HB biosynthesis was correlated to amino acid
limitation (supplied as NZ-amines) and not to nitrogen depletion, as it is the case for many other
types of PHAs. Furthermore, it was found that addition of acetic acid at the beginning of batch
culture stimulated the P4HB accumulation in recombinant E. coli JM109 (pKSSE5.3) when
cultivated in glycerol but not on xylose. High cell density culture using glycerol was performed
to reach high P4HB productivity. Various feeding modes were investigated to reach the
maximum P4HB yield.
Chapter 6 describes the effect of molecular weight on the material properties of the
biosynthesized P4HB, in particular the crystallinity and the tensile mechanical properties. Acid-
catalyzed hydrolysis method was found to be a way to produce low molecular weight P4HB
with easier processability but with still good thermal and mechanical properties suitable for
biomedical applications.
This thesis ends with the chapter 7 where a general conclusion of the obtained results, the
encountered difficulties and the relevant findings are discussed. Then, possible routes for
further research to improve PHA production in a sustainable way are discussed and proposed.
Chapter 2
Production of medium-chain-length
polyhydroxyalkanoates by sequential feeding xylose
and octanoic acid in engineered Pseudomonas putida
KT2440
Le Meur S, Zinn M, Egli T, Thöny-Meyer L, Ren Q.
BMC Biotechnology 2012, 12:53
doi:10.1186/1472-6750-12-53
Chapter 2: Production of mcl-PHAs using xylose
48
Abstract
Pseudomonas putida KT2440 is able to synthesize large amounts of medium-chain-length
polyhydroxyalkanoates (mcl-PHAs). To reduce the substrate cost, which represents nearly
50% of the total PHA production cost, xylose, a hemicellulose derivative, was tested as the
growth carbon source in an engineered P. putida KT2440 strain.
The genes encoding xylose isomerase (XylA) and xylulokinase (XylB) from Escherichia coli
W3110 were introduced into P. putida KT2440. The recombinant KT2440 exhibited a XylA
activity of 1.47 U mg-1 and a XylB activity of 0.97 U mg-1 when grown on a defined medium
supplemented with xylose. The cells reached a maximum specific growth rate of 0.24 h-1 and
a final cell dry weight (CDW) of 2.5 g L-1 with a maximal yield of 0.41 g CDW g-1 xylose.
Since no mcl-PHA was accumulated from xylose, mcl-PHA production can be controlled by
the addition of fatty acids leading to tailor-made PHA compositions. A sequential feeding
strategy was applied using xylose as the growth substrate and octanoic acid as the precursor
for mcl-PHA production. In this way, up to 20% w w-1 of mcl-PHA was obtained. A yield of
0.37 g mcl-PHA per g octanoic acid was achieved under the employed conditions.
Sequential feeding of relatively cheap carbohydrates and expensive fatty acids is a practical
way to achieve more cost-effective mcl-PHA production. This study is the first reported
attempt to produce mcl-PHA by using xylose as the growth substrate. Further process
optimizations to achieve higher cell density and higher productivity of mcl-PHA should be
investigated. These scientific exercises will undoubtedly contribute to the economic feasibility
of mcl-PHA production from renewable feedstock.
Keywords: mcl-PHA; xylose; octanoic acid; Pseudomonas putida KT2440; sequential-
feeding; tailor-made PHA.
Chapter 2: Production of mcl-PHAs using xylose
49
Background
Polyhydroxyalkanoates (PHAs) are bacterial storage compounds produced widely by many
microorganisms under nutrient limited growth conditions such as a nitrogen, phosphorous or
oxygen starvation and when an excess of carbon source is present [19, 131]. PHAs gained
particular interest because they were shown to be biodegradable and biocompatible (see review
by [132]). Based on the chain length of the fatty acid monomers, PHAs can be classified into
three categories: short-chain-length (scl) PHAs with 3 to 5 carbon atoms, medium-chain-length
(mcl) PHAs with 6 to 14 carbon atoms and long-chain-length (lcl) PHAs with more than 14
carbon atoms [22]. The difference in length and/or chemical structure of the alkyl side chain of
the PHAs influences the material properties of the polymers to a great extent [29]. The
production of tailor-made mcl-PHAs enables to obtain the wanted material properties using the
appropriate fatty acid precursor. PHAs have been considered as an attractive ecofriendly
alternative to petrochemical polymers. However, the much higher production cost compared
with conventional petrochemical derived polymers has limited their widespread use.
Much effort has been devoted to reduce the price of PHAs by developing better bacterial strains,
more efficient fermentation and/or more economical recovery processes [86, 128, 133-135]. It
has been shown that the cost of raw materials (mainly the carbon source) contributes most
significantly to the overall production cost of PHAs (up to 50% of the total production cost)
[84]. The use of two kinds of carbon sources can be an attractive approach to reduce cost: the
first carbon substrate is used for cell growth to obtain biomass, while the second one (which
may be more expensive) allows the synthesis of PHA. The substrate for bacterial growth should
be inexpensive and abundant. Xylose is second only to glucose in natural abundance [136].
Thus, it is a promising candidate substrate for inexpensive bacterial growth.
Chapter 2: Production of mcl-PHAs using xylose
50
D-Xylose is the dominant building unit of the hemicelluloses in plants of all species of the
Gramineae. Hemicellulose, the third most abundant polymer in nature, can be easily hydrolyzed
into fermentable sugars by either chemical or enzymatic hydrolysis [91]. In some plants, xylan
comprises up to 40% of the total dry material. Annually, 60 billion tons of hemicelluloses are
produced and remain almost completely unused [90]. It has been reported that the hemicellulose
hydrolysate including xylose can be used by Candida blankii for efficient protein production.
There are also reports that poly(3-hydroxybutyrate) (PHB) could be synthesized from xylose in
Pseudomonas pseudoflava or P. cepacia up to 22% (w w -1) and 50% (w w -1), respectively [93-
95]. Furthermore, Escherichia coli harboring PHA synthesis genes of Ralstonia eutropha was
reported to be able to accumulate PHB from xylose up to 74% w w -1 with a yield of 0.226 g
PHB per g xylose [137].
Up to now, no report has been published on the production of mcl-PHA by using xylose. Since
mcl-PHAs offer different material properties compared to scl-PHAs, it would be interesting to
investigate whether mcl-PHAs can be obtained from xylose. Pseudomonas putida KT2440,
whose genome sequence is available (www.ncbi.nlm.nih.gov), is one of the best-characterized
pseudomonads for mcl-PHA production [71]. It is able to synthesize and accumulate large
amounts (up to 75% w w -1) of mcl-PHAs [30], but can only ferment a narrow range of sugars,
in which xylose is not included. It has been shown that an engineered strain of P. putida S12
can utilize D-xylose and L-arabinose [97]. Introducing xylA (encoding xylose isomerase) and
xylB (encoding xylulokinase) from E. coli into P. putida S12 enabled the latter to utilize xylose
as the sole carbon source.
In this study, the possibility of using xylose as a growth carbon source and octanoic acid as
mcl-PHA precusor in the controlled production of mcl-PHA by recombinant P. putida KT2440
was examined. The xylAB genes from E. coli W3110 were cloned into P. putida KT2440 and
Chapter 2: Production of mcl-PHAs using xylose
51
the obtained recombinant was studied for its ability to grow on xylose. For mcl-PHA production
a sequential feeding strategy of using xylose and fatty acids was applied.
Methods
Bacterial strains and plasmids
Strains and plasmids used in this study are listed in Table 2.1.
Table 2.1. Strains and plasmids used in this study.
Strain or plasmid Revelant characteristics References
Strains
P. putida KT2440 Prototrophic, reference strain [138]
E. coli W3110 Wild-type, xylAB donor [139]
E. coli JM109
endA1, glnV44, gyrA96, thi-1, mcrB+, hsdR17 (rk–, mk
+), relA1,
supE44, [F' traD36 proAB+ lacIq lacZΔM15]
[140]
E. coli HB101
F-, hsdS20 (rB- mB
-) recA13, ara-14, proA2, lacY1, galK2, xyl-
5, mtl-1, rpsL20 (SmR).
[141]
Plasmids
RK600 Cmr, ColE1, oriV, RK2, mob+, tra+ [142]
pVLT33
Kmr, Ptac, MCS of pUCP18, hybrid broad-host-range
expression vector
[143]
pSLM1 xylA and xylB cloned into pVLT33 this study
Chapter 2: Production of mcl-PHAs using xylose
52
Chemicals
All chemicals were purchased from Sigma-Aldrich (Buchs, Switzerland). The oligonucleotides
were purchased from Microsynth (Balgach, Switzerland). The restriction enzymes were
purchased from Fermentas GmbH (Nunningen, Switzerland) or New England Biolabs
(Allschwil, Switzerland).
Cloning, characterization and expression genes involved in xylose utilization
Construction of pSLM1
The chromosomal DNA of E. coli W3110 was extracted and used as the template for cloning
of xylAB (GenEluteTM, bacterial Genomic DNA kit, Sigma-Aldrich). The fragment containing
both xylA and xylB was amplified using the following primers: PFXylA (5’
CCGAATTCTGGAGTTCAATATG 3’) and PRXylB (5’
GATAAGCTTTACGCCATTAATG 3’). The amplified fragment was purified from agarose
gel (GenEluteTM, Gel Extraction kit, Sigma Aldrich) and further digested with EcoRI and
HindIII restriction enzymes. This digested fragment was ligated into the shuttle vector pVLT33
[143], which was cut with the same restriction enzymes. The ligation solution was transformed
into E. coli JM109 and the recombinants were selected on a Luria-Bertani broth agar plate with
50 µg mL-1 kanamycin, 1 mM bromo-chloro-indolyl-galactopyranoside (X-gal), and 1 mM
isopropyl β-D-1-thiogalactopyranoside (IPTG). The obtained plasmid (insert + vector) was
named pSLM1. The nucleotide sequence of xylAB was analyzed and confirmed by GATC
Biotech AG (Konstanz, Germany).
Introduction of pSLM1 into P. putida KT2440
The obtained plasmid pSLM1 was introduced into P. putida KT2440 by triparental mating
[141]. E. coli HB101 (RK600) was used as the helper strain. E. coli JM109 (pSLM1) was the
donor strain and P. putida KT2440 was the acceptor strain. The P. putida KT2440 recombinants
Chapter 2: Production of mcl-PHAs using xylose
53
were selected on E2 medium containing 0.2% citrate and 50 µg mL-1 kanamycin [144]. In
analogy, the empty vector pVLT33 was also introduced into P. putida KT2440 as a control.
Growth conditions
E2 minimal medium supplemented with different carbon sources (xylose, glucose or octanoic
acid) was used throughout the whole study. This medium contains the following components:
NaNH4HPO4* 4H2O 3.5 g L-1, KH2PO4 3.7 g L-1, K2HPO4 7.5 g L-1, dissolved in water and 1
mL L-1 of microelements containing: MgSO4*7H2O 246.5 g L-1, and with 1 mL L-1 of trace
element dissolved in 1M HCl and containing: FeSO4*7H2O 2.78 g L-1, CaCl2*2H2O 1.47 g L-
1, MnCl2*4H2O 1.98 g L-1, CoCl2*6H2O 2.38 g L-1, CuCl2*2H2O 0.17 g L-1, ZnSO4*7H2O 0.29
g L-1. In some experiments, the nitrogen content of the E2 medium was reduced to 20%
(0.2NE2), and also especially indicated in the results section. If necessary, 25 µg mL-1
kanamycin was added to the culture medium. The medium was theoretically nitrogen-limited
up to 2.06 g CDW L-1 for medium E2 used in the 3.7 L reactor and up to 0.41 g CDW L-1 in the
1 L minireactors for the medium 0.2NE2 , assuming a carbon yield of 1.0 g g-1 and a nitrogen
yield of 8.75 g g-1 [110].
Growth in shake flasks
The recombinant P. putida KT2440 (pSLM1) was pre-cultured in 100 mL of E2 medium
containing 10 g L-1 xylose and 25 µg mL-1 kanamycin. The preculture in the exponential growth
phase was then transferred to fresh E2 medium containing xylose and kanamycin. This transfer
was repeated twice to allow cells to adapt to xylose. P. putida KT2440 (pVLT33) was used as
control. The P. putida cells were grown at 30°C with an agitation of 150 rpm in 1 L baffled
shake flasks.
Chapter 2: Production of mcl-PHAs using xylose
54
E. coli cells were grown at 37°C in either LB medium or E2 medium containing xylose as the
sole carbon source. Samples were taken and stored at -20°C as indicated in the Results section
for the determination of xylose isomerase and xylulokinase activities.
Batch culture in 3.7 L reactor
The bioreactor study was carried out in a 3.7 L laboratory bioreactor (KLF 2000,
Bioengineering, Wald, Switzerland) with a working volume of 2 L. Medium E2 supplemented
with 10 g L-1 xylose as the sole carbon source was used. The batch bioreactor was inoculated
with 300 mL of preculture having an OD600 of 2.10 and containing exactly the same medium
as the one present in the bioreactor. The agitation was set at 750 rpm. The temperature was
controlled at 30°C and the pH was maintained at 7.0 by automated addition of 4 M KOH or 2
M H2SO4. The dissolved oxygen tension was monitored continuously with an oxygen probe
and care was taken that it remained above 20% of air saturation (with a flow of 1 v v -1 min-1).
Batch culture in 1 L mini-reactors
In order to obtain a nitrogen-limited growth condition more rapidly, 0.2NE2 medium was used
in the following experiments. Four mini-reactor cultures (A, B, C and D) were grown in parallel
in Multifors-Multiple benchtop bioreactors (Infors AG, Bottmingen, Switzerland). Temperature
was controlled at 30°C and pH was maintained at 7.0 by automated addition of 4 M KOH or 2
M H2SO4. The dissolved oxygen tension was monitored continuously with an oxygen probe
and kept at 30% of air saturation. Each reactor was inoculated using the pre-culture which was
prepared as described above in the section “Growth in shake flasks”. The initial OD600 in
bioreactors was about 0.08. Kanamycin was added to a final concentration of 25 µg mL-1 when
a recombinant strain was cultivated. Octanoic acid with different concentrations was fed to the
bioreactors at different growth stages of the batches, as described in the Results section.
Chapter 2: Production of mcl-PHAs using xylose
55
Enzymatic assays
The cell pellets from batch culture were washed twice with 250 mM Tris-HCl buffer pH 7.5,
and then lysed by the addition of lysis solution according to the manufacture’s instruction
(CellLytic TM B Cell Lysis Reagent, Sigma-Aldrich, St. Louis, MO, USA). The samples were
centrifuged at 20’000 g for 3 min in an Eppendorf centrifuge. The supernatant is referred as
cell-free extract (CFE).
Xylose isomerase (EC 5.3.1.5) was measured in a solution containing 0.2 mM NADH, 50 mM
xylose, 10 mM MgSO4, 0.5 U sorbitol dehydrogenase, and 30 μL CFE as it has been described
previously [145]. The assay was performed in a 96-well plate at 30°C. The total volume of the
assay was 200 µL. The consumption of NADH was measured spectrophotometrically at 340
nm using a plate reader (Bioteck Instruments GmbH, Luzern, Switzerland). One unit is defined
as 1 µmole of consumed NADH min-1 mg of total protein -1.
Xylulokinase (EC 2.7.1.17) was assayed as described previously [146]. The assay mixture
contained 0.2 mM NADH, 50 mM Tris-HCl (pH 7.5), 2 mM MgCl2, 2 mM ATP, 0.2 mM
phosphoenolpyruvate, 8.5 mM xylulose, 2.5 U pyruvate kinase, 2.5 U lactate dehydrogenase
and 30 μL CFE. The assay was performed at 30°C. The total volume was 200 µL in each well
of the 96-well plate. The consumption of NADH was measured spectrophotometrically at 340
nm (Bioteck Instruments GmbH, Luzern, Switzerland). One unit is defined as 1 µmole of
consumed NADH min-1 mg of total protein -1.
Analytical methods
Cell growth
Growth of bacterial cells was followed by measuring the optical density at 600 nm (OD600)
using a UV-visible spectrophotometer (Genesys 6, ThermoSpectronic, Lausanne, Switzerland).
Chapter 2: Production of mcl-PHAs using xylose
56
Cell dry weight was determined using pre-weighed polycarbonate filters (pore size: 0.2 µm,
Whatman, Scheicher & Schuell, Dassel, Germany). An appropriate volume (0.5 to 5 mL) of
culture was filtered in order to obtain a biomass weight of about 2 mg per filter. The filter was
dried overnight at 105°C, cooled down to room temperature in a desiccator and then weighted.
The weight difference was used to determine the quantity of biomass per culture volume.
Measurement of carbon sources
The consumption of carbon sources was measured by HPLC-MS. Samples were diluted
between 0.01 and 0.1 mM with 50% acetic acid 50% acetonitrile (v v-1) and loaded on a reversed
phase C18 column (Gemini C18 5 micron, 250 mm x 4.60 mm, Phenomenex, U.K.). A gradient
of 100% diluted formic acid (0.1 v% in water) to 100% acetonitrile was applied as the mobile
phase. The flow rate was 0.8 mL min-1 and the gradient was completed after 25 minutes. The
peaks were detected by electrospray ionization (ESI) in negative mode [147]. The standard
curves for xylose and octanoic acid were recorded in the range of 0.01 to 1 g L-1, and 0.005 g
L-1 to 0.03 g L-1, respectively.
Ammonium concentration
NH4+-nitrogen concentration was measured using an ammonium test kit following the
manufacturer instruction (Merck KGaA, 64271 Darmstadt, Germany). The detection limit was
0.01 NH4+-N mg L-1. The method was linear up to 3.0 mg N L-1, above which dilution with
distilled water was needed.
Acetic acid measurement
A DX-500 ion chromatography system (Dionex, Sunnyvale, CA, USA) was used to analyze the
acetic acid production during the co-feeding experiments. IonPac AS 11 HC (250 mm× 4 mm)
and AG 11 HC guard (50 mm× 4 mm) columns were used. A sodium hydroxide gradient of 0.5
to 30 mM allowed the identification and the quantification of this organic acid in 15 minutes.
Chapter 2: Production of mcl-PHAs using xylose
57
PHA content
For analysis of intracellular PHA the culture broth was centrifuged (10,000 x g; 4°C; 15 min)
and the cell pellet was lyophilized for 48 hours. Pyrex vials were weighed to determine the
exact transferred biomass, then 2 ml of 15% v v-1 H2SO4 in methanol were added. Furthermore,
2 ml of methylene chloride containing 2-ethyl-2-hydroxybutyrate (10 g L-1) were added as
internal standard. The suspension was boiled at 100°C for 2.5 h in an oven. The samples were
cooled on ice; then 1 ml of distilled water was added in order to extract the cell debris that is
soluble in the aqueous phase. The sample was mixed by vortexing for 1 min. The complete
water phase was discarded (upper phase), including droplets hanging on the tube wall and
including the top layer of the methylene chloride phase. Na2SO4 powder was added to dry the
methylene chloride phase. Two hundred µL of the chloroform phase was filtered using solvent
resistant filters (PTFE, 0.45 µm) and transferred to a GC sample tube. PHA content and
monomer composition were subsequently analyzed on a GC (A200s, Trace GC 2000 series,
Fisons Instruments, Rodano, Italy) equipped with a polar fused silica capillary column
(Supelcowax-10: length 30 m; inside diameter 0.31 mm; film thickness 0.5 µm; Supelco, Buchs,
Switzerland).
Reproducibility
All measurements for growth and PHA assays were performed at least in duplicates. The
measurements for XylAB assays were performed in triplicates. The data presented in this report
are the average numbers.
Chapter 2: Production of mcl-PHAs using xylose
58
Results
Cloning and expression of the xylA and xylB genes encoding xylose isomerase and
xylulokinase
To clone the xylAB genes, which are organized in an operon, of E. coli W3110, DNA primers
PFXylA1 and PRXylB were designed based on the genomic sequence of E. coli W3110
(GenBank number: AP009048) [148]. These primers were used to amplify the xylAB fragment
by PCR with W3110 chromosomal DNA as the template, leading to a 2.85 kb DNA product
(xylAB). The PCR product was inserted into the shuttle vector pVLT33 as described in Materials
and Methods, resulting in pSLM1 plasmid. P. putida KT2440 (pSLM1) was grown on E2
minimal medium with either 10 g L-1 xylose or glucose, leading to a C/N ratio of 17 g g -1. P.
putida KT2440 (pVLT33) was used as a control.
When grown on glucose, KT2440 (pVLT33) exhibited a higher specific growth rate (0.32 h-1)
than KT2440 (pSLM1) (0.26 h-1) (Fig. 2.1). The maximum OD600 reached by KT2440
(pVLT33) was also higher (4.28) than KT2440 (pSLM1) (2.94) (Fig. 2.1). When xylose was
used as the sole carbon source, KT2440 (pVLT33) was not able to grow during the entire test
period (25 h), whereas the recombinant KT2440 (pSLM1) exhibited a typical bacterial growth
curve (Fig. 2.1). The maximum specific growth rate of the IPTG-induced recombinant KT2440
(pSLM1) culture was similar to the culture without induction, of µ = 0.23 h-1 and µ = 0.21 h-1,
respectively (Fig. 2.1). This demonstrates that the expression of xylAB from pSLM1 is not
tightly regulated and xylAB can be expressed even without the induction by IPTG. The
recombinant KT2440 (pSLM1) reached a maximal OD600 of 3.66 on xylose. In all experiments
the carbon substrate (either glucose or xylose) was not totally consumed at the end of the
cultivation (26 h), around 4 g L-1 was left over in the culture broth.
Chapter 2: Production of mcl-PHAs using xylose
59
Fig. 2.1: Growth in shake flasks of the P. putida KT2440 recombinants on E2 minimal medium
containing 10 g L-1 glucose or xylose as the sole carbon source. The arrow represents the
addition of IPTG. Data points are the averages of the results of duplicate measurements.
0
0,05
0,1
0,15
0,2
0,25
0
1
2
3
4
5
0 10 20 30
Nitro
gen (
g L
-1)
OD
600
Time (h)
KT2440 (pSLM1) on glucose Nitrogen
0
0,05
0,1
0,15
0,2
0,25
0
1
2
3
4
5
0 10 20 30
Nitro
gen (
g L
-1)
OD
600
Time (h)
KT2440 (pSLM1) on xylose Nitrogen
0
0,05
0,1
0,15
0,2
0,25
0
1
2
3
4
5
0 10 20 30
Nitro
gen (
g L
-1)
OD
600
Time (h)
KT2440 (pSLM1) on xylose +IPTG Nitrogen
0
0,05
0,1
0,15
0,2
0,25
0
1
2
3
4
5
0 10 20 30
Nitro
gen (
g L
-1)
OD
600
Time (h)
KT2440 (pVLT33) on glucose Nitrogen
0
0,05
0,1
0,15
0,2
0,25
0
1
2
3
4
5
0 10 20 30
Nitro
gen (
g L
-1)
OD
600
Time (h)
KT2440 (pVLT33) on xylose Nitrogen
A B
C D
E
Chapter 2: Production of mcl-PHAs using xylose
60
These results suggest that the cloned xylAB from E. coli are functionally expressed in P. putida
KT2440, and xylAB alone are sufficient to allow the growth of KT2440 on xylose. To have
better controlled growth, further experiments were performed in bioreactors.
Growth of P. putida KT2440 (pSLM1) on xylose in the bioreactor
P. putida KT2440 (pSLM1) was grown on E2 medium with 10 g L-1 xylose in a 3.7 L laboratory
bioreactor. Figure 2.2 shows that the KT2440 (pSLM1) cells utilized xylose as the sole carbon
source with a maximum specific growth rate of 0.24 h-1.
Fig. 2.2. Growth of P. putida KT2440 (pSLM1) in E2 minimal medium with 10 g L-1 xylose in
a 3.7 L bioreactor. Data points are the averages of the results of duplicate measurements.
-6
-4
-2
0
2
4
6
8
10
12
-2
-1
0
1
2
3
4
0 5 10 15 20 25 30
Xylo
se (
g L
-1)
Ln O
D;
OD
600
; C
DW
(g L
-1);
Nit
ogen
x 1
0 (
g L
-1)
Time (h)
OD LN OD Nitrogen CDW Xylose
Chapter 2: Production of mcl-PHAs using xylose
61
The growth stopped due to nitrogen limitation after 13 hours of cultivation. Afterwards the
biomass increased only slightly from 2.2 g L-1 to maximum 2.7 g L-1 at 28 h, which is in the
range of the theoretical values calculated in Materials and Methods. Even through nitrogen-
limitation was reached, xylose was further consumed and finally only a tiny amount (< 0.01g
L-1) was left in the medium (Fig. 2.2). The consumed xylose may have been used for cell
maintenance and/or by-products such as acetic acid. Indeed, large amounts of acetic acid were
detected from the beginning of the growth in the range of several hundred milligrams per liter.
The culture was also assayed for PHA content at different time points. Only trace amounts (<
1% w w-1) of PHA were detected using xylose as the sole carbon source, which enables to use
xylose as growth substrate for the production of tailor-made mcl-PHAs.
To confirm the enzymatic activities of XylA and XylB, cells were harvested at the early
exponential growth phase (OD600 of about 0.5). Samples without substrates and samples without
cell-free extracts were used as negative controls, while E. coli W3110 cells grown on E2 with
xylose were used as the positive control. The specific activities of xylose isomerase and
xylulokinase measured in P. putida KT2440 (pSLM1) were 1.47 U mg -1 and 0.97 U mg -1,
respectively, whereas no significant activities were observed in the negative controls (Table
2.2).
Table 2.2. Enzymatic activities of XylA and XylB in P. putida KT2440 (pSLM1).
Negative control Sample
No substrate No cells E. coli W3110 P. putida (pSLM1)
XylA act. (U) 0.07 0.33 1.79 1.47
XylB act. (U) 0.26 0.12 1.39 0.97
U: One unit is defined as 1 µmole of consumed NADH minute -1 mg of total protein -1.
Chapter 2: Production of mcl-PHAs using xylose
62
The activities obtained here were in the same range as those found in wild-type E. coli W3110
(Table 2.2). These results confirmed that both XylA and XylB were active in P. putida KT2440.
The enzymatic activities of XylA and XylB were also found for the non-induced cultures, thus,
induction by IPTG is not needed for the expression of xylA and xylB genes and was therefore
omitted in the following experiments.
PHA production in KT2440 (pSLM1) by sequential-feeding of xylose and fatty acid
Nitrogen limitation is known to promote PHA accumulation [19]. It has been demonstrated that
nitrogen limitation can lead to a strong induction of phaG encoding a transacylase, resulting in
mcl-PHA accumulation from carbohydrates in P. putida KT2440 [149]. Thus, in the
experiments performed in mini-reactors the amount of nitrogen present in E2 medium was
decreased to 20% (namely 0.2NE2 medium) to obtain the best conditions for mcl-PHA
accumulation. As expected, KT2440 (pVLT33) did not show any growth on xylose (Table 2.3,
culture A), similar as observed in Fig. 2.1. KT2440 (pSLM1) exhibited a maximal specific
growth rate of 0.24 h-1 on xylose with a maximum OD600 of 0.99 (Table 2.3, culture B). No
PHA was detected for KT2440 (pSLM1) on xylose.
Chapter 2: Production of mcl-PHAs using xylose
63
Table 3: PHA production in batch and fed-batch fermentations. The cells were grown in 0.2NE2 minimal media supplemented with different carbon
sources in 1 L bioreactors with a working volume of 800 mL. Samples were taken regularly to measure growth, nitrogen concentration, carbon source
present in the medium and PHA contents. Data points are the averages of duplicate measurements.
Entry Strains Fermentation
type
Carbon source
Feeding type
/ duration
Feeding
phase Flow
Total
amount of
fed C8
OD600 µ max (h-1
) PHA content
(% w w -1)
growth
substrate
PHA
precusor
A KT2440 (pVLT33) Batch xylose - - - - no growth 0 0
B KT2440 (pSLM1) Batch xylose - - - - 0.99 0.24 0.3
C KT2440 (pSLM1) Batch octanoic acid - - - - 10 mM 2.77 0.35 21.0
D KT2440 (pSLM1) Fed-Batch xylose octanoic acid linear/ 12 h mid exp. (1)
0.5 mM L-1
h-1
6 mM 1.48 0.24 12.1
E KT2440 (pSLM1) Fed-Batch xylose octanoic acid linear/ 8 h end exp. (2)
0.5 mM L-1
h-1
4 mM 1.52 0.25 16.2
F KT2440 (pSLM1) Fed-Batch xylose octanoic acid linear/ 4h end exp. (2)
2 mM L-1
h-1
8 mM 1.4 0.25 20
G KT2440 (pSLM1) Batch xylose +
octanoic acid
octanoic acid - - - 10 mM 2.13 0.27 28.7
(1): Feeding started at the middle of exponential batch phase, OD600 of 0.5.
(2): Feeding started at the end of exponential batch phase, OD600 of 1.
Chapter 2: Production of mcl-PHAs using xylose
64
To test whether the recombinant is able to accumulate mcl-PHA from a related carbon source
(e. g. octanoic acid), KT2440 (pSLM1) was pre-cultured in E2 minimal medium with xylose as
the sole carbon source and then transferred into a bioreactor containing 0.2NE2 medium with
10 mM octanoic acid as the sole carbon source (Table 2.3, culture C). Samples were taken
regularly and the cellular PHA content was determined. It was found that KT2440 (pSLM1)
was able to accumulate mcl-PHA to 21% (w w-1) after 33 hours of cultivation.
The above results demonstrate that the recombinant strain KT2440 (pSLM1) kept the ability to
synthesize PHA from fatty acids, but could not do so from xylose. This allows sequential
feeding of xylose and fatty acids to obtain tailor-made mcl-PHA biosynthesis from xylose,
namely, first using an inexpensive carbon source for cell growth and then adding the appropriate
mcl-PHA precursor to allow the polymer accumulation. The sequential feeding strategy enables
production of a tailor-made mcl-PHA according to the supplied fatty acid. Octanoic acid was
tested here as mcl-PHA precursor in order to obtain poly(3-hydroxyoctanoate) accumulation.
We first investigated the influence of linear feeding of octanoic acid at different growth stages
on PHA synthesis. Four minireactors in parallel were inoculated using the same P. putida
KT2440 (pSLM1) preculture grown in E2 medium with 1.8 g L-1 xylose. In cultures D and E
linear feeding of 0.5 mM h-1 of octanoic acid was initiated at OD600 of 0.5 (8 h of batch
cultivation) and 1.0 (10 h of batch cultivation), respectively. Both cultures showed a similar
maximum specific growth rate of 0.24 h-1 (Table 2.3). The nitrogen limitation was reached after
16 h and xylose was depleted after 12 h for both cultures. The maximum accumulation of PHA
was found to be 12.1% w w-1 and 16.2% w w-1 for D and E, respectively, after about 20 h of
cultivation (Table 2.3). The obtained results suggested that PHA can be produced in P. putida
KT2440 (pSLM1) by sequential feeding of xylose and fatty acids. The exponential phase ended
at OD600 of 1.0 due to nitrogen limitation. Linear feeding at the end of the exponential growth
phase in the batch (OD600 of 1.0) gave a better yield of PHA compared to that at the mid-
Chapter 2: Production of mcl-PHAs using xylose
65
exponential growth phase (OD600 of 0.5). This lower yield obtained in the latter can be
explained by consumption of octanoic acid for growth rather than for PHA accumulation during
the mid-exponential phase.
To increase PHA accumulation, we increased the feeding rate from 0.5 mM h-1 to 2 mM h-1 of
octanoic acid. Culture F was grown on 1.8 g L-1 xylose and feeding started at the end of the
exponential growth phase with a feeding rate of 2 mM h-1 of octanoic acid. For comparison,
culture G was supplemented with 1.8 g L-1 xylose and 10 mM octanoic acid from the beginning
on (batch culture on mixed carbon sources). Using culture F as an example, the figure 2.3
represents a typical behavior of cells regarding growth and PHA synthesis. After 7 h and 14.5
h of cultivation, nitrogen and xylose were depleted, respectively. When cells entered the
starvation phase a linear feeding of octanoic acid was started for 4 hours and then stopped. PHA
synthesis was detected after 2 h of feeding and increased linearly to 17.6% w w-1 during the
following 14 h. Only a slight increase of PHA content to about 20% w w-1 was found after
further incubation up to 43 h. The concentration of octanoic acid measured in the culture
increased with feeding time up to 2.56 mM after 7.5 hours from the beginning of the feeding;
afterwards it continuously decreased. At the end of the cultivation, after 48.5 h, the remaining
octanoic acid was only 0.48 mM. A maximal yield of mcl-PHA from octanoic acid of 0.37 g
mcl-PHA g-1 octanoic acid was obtained.
Chapter 2: Production of mcl-PHAs using xylose
66
Fig. 2.3: Fed-batch experiment of P. putida KT2440 (pSLM1) grown on 0.2NE2 medium
containing 1.8 g L-1 xylose with linear feeding of 2 mM h-1 octanoic acid at OD600 of 1 for 4
hours. Nitrogen (○), octanoic acid (□) and xylose (◊) concentrations were measured. The
logarithmic growth is represented by filled squares (■) and the PHA accumulation by filled
triangles (▲). Data points are the averages of the results of duplicate measurements.
GC analysis revealed that the main monomer component of the synthesized PHA was 3-
hydroxyoctanoate (87 mol %) and no 3-hydroxydecanoate was detected. These results confirm
that the detected PHA is mainly from octanoic acid. Since the main monomer unit of PHA
produced from carbohydrates is 3-hydroxydecanoate in KT2440 [79, 150] it is very unlikely
that xylose was used for PHA synthesis. The sequential feeding strategy using xylose as growth
substrate and octanoic acid as mcl-PHA precursor enabled production of a controlled mcl-PHA
0
5
10
15
20
25
30
35
40
-2
-1,5
-1
-0,5
0
0,5
1
1,5
0 5 10 15 20 25 30 35 40 45 50
Nit
rogen
(m
g L
-1);
P
HA
co
nte
nt
( %
w w
-1);
oct
ano
ic a
cid
10
x (
g L
-1)
LN
OD
600;
Xylo
se
(g L
-1)
Time(h)
LN OD600 Xylose Nitrogen PHAs Octanoic acid
Chapter 2: Production of mcl-PHAs using xylose
67
production. The yield of PHA from octanoic acid was between 0.11 g g-1 to 0.37 g g-1, with
culture F as the highest.
Discussion
Growth of KT2440 on xylose
A recombinant P. putida KT2440 strain was constructed that could efficiently utilize
xylose. The introduction of xylose isomerase (XylA) and xylulokinase (XylB) was essential and
sufficient for the utilization of xylose and a growth rate of 0.24 h-1 was routinely obtained.
Previously, it has been reported that a so called “laboratory evolution” was necessary to
improve the growth rate of P. putida S12 (xylAB) on xylose from 0.01 h-1 to 0.35 h-1 [97]. The
laboratory evolution is an adaption process by growing the cells consecutively in a fresh
medium containing the unfavorable carbon source. The “laboratory evolution” was not needed
for the KT2440 recombinant to grow on xylose. This difference could be attributed to the
different physiological background / metabolic fluxes of KT2440 and S12. It has been reported
that in P. putida a complete pentose phosphate pathway is present [97, 151] (Fig. 2.4) as well
as the key enzymes for mcl-PHA accumulation [78]. Our study demonstrated that the enzymes
responsible for converting xylose to the entry intermediate xylulose-5-phosphate of PP pathway
are missing in P. putida. By introducing the relevant enzymes XylA and XylB, P. putida
KT2440 was able to utilize xylose.
In addition, the recombinant P. putida KT2440 appeared to have an efficient xylose uptake
system. Similarly, P. putida S12 carrying D-xylonate dehydratase has been reported to grow on
xylose without expressing any xylose transporter [152]. Since pentose and hexose transporters
have been shown to be promiscuous [92], it is possible that xylose uptake can be accomplished
by glucose uptake systems in strain KT2440 (xylAB). Many bacteria also possess non-specific
transporters. Indeed, many sugars are transported into E. coli by phosphoenolpyruvate-
Chapter 2: Production of mcl-PHAs using xylose
68
dependent phosphotransferase systems (PTS) like glucose, mannose, fructose, and N-
acetylglucosamine [153]. In this study, no specific xylose transporters such as XylE or XylFGH
were needed for growth of KT2440 (xylAB) on xylose. Thus, it is also possible that xylose
entered the cell through the fructose PTS system present in P. putida in a similar way as reported
for fructose [154]. Xylose, after uptake into the cell, is isomerized by xylose isomerase to
xylulose, which is then converted by xylulokinase to xylulose 5-phosphate. This
phosphorylated derivative is then catabolized by the pentose phosphate pathway. In comparison
to growth on glucose, the growth of P. putida KT2440 (xylAB) on xylose exhibited a similar
specific growth rate of 0.24 h-1 (Table 2.3). This demonstrated that the catabolic rate of xylose
by the recombinant P. putida KT2440 (pSLM1) is in the same range as that of glucose.
PHA production by sequential feeding
The biosynthesis of mcl-PHA is mainly studied for fluorescent pseudomonads, e.g. P. putida
KT2440. Strain KT2440 is characterized by a wide metabolic and physiologic versatility and is
able to accumulate mcl-PHA from glucose [119]. In this study, we demonstrated that mcl-PHA
biosynthesis on xylose does not occur when xylA and xylB are expressed even under nitrogen
limitation, perhaps because the expression of xylAB channels the metabolic flux to central
metabolism such as TCA cycle for cell maintenance or/and to production of side products like
acetate, rather than to PHA synthesis (Fig. 2.4).
Chapter 2: Production of mcl-PHAs using xylose
69
Fig. 2.4. Hypothetical pathway for mcl-PHA accumulation from xylose in P. putida. Dashed
arrows: steps absent in wild-type P. putida strains; XylA: xylose isomerase; XylB:
xylulokinase; PhaG: 3- hydroxyacyl-ACP:CoA transferase; PhaC: PHA polymerase.
Up to now, there has been no report on mcl-PHA production by using xylose as the growth
substrate. Substrate costs make up a large proportion of the total production cost of PHA. Fatty
acids are generally much more expensive than lignocellulose hydrolysates (such as xylose) and
often toxic to the cells at relatively low concentrations and, for some of them, do not support
3-Ketoacyl-CoA
D-Xylose
Pyruvate
β-D-Fructose-1,6P
Glyceraldehyde-3P
Malonyl-CoA
Malonyl-ACP
Acyl-ACP
3-Ketoacyl-ACP
R-3-Hydroxyacyl-
ACP
Enoyl-
ACP
S-3-Hydroxyacyl-
CoA
Enoyl-CoA
Acyl-CoA
mcl-PHAs
XylA XylB
PhaC
PhaG
R-3-Hydroxyacyl-
CoA
Octanoic acid
D- Xylulose β-D-Fructose-6P D- Xylulose-5P
Acetate
ATP ADP
Acetyl-CoA
Chapter 2: Production of mcl-PHAs using xylose
70
fast growth rates. Xylose is in a similar price range like cane molasses and half the price of
glucose [155], consequently, sequential-feeding strategies are a valid option to reduce the
production cost [156, 157]. Sequential-feeding consists of using on one hand cheap
carbohydrates for achieving a large biomass and on the other hand fatty acids as mcl-PHA
precursors to produce tailor-made mcl-PHAs.
In the fed-batch experiments, xylose was used for cell growth in the first step, and then
octanoate was supplied to synthesize mcl-PHA in the second step under nitrogen limitation.
This sequential feeding process allowed a tailor-made mcl-PHA accumulation of up to 20% (w
w-1) under not-yet-optimized conditions. When 10 mM octanoate was employed alone for
growth and PHA production (Table 2.3, entry C), lower PHA content (about 21% w w-1) was
obtained than that from using both xylose and 10 mM octanoate (Table 2.3, entry G, about
28.7% w w-1), even though the growth rate and the final cell optical density reached in entry C
were higher than those in entry G. These results suggest that xylose is not a substrate as good
as octanoate for growth of KT2440, however, it can facilitate the PHA production by being a
substrate for growth and allowing only octanoate to be converted to PHA.
In this study, P. putida KT2440 (pSLM1) showed a biomass yield from xylose at 0.50 g g-1,
which is similar to what has been reported from glucose at 0.41 g g-1 [158]. Previously, Kim
and co-workers used a sequential feeding strategy to maximize the PHA production in P. putida
using glucose as growth substrate and then octanoic acid for PHA accumulation [159]. A yield
of 0.4 g mcl-PHA g-1 octanoic acid was reached [159], similar to the yield of 0.37 g mcl-PHA
g-1 octanoic acid obtained in this study by sequential feeding of xylose and octanoic acid.
However, it has also been reported that the yield of mcl-PHAs from fatty acids such as nonanoic
acid could achieve 0.66 to 0.69 g−1 mcl-PHA g nonanoic acid by co-feeding glucose [157].
Chapter 2: Production of mcl-PHAs using xylose
71
Therefore, further optimization of the sequential-feeding process is needed to increase the yield
of tailor-made mcl-PHAs.
Conclusions
In P. putida KT2440, introduction of xylAB from E. coli were sufficient to allow the
recombinant to efficiently utilize xylose as the sole carbon source. Experiments performed in
bioreactors showed that XylA and XylB were active in P. putida KT2440. The recombinant did
not produce mcl-PHA from xylose, thus enabled production of a tailor-made mcl-PHA of up to
20% (w w-1) by sequential-feeding of xylose and octanoate. A maximal yield of mcl-PHA from
octanoic acid of 0.37 g mcl-PHA g-1 octanoic acid was obtained containing mainly 3-
hydroxyoctanoate monomers (87% w w-1). Indeed, sequential feeding of relatively cheap
carbohydrates and expensive fatty acids is a practical way to achieve more cost-effective mcl-
PHA production. Optimization of initiation, rate and duration of feeding should be performed
to achieve a higher yield and higher productivity of mcl-PHA. Furthermore, optimized growth
conditions will undoubtedly contribute to the economic feasibility of mcl-PHA production from
renewable feedstock.
Authors’ contributions
SLM carried out the experiments, and drafted the manuscript. MZ and TE participated in the
design of the study and helped to draft the manuscript. LTM helped with manuscript
preparation. QR conceived of the study, and participated in its design and coordination and
helped to draft the manuscript. All authors read and approved the final manuscript.
Acknowledgement
This study was supported by a grant from Swiss National Science Foundation (SNSF). We
thank Stéphanie Follonier for her helpful advice.
Chapter 3
Construction and expression of recombinant
plasmids encoding for orfZ and phaC genes into an
inducible vector
Chapter 3: Construction and expression of inducible plasmid
74
Abstract
Poly (4-hydroxybutyrate) is a biodegradable and biocompatible polyester with high potential in
medical applications. Two enzymes are mainly responsible for the P4HB synthesis in
recombinant Escherichia coli, PHA synthase gene (phaC) from Ralstonia eutropha and a 4-
hydroxybutyric acid-coenzyme A transferase gene (orfZ) from Clostridium kluyveri. A two-
step pathway gives the ability to E. coli to convert 4-hydroxybutyric acid to poly (4-
hydroxybutyrate) homopolyester while precursor is supplemented in the medium broth. First,
OrfZ enzyme catalyzes a coenzyme A transferase reaction from 4HB to 4HB-CoA using free
coenzyme A or acetyl-CoA as donor. Then, PhaC enzyme polymerized 4HB-CoA into P4HB
with the concomitant release of CoA. Three different plasmids containing phaC and orfZ genes
with or without their respective promoters (i.e. inducible or not) were constructed through
classical DNA manipulation. P4HB accumulation was investigated in various batch studies;
however, low P4HB accumulation was observed in all tested strains.
Introduction
Biopolymers are a versatile class of compounds, which leads to an important growth of polymer
industry, evidenced by the wide spectrum of emerging applications in every sector of the
economy. Polyhydroxyalkanoates (PHAs) can be classified according to monomer chain length
into three categories: short-chain-length (scl) PHAs with 3 to 5 carbon atoms, medium-chain-
length (mcl) PHAs with 6 to 14 carbon atoms and long-chain-length (lcl) PHAs with more than
14 carbon atoms [22]. PHAs are accumulated in bacterial cytoplasm mainly under growth
limiting conditions. Poly (4-hydroxybutyrate) (P4HB) has attracted many attentions recently
due to its interesting properties such as its biodegradability, biocompatibility and flexibility,
leading to a wide variety of medical applications like tissue engineering and drug delivery.
P4HB is the first and only PHA-based product approved by the FDA in 2007 for clinical
Chapter 3: Construction and expression of inducible plasmid
75
application (TephaFLEX®) as absorbable suture. In addition, P4HB is extremely well tolerated
in vivo given that the hydrolysis of P4HB yields 4HB which is already present in the human
body [38].
One of the key enzymes of PHA biosynthesis is PHA synthase (PhaC). This enzyme
polymerizes coenzyme A (CoA) thioesters of hydroxyalkanoic acids (HAs) into PHAs with the
concomitant release of CoA (Fig. 1). Another important enzyme of the P4HB biosynthesis is 4-
hydroxybutyryl-CoA transferase (OrfZ) which belongs to CoA-transferases. It catalyzes the
transfer of CoA to 4-hydroxybutyric acid (Fig. 3.1). 4-hydroxybutyryl-CoA is an acyl-CoA
resulting from the condensation of the thiol group of coenzyme A with the carboxy group of 4-
hydroxybutyric acid. Three families of CoA-transferases were described which differ in
sequence and reaction mechanism [160]. E. coli wild-type strain is not able to accumulate
P4HB. Introduction of plasmid pKSSE5.3, which carries PHA synthase gene (phaC) from
Ralstonia eutropha and a 4-hydroxybutyric acid-coenzyme A transferase gene (orfZ) from
Clostridium kluyveri, enables E. coli strains to produce P4HB when 4HB is supplied in the
culture medium [64].
These orfZ, phaC and truncated phaA’ genes were ligated into pBluescript to obtain pKSSE5.3
plasmid [64]. Previously, orfZ gene from C. kluyveri was cloned into pCK3pSK to study the
succinate degradation pathway [161]. The 1.8 kb fragment carrying orfZ gene was inserted into
pBluescript vector together with a 3.5 kb fragment containing phaC gene and partial β-
ketothiolase encoding gene phaA’ from R. eutropha isolated from pSK2665 [64, 162].
Expression of both phaC and orfZ from pKSSE5.3 is driven by their native promoters, which
are not inducible by isopropyl β-D-1-thiogalactopyranoside (IPTG).
Chapter 3: Construction and expression of inducible plasmid
76
Figure 3.1: Synthetic pathway of poly(4-hydroxybutyrate) in E. coli recombinant. OrfZ: 4-
hydroxybutyric acid CoA: CoA transferase from C. kluyveri; PhaC: PHB synthase from R.
eutropha.
In order to initiate the expression of phaC and orfZ at desired time, inducible expression is
needed. Three different approaches were investigated. In the first approach, orfZ and phaC
without their respective promoter regions were digested, and then these two genes were cloned
together into the selected vector. Both genes were expressed through T7 promoter present in
pET22b plasmid in recombinant E. coli BL21 (DE3). In the second approach, the fragment
containing phaC gene, orfZ promoter and orfZ gene, was cut and inserted into pET22b. phaC
gene was transcribed under the control of T7 promoter of pETT22b and then the putative orfZ
promoter initiated the transcription of orfZ gene in the recombinant E. coli BL21 (DE3). The
4-hydroxybutyric acid CoA: CoA
transferase (OrfZ)
PHB synthase (PhaC)
SH-CoA
SH-CoA
4HB
4HB-CoA
P4HB
n
Chapter 3: Construction and expression of inducible plasmid
77
third approach was to clone orfZ gene alone and phaC with its promoter region and to insert
them into pET22b. In the last strategy, orfZ gene is under the control of T7 promoter but phaC
was cloned with its own promoter. E. coli BL21 (DE3) was transformed with one of the three
different constructions. This E. coli strain was selected due to its ability to synthesize T7 RNA
polymerase which was mandatory to start the transcription through the T7 promoter. The three
different strategies are represented in figure 3.2.
pSLM20
pSLM21
pSLM22
Figure 3.2: Three different plasmid constructions to direct the expression of phaC and orfZ
genes in pET22b vector when expressed in E. coli BL21 (DE3).
Materials and methods
DNA manipulation
Plasmid pKSSE5.3, derived from pBluescript, carries genes encoding PHB synthase (PhaC)
from R. eutropha and 4-hydroxybutyryl-CoA transferase (OrfZ) from C. kluyveri [64]. This
phaC orfZ
NdeI BamHI EcoRI
I I I
NdeI BglII EcoRI
phaC phaA’ orfZ promoter orfZ
I I I
orfZ phaC promoter phaC
NdeI EcoRI XhoI XhoI
I I I I
Chapter 3: Construction and expression of inducible plasmid
78
plasmid enables E. coli to produce P4HB from 4HB precursor [64, 66]. In order to direct the
expression of both phaC and orfZ genes, three different approaches were planned.
The first approach was named “pSLM20”: First, phaC gene was amplified by PCR using the
couple of primers: ForPhaC_NdeI: 5’ GTACCATATGGCGACCGGCAAAG 3’ and
RevPhaC_BamHI: 5’ CACGGATCCAAGCGTCATGCCTTG 3’ using the pKSSE5.3 plasmid
as template. Then, the obtained PCR fragment of phaC (1.77 kb) was cut, gel purified and
digested by NdeI and BamHI. The digested fragment was purified using the “PCR clean up kit”
(Fisher Scientific, Wohlen, Switzerland). The purified plasmid pET22b was also digested using
the same enzymes. Then, phaC fragment was ligated into the pET22b plasmid. The ligation
solution was used to transform competent E. coli DH5α. The colonies obtained were used to do
“Rusconi analysis”. Rusconi analysis consists in a fast plasmid separation which allows to
differentiate the recombinants according to the size of their plasmids. The recombinant cells
were incubated at 37 °C for at least 6 hours. Then, 400 µL of culture were spin down (1 min at
13'000 rpm). The supernatant was removed completely and 25 µL Rusconi-mix containing 1.0
mL of lysozyme (10 g L-1 in H2O), 1.0 mL EDTA (0.5 M), 500 µL Tris (1M, pH 7.5), 250 µL
RNase (20 g L-1), 7.0 mL 10.3% sucrose, 250 µL bromphenol blue-solution, was added to the
pellet (S. Rusconi, unpublished method). The pellet was suspended by vortexing and incubated
for 15 min at room temperature. Then, 20 µL of neutral phenol was added and mixed by
vortexing. The mixture was centrifuged for 2 min at 13'000 rpm and 15 µL of supernatant was
loaded on an electrophoresis gel.
The colonies showing different trends than the others were used to do plasmid purifications. In
order to check the orientation of the constructs, purified plasmids from these colonies were
digested by NdeI and BamHI to detect only the phaC insert and by EcoRI to linearize the
construct. The correct plasmid containing phaC gene was used to insert the orfZ gene.
Chapter 3: Construction and expression of inducible plasmid
79
The orfZ gene was obtained from PCR using the following primers: ForOrfZ_BamHI (5’
CTGCTGCGTGGATCCTAGTAAGCTTAAG 3’) and RevOrfZ_EcoRI (5’
GCAGGGAATTCCCTTCATATAAAGTGTAAC 3’) (pSLM20) using pKSSE5.3 plasmid as
template or was obtained by cutting pKSSE5.3 plasmid by BglII and EcoRI (pSLM21) (Figure
3.2). The orfZ gene was ligated into pET22b+phaC plasmid which was digested by EcoRI and
NdeI. The obtained plasmid containing orfZ and phaC genes was used to transform E. coli
DH5α. Another Rusconi analysis was performed to select the right clones. Then, digestions by
NdeI and EcoRI of the obtained plasmids were done in order to confirm the orientation of the
right constructs.
For pSLM22, orfZ fragment was digested by BamHI and EcoRI and cloned into pUC18 in order
to take the NdeI restriction site from this plasmid. The fragment was then digested by NdeI and
EcoRI. The phaC gene with its promoter was cut from pKSSE5.3 plasmid by SmaI and XhoI.
Then, this 3.5 kb was inserted into pJET 1.2 blunt end and used to transform E. coli DH5α.
Plasmid purification was done and the obtained plasmid was digested by XhoI. The digested
XhoI fragment containing phaC and its promoter was ligated into pET22b which contained
already orfZ gene. The new purified plasmid was controlled by digestion with XhoI and NdeI
and by EcoRI. Finally, three different plasmids named respectively pSLM20, pSLM21 and
pSLM22 were used to transform E. coli BL21 (DE3). P4HB accumulation and growth studies
were performed according to induction of T7 promoter at various physiological stages.
Growth study
Recombinant E. coli BL21 (DE3) growth studies were performed on minimal E2 medium
supplemented with 4 g L-1 Na-4HB, 10 g L-1 glucose, 1 g L-1 NZ-amines and 100 mg L-1
ampicillin in 1 L shake flasks with an agitation of 150 rpm. The temperature was set to 37 °C,
Chapter 3: Construction and expression of inducible plasmid
80
32°C or 30°C. IPTG as inducer of T7 lac promoter was added to the culture broth at different
concentrations and cultivation times according to the design of the experiments.
Cell concentration
The growth of bacterial cells was estimated by measuring the optical density at 600 nm (OD600)
of samples taken periodically using a UV-visible spectrophotometer (Genesys 6,
ThermoSpectronic, Switzerland).
PHA analysis
PHA content and composition were determined according to a method described previously
[98]. Methylene chloride containing benzoic acid (0.1 g L-1) was used as internal standard.
Purified P4HB was used to obtain standard curves. Na2CO3 powder was added to dry the
extracted chlorinated solvent phase. The samples were analyzed by gas chromatography (GC)
(A200s, Trace GC 2000 series, Fisons Instruments, Rodano, Italy) equipped with a polar fused
silica capillary column (Supelcowax-10: length 30 m; inside diameter 0.31 mm; film thickness
0.5 µm; Supelco, Buchs, Switzerland) [163]. P4HB was depolymerized, esterified and
methylated, leading to three different peaks in the GC chromatogram which were usually
observed during P4HB homopolymer analysis [64].
Synthesis of 4HB
The simplest way to produce 4HB is by the hydrolysis of the corresponding lactone to the
desired hydroxy acid. Ester hydrolysis can be done using a base to catalyze the reaction. The
base catalyzed reaction is chosen because the reaction is not reversible. The reaction proceeds
equimolarly and there are no byproducts produced in this reaction. The sodium salt of 4HB is
obtained.
Chapter 3: Construction and expression of inducible plasmid
81
Gamma-butyrolactone + NaOH Sodium 4-hydroxy butyrate (Na-4HB)
Results
Cloning strategy
Three different plasmids containing phaC and orfZ genes with or without their respective
promoters were constructed through classical DNA manipulations. Digestions were performed
to check the pSLM20 and pSLM21constructions for the selected recombinants. First, phaC
ligated into pET22b was digested by NdeI and BamHI to cut the insert (Digestion n°1, Fig. 3.3).
Typically, two bands at 5.5 (size of the plasmid) and 1.8 kb (size of phaC) were seen for the
three tested colonies. The plasmid was also digested by EcoRI in order to control the total
plasmid size by linearization. Achievement of the desired plasmid was confirmed by
linearization (Digestion °2, Fig. 3.3). The colony n°1 was chosen to perform the plasmid
purification. Simultaneously, orfZ gene alone (pSLM20) or orfZ with its promoter and truncated
phaA’ (pSLM21) was amplified by PCR, digested by BamHI and EcoRI and purified.
Chapter 3: Construction and expression of inducible plasmid
82
Figure 3.3: Gel electrophoresis of the digestion by NdeI and BamHI (Digestion n°1) and
linearization (Digestion n°2) by EcoRI of the obtained construction for pSLM20 and pSLM21.
Then, fragment containing orfZ gene was inserted after the phaC gene into pET22b for pSLM20
and pSLM21. The construct was confirmed by digestion using NdeI and EcoRI.
Figure 3.4: Digestion by NdeI and EcoRI of the constructs resulted from pSLM20 and pSLM21
on gel electrophoresis picture.
Plasmids were digested by NdeI and EcoRI for pSLM20 (a1 and a2) and pSLM21 (b1 and b2)
in order to cut the insert meaning the ligated phaC and orfZ (Fig. 3.4). The control pET22b +
phaC was cut by NdeI and BamHI. Expected sizes of 3.3 kb (phaC + orfZ) and 5.5 kb (pET22b
+ plasmid) were observed for both clones “a”. For pSLM21, bands at 5.77 (phaC + promoter
of orfZ + orfZ) and 5.5 kb were observed for the clone b1 (Fig. 3.4). The control revealed 3
Digestion n°1 Digestion n°2
Colony: 1 14 22 1 14 22
a1 a2 b1 b2 control
Chapter 3: Construction and expression of inducible plasmid
83
bands: 7.3 kb (non-digested plasmid), 5.5 kb (pET22b plasmid) and 1.8 kb (phaC) as shown in
figure 3.4.
orfZ gene was amplified by PCR using different primers than for the first cloning strategies
(pSLM20 and pSLM21). For the last strategy, named pSLM22 plasmid, purified orfZ fragment
was digested by NdeI and EcoRI as well as pET22b plasmid. orfZ digested fragment and
pET22b digested plasmid were ligated leading to a new plasmid which was digested by XhoI.
pKSSE5.3 plasmid was digested by XhoI and SmaI and the resulting 3.5 kb fragment containing
phaC gene and its promoter was cut and purified. This fragment was then inserted into pJET1.2
to get two XhoI sites at both ends. Then, the inserted fragment was digested by XhoI and ligated
into pET22b containing orfZ gene. The obtained plasmid was digested by NdeI and XhoI
(digestion n°1) and by EcoRI (digestion n°2) to be linearized (Fig. 3.5). Expected fragment
sizes were observed at 5.5 kb (pET22b plasmid), 3.5 kb (phaC gene and its promoter) and 1.4
kb (orfZ gene) (Fig. 3.5). Linearized plasmid also gave the right size (10.4 kb). Then, this
plasmid was used to transform E. coli BL21 (DE3).
Figure 3.5: pSLM22 construction containing orfZ gene and phaC genes and its promoter,
digested by NdeI and XhoI (digestion n°1) or by EcoRI (digestion n°2) for linearization.
Digestion: 1 2
Chapter 3: Construction and expression of inducible plasmid
84
To summarize, three different genetic constructions were obtained as illustrated in the figure
3.6. Each of them should allow directing the expression of one or two genes at a specific time
point of recombinant E. coli BL21 (DE3) cultivation.
Figure 3.6: Cloning strategies for an inducible system for P4HB accumulation.
Growth studies
Growth studies were performed using recombinant E. coli BL21 (DE3) pSLM20 and pSLM21
in minimal E2 medium supplemented with 4 g L-1 Na-4HB, 10 g L-1 glucose, 1 g L-1 NZ-amines
pSLM20 pSLM21
pSLM22
Chapter 3: Construction and expression of inducible plasmid
85
and 100 mg L-1 ampicillin. In order to avoid lag phase, the same preculture media was used as
the main cultivation media. Recombinant cells were grown at 37°C in 1 L shake flasks.
Induction was performed using 1 mM IPTG at the beginning of the cultivation for both
recombinants.
Figure 3.7: Growth studies of recombinant E. coli BL21 (DE3) pSLM20, induced with different
IPTG concentration at 30°C or 37°C. Stars and arrows represent the sampling for SDS-PAGE
experiments and for P4HB analysis, respectively.
Cells reached a maximal OD600 of 2 with a growth rate of 0.28 h-1 at 37°C. No significant
P4HB accumulation was observed for induced and non-induced (data not shown). It seems that
induction with 1 mM IPTG may lead to inclusion body formation, leading to inactive PhaC
and/or OrfZ. In order to study this hypothesis, further growth studies were performed with
0
0,5
1
1,5
2
2,5
0 5 10 15 20 25
OD
600
Time (h)
37°C OD - 0 mM IPTG OD - 0.1 mM IPTG OD - 0.2 mM IPTG OD - 0.5 mM IPTG
0
0,5
1
1,5
2
0 5 10 15 20 25
OD
600
Time (h)
30°C OD - 0 mM IPTG OD - 0.1 mM IPTG OD - 0.2 mM IPTG
OD - 0.5 mM IPTG OD - 1 mM IPTG
*
*
µ= 0.24 h-1
µ= 0.28 h-1
Chapter 3: Construction and expression of inducible plasmid
86
different IPTG concentrations and at two different temperatures: 30°C and 37°C. The growth
conditions mentioned above were identical as those used in the following experiments.
Table 3.1: P4HB content for the different E. coli BL21 (DE3) pSLM20 cultures performed at
37°C and 30°C with various inducer concentrations.
IPTG concentration
% P4HB w w-1 0 µM 100 µM 200 µM 500 µM 1 mM
37°C 0.20 0.20 0.20 0.30 -
30°C 0.20 0.30 0.30 0.40 0.40
All the tested IPTG concentrations did not influence the growth of the recombinant strain
pSLM20. Only the temperature decreased the growth rate from 0.28 h-1 at 37°C to 0.24 h-1 at
30°C. Recombinant E. coli BL21 (DE3) pSLM20 reached a maximal OD600 of 2 at 37°C and a
maximal OD600 of 1.8 at 30°C. Furthermore, only trace amounts of P4HB were detected in any
of the samples by GC analysis (Table 3.1). SDS-PAGE was performed using the soluble
fraction and the non-soluble fraction of the cell extracts after 6.5 h cultivation, meaning 1.5 h
induction. The theoretical size of PhaC is about 67 kDa and OrfZ is about 55 kDa.
Chapter 3: Construction and expression of inducible plasmid
87
Non-soluble fraction
Soluble fraction
Figure 3.8: SDS gels from the non-soluble and soluble fractions using the different cultivations
performed with various IPTG concentrations.
In the soluble fraction, a band was observed at around 70 kDa and seems to correspond to PhaC
size (67 kDa). Another band was detected at 55 kDa which could correspond to OrfZ. However,
these bands did not increase with the IPTG concentration (Fig. 3.8). Furthermore, these bands
are also present for the non-induced sample.
The fact that only trace amounts of P4HB were detected when E. coli recombinants were grown
on glucose as growth carbon substrate, suggests that induction of T7 promoter from pET22b
did not result in active PhaC and OrfZ. To investigate this influence of the growth carbon
30°C 37°C
0 µM 100 µM 200 µM 500 µM 1mM 0 µM 100 µM 200 µM 500 µM
37°C 30°C
0 µM 100 µM 200 µM 500 µM 0 µM 100 µM 200 µM 500 µM 1mM
Chapter 3: Construction and expression of inducible plasmid
88
substrate on orfZ and phaC expression as well as on the P4HB accumulation, another growth
study was performed using exactly the same conditions as previously used for 37 °C, but using
glycerol instead of glucose as the carbon source. Utilization of glycerol should allow to
counteract the possible inhibition applied on the Lac promoter by glucose. E. coli BL21 (DE3)
pSLM20 was grown at 37°C in E2 medium with 10 g L-1 glycerol, 1 g L-1 NZ-amines, 4 g L-1
Na4HB and 100 mg L-1 ampicillin. Different concentrations of IPTG were added to the cultures
at the end of the exponential phase to induce the expression of phaC and orfZ.
Figure 3.9: Growth study of the recombinant E. coli BL21 (DE3) pSLM20 induced by different
IPTG concentrations while growing on glycerol at 37°C.
E. coli BL21 (DE3) pSLM20 grew on glycerol without lag phases until a maximal OD600 of 5.5
with a growth rate of 0.35 h-1. Once again, only trace amounts of P4HB were detected by GC
analysis.
-1,5
-1
-0,5
0
0,5
1
1,5
2
0 5 10 15 20 25 30
Ln O
D600
Time (h)
a1-A1 a1-B1 a1-C1 a1-D1 a1-E1
Addition of IPTG
[IPTG] 0 µM 100 µM 200 µM 500 µM 1mM
Chapter 3: Construction and expression of inducible plasmid
89
Further growth studies were performed with strain pSLM21 under the same conditions in order
to confirm the obtained results (OD, growth rate, PHA content). Two temperatures were tested:
37°C and 30°C, with a non-induced culture and an induced culture with 500 µM of IPTG. This
study showed exactly the same trend as the previous one. An SDS-PAGE was performed using
total proteins extracts from 8 h of cultivation (3.5 h after induction) and 24 h of cultivation (19.5
h after induction) for each temperature. No differences were observed for the induced and the
non-induced cultures at 37°C and 30°C; all the protein bands were similar. It seems that the
phaC and orfZ genes were not expressed even with glycerol as carbon source. Furthermore, no
P4HB was detected for both cultivations.
Another growth study with E. coli BL21 (DE3) pSLM22 was performed on xylose using the
same experimental conditions as previously used for 37 °C. To compare the growth, negative
control containing no Na4HB was performed. E. coli BL21 (DE3) pSLM22 grew on xylose
directly without lag phase until a maximal OD600 of 5.2. As expected, no biopolymer
accumulation was detected by GC (P4HB < 0.5% w w-1) for the induced and non-induced
cultures (Fig 3.10).
Chapter 3: Construction and expression of inducible plasmid
90
Figure 3.10: Growth studies in shake flasks of E. coli BL21 (DE3) pSLM22 on xylose with and
without induction at 37°C.
It may be possible that E. coli strain BL21 (DE3) as host strain is not suitable for P4HB
production. In order to prove this hypothesis, experiments using E. coli BL21 (DE3) with the
original pKSSE5.3 plasmid were performed with identical growth conditions at 37°C in E2
medium with 10 g L-1 glucose or xylose, 1 g L-1 NZ-amines, 4 g L-1 Na4HB and 100 mg L-1
ampicillin.
E. coli BL21 (DE3) (pKSSE5.3) was able to accumulate up to 7.02% w w-1 P4HB on glucose
which demonstrated that this strain is able to produce biopolymers (Table 3.2). It is possible
that an expression problem led to inactive enzymes for the three tested plasmids. Table 2
summarized the obtained results for recombinant transformed with different cloning strategies
and for E. coli BL21 (DE3) pKSSE5.3 control. However, the maximal P4HB content
accumulated by this strain was not high compare with previous E. coli pKSSE5.3 recombinants
[66].
-2,5
-2
-1,5
-1
-0,5
0
0,5
1
1,5
2
0 10 20 30 40 50 60
Ln O
D600
Time (h)
No Na4HB + 100 µM IPTG(A) No induction + Na4HB (B)
20 µM IPTG (C) 100 µM IPTG (D)
500 µM IPTG (E) 1 mM IPTG (F)
Chapter 3: Construction and expression of inducible plasmid
91
Table 3.2: Summary of P4HB content obtained from different recombinants of E. coli BL21
(DE3) grown on glucose, glycerol or xylose at different temperatures. Results presented in this
table were average values of at least two experiments.
% P4HB (w w-1)
Induction by IPTG
Strain Temperature 0 µM 20 µM 100 µM 200 µM 500 µM 1 mM
Glucose
E.
coli
BL
21 (
DE
3)
pSLM20
37°C 1.30 - 0.20 0.30 0.30 0.90
30°C 0.20 - 0.30 0.30 0.40 0.40
pSLM21 37°C 0.85 - - - - 0.75
pSLM22
32°C 0.40 0.17 0.13 - 0.20 0.20
30°C 0.55 0.05 0.15 - 0.15 0.20
pKSSE5.3 37°C 6.84 - - 7.02 1.00 -
Glycerol
pSLM20 37°C 0.30 - 0.40 0.20 1.00 0.80
Xylose
pKSSE5.3 37°C 3.98 - 1.00 5.77 1.70 -
Conclusions
The inducible expression of phaC and orfZ genes from the constructed plasmids did not lead to
meaningful amounts of P4HB, whereas the plasmid pKSSE5.3 introduced into E. coli BL21
(DE3) allowed synthesis of about 7% (w w-1) P4HB. In our previous studies [66], the best E.
coli strain was JM109 which was able to synthesize up to 22% (w w-1) of P4HB on glucose
when transformed with pKSSE5.3 plasmid. E. coli JM109 (pKSSE5.3) is K12 strain bacterium
while E. coli BL21 (DE3) is B strain bacterium with DE3, a λ prophage carrying the T7 RNA
polymerase gene and lacIq allowing to constitutively express the lac inhibitor and to bind to T7
Chapter 3: Construction and expression of inducible plasmid
92
promoter specifically. More than half of the 3793 proteins of their basic genomes of the B and
K-12 E. coli genomes are predicted to be identical, although about 310 appear to be functional
in either B or K-12 but not in both [43]. These genomic differences may impact the expression
levels of the phaC or orfZ genes needed for P4HB accumulation. It is not clear yet why the new
inducible plasmids (pSLM20, pSLM21 and pSLM22) do not allow P4HB synthesis. If inactive
PhaC and/or OrfZ inclusion bodies were formed after induction, analysis of the cell free extracts
by SDS-PAGE should highlight these protein bands, but it was not the case in the present work.
Moreover, no expression differences were observed between induced and non-induced cultures
for the three recombinants.
In order to gain deeper insights into this expression problem, transformation of E. coli JM109
(DE3) by the original plasmid as well as by each of the three inducible systems should be
performed to state on the ability of E. coli strain of accumulating high amounts of P4HB while
induced by IPTG. Furthermore, it seems also possible that both phaC and orfZ genes need their
own promoter systems. Expression of orfZ and phaC can be verified using quantitative real-
time PCR (qRT-PCR) in the different recombinants.
Chapter 4
Poly(4-hydroxybutyrate) (P4HB) production in
recombinant Escherichia coli: P4HB synthesis is
uncoupled with cell growth
Le Meur S, Zinn M, Egli T, Thöny-Meyer L, Ren Q,
Microbial Cell Factories 2013, 12:123
doi:10.1186/1475-2859-12-123
Chapter 4: P4HB production by recombinant E. coli using xylose
94
Abstract
Poly(4-hydroxybutyrate) (P4HB), belonging to the family of bacterial polyhydroxyalkanoates
(PHAs), is a strong, flexible and absorbable material which has a large variety of medical
applications like tissue engineering and drug delivery. For efficient production of P4HB
recombinant Escherichia coli has been employed. It was previously found that the P4HB
synthesis is correlated to the cell growth. In this study, we aimed to investigate the physiology
of P4HB synthesis, and to reduce the total production cost by using cheap and widely available
xylose as the growth substrate and sodium 4-hydroxybutyrate (Na-4HB) as the precursor for
P4HB synthesis.
Six different E. coli strains which are able to utilize xylose as carbon source were compared for
their ability to accumulate P4HB. E. coli JM109 was found to be the best strain regarding the
specific growth rate and the P4HB content. The effect of growth conditions such as temperature
and physiological stage of Na-4HB addition on P4HB synthesis was also studied in E. coli
JM109 recombinant in batch cultures. Under the tested conditions, a cellular P4HB content in
the range of 58 to 70% (w w-1) and P4HB concentrations in the range of 2.76 to 4.33 g L-1 were
obtained with a conversion yield (YP4HB/Na-4HB) of 92% w w-1 in single stage batch cultures.
Interestingly, three phases were identified during P4HB production: the “growth phase”, in
which the cells grew exponentially, the “accumulation phase”, in which the exponential cell
growth stopped while P4HB was accumulated exponentially, and the “stagnation phase”, in
which the P4HB accumulation stopped and the total biomass remained constant. P4HB
synthesis was found to be separated from cell growth, i.e. P4HB synthesis mainly took place
after the end of the exponential cell growth. High conversion rates and P4HB contents from
xylose and Na-4HB were achieved here by simple batch culture, which was only possible
previously through fed-batch high cell density cultures on glucose.
Chapter 4: P4HB production by recombinant E. coli using xylose
95
Background
Natural polyhydroxyalkanoates (PHAs) are synthesized by many microorganisms as carbon
and energy storage compounds and deposited as granules in their cytoplasm. PHA accumulation
takes place when bacterial cells grow under conditions where nutrients other than carbon
source, such as nitrogen or phosphorus, are limiting growth. Depending on the carbon substrate
supplied, PHAs with different composition are produced. They are classified as short-chain-,
medium-chain- and long-chain- length PHAs according to the number of carbon atoms of the
monomeric units [22]. Over a hundred different carboxylic acid monomers were reported to be
incorporated into PHAs [22], resulting in polymers with a wide range of material properties.
These natural polymers have attracted particular attention due to their biodegradability and
biocompatibility [164-166]. Among them, poly(4-hydroxybutyrate) (P4HB) is a highly
interesting polymer for various biomedical applications [53].
P4HB biosynthesis has been studied for about 20 years and it was, and still is, the first and only
PHA-based product approved by the FDA as an absorbable suture for clinical application. It is
a strong, flexible thermoplastic material that can be processed easily to scaffolds, heart valves
or cardiovascular tissue supports [53]. The most remarkable property of P4HB is its very high
elasticity and molecular weight, as both benchmark closely to ultra-high molecular weight
polyethylene [167]; it can be stretched 10-times its original length before breaking [53]. In
addition, P4HB is biocompatible and extremely well tolerated in vivo because biological
hydrolysis of P4HB yields 4HB, which is a common metabolite in the human body [38]. When
used in vivo, the degradation of P4HB implant takes place via surface erosion and does not lead
to a burst release of acid, which is an immense advantage for medical applications [53]. Thus,
it is highly desired to obtain P4HB in large scale at a competitive cost. It was reported that up
to 50% of the total cost of poly(3-hydroxybutyrate) (P3HB) arises from the carbon source [84].
Chapter 4: P4HB production by recombinant E. coli using xylose
96
Therefore, to reduce the cost of the carbon source used for large scale P4HB production,
agricultural derived feedstock such as processed hemicelluloses may be employed as a co-
substrate to produce the bacterial biomass.
Annually, 60 billion tons of hemicelluloses are produced and remain mostly unused [90].
Hemicellulose is the third most abundant polymer in nature and can be hydrolyzed into simple
sugars by either chemical or enzymatic hydrolysis [91]. The dominant building unit of
hemicelluloses is xylose. In some plants, xylose polymer (xylan) comprises up to 40% of the
total dry plant material. Xylose can be used as an industrially relevant carbon source for
bacterial growth, for example, by Escherichia coli strains [92].
Up to now, several wild-type bacterial strains have been reported to be able to produce P(3HB-
co-4HB) copolymer: Ralstonia eutropha, Alcaligenes latus, Comamonas acidovorans,
Comamonas testosteroni and Hydrogenophaga pseudoflava [168]. Saito and coworkers
reported the production of P(3HB-co-4HB) copolymers by R. eutropha using different carbon
sources with or without 4HB as precursor, however, only very low cellular polymer contents
were obtained [169]. It was also reported that a maximum of 21% w w-1 of P4HB can be
achieved by C. acidovorans when using 4HB or 1,4-butanediol as precursor [169]. Kim and
colleagues performed fed-batch experiments with R. eutropha supplying in the first step
fructose and in the second step only 4HB. They obtained a cell concentration of 33.6 g L-1 and
a P(3HB-co-4HB) copolymer content of 41.7% w w-1 with 25 mol.% 4HB [168]. To produce
P4HB homopolymers recombinant strains were mainly used.
It has been shown previously that microorganisms that do not produce PHA naturally are ideally
suited for the manipulation of the levels of the PHA biosynthetic enzymes and, hence, allow to
increase polymer productivity [170]. Wild-type E. coli strains cannot synthesize any type of
PHA, including P4HB. By introducing the P4HB synthesizing genes, recombinant E. coli
Chapter 4: P4HB production by recombinant E. coli using xylose
97
strains are able to produce P4HB through the newly acquired biosynthetic pathway. It has been
reported that the overexpression of PHA synthase (phaC) and β-ketothiolase (phaA) genes from
R. eutropha allowed C. acidovarans to produce up to 51% w w-1 P4HB [171]. By introducing
phaC from R. eutropha and a 4-hydroxybutyric acid-coenzyme A transferase gene (orfZ) from
Clostridium kluyveri, E. coli strain XL1-Blue was able to produce P4HB when 4HB was
supplied as a precursor in the culture medium [64]. A P4HB content of 58.5% w w -1 was
achieved in 100 mL shake flasks, however, information on the biomass concentration was not
provided [64]. Recently, Zhou et al. reported that E. coli JM109 mutant carrying two plasmids
reached about 1.9 g L-1 P4HB and 35% (w w-1) P4HB using LB medium containing glucose in
a batch culture [67]. There, LB rich medium was applied and two antibiotics were needed to
keep the plasmids, which might be too expensive for large-scale production.
The importance of choosing a suitable E. coli host strain for recombinant culture cultivation
was demonstrated by Luli and Strohl [172], who showed that specific growth rate, biomass
yield, and acetate formation varied significantly among different strains tested. It has also been
reported that among different E. coli strains E. coli JM109 was the only strain that allowed good
production of poly(L-aspartyl-L-phenylalanine) [173]. Up to now, little effort has been made
to understand the physiology of P4HB synthesis in E. coli.
In this study, we compared P4HB production in different E. coli recombinants and identified
the best E. coli strain regarding cell growth and P4HB accumulation. The effect of growth
conditions in batch culture was studied for following parameters: temperature, the carbon
source, and Na-4HB concentrations. Furthermore, the best physiological stage at which Na-
4HB precursor should be added was investigated. P4HB productivity of 0.027 w w-1 h-1 with
excellent conversion yield YP4HB/Na-4HB of 92% w w-1 was achieved.
Chapter 4: P4HB production by recombinant E. coli using xylose
98
Methods
Bacterial strains and plasmids
The E. coli strains used in this study are listed in Table 4.1. Among them, XL1-Blue, S17-1 and
JM109 were previously used for P4HB production [64, 65, 174], and thus were selected here
for comparison purpose. The previously constructed plasmid pKSSE5.3 carrying a PHA
synthase gene (phaC) from R. eutropha and a 4-hydroxybutyric acid-coenzyme A transferase
gene (orfZ) from C. kluyveri was used in this study [64].
Table 4.1: E. coli strains used in this study.
Strains Relevant characteristics References
DH5α
F–, ø80dlacZΔM15, Δ(lacZYA-argF)U169, deoR, recA1,
endA1, hsdR17(rK–, mK+), glnV44, supE44, λ-, thi-1, gyrA96,
relA1, nupG
[175]
JM109
endA1, glnV44, thi-1, relA1, gyrA96, recA1, mcrB+, Δ(lac-
proAB), e14-, [F' traD36, proAB+, lacIq, lacZΔM15],
hsdR17(rK-mK
+)
[176]
XL-1 Blue endA1, gyrA96(nalR), thi-1, recA1, relA1, lac, glnV44,
F'[ ::Tn10, proAB+, lacIq, Δ(lacZ)M15], hsdR17(rK- mK
+) [177]
S17-1 tmpR, spcR, strR, recA pro hsdR RP4-2-Tc::Mu-Km::Tn7 [178]
W3110 F,- λ-, rph-1, INV(rrnD, rrnE) [139]
BL21(DE3) F-, ompT, gal, dcm, lon, hsdSB(rB
- mB-), λ(DE3), [lacI lacUV5-
T7 gene 1 ind1 sam7 nin5]) [179]
Plasmid
pKSSE5.3 phaC, orfZ, Ampr [64]
Chapter 4: P4HB production by recombinant E. coli using xylose
99
Chemicals, media and cultivation conditions
Chemicals
All chemicals were purchased from Sigma-Aldrich (Buchs, Switzerland).
Synthesis of Na-4HB
One of the simplest and low-cost ways to obtain 4HB is by hydrolysis of the corresponding
lactone to the desired hydroxy acid. The reaction was proceeded with equal molar of gamma-
butyrolactone and NaOH [180]. In detail: 4 M NaOH solution was prepared and mixed slowly
to 4 M of gamma-butyrolactone on ice. After the reaction mixture was cooled down to room
temperature, it was analyzed by HPLC/MS ([147], also see below). An almost 100% conversion
of gamma-butyrolactone to Na-4HB was achieved.
Media
E. coli strains were cultivated overnight in LB medium with 100 µg mL-1 ampicillin. This
culture was used to inoculate the preculture containing modified E2 medium [23]. Modified E2
medium contained the following constituents: NaNH4HPO4· 4H2O 3.5 g L-1, KH2PO4 3.7 g L-
1, K2HPO4 7.5 g L-1, dissolved in 1 L of water. One mL L-1 of 1 M MgSO4·7H2O was added to
the medium. One mL L-1 of trace elements (TE) dissolved in 1 M HCl was also added. TE
contained: FeSO4·7H2O 2.78 g L-1, CaCl2·2H2O 1.47 g L-1, MnCl2·4H2O 1.98 g L-1,
CoCl2·6H2O 2.38 g L-1, CuCl2·2H2O 0.17 g L-1, ZnSO4·7H2O 0.29 g L-1. Xylose, glucose or
glycerol (10 g L-1) was used as the sole carbon source.
Growth in shake flasks
Growth studies were performed in 1 L shake flasks containing 200 mL of modified E2 medium
and 10 g L-1 of a carbon source. One g L-1 of NZ-amines and 100 µg mL-1 of ampicillin were
Chapter 4: P4HB production by recombinant E. coli using xylose
100
added to the minimal medium. Na-4HB (1 to 6 g L-1 according to the experiment) was added
as P4HB precursor as indicated in individual experiments.
Culture in 1 L bioreactors
Four 800 mL reactor cultures were grown in parallel in 1 L Multifors benchtop bioreactors
(Infors AG, Bottmingen, Switzerland). Temperature was controlled at 32°C with an external
circulating water bath, and pH was maintained at 7.0 +/- 0.1 by automatic addition of 25%
NaOH or 30% H3PO4. Dissolved oxygen tension was monitored continuously with an oxygen
probe (Infors AG, Bottmingen, Switzerland) and kept always above 30% oxygen saturation.
The agitation was set at 500 rpm. Each reactor was inoculated using a preculture prepared as
described above in “Growth in shake flasks”. The initial OD600 value in bioreactors was
between 0.10 and 0.30. The modified E2 medium was used to perform all the growth studies in
1 L reactors supplemented with 10 g L-1 of carbon source, 1 g L-1 of NZ-amines, 4 g L-1 of Na-
4HB and 0.015 g L-1 of thiamine. Ampicillin was added to a final concentration of 100 µg mL-
1 to maintain the pKSSE5.3 plasmid.
Analytical methods
Cell concentration
Growth of bacterial cells was followed by measuring optical density at 600 nm (OD600) using a
UV spectrophotometer (Genesys 6, ThermoSpectronic, Switzerland).
Cell dry weight was determined either by using pre-weighed polycarbonate filters (pore size
0.2 µm, Whatman, Scheicher & Schuell, Dassel, Germany) or by pre-weighed 2 mL Eppendorf
tubes. In the first method, an appropriate volume (0.5 to 5 mL) of culture was filtered in order
to obtain a biomass dry weight of about 2 mg per filter. The filter was dried overnight at 100
°C, cooled down to room temperature in a desiccator and then weighed. In the second method,
2 mL of culture broth was centrifuged at 12’000 g for 2 min in a 2 mL pre-weighed Eppendorf
Chapter 4: P4HB production by recombinant E. coli using xylose
101
tube. The supernatant was discarded and the cell pellet was dried overnight at 100 °C and cooled
down to room temperature in a desiccator. The 2 mL Eppendorf tube was then weighed. For
both methods, the weight difference was used to determine the dry biomass.
PHA content
PHA content and composition were determined according to a method described previously
[98]. Methylene chloride containing benzoic acid (0.1 g L-1) was used as internal standard. Own
lab purified P4HB was used for obtaining standard curves. Na2CO3 powder was added to dry
the extracted chlorinated solvent phase. The samples were analyzed by gas chromatography
(GC) (A200s, Trace GC 2000 series, Fisons Instruments, Rodano, Italy) equipped with a polar
fused silica capillary column (Supelcowax-10: length 30 m; inside diameter 0.31 mm; film
thickness 0.5 µm; Supelco, Buchs, Switzerland) [163]. P4HB was depolymerized, esterified
and methylated, leading to three different peaks in the GC chromatogram. These three peaks
were also observed by Hein and coworkers when P4HB homopolymers were analyzed [64].
Nitrogen concentration
NH4+-nitrogen consumption was detected using an ammonium test kit following the
manufacturer instruction (Merck KGaA, 64271 Darmstadt, Germany). The detection limit was
0.01 NH4+-nitrogen mg L-1. The method was linear up to 3.0 mg L-1, above which dilution with
distilled water was needed. The results obtained are in mg L -1 of nitrogen.
Measurement of xylose, Na-4HB, acetate, pyruvate and lactate
Concentrations of xylose, Na-4HB and acetate in the culture medium were measured by
HPLC/MS. Supernatant resulting from culture centrifugation at 12’000 g for 2 min was diluted
to a concentration between 0.01 and 0.1 mM with distilled water, filtrated through a Titan HPLC
filter (0.45 µm, Infochroma AG, Zug, Switzerland), and loaded on a reversed phase C18 column
(Gemini C18 5 micron, 250 mm x 4.60 mm, Phenomenex, U.K.). A gradient of 100% of diluted
formic acid (0.1 v % in water) to 100% of acetonitrile was applied as the mobile phase. The
Chapter 4: P4HB production by recombinant E. coli using xylose
102
flow rate was 0.8 mL min-1 and the gradient was completed after 25 minutes. The peaks were
detected by electrospray ionization (ESI) in negative mode [147]. Standard curves for xylose,
Na-4HB and acetate were recorded in the range of 0.01 to 1.00 g L-1, 0.01 g L-1 to 0.20 g L-1
and 0.01 to 1.00 g L-1, respectively.
Pyruvate and lactate in the culture supernatant were measured by ion chromatography (IC)
(Metrosep A SUPP 5 250, 4 x 250 mm). A flow of 0.7 mL min-1 of eluent containing 1 mM
NaHCO3 was used. Both acids were detected using a conductivity detector. A volume of 20 µL
of sample diluted with water to a range of 50 to 250 ppm was injected and analyzed by IC
system. Pure pyruvate and lactate were used to generate standard curves.
Calculation of conversion rate
Consumed Na-4HB was determined by the difference between the Na-4HB amount supplied at
the beginning of a cultivation and Na-4HB content left over in the medium after the cultivation.
The concentration of P4HB (g L-1) was determined from cell dry weight (CDW) in g L-1 and
the cellular content of P4HB (w w-1) obtained at the end the cultivation. The conversion rate
was calculated by dividing the mass of carbon in gram from P4HB with the mass of carbon in
gram from Na-4HB (w w-1).
Results
Comparison of different E. coli recombinants for and influence of 4HB concentrations on
P4HB production
Six different E. coli strains were transformed with plasmid pKSSE5.3 carrying the necessary
genes for P4HB synthesis, namely a PHA synthase gene (phaC) from R. eutropha and a 4-
hydroxybutyric acid-coenzyme A transferase gene (orfZ) from C. kluyveri. An initial screening
Chapter 4: P4HB production by recombinant E. coli using xylose
103
on the performance of the obtained recombinant strains was conducted in shake flasks
containing modified E2 medium with xylose as the growth substrate and Na-4HB for P4HB
synthesis. Specific growth rate, maximum optical density (OD600) and P4HB accumulation
were measured with time. For comparison, the same experiments were performed with glucose
as the growth substrate. The tested E. coli recombinants exhibited different specific growth
rates and accumulated different amounts of P4HB (Fig. 4.1). On both glucose and xylose, the
W3110 and BL21 (DE3) recombinants displayed a high specific growth rate, but accumulated
only negligible amounts of P4HB. Specific growth rates of DH5α and XL1-Blue recombinants
were much lower on xylose than on glucose, and the P4HB content in the range of 11% to 18%
(w w-1) was measured during growth on both sugars. On xylose the best performer for P4HB
production was the recombinant JM109, which exhibited a specific growth rate of 0.28 h-1 and
accumulated P4HB up to 19% (w w-1). E. coli JM109 (pKSSE5.3) was thus selected for further
studies.
Chapter 4: P4HB production by recombinant E. coli using xylose
104
Fig. 4.1: Comparison of P4HB accumulation in six recombinant E. coli strains. Cultures were
grown in shake flasks at 37°C in modified E2 minimal medium containing either glucose or
xylose (10 g L-1). Standard deviations in the table were obtained from four independent
measurements. There is a significant difference from t-test in the P4HB accumulation between
the strains growing on glucose and on xylose with t (5) value of 3.71 and p < 0.01.
In parallel, under the same conditions as described above and using glucose as growth substrate,
the effect of the 4HB concentration on cell growth and P4HB production was investigated.
When the modified E2 medium was supplemented with Na-4HB as the sole carbon source, no
growth was observed for E. coli JM109 (pKSSE5.3), demonstrating that Na-4HB cannot be
utilized by E. coli JM109 as carbon source for growth. The optimum concentration of Na-4HB
0
5
10
15
20
25
Glucose Xylose
% P
4H
B (
w w
-1)
DH5α JM109 W3110 XL-1 Blue S17-1 BL21(DE3)
Chapter 4: P4HB production by recombinant E. coli using xylose
105
for P4HB production was found to be between 2 g L-1 and 4 g L-1. Outside this range either low
amounts of P4HB were obtained, or growth inhibition took place (Table 4.2). Therefore, 4 g L-
1 Na-4HB was used in subsequent experiments.
Table 4.2: Influence of Na-4HB concentrations on P4HB accumulation in E. coli JM109
(pKSSE5.3). The cells were grown at 37°C for 30 h in shake flasks containing modified E2
medium supplemented with 10 g L-1 glucose, 1 g L-1 NZ-amines and 100 µg mL-1 ampicillin.
The standard deviations were obtained from three independent measurements.
1 g L-1 Na-4HB 2 g L-1 Na-4HB 4 g L-1 Na-4HB 6 g L-1 Na-4HB
OD600nm 1.77 ± 0.08 1.88 ± 0.02 1.94 ± 0.04 1.93 ± 0.06
% P4HB (w w-1) 2 ± 0.1 21 ± 0.4 23 ± 0.7 21 ± 0.9
µ (h-1) 0.32 ± 0.01 0.34 ± 0.02 0.33 ± 0.01 0.22 ± 0.01
Comparison of carbon sources for P4HB synthesis in JM109 (pKSSE5.3)
To produce P4HB under better controlled conditions, the selected JM109 (pKSSE5.3) was
cultivated in a 1 L bioreactor using modified E2 minimal medium containing xylose and 4HB.
For comparison, glucose and glycerol were used as growth substrates, respectively.
Table 4.3 shows that the cells grown on xylose and glucose reached a similar maximal OD600
with a similar specific growth rate. More P4HB was produced on xylose (32% w w-1) than on
glucose (19% w w-1). Grown on glycerol, the recombinant strain reached a much higher biomass
than on glucose or xylose. This difference cannot be caused by P4HB accumulation because
the cells synthesized only 12% (w w-1) of P4HB on glycerol, which is much lower than those
found during growth on either glucose or xylose. This result indicates that more carbon source
is channeled to biomass when grown on glycerol under the used conditions. The achieved P4HB
concentration of 0.41 g L-1 from glycerol was also lower than that from xylose (0.65 g L-1
P4HB).
Chapter 4: P4HB production by recombinant E. coli using xylose
106
Table 4.3: Comparison of carbon sources for growth and P4HB accumulation of E. coli JM109
(pKSSE5.3). The cells were cultivated in 1 L bioreactors at 37 °C with an agitation of 500 rpm
in modified E2 minimal medium supplemented with 4 g L-1 Na-4HB, 1 g L-1 NZ-amines, 100
µg mL-1 ampicillin and 0.015 g L-1 thiamine. Xylose, glucose or glycerol was used as the growth
substrate. The growth was followed over time and samples were taken after 25 h for P4HB
analysis. The data were obtained from two independent cultivations.
Carbon source Xylose Glucose Glycerol
OD600 3.4 ± 1.4 3.9 ± 1.1 7.6 ± 0.4
CDW (g L-1) 2.16 ± 0.37 2.04 ± 0.60 3.80 ± 0.18
µ (h-1) 0.32 ± 0.09 0.38 ± 0.04 0.35 ± 0.01
P4HB content % (w w-1) 32 ± 3.7 19 ± 6.4 12 ± 3.6
P4HB concentration (g L-1) 0.65 ± 0.11 0.36 ± 0.05 0.41 ± 0.00
Influence of temperature on growth and P4HB accumulation
Optimal temperature should support cell growth as well as product formation. Therefore, the
influence of temperatures at 30, 32, 34 and 37°C on growth and P4HB accumulation was
investigated. As expected, with the increase of temperature the specific growth rate increased
correspondingly (Fig. 4.2). Temperature also displayed a significant impact on P4HB
accumulation and the best temperature was found to be 32°C where about 37% (w w-1) of P4HB
was produced after 24 h of cultivation. Temperatures below or above 32°C resulted in
considerable decrease in P4HB content (Fig. 4.2). Thus, cultivation temperature was set to 32°C
for subsequent experiments.
Chapter 4: P4HB production by recombinant E. coli using xylose
107
Fig. 4.2: Influence of temperature on the growth and P4HB accumulation of E. coli JM109
(pKSSE5.3). The cells were grown in modified E2 minimal medium supplemented with 10 g
L-1 xylose, 4 g L -1 Na-4HB, 1 g L-1 NZ-amines, 100 µg mL-1 ampicillin and 0.015 g L-1
thiamine. Four different temperatures were tested: 30°C (♦), 32 °C (■), 34°C (▲) and 37°C (●).
Error bars represent the deviations from two independent measurements.
Impact of the precursor addition at different physiological growth stages on P4HB synthesis
Previously, it was found that addition of the precursor 4HB at the beginning of cultivation was
best for P4HB synthesis [65]. The authors stated that addition of 4HB at the late exponential
growth phase led to considerably lower cell mass reached and less P4HB accumulation due to
the limited availability of CoA [65]. To investigate whether P4HB synthesis in the E. coli
JM109 recombinant is related to cell growth (i.e., CoA availability), we conducted the
following experiment: E. coli JM109 (pKSSE5.3) was grown on modified E2 medium
containing xylose in a 1 L bioreactor at 32°C, and 4 g L-1 of Na-4HB was added to the culture
at the beginning (culture I), at the end of the exponential phase (culture II), or by a combination
-3
-2
-1
0
1
2
3
0 5 10 15 20 25
lnO
D600
Time (h)
30°C 32°C 34°C 37°C
0
10
20
30
40
0,2
0,3
0,4
0,5
0,6
28 30 32 34 36 38
% P
4H
B (
w w
-1)
µ (
h-1
)
Temperature (°C)
µ % P4HB
Chapter 4: P4HB production by recombinant E. coli using xylose
108
of 2 g L-1 at the beginning and 2 g L-1 at the end of the exponential phase (culture III) (Fig.
4.3A). The results obtained demonstrate that addition of 4HB at different growth phases
influenced neither specific growth rate of the culture nor P4HB synthesis (Fig. 4.3A). Cells in
all cultures exhibited a specific growth rate of about 0.34 h-1 in the first 8 h of cultivation. In all
cultures the initiation of P4HB synthesis was only at the end of the exponential growth phase,
even when 4HB was provided at the beginning (cultures I and III). During the accumulation
phase, P4HB content increased exponentially with a similar rate in all three cultures and to the
same extent for about 24 h in all cultures (Fig. 4.3B). Afterwards the P4HB accumulation
slowed down until the end of cultivation (55 h), where the P4HB content increased to a
maximum of about 70% in cultures I and III and about 60% in culture II. It seems that P4HB
content in culture II could potentially increase further, however, it was not possible likely due
to a limitation of certain nutrients. The concentration of P4HB increased exponentially for 18
h, starting from the initiation of P4HB synthesis at the end of the first exponential growth phase
(Fig. 4.3B). Afterwards the increase of the P4HB concentration slowed down and maximal
about 3.7, 3.3 and 4.3 g L-1 of P4HB was obtained in cultures I, II and III, respectively, at the
end of the cultivation (Fig. 4.3B).
Chapter 4: P4HB production by recombinant E. coli using xylose
109
Chapter 4: P4HB production by recombinant E. coli using xylose
110
Fig. 4.3: Influence of the physiological stage of 4HB addition on P4HB synthesis. E. coli JM109
(pKSSE5.3) was grown in a 1 L bioreactor at 32 °C on modified E2 medium supplemented with
10 g L-1 xylose, 4 g L -1 Na-4HB, 1 g L-1 NZ-amines, 100 µg mL-1 ampicillin and 0.015 g L-1
thiamine. The black arrows represent the addition of Na-4HB.
Panel A: addition of Na-4HB at different growth stages. I: Addition of Na-4HB at the beginning
of the culture; II: Addition of Na-4HB at the end of the exponential growth phase; III:
Combination of addition of Na-4HB at the beginning and at the end of exponential growth
phase. Panel B: Time courses of P4HB content and concentration presented in log-scale. Panel
C: P4HB productivity. The P4HB accumulation rate is obtained for the described conditions
from three independent cultivations.
Correspondingly, cell density in all cultures also increased exponentially with the exponential
increase of P4HB synthesis (Fig. 4.3A). The accumulation rate of P4HB per cell dry weight
was linear and similar in all three cultures with a value of about 0.025 g g -1 h-1 (Fig. 4.3C).
The results obtained here demonstrate the following: 1) P4HB synthesis only started at the end
of the exponential growth phase, regardless of the stage the precursor 4HB was added (i.e.,
either at the beginning or at the end of the exponential growth phase); 2) P4HB content and
concentration increased exponentially once the P4HB synthesis was initiated; 3) The P4HB
accumulation rate per cell dry weight was similar regardless when the precursor 4HB was added
(i.e. at the beginning or the end of the exponential growth phase); 4) The increase of biomass
after the exponential growth phase was mainly due to the P4HB accumulation; and 5) P4HB
accumulation stopped due to either nutritional limitation and/or product(s) inhibition. To obtain
more information, a more detailed analysis on substrate consumption and product formation
was performed.
Batch culture for P4HB production
E. coli JM109 (pKSSE5.3) was grown in a 1 L bioreactor on modified E2 medium containing
xylose and Na-4HB. The cells behaved in the same manner as described above (see Fig. 4.3)
and three phases were observed (Fig. 4.4). Phase 1: Growth phase (0 - 11 h). Cells grew
exponentially with a specific growth rate of 0.28 h-1 for 11 h. In this phase, xylose and nitrogen
were consumed but were still in excess in the medium. No excretion of acids such as acetic,
Chapter 4: P4HB production by recombinant E. coli using xylose
111
pyruvic or lactic acid was observed during this phase. Na-4HB was hardly consumed and only
a small amount of P4HB was detected (below 3% w w-1). The observed termination of the
exponential phase can be caused either by a limited availability of nutrient(s) or by product(s)
inhibition under our experimental conditions. This limitation or inhibition appears to promote
P4HB synthesis. O2 limitation can be ruled out due to automatic control of the dissolved oxygen
which was never below 30% as described in Method section. Phase 2: P4HB accumulation
phase (11 – 35 h). Similar to what found before, cells started to accumulate P4HB exponentially
after phase 1 and Na-4HB was consumed and decreased in the culture from 3.8 to 1.4 g L-1.
During this time, P4HB content increased from 3% to 58% (w w-1) and the P4HB concentration
increased from 0.024 to 2.76 g L-1 (Fig. 4.4). The residual biomass kept almost constant during
this phase. Xylose and nitrogen were further consumed and the culture reached carbon (xylose)
limitation after 35 h of incubation, whereas there was still enough nitrogen left. In this phase,
pyruvic acid and lactic acid were produced and reached maximal concentrations of 113 mg L-1
and 11 mg L-1, respectively, after 27 h of incubation. Both acids were further consumed and
depleted from the medium after 35 h of incubation. Accumulation of pyruvic acid and lactic
acid cannot be the reason for the transition from Phase 1 to Phase 2 because the concentrations
of both acids were too low to be inhibiting [181]. Phase 3: Stagnation phase (35 – 54 h).
Upon depletion of xylose no significant change in biomass and P4HB content took place. The
cells consumed neither the nitrate provided nor the Na-4HB completely. The P4HB
accumulation rate was in the range of 0.027 g g-1 h-1, similar to that found in Fig. 4.3. The
consumed Na-4HB was almost completely converted into polymer with a yield YP4HB/Na-4HB of
92% g of carbon from P4HB per g of carbon from Na-4HB.
Chapter 4: P4HB production by recombinant E. coli using xylose
112
Fig. 4.4: P4HB production in batch culture in 1 L bioreactors. E. coli JM109 (pKSSE5.3) were
grown in modified E2 medium with 10 g L-1 xylose and 4 g L-1 Na-4HB at 32°C with an
agitation of 500 rpm. The substrate consumption and product formation were followed with
time. Error bars represent measurement errors of the same sample in triplicates.
0
10
20
30
40
50
60
70
0
1
2
3
4
5
6
0 10 20 30 40 50 60
P4
HB
con
ten
t (%
w w
-1)
Na-
4H
B c
on
cen
trat
ion
(g L
-1);
P4
HB
con
cen
trat
ion
(g L
-1)
Time (h)
Na-4HB P4HB concentration PHA content
-5
-3
-1
1
3
5
7
9
11
-2
-1
0
1
2
3
4
5
0 10 20 30 40 50 60
Xylo
se (
g L
-1);
OD
60
0
lnO
D6
00;
Nit
rogen
(g L
-1)
; C
DW
(g L
-1)
Time (h)
LN OD600 CDW Xylose concentration OD
0
0,1
0,2
0,3
0,4
0
30
60
90
120
0 10 20 30 40 50 60
Nit
rogen
(g L
-1)
Pyru
vic
aci
d (
mg L
-1);
Lac
tic
acid
(m
g L
-1)
Time (h)
Pyruvic acid Lactic acid Nitrogen
0,01
0,1
1
0 10 20 30 40 50 60
Pro
du
ctiv
ity
(g P
4H
B g
CD
W -1
)
Time (h)
1
10
100
0,01
0,1
1
10
0 20 40 60
P4
HB
con
ten
t (%
w w
-1)
P4
HB
(g L
-1)
Time (h)
P4HB
concentration
Chapter 4: P4HB production by recombinant E. coli using xylose
113
Discussion
Despite the fact that bioprocesses for recombinant production of P3HB in E. coli have been
studied extensively [182, 183], the biosynthesis of P4HB in E. coli has not been yet investigated
in depth. Several reports have described the P4HB synthesis and accumulation in E. coli [64,
65, 174]. However, neither physiological and cultivation conditions, nor the external factors
that may influence P4HB accumulation have been studied yet in detail. For this reason, we
attempted to address two issues in this work. The first issue was whether or not P4HB can be
produced from Na-4HB efficiently in combination with xylose as growth substrate. The second
issue was to tackle how P4HB synthesis can be stimulated. Our results demonstrate that P4HB
can be synthesized efficiently by combining xylose and 4HB and its production can be enhanced
reproducibly by an unknown factor, either nutrient depletion or product inhibition.
To reach efficient P4HB production, cultures exhibiting high specific growth rate, high biomass
concentration and high levels of P4HB content are desired. Since the metabolic status, including
the concentrations of metabolites and the rate of metabolite formation may be different from
one strain to another, it is very understandable that rates of P4HB synthesis and levels of P4HB
accumulation will be different from one to another. Previously, it has been reported that P3HB
production can differ dramatically by using different E. coli strains, e.g. the wild-type E. coli
K12 synthesized 0.4 g L-1 P3HB, whereas XL1-Blue produced 7.2 g L-1 P3HB under the same
conditions [182, 183]. In this study, we have chosen six E. coli strains originated from B strain
(BL21(DE3)) and K12 strains including the wild-type (W3110) and the K12 derivatives (DH5α,
JM109, XL1-Blue, S17-1). JM109 seems to have the best physiological background for P4HB
synthesis, whereas the worst performers were W3110 and BL21(DE3). The latter two strains
grew fast, and used the carbon source mainly for biomass formation but produced little amount
of P4HB (Fig. 4.1).
Chapter 4: P4HB production by recombinant E. coli using xylose
114
Previously it has been reported that using E. coli XL1-Blue carrying pKSSE5.3, a P4HB
concentration of about 4.0 g L-1 and P4HB content of 36% (w w-1) could be obtained by a fed-
batch culture on M9 medium containing glucose and yeast extract and 18 g L-1 of 4HB [65].
The conversion yield of the precursor 4HB to P4HB (g carbon : g carbon) was about 24%.
Recently, Zhou et al. reported that E. coli JM109 mutant carry two plasmids reached about 1.9
g L-1 P4HB and 35% (w w-1) P4HB using LB rich medium containing glucose in a batch culture
[67]. Two antibiotics were needed to keep the plasmids and LB rich medium is costly. The
authors also showed that in a fed-batch fermentation 7.5 g L-1 P4HB could be achieved by using
LB medium containing a total of 90 g L-1 glucose after 52 hours [67]. The conversion yield of
the precursor glucose to P4HB (g carbon : g carbon) was about 10.5%. In the current study, we
achieved 4.3 g L-1 P4HB and 67% (w w-1) P4HB in a batch culture using the described medium.
The consumption of the precursor 4HB was almost complete with a conversion yield YP4HB/Na-
4HB of 92% g g -1. Even though the cost of 4HB is higher than glucose, the price of 4HB can be
significantly reduced by using gamma-butyrolactone as the precursor for chemical synthesis of
4HB (see Methods section). Hence, the process developed here is an efficient for P4HB
production.
In earlier studies, addition of 4HB at the beginning of a cultivation was found to be the best for
cell growth and P4HB production [65]. Here, we observed no difference in cell growth and
P4HB synthesis between adding 4HB at the beginning and at the end of the exponential growth
phase (Fig. 4.3). P4HB synthesis was initiated only at the end of exponential growth, even when
4HB was supplied right at the start. In contrast to P3HB accumulation in E. coli, where the
polymer is synthesized during cell growth [184], P4HB production has been found to be
distinctly separated from exponential cell growth in our experiments. The end of exponential
growth caused by either product inhibition or nutrient limitation stimulated P4HB synthesis. It
Chapter 4: P4HB production by recombinant E. coli using xylose
115
seems that the cell growth and P4HB production compete with each other for the same nutrients.
As indicated from the results shown in Figure 4.1, both W3110 and BL21(DE3) strains grew
fast and reached high final biomass but accumulated only a negligible amount of P4HB.
Furthermore, when the conditions are favored for cell growth e.g. at 37°C, P4HB is
disadvantaged (Fig. 4.2). These results suggest that nutrients are directed mainly into the
tricarboxylic acid (TCA) cycle for cell growth rather than into P4HB synthesizing pathway. We
also did not observe the accumulation of acetic acid during the whole cultivation period. This
seems to be due to the efficient utilization of excessive acetyl-CoA for the synthesis of P4HB,
which would otherwise form acetic acid [185].
Taking advantage of the knowledge acquired previously and our findings in this study, we
propose a model to explain the metabolism of P4HB synthesis in recombinant E. coli:
Introducing PHA synthase (PhaC) from R. eutropha and 4-hydroxybutyrate CoA-transferase
(OrfZ) from C. kluyveri into E. coli would result in the establishment of a new metabolic
pathway, which competes with several existing pathways leading to citrate and acetate
formation and to fatty acid synthesis (Fig. 4.5). When the available nutrients and energy are
used for cell growth, P4HB would hardly be synthesized. When the cell growth slows down /
stops due to nutrient limitation other than carbon starvation, P4HB synthesis can then be
initiated. The reduction or stop of cell growth cannot be caused by carbon limitation because
Chapter 4: P4HB production by recombinant E. coli using xylose
116
the cells still need the essential nutrients for maintenance. When xylose limitation occurred,
P4HB synthesis also terminated (Fig. 4.4).
Fig 4.5: Hypothetic metabolic pathway of P4HB synthesis from Na-4HB in recombinant E. coli
JM109 (pKSSE5.3). Green color represents growth phase, blue color represents P4HB
synthesis phase.
Conclusions
In this study, we compared for the first time the cell physiology of different E. coli strains
hosting the same plasmid pKSSE5.3 with respect to their growth on xylose and P4HB
accumulation under different growth conditions. Unlike what has been reported previously, the
P4HB synthesis was found to be separated from the cell growth, namely P4HB synthesis mainly
takes place after the end of the exponential growth phase. Under the tested conditions, P4HB
Acetyl-CoA
4HB-CoA
HS-CoA
P4HB
Acetate
4HB
Fatty acid
synthesis Pyruvate
Biomass / CO2
TCA cycle
Glucose Xylose
Growth phase
P4HB accumulation phase
OrfZ
PhaC
Chapter 4: P4HB production by recombinant E. coli using xylose
117
contents in the range of 58 to 70% (w w-1) and P4HB concentrations in the range of 2.8 to 4.3
g L-1 were obtained with a conversion yield YP4HB/Na4HB of 92% w w-1. These results were
achieved here by simple batch cultures, which was only possible previously through fed-batch
high cell density cultures. However, to further improve the productivity of the P4HB production
process for industrial applications, high-cell density cultures will need to be investigated and
employed.
Authors’ contributions
SLM designed and performed the experiments, prepared and revised the manuscript. MZ and
TE participated in designing the experiment and in revising the final manuscript. LTM revised
the final manuscript. QR designed and supervised the experiments, prepared and revised the
manuscript. All authors read and approved the final manuscript.
Acknowledgement
We thank Karl Kehl for IC measurements and Melisa Novelli for technical assistances. We
thank Prof. Guoqiang Chen (Tsinghua University) for kindly providing the plasmid pKSSE5.3.
Chapter 5
Improved productivity of poly(4-hydroxybutyrate)
(P4HB) in recombinant Escherichia coli using
glycerol as the growth substrate with fed-batch
culture
Le Meur S, Zinn M, Egli T, Thöny-Meyer L, Ren Q
Microbial Cell Factories 2014, 13:131
doi:10.1186/s12934-014-0131-2
Chapter 5: Improved productivity of P4HB using glycerol
120
Abstract
The most successful polyhydroxyalkanoate (PHA) in medical applications is poly(4-
hydroxybutyrate) (P4HB), which is due to its biodegradability, biocompatibility and
mechanical properties. One of the major obstacles for wider applications of P4HB is the cost of
production and purification. It is highly desired to obtain P4HB in large scale at a competitive
cost.
In this work, we studied the possibility to increase P4HB productivity by using high-cell density
culture. To do so, we investigated for the first time some of the most relevant factors influencing
P4HB biosynthesis in recombinant Escherichia coli. We observed that P4HB biosynthesis
correlated more with limitations of amino acids and less with nitrogen depletion, contrary to
the synthesis of many other types of PHAs. Furthermore, it was found that using glycerol as the
primary carbon source, addition of acetic acid at the beginning of a batch culture stimulated
P4HB accumulation in E. coli. Fed-batch high cell density cultures were performed to reach
high P4HB productivity using glycerol as the sole carbon source for cell growth and 4HB as
the precursor for P4HB synthesis. A P4HB yield of 15 g L-1 was obtained using an exponential
feeding mode, leading to a productivity of 0.207 g L-1 h-1, which is the highest productivity for
P4HB reported so far.
We demonstrated that the NZ-amines (amino acids source) in excess abolished P4HB
accumulation, suggesting that limitation in certain amino acid pools promotes P4HB synthesis.
Furthermore, the enhanced P4HB yield could be achieved by both the effective growth of E.
coli JM109 (pKSSE5.3) on glycerol and the stimulated P4HB synthesis via exogenous addition
of acetic acid. We have developed fermentation strategies for P4HB production by using
glycerol, leading to a productivity of 0.207 g L-1 h-1 P4HB. This high P4HB productivity will
decrease the total production cost, allowing further development of P4HB applications.
Chapter 5: Improved productivity of P4HB using glycerol
121
Background
Polyhydroxyalkanoates (PHAs) are natural polyesters that have gained special interest due to
their biodegradability and biocompatibility [34, 132, 165, 186]. PHAs can be stored by a wide
variety of microorganisms as intracellular reserve materials. They are accumulated when the
bacterial cells experience nutrient-limited growth conditions other than carbon. Up to now,
more than one hundred different monomers have been reported to be incorporated as building
blocks into bacterial PHAs, resulting in different material properties of the polymers [22, 46,
187, 188].
One of the most promising PHAs for medical applications is poly(4-hydroxybutyrate) (P4HB)
[53]. This homopolymer is a strong and flexible material, which can be employed for instance
for tissue engineering and drug delivery. In addition, P4HB is biocompatible and extremely
well tolerated in vivo due to the fact that hydrolysis of P4HB yields 4HB, which is a common
metabolite in the human body [38]. This biopolymer was the first and so far only PHA-
based material approved for clinical application as absorbable suture (TephaFLEX®) by the
FDA. Other applications of P4HB are currently under investigation, for example, Opitz and
coworkers successfully produced an ovine, aortic blood vessel substitute using bioabsorbable
P4HB scaffolds [189]. However, the high cost of P4HB hinders its wider applications [132]. In
order to have sufficient material available for application studies and to reduce production cost,
much research has been focused on the efficient production of P4HB by increasing the amount
of biopolymer accumulated in the cells. Surprisingly, there are no reports in the literature
documenting the use of high cell density (higher than 20 g L-1) processes to reach high P4HB
productivities. High productivity can be obtained by combining cultivation procedures to
achieve maximum polymer accumulation per cell with those allowing fast growth to reach high
cell densities. High cell density processes allow increasing the productivity of accumulated
Chapter 5: Improved productivity of P4HB using glycerol
122
metabolites with simultaneously decreasing the production cost as a result of a lower culture
volume (smaller bioreactors) and shorter fermentation time. So far there is no generally
accepted value to be defined as high cell density [190]. Different studies have considered
different values of cell dry weight (CDW), for example, Restaino and coworkers reported a
high cell density of 22 g CDW per liter for E. coli culture [122], whereas Yamanè and Shimizu
mentioned that high cell density cultivation is achieved when reaching about cell concentrations
of 50 g CDW per liter [118].
Generally, high cell densities are reached by fed-batch cultures using a pulse, linear or
exponential feed of the limiting carbon substrate. It was reported that exponential feeding
allows to achieve cell concentrations up to 148 g L-1 using glycerol as carbon source with
Escherichia coli TG1 cells [191]. To increase productivity, it is important to understand the
factors stimulating P4HB accumulation. In earlier work using recombinant E. coli, we identified
three physiological phases during P4HB production: i) the “growth phase”, in which cells grew
exponentially, ii) the “accumulation phase”, in which cells stopped dividing and started to
accumulate P4HB, and iii) the “stagnation phase”, in which both cell proliferation and P4HB
accumulation stopped while the total biomass remained constant [66]. Hence, under this
condition P4HB synthesis was found to be distinctly separated from cell growth and to occur
after exponential cell growth stopped. This is different from the synthesis of other types of
PHAs in recombinant E. coli [186, 192].
While the development of a highly efficient fermentation process constitutes one part of the
optimization procedure, the use of a cheap carbon substrate is another crucial factor that allows
reducing production costs significantly. For example, the hemicellulose derivative xylose can
be used as an industrially relevant carbon source for growth of E. coli strains in general [92]
and for P4HB homopolymer production in particular [66]. Glycerol is another interesting
Chapter 5: Improved productivity of P4HB using glycerol
123
carbon source because it currently accumulates as a waste byproduct during biodiesel
production [99], and therefore, production of higher value products from crude glycerol is of
primary interest. Glycerol, which can be used both as carbon and energy source, enables cheap
production of valuable synthons, for example 1,3-propanediol, dihydroxyacetone, ethanol,
succinate, and propionate [103] and has been tested as growth substrate for E. coli in fed-batch
processes to reach high cell density [193]. Advancements in metabolic engineering made it
possible to produce many heterologous products such as proteins [194], biofuels [195], and
PHAs [132, 186] in E. coli strains at high cell density. A recent study demonstrated that crude
and refined glycerol from biodiesel industry can be used as carbon substrate to accumulate
medium-chain-length PHAs by Pseudomonas mediterranea and P. corrugate [196].
In this study we investigated the influence of different nutrient concentrations on P4HB
synthesis in E. coli JM109 (pKSSE5.3), a strain harboring the genes essential for P4HB
production from 4HB. We further tested whether or not refined glycerol can be used as the
growth substrate for P4HB production in high cell density cultures. It was found that acetate
can stimulate P4HB synthesis in recombinant E. coli grown on glycerol. Based on this study,
an efficient process was developed to reach high productivity of P4HB by using high cell
density cultures combined with acetic acid addition.
Methods
Bacterial strain and plasmid
Escherichia coli JM109 [176] carrying plasmid pKSSE5.3 was used throughout the whole
study. pKSSE5.3 harbors the PHA synthase gene (phaC) from Ralstonia eutropha and a 4-
hydroxybutyric acid-coenzyme A transferase gene (orfZ) from Clostridium kluyveri [64], and
Chapter 5: Improved productivity of P4HB using glycerol
124
enables E. coli strains to produce P4HB when 4HB is supplied in the culture medium. The
expression of phaC and orfZ on pKSSE5.3 is driven by their native promoter(s) [64].
Chemicals
All chemicals were purchased from Sigma-Aldrich (Buchs, Switzerland).
Synthesis of sodium 4-hydroxybutyrate (Na-4HB)
Na-4HB was synthesized by hydrolysis of the corresponding lactone. The synthesis was
performed as described previously [66]. In detail, a 4 M NaOH solution was prepared and mixed
slowly with 4 M of -butyrolactone on ice. The reaction mixture was cooled down to room
temperature and analyzed by HPLC/MS [66, 147]. An almost 100% conversion of -
butyrolactone to Na-4HB was achieved.
Media and cultivation conditions
Shake flasks experiments
Growth studies were performed in 1 L shake flasks containing 200 mL of modified E2 medium
and 10 g L-1 of carbon source glycerol. One g L-1 of NZ-amines, 100 µg mL-1 ampicillin and 4
g L-1 of Na-4HB were added at the beginning of the cultivation. NZ-amines are casein
enzymatic hydrolysates with a total amino acid content of approximately 0.89 g g-1. Cultures
were incubated at 32°C and 150 rpm based on our previous study [66]. Modified E2 medium
was composed of the following components: NaNH4HPO4·4H2O 3.5 g L-1, KH2PO4 3.7 g L-1
and K2HPO4 7.5 g L-1 dissolved in distilled water. One mL L-1 of 1 M MgSO4·7H2O and 1 mL
L-1 of trace elements (TE) dissolved in 1 M HCl were added. TE contains FeSO4·7H2O 2.78 g
L-1, CaCl2·2H2O 1.47 g L-1, MnCl2·4H2O 1.98 g L-1, CoCl2·6H2O 2.38 g L-1, CuCl2·2H2O 0.17
g L-1, and ZnSO4·7H2O 0.29 g L-1. LB was used as the preculture medium to inoculate the main
culture to an initial OD600 between 0.2 and 0.3.
Chapter 5: Improved productivity of P4HB using glycerol
125
Bioreactor experiments
Experiments of identification of influencing factors in batch culture
E. coli JM109 (pKSSE5.3) cells were grown at 32°C in 1 L bioreactors (Infors AG, Bottmingen,
Switzerland) containing modified E2 medium supplemented with 10 g L-1 xylose, 4 g L-1 Na-
4HB, 1 g L-1 NZ-amines and 0.015 g L-1 thiamine. Preculture medium had the same composition
as the one for the main culture. The initial OD600 value in bioreactors was always between 0.1
and 0.3 units. Temperature was controlled at 32°C and pH was maintained at 7.0 by automated
addition of 25% NaOH or 2 M H2SO4. The dissolved oxygen tension was monitored
continuously with an oxygen probe and maintained at 30% of oxygen saturation.
High cell density culture experiments
In order to improve the productivity, high cell density cultivations were performed using E. coli
JM109 (pKSSE5.3). Modified M9 medium instead of modified E2 medium was used in these
studies because modified M9 medium was reported to be suitable for high cell density culture
of E. coli JM109 [197]. Modified M9 medium contained (NH4)2HPO4 4 g L-1, KH2PO4 13.3 g
L-1, (NH4)2SO4 1 g L-1, glycerol 20 g L-1, Na-4HB 6 g L-1, and NZ-amines 0.5 g L-1. After
autoclaving the medium, 10 mL L-1 of trace elements composed of CaCl2 2.5 g L-1, CuCl2·4H2O
0.075 g L-1, FeCl3·4H2O 3.525 g L-1, Zn(CH3COO)2 0.65 g L-1, MnCl2·4H2O 0.75 g L-1,
CoCl2·6H2O 0.125 g L-1, H3BO3 0.15 g L-1, NaMoO4·2H2O 0.125 g L-1 and Na2EDTA 0.625 g
L-1 were added to the medium. In addition, 5 mL L-1 of MgSO4·7H2O 1 M, thiamine 0.015 g L-
1, and ampicillin 100 mg L-1 were filter sterilized separately and added to the bioreactors before
inoculation. Preculture medium had the same composition as the one for the main culture. The
initial OD600 value in bioreactors was always between 0.1 and 0.3 units. Temperature was
controlled at 32°C and pH was maintained at 7.0 by automated addition of NH4OH 7.7 M or
Chapter 5: Improved productivity of P4HB using glycerol
126
H2SO4 2 M. The dissolved oxygen tension was monitored continuously with an oxygen probe
and maintained at 30% of oxygen saturation.
For exponential feedings, the substrate feeding rate (F) for controlling the specific growth rate
(µ) was determined as follows with neglecting the carbon substrate consumption for cell energy
maintenance. To get a time-dependent exponential feed, it is necessary to achieve a constant µ
that is lower than µmax. We started from the mass balance on the limiting substrate, which in
our case is the growth carbon substrate (glycerol). The consumption of growth limiting substrate
concentration according to the time can be expressed by:
𝑑𝑆
𝑑𝑡=
𝐹
𝑉 (𝑠0 − 𝑠) − 𝑞𝑠 𝑥 (1)
where s0 is the limiting substrate concentration (g L-1) in feeding medium and s is the actual
growth limiting substrate concentration (g L-1) in culture broth, x is the actual biomass
concentration (g L-1), YX/S is the growth yield (g g-1) for the limiting substrate and qs is the
specific substrate consumption rate (g g-1 h-1).
Because the cell density in the fed-batch is very high and s0 therefore consumed rapidly, it can
be stated that s << s0 and 𝑑𝑠
𝑑𝑡 ≈ 0. Consequently, equation 1 can be modified to:
𝐹(𝑡) =𝑞𝑠 (𝑥𝑉)𝑡
𝑠0 (2)
The biomass concentration (x) and the volume of the culture (V) increased with time, leading
to:
(𝑥𝑉)𝑡 = (𝑥0 𝑉0)𝑒µ𝑡 (3)
Where x0 and Vo are starting biomass concentration and the initial volume of culture,
respectively. Hence, the flow rate which enables recombinant E. coli to grow at a constant µ is
obtained in equation (4) by combining the equations (2) and (3).
𝐹(𝑡) =𝑞𝑠
𝑠0 (𝑥0𝑉0)𝑒µ𝑡 (4)
Chapter 5: Improved productivity of P4HB using glycerol
127
This is equivalent to:
𝐹(𝑡) = 𝐹0𝑒µ𝑡 (5)
This means one can formulate the starting flow condition Fo at t = 0 h as follows:
𝐹0 =µ
𝑠0 𝑌𝑋/𝑆 𝑥0 (6)
𝐹0 = µ 𝑉 (7)
The exponential feeding technique allows controlling the overflow metabolism of recombinant
E. coli in a fed-batch process. This technique makes it possible to grow the culture at a constant
specific growth rate and consequently the yield coefficient YX/S remains constant.
Test of plasmid stability
Cells at the end of cultivation were collected and a serial dilution of the cell suspension was
prepared. The suspensions were plated on the LB agar plate with or without ampicillin. The
plates were incubated overnight at 37°C and the colony numbers on plates with and without
ampicillin were counted and compared.
Analytical methods
Cell concentration
Growth of bacterial cells was followed by measuring optical density at 600 nm (OD600) using a
UV-visible spectrophotometer (Genesys 6, ThermoSpectronic, Switzerland).
Cell dry weight (CDW) was determined using 2 mL pre-weighed Eppendorf tubes. Two mL
culture broth were added into the tube and centrifuged at 10’000 g for 2 min. The cell pellet
was washed once with water. Cells were spun down again and the cell pellet was dried overnight
at 100°C, cooled down to room temperature in a desiccator and weighed. The weight difference
was used to determine the quantity of biomass per culture volume.
Chapter 5: Improved productivity of P4HB using glycerol
128
PHA content
To determine the PHA content and composition, the culture was centrifuged (8'500 g, 4°C, 15
min) and the cell pellet was washed once with water and lyophilized for 48 hours. Biomass in
the range of 20 - 50 mg was added to Pyrex vials. Then, 2 ml of 15% v v-1 H2SO4 in methanol
was added and mixed. Furthermore, 2 ml of methylene chloride containing benzoic acid (0.1 g
L-1) as internal standard were added. The suspension was boiled at 100°C for 2.5 h in an oven.
The samples were cooled on ice, and 1 ml of distilled water was added in order to extract the
cell debris into the aqueous phase. The solution was mixed by vortexing for 1 min. The
complete (upper) water phase was discarded, including droplets hanging on the tube wall. The
remaining methylene chloride phase was dried and neutralized by adding Na2SO4 and Na2CO3
powder, and 200 µl of the organic phase were filtered using a solvent resistant filter (PTFE,
0.45 µm) and transferred to a GC sample vial. Samples were analyzed using gas
chromatography (GC) (A200s, Trace GC 2000 series, Fisons Instruments, Rodano, Italy)
equipped with a polar fused silica capillary column (Supelcowax-10: length 30 m; inside
diameter 0.31 mm; film thickness 0.5 µm; Supelco, Sigma-Aldrich, Buchs, Switzerland) [163].
The methylation of P4HB resulted in 3 distinct peaks representing the methylester of 4HB, -
butyrolactone and the methyl ether of 4HB, respectively, which were also obtained if only Na-
4HB was subjected to methanolysis. These three peaks were also observed by others when
analyzing P4HB homopolymers [64, 66, 198].
Evaluation of glycerol limitation
The dissolved oxygen tension (pO2) was used as an indicator for glycerol consumption during
fed-batch cultures [199]. This is based on the fact that whenever the substrate in the medium is
about to run out and thus becomes a limiting factor, the pO2 increases rapidly. When the carbon
substrate is added to the culture, pO2 decreases to its former level.
Chapter 5: Improved productivity of P4HB using glycerol
129
Measurement of nitrogen
NH4+-nitrogen content was measured using an ammonium test kit following the manufacturer
instruction (Merck KGaA, 64271 Darmstadt, Germany). The detection range was from 0.01 to
3.0 NH4+-N mg L-1, above which dilution with distilled water was needed.
Acetate and Na-4HB measurements
Acetate and Na-4HB were measured by HPLC/MS (Agilent 1000 Series, Santa Clara, United
States for the HPLC unit, and Bruker Daltonics esquire HCT, Bremen, Germany for the MS
unit). Supernatant resulting from culture centrifugation at 10’000 g for 2 min was diluted to
0.01 to 0.1 mM with distilled water and loaded on a reversed phase C18 column (Gemini C18
5 micron, 250 mm x 4.60 mm, Phenomenex, U.K.). A gradient of diluted formic acid (0.1% v
v-1 in water) to 100% acetonitrile mixed with 0.1% v v -1 formic acid was applied as the mobile
phase. The flow rate was 0.8 mL min-1 and the gradient was completed after 25 minutes. The
peaks were detected by electrospray ionization (ESI) in negative mode [147]. The standard
curves for acetate and Na-4HB were recorded in the range of 0.01 to 1 g L-1 and 0.01 to 0.2 g
L-1, respectively.
Reproducibility
In this study, for each batch culture at least two independent experiments were performed, for
each fed-batch culture at least three independent experiments were performed. The absolute
values of cell density and P4HB content obtained from the independent experiments varied,
which is not surprising for biological systems. This could be caused by slight differences in
inoculum, cultivation conditions, sampling, and etc. However, the cell growth and P4HB
synthesis exhibited same patterns in the same set of independent experiments. In this report the
results obtained from one independent experiment were presented. Each individual sample was
measured in duplicates. The data presented here are the average numbers.
Chapter 5: Improved productivity of P4HB using glycerol
130
Results and Discussion
Previously, we observed that the recombinant E. coli strain JM109 (pKSSE5.3) synthesized
only small amounts of P4HB (about 10%) when glycerol was offered as carbon source [66]. In
this study, we attempted to utilize this inexpensive carbon source as the growth substrate for
P4HB synthesis by high cell density cultivation. To enhance P4HB production, we first set out
to identify the influencing factors for P4HB synthesis. It is difficult to conclude whether a factor
plays a significantly influencing role or not when the base value is low such as 10%, especially
when the factor has a negative impact. Thus, xylose, which could lead to 30-70% of P4HB [66],
was used as the growth carbon source for the investigation.
Identification of factors influencing P4HB synthesis
E. coli JM109 (pKSSE5.3) was cultivated in 1 L bioreactors containing modified E2 minimal
medium. Various factors were tested for their influence on P4HB synthesis: carbon, nitrogen
and amino acid source, trace elements and magnesium. As described previously [66], three
phases (growth, accumulation and stagnation phase) were observed for cultures A (with
standard medium containing modified E2 medium containing 10 g L-1 xylose, 4 g L-1 Na-4HB,
1 g L-1 NZ-amines and 1 mL L-1 trace elements), B (two times more xylose), C (five times more
nitrogen source NaNH4HPO4·4H2O), E (three times more trace elements), and F (three times
more magnesium), whereas culture D (five times more NZ-amines) exhibited no accumulation
phase (Fig. 5.1). Culture D reached a maximal OD600 and a maximal P4HB content of about
8.6 and 3% (w w-1), respectively. Culture A with the standard medium led to highest maximal
P4HB content of 65% (w w-1), while Cultures B, C, E and F reached a slightly lower maximal
P4HB content of 52%, 52%, 59%, 45%, respectively.
Chapter 5: Improved productivity of P4HB using glycerol
131
These results showed that NZ-amines (amino acids) in excess blocked P4HB synthesis, whereas
increased concentrations of carbon source, nitrogen source NaNH4HPO4·4H2O, trace elements
or magnesium did not impact P4HB synthesis significantly. Normally, PHAs accumulate in the
bacterial growth phase under nitrogen, phosphorous or oxygen limited conditions with an
excess of carbon source [34, 200].
It has been reported that recombinant E. coli does not require any nutrient limitation for
synthesis of poly(3-hydroxybutyrate) (P3HB) and produces P3HB in a growth-associated
manner even under nutrient-sufficient conditions [192]. In this study with a recombinant E. coli
strain, neither nitrogen nor carbon source in excess led to a significant reduction of P4HB
content, whereas excess of amino acids (NZ-amines) almost abolished P4HB synthesis (Fig.
5.1). It seems that amino acid limitation caused a halt of cell growth and triggered P4HB
accumulation.
Previously, we have tested a defined medium without addition of any amino acids for P4HB
synthesis and found that the chemically defined medium resulted in hardly any P4HB synthesis
[201]. Addition of a small amount of complex nitrogen sources such as NZ-amines promoted
considerably P4HB accumulation [201]. Therefore, other means than omitting amino acids in
the medium are needed to limit the intracellular amino acid pool for promoting P4HB synthesis.
Chapter 5: Improved productivity of P4HB using glycerol
132
Figure 5.1: Influence of various factors on growth and P4HB accumulation. E. coli JM109
(pKSSE5.3) was grown in 1 L bioreactors in modified E2 medium containing 10 g L-1 xylose,
4 g L-1 Na-4HB, 1 g L-1 NZ-amines, and 1 mL L-1 trace elements was used as standard medium.
Culture A: standard medium; Culture B: two times more xylose was added to the standard
medium, leading to 20 g L-1 xylose; Culture C: five times more nitrogen source
NaNH4HPO4·4H2O was added to the standard medium, leading to a final NaNH4HPO4·4H2O
concentration of 17.5 g L-1; Culture D: NZ-amine amount was increased by 5 fold, leading to 5
g L-1; Culture E: three times more trace elements were added, leading to 3 mL L-1; Culture F:
three times more magnesium was added, leading to 3 mM of MgSO4·7H2O. The data are the
average numbers of duplicates.
0
10
20
30
40
50
60
70
-3
-2
-1
0
1
2
3
0 20 40 60
% P
4H
B (
w w
-1)
LN
OD
600
Time (h)
LN OD % P4HB
Standard conditions A
0
10
20
30
40
50
60
70
-3
-2
-1
0
1
2
3
0 20 40 60
% P
4H
B (
w w
-1)
LN
OD
600
Time (h)
LN OD P4HB
NZ-amines influence D
0
10
20
30
40
50
60
70
-3
-2
-1
0
1
2
3
0 20 40 60
% P
4H
B (
w w
-1)
LN
OD
600
Time (h)
LN OD P4HB
Trace elements influence E
0
10
20
30
40
50
60
70
-3
-2
-1
0
1
2
3
0 20 40 60
% P
4H
B (
w w
-1)
LN
OD
600
Time (h)
LN OD P4HB
Xylose influence B
0
10
20
30
40
50
60
70
-3
-2
-1
0
1
2
3
0 20 40 60
% P
4H
B (
w w
-1)
LN
OD
600
Time (h)
LN OD % P4HB
Nitrogen influence C
0
10
20
30
40
50
60
70
-3
-2
-1
0
1
2
3
0 20 40 60
% P
4H
B (
w w
-1)
LN
OD
600
Time (h)
LN OD % P4HB
Magnesium influence F
Chapter 5: Improved productivity of P4HB using glycerol
133
Influence of acetate on P4HB synthesis
To artificially obtain amino acid limitation, one possibility is to add weak organic acids to the
culture medium. It has been reported that the growth inhibitory effect of acetic acid on E. coli
is due to its influence on the amino acid (e.g. methionine) pool in the cells: the more acetic acid
produced, the smaller the methionine pool becomes, leading to restriction of cell growth [202].
Recently we have reported that addition of propionic acid to the culture medium stimulates
P4HB accumulation in recombinant E. coli grown on glycerol. This stimulating effect was
significantly weakened by addition of exogenous methionine but not by cysteine, suggesting
that propionic acid enhances P4HB synthesis at least partially by reducing the intracellular
methionine pool [201]. Whether propionic acid also influences other amino acid pools is not
not known. In this study, we further investigated whether the extracellular addition of acetic
acid would enhance P4HB synthesis. Glycerol is a simple polyol compound and a side product
from the biodiesel industries. E. coli grown on glycerol generates lower amounts of acetic acid
than on xylose or glucose [172, 191]. E. coli JM109 (pKSSE5.3) was grown in 1 L shake flasks
containing modified E2 medium. A concentration of 10 g L-1 of glycerol was added with or
without 2 g L-1 acetic acid at the beginning of the cultivation. With acetic acid a maximal
content of 23% w w-1 P4HB was obtained, whereas without only 12% w w-1 was achieved (Fig.
5.2A). To confirm that the observed enhanced P4HB content was not caused by a reduced
growth rate due to the addition of acetic acid, 1 g L-1 instead of 2 g L-1 acetic acid was added at
the beginning of the cultivation on glycerol. The cultures with or without 1 g L-1 acetic acid
showed the same growth rate of 0.31 h-1 (Fig. 5.2B); however, the culture with addition of acetic
acid accumulated much more P4HB than the one without (Fig. 5.2B). Thus, it can be speculated
that the P4HB synthesis is stimulated by acetic acid addition through reduction of the
intracellular amino acid pool rather than a reduction in specific growth rate, similar to the
findings reported previously [201].
Chapter 5: Improved productivity of P4HB using glycerol
134
Figure 5.2: E. coli JM109 (pKSSE5.3) grown in modified E2 medium supplemented with or
without acetate in shake flasks. 10 g L-1 glycerol was used as the main carbon source. A: 2 g L-
1 acetate was added to the culture; B: 1 g L-1 acetate was added to the culture. The data are the
average numbers of duplicates.
Previously, it has been reported that the molar fraction of 4HB in the P(3HB-co-4HB)
biosynthesis by R. eutropha was increased significantly from 38 to 54 mol% by the addition of
a small amount of acetic acid or propionate [168]. The authors suggested that acetate is able to
increase acetyl-CoA pool, inhibit the ketolysis of 4-hydroxybutyryl-CoA to two molecules of
acetyl-CoA, and consequently increase 4HB fraction. If this hypothesis is valid for E. coli, E.
coli (pKSSE5.3) would be able to utilize 4HB as a sole carbon source for cell growth. However,
E. coli JM109 (pKSSE5.3) is not able to grow on medium containing 4HB as the sole carbon
source and cannot use 4HB as a growth substrate even when combined with another growth C-
source [66]. Furthermore, we have recently showed that propionic acid enhances P4HB
synthesis by reducing the intracellular methionine pool [201]. Therefore, the hypothesis that
addition of acetate stabilizes 4-hydroxybutyryl-CoA from ketolysis and consequently leads to
a higher 4HB fraction in polymers is not valid here. The results obtained further confirmed the
0
10
20
30
40
50
-2
-1
0
1
2
3
0 10 20 30 40 50
% P
4H
B (
w w
-1)
LN
OD
600
Time (h)
LN OD (without acetate)LN OD (with 2 g/L acetate)P4HB (without acetate)P4HB (with 2 g/L acetate)
A B
0
10
20
30
-2
-1
0
1
2
3
0 10 20 30 40 50
% P
4H
B (
w w
-1)
LN
OD
600
Time (h)
LN OD (without acetate)LN OD (with 1 g/L acetate)% P4HB (without acetate)% P4HB (with 1 g/L acetate)
Chapter 5: Improved productivity of P4HB using glycerol
135
hypothesis reported in our previous work [66] that the pathways for cell growth and P4HB
synthesis compete with each other. When the available nutrients and energy are used for cell
growth, P4HB can hardly be synthesized. When the cell growth slows down / stops due to
nutrient limitation (e.g. amino acids) other than carbon starvation, P4HB synthesis can be
initiated. It has been reported that exogenous addition of acetic acid increases the acetyl-CoA
synthetase (ACS) activity in order to reach the equilibrium between the concentration of acetate
and acetyl-CoA, following the equation ATP + Acetate + CoA ACS AMP + Pyrophosphate +
Acetyl-CoA [203]. An overflow of acetyl-CoA, which is the donor of CoA to 4HB, increases
the accumulation of P4HB.
Influence of acetate addition on P4HB synthesis at different physiological growth stages
The influence of acetic acid addition at different physiological growth stages was studied during
high cell density cultivation. E. coli JM109 (pKSSE5.3) was grown on modified M9 medium.
Glycerol and Na-4HB were pulsed when needed during cell growth, which was indicated by an
increase of dissolved oxygen tension (pO2) signal. In culture A (Fig. 5.3), 2 g L-1 of acetic acid
was added at the beginning of the cultivation. The cells reached a maximal OD600 of 57.5 with
a P4HB content of 31% w w-1 at 64 h of cultivation. In culture B, 1 g L-1 acetic acid was added
twice, first at the beginning and again at the end of the growth phase (66 h). The cells reached
a maximal OD600 of 92.6 with a P4HB content of 30% w w-1 at 63 h. In culture C, 2 g L-1 acetic
acid was added at 48 h of cultivation. The cells reached a maximal OD600 of 53.5 at 66.25 h
with a P4HB content of 9% w w-1. The culture without any addition of acetic acid (culture D)
reached a maximal OD600 of 45.5 with a P4HB content of 10% w w -1 (Fig. 5.3). These results
demonstrated that the addition of acetic acid at the beginning of the cultivation enhances P4HB
Chapter 5: Improved productivity of P4HB using glycerol
136
A
accumulation dramatically, leading to a three-fold higher P4HB content than without acetic
improvement of P4HB production compared to the culture without any acetic acid.
Figure 5.3: Fed-batch strategy using acetic acid as stimulator for P4HB synthesis in E. coli
JM109 (pKSSE5.3) grown on modified M9 medium supplemented with 20 g L-1 glycerol, 6 g
L-1 Na-4HB, 0.5 g L-1 NZ-amine, 0.015 g L-1 thiamine and 100 mg L-1 ampicillin. Acetic acid
was added at different physiological states. For all cultures pulse-feeding started at 40 h of
cultivation: T = 40.5 h, addition of 12 g L-1 glycerol and 6 g L-1 Na-4HB; T = 45.75 h, addition
of 20 g L-1 glycerol; T = 63.75 h, addition of 10 g L-1 glycerol and 3 g L-1 Na-4HB; T = 72.25
h, addition of 20 g L-1 glycerol and 6 g L-1 Na-4HB; T = 76.75 h, addition of 10 g L-1 glycerol.
Culture A, addition of 2 g L-1 acetic acid at the beginning of the cultivation; Culture B, addition
of 1 g L-1 acetic acid at beginning and at the end of growth phase (66 h), respectively; Culture
C, addition of 2 g L-1 acetic acid after 48 h of cultivation; Culture D, no addition of acetic acid
to the culture. Arrows represent the addition of acetic acid. The data are the average numbers
of duplicates.
0
10
20
30
40
50
60
0
20
40
60
80
100
0 20 40 60 80 100
% P
4H
B (
ww
-1)
OD
600
Time (h)
OD P4HB
0
10
20
30
40
50
60
0
20
40
60
80
100
0 20 40 60 80 100
% P
4H
B (
ww
-1)
OD
600
Time (h)
OD P4HB
0
10
20
30
40
50
60
0
20
40
60
80
100
0 20 40 60 80 100
% P
4H
B (
ww
-1)
OD
600
Time (h)
OD P4HB
0
10
20
30
40
50
60
0
20
40
60
80
100
0 20 40 60 80 100
% P
4H
B (
ww
-1)
OD
600
Time (h)
OD P4HB
A C
B D
Chapter 5: Improved productivity of P4HB using glycerol
137
The reason why addition of acetic acid at the end of growth phase did not promote P4HB
synthesis could be that cell metabolism at the stationary phase is not active enough to convert
acetic acid to acetyl-CoA. When acetic acid is added at the beginning of the growth phase, it
can be converted to acetyl-CoA which can be further channelled to cell growth and maintenance
(during the growth phase) or P4HB synthesis (during the accumulation phase).
Influence of the feeding mode on P4HB product during fed-batch culture
Based on the above results, different nutrient feeding strategies were compared for P4HB
production in recombinant E. coli JM109 (pKSSE5.3) using glycerol as the carbon substrate
and acetic acid as the stimulator.
Pulse-feeding
The batch culture was performed using modified M9 medium. Glycerol, Na-4HB and acetic
acid were added when the carbon source glycerol was limited. Glycerol limitation was
monitored by pO2 signal as described in Materials and Methods. This culture grew with an
initial specific growth rate of 0.11 h-1 (Fig. 5.4). The concentration of Na-4HB was never
limiting and did not exceed 7 g L-1. The maximal Na-4HB consumption rate was 0.43 g L-1 h-1,
leading to a maximal specific consumption rate of 0.05 g g-1 h-1. The initially fed acetic acid
was not totally consumed when the first pulse of acetic acid was added to the culture broth after
30 h of cultivation. No visible impact on the cell growth was observed after this addition. After
39 h of cultivation, acetic acid was added once more, which was consumed quickly with a
specific consumption rate of 0.032 g g-1 h-1.
Chapter 5: Improved productivity of P4HB using glycerol
138
Figure 5.4: Time course of cell dry weight (CDW), P4HB content and P4HB concentration
during a pulse feeding fed-batch culture of E. coli JM109 (pKSSE5.3). Glycerol and 4-
hydroxybutyric acid were used as carbon source and precursor, respectively. Cultivation was
conducted at 32°C in a 1 L bioreactor with an initial volume of 600 mL of modified M9 medium
plus 20 g L-1 glycerol, 6 g L-1 Na-4HB, 2 g L-1 acetic acid, 0.5 g L-1 NZ-amines, 0.015 g L-1
thiamine and 100 mg L-1 ampicillin. Feeding solution was added to the bioreactor when glycerol
in the medium was close to depletion, indicated by pO2 signal.
Arrow #1, feeding of 12.5 g L-1 glycerol + 2.5 g L-1 Na-4HB + 1.1 g L-1 acetate at 30 h; Arrow
#2, feeding of 25.0 g L-1 glycerol + 2.1 g L-1 acetate at 39 h; Arrow #3, feeding of 2.5 g L-1 Na-
4HB at 41 h; Arrow #4, feeding of 25.0 g L-1 glycerol + 2.1 g L-1 acetate + 2.5 g L-1 Na-4HB at
44 h; Arrow #5, feeding of 25.0 g L-1 glycerol + 2.1 g L-1 acetate + 6 g L-1 Na-4HB at 49.5 h.
The data are the average numbers of duplicates.
The P4HB content decreased after 40 h of cultivation along with cell growth. However, the
P4HB concentration continuously increased, for example, during 9 h of cultivation from 40 h
to 49 h 2.63 g L-1 P4HB was accumulated, leading to a P4HB accumulation rate of 0.25 g L-1
0
2
4
6
8
10
12
0
10
20
30
40
50
60
70
80
90
0 10 20 30 40 50 60 70 80A
ceta
te (
g L
-1);
P4
HB
(g L
-1);
Na-
4H
B(g
L-1
)
OD
600;
CD
W (
g L
-1);
% P
4H
B (
w w
-1)
Time (h)
OD CDW
% P4HB Acetate concentration
Na-4HB concentration P4HB concentration
1
2
3
4 5
Chapter 5: Improved productivity of P4HB using glycerol
139
h-1. The OD600 increased continuously to 86 within 53 h, afterwards decreased to 75 during
prolonged cultivation from 53 h to 69 h (Fig. 5.4).
Linear-feeding
The cells were grown in modified M9 medium. A feeding solution containing 200 g L-1 acetic
acid and 200 g L-1 glycerol was used for the first 65 h of cultivation and then exchanged with a
feeding solution of 100 g L-1 acetic acid and 400 g L-1 glycerol for the next 69 h. Different feed
rates were compared: 0.5, 1, 2 and 3 mL h-1. It was found that the best feed rate for P4HB
synthesis was between 1 and 2 mL h-1 under the conditions used in this study. Below or above
this range P4HB content decreased. Thus, the feed rates of 1 and 2 mL h-1 were studied in more
details.
Fig. 5.5 shows that with the feeding rate of 1 mL h-1 (Culture A) the cells reached a maximal
OD600 value of 63.8, a CDW of 22.4 g L-1 and a P4HB content of 30% w w-1 after 119 h, leading
to a final product concentration of about 7 g L-1 P4HB. In Culture B (feeding rate of 2 mL h-1),
the cells reached a maximal OD600 value, a CDW and a P4HB content of 80.9, 32.9 g L-1, and
19% w w-1 after 119 h, respectively, leading to a yield of about 6 g L-1 P4HB. For both cultures,
the Na-4HB precursor was not limiting, however, the P4HB content decreased dramatically
after 40 h of cell growth.
Chapter 5: Improved productivity of P4HB using glycerol
140
Figure 5.5: High cell density cultivation with linear feeding mode of E. coli JM109 (pKSSE5.3). The feeding solution contained 200 g L-1 acetic acid
and 200 g L-1 glycerol for 65 h and then 100 g L-1 acetic acid and 200 g L-1 glycerol. Panel A: feeding rate of 1 mL h-1; B: feeding rate of 2 mL h-1.
Arrows represent the start of feeding. The data are the average numbers of duplicates.
0
3
6
9
12
15
0
20
40
60
80
100
0 30 60 90 120 150
P4
HB
(g L
-1);
Na-
4H
B(g
L-1
)
OD
60
0;
% P
4H
B(w
w-1
); C
DW
(g L
-1)
Time (h)
CDW
OD
% P4HB
Na-4HB concentration
P4HB concentration
B
0
3
6
9
12
15
0
20
40
60
80
100
0 30 60 90 120 150
P4
HB
(g L
-1);
Na-
4H
B (
g L
-1)
OD
600;
% P
4H
B (
w w
-1);
CD
W (
g L
-1)
Time (h)
CDW
OD
% P4HB
Na-4HB concentration
P4HB concentration
A
Chapter 5: Improved productivity of P4HB using glycerol
141
It seems that most of the cells generated during the late stage had difficulty to accumulate
P4HB; leading to a dilution of the P4HB content caused by cell divisions even if the overall
P4HB concentrations were increased. Previously, Song and co-workers have reported similar
phenomenon that almost no P4HB accumulated in newly-produced cells in the late stage during
a fed-batch experiment [65]. No explanation could be given. It cannot be caused by the plasmid
instability because at the end of the cultivations cells were taken and plated on LB agar with or
without ampicillin and were found to maintain at least 90% of the plasmid (data not shown).
Exponential feeding
The batch culture was conducted using modified M9 medium. Three different feeding rates of
0.02 h-1, 0.04 h-1 and 0.08 h-1 were tested in cultures A, B and C, respectively. The feeding
solution used for all three cultures was composed of 40 g L-1 Na-4HB, 300 g L-1 glycerol and
20 g L-1 acetic acid. The culture A reached a higher maximal OD600 of about 80 after 72.5 h of
cultivation (Fig. 5.6). Cultures B and C showed a similar maximal OD600 of about 100 after
72.5 h of cultivation (Fig. 5.6). No Na-4HB precursor limitation was observed for any of the
three cultivations. The exponential growth stopped at about 53 h, even though glycerol,
nitrogen, acetic acid and Na-4HB were found to be still available in the medium based on the
measurement described in the Materials and Methods (data not shown). A maximal P4HB
content of 34% w w-1 and a P4HB concentration of 15 g L-1 were obtained for culture A after
72.5 h of cultivation. These results demonstrate that concomitant addition of acetic acid,
glycerol and Na-4HB precursor in E. coli JM109 (pKSSE5.3) can lead to a high productivity
by using a slow exponential feeding.
Chapter 5: Improved productivity of P4HB using glycerol
142
0
4
8
12
16
0
20
40
60
80
100
120
0 20 40 60 80 100 120
P4
HB
(g L
-1);
Na-
4H
B (
g L
-1)
OD
600;
% P
4H
B(w
w-1
); C
DW
(g L
-1)
Time (h)
OD
% P4HB
CDW
P4HB concentration
Na-4HB concentration
0
4
8
12
16
0
20
40
60
80
100
120
0 20 40 60 80 100 120
P4
HB
(g L
-1);
Na-
4H
B(g
L-1
)
OD
600;
% P
4H
B(w
w-1
); C
DW
(g L
-1)
Time (h)
OD
% P4HB
CDW
P4HB concentration
Na-4HB concentration
A B
0
4
8
12
16
0
20
40
60
80
100
120
0 20 40 60 80 100 120
P4
HB
(g L
-1);
Na-
4H
B (
g L
-1)
OD
60
0;
% P
4H
B (
w w
-1);
CD
W (
g L
-1)
Time (h)
OD
% P4HB
CDW
P4HB concentration
Na-4HB concentration
C
Figure 5.6: High cell density cultivations of E.
coli JM109 (pKSSE5.3) with exponential feeding
mode. The feeding solution contained 40 g L-1
Na-4HB, 300 g L-1 glycerol, and 20 g L-1 acetic
acid. Controlled feeding rate was set for the
cultures A, B and C at 0.02, 0.04 and 0.08 h-1,
respectively. Arrows represent the start of
feeding. The data are the average numbers of
duplicates.
Chapter 5: Improved productivity of P4HB using glycerol
143
In summary, with the pulse feed strategy an addition of acetic acid at the beginning of the
cultivation led to a multi-fold increase in P4HB yield from 9% to 31% (w w-1) (Fig. 5.3). A
yield of 11.1 g L-1 and a P4HB productivity of 0.173 g L-1 h-1 within 64 h could be achieved.
With a linear feeding mode a lower yield was obtained than with pulse feeding (Table 5.1). The
best feeding rate was 1 mL h-1, leading to a P4HB yield of 6.8 g L-1 and a volumetric
productivity of 0.058 g L-1 h-1 over 118 h. Exponential feeding led to the maximal yield of 15
g L-1 P4HB in about 72.5 h with a feeding rate of 0.02 h-1, resulting in a volumetric productivity
of 0.207 g L-1 h-1 (Table 5.1). Previously, it has been reported that the production of P4HB
homopolymer using glucose as growth substrate and Na-4HB as precursor can reach a final
yield of 4.0 g L-1 and a P4HB productivity of 0.065 g L-1 h-1 in 62 h via a pulse feeding strategy
[65]. A recent publication showed that an E. coli recombinant JM109SG carrying two plasmids
could utilize solely glucose for P4HB production [67], and a P4HB yield of 7.8 g L-1 and a
productivity of 0.150 g L-1 h-1 were obtained by using LB medium containing yeast extract in a
pulse feeding fed-batch culture [67]. The productivity of 0.207 g L-1 h-1 obtained in this study
is the highest reported so far.
In this study, we also demonstrated that even though the cost of Na-4HB is relative high, it can
be significantly reduced by using gamma-butyrolactone as a low-cost precursor for chemical
synthesis of Na-4HB (see Methods section). Furthermore, Na-4HB was not used as the growth
substrate but the precursor for P4HB, thus only low amount was needed, e.g. a total of about
19 g L-1 Na-4HB was added to produce 11 g L-1 P4HB in the case of pulse feeding fed-batch
culture (Fig. 5.4).
Chapter 5: Improved productivity of P4HB using glycerol
144
Table 5.1: Summary of different feeding modes and their effect on P4HB production during fed-batch cultivations. The data are the average numbers
of duplicates.
Growth substrate /
stimulator /
precursor / Media
Feeding strategy
Culture
time (h)
OD600max
CDW
(g L-1
)
P4HB
content %
(w w-1)
Volumetric
yield P4HB
(g L-1
)
Volumetric
productivity
(g L-1 h-1)
References
Glycerol / acetate /
Na-4HB / modified
M9 medium
Pulse feed 64 77.9 42.8 26 11.5 0.180
This study
Linear feed 118 63.8 33.8 30 6.8 0.058
Exponential feed 73 81.5 43.2 33 15.0 0.207
Glucose / - /4HB /
M9 medium
Pulse feed 62 24.5 13.0 31 4.0 0.065 [65]
Glucose / - /yeast
extract / LB medium
Pulse feed 52 21.7 11.5 68 7.8 0.150 [67]
Chapter 5: Improved productivity of P4HB using glycerol
145
To further improve the productivity and reduce the cost of P4HB one of the imperative tasks is
to achieve P4HB accumulation in newly-produced cells in the late stage during a fed-batch
experiment, thus avoiding the dilution of P4HB content.
Conclusions
In this study, we demonstrated that the NZ-amines (amino acids source) in excess abolished
P4HB accumulation, suggesting that limitation in certain amino acid pools promotes P4HB
synthesis. This was validated by providing exogenous acetic acid to the cells, which most likely
resulted in the reduction of the intracellular amino acid pool. Furthermore, the enhanced P4HB
yield was achieved by both the effective growth of E. coli JM109 (pKSSE5.3) on glycerol and
the stimulated P4HB synthesis via exogenous addition of acetic acid. We have developed
fermentation strategies for P4HB production by using glycerol, leading to a productivity of
0.207 g L-1 h-1 P4HB with a yield of 15 g L-1, which is the highest yield for P4HB production
reported so far. This high P4HB productivity will decrease the total production cost, allowing
further development of P4HB applications.
Competing interests
The authors declare that they have no competing interest.
Authors’ contributions
SLM designed and performed the experiments, prepared and revised the manuscript. MZ and
TE participated in designing the experiment and in revising the final manuscript. LTM revised
the final manuscript. QR designed and supervised the experiments, prepared and revised the
manuscript. All authors read and approved the final manuscript.
Chapter 5: Improved productivity of P4HB using glycerol
146
Acknowledgement
We thank Melisa Novelli for technical assistances. We thank Prof. Guoqiang Chen (Tsinghua
University) for kindly providing the plasmid pKSSE5.3. The Swiss Commission for Technology
and Innovation (CTI) is acknowledged for the financial support of this work through project
number 12409.2 PFLS-LS.
Chapter 6
The effect of molecular weight on the material
properties of biosynthesized poly(4-
hydroxybutyrate)
Boesel L F, Le Meur S, Thöny-Meyer L, Ren Q
International Journal of Biological Macromolecules 2014, 71:124
doi:10.1016/j.ijbiomac.2014.04.015
Sylvaine Le Meur has carried out following parts: the biosynthesis of P4HB and the polymer
extraction.
Chapter 6: Material properties of P4HB
148
Abstract
Poly(4-hydroxybutyrate) (P4HB) is a bacterial polyhydroxyalkanoate with interesting
biological and physico-chemical properties for the use in biomedical applications. The
synthesis of P4HB through a fermentation process often leads to a polymer with a too high
molecular weight, making it difficult to process it further by solvent- or melt-processing. In this
work P4HB was degraded to obtain polymers with a molecular weight ranging from 1.5 × 103 g
mol-1 to 1.0 × 106 g mol-1 by using a method established in our laboratory. We studied the effect
of the change in molecular weight on thermal and mechanical properties. The decrease of the
molecular weight led to an increase in the degree of crystallinity of the polymer. Regarding the
tensile mechanical properties, the molecular weight played a more prominent role than the
degree of crystallinity in the evolution of the properties for the different polymer fractions. The
method presented herein allows the preparation of polymer fractions with easier processability
and still adequate thermal and mechanical properties for biomedical applications.
Introduction
Poly(4-hydroxybutyrate) (P4HB) is a natural polyester that has been approved for use as an
absorbable suture by the FDA in 2007. P4HB is a polyhydroxyalkanoate, a family of polymers
synthesized by microorganisms as carbon and energy storage compounds.
The chemical synthesis of P4HB has been attempted; however, it is generally considered
impossible to produce the polyester by this method with sufficiently high molecular weight
necessary for most applications [204]. Furthermore, the chemically produced P4HB may
contain residual metal catalysts that are used in the chemical synthesis of the polymer. Thus,
P4HB is produced through a fermentation rather than a chemical process. To produce P4HB
homopolymers, recombinant Escherichia coli strains were used. By introducing the PHB
Chapter 6: Material properties of P4HB
149
synthase gene (phbC) from Ralstonia eutropha and a 4-hydroxybutyric acid-coenzyme A
transferase gene (orfZ) from Clostridium kluyveri, E. coli strains XL1-Blue and JM109 were
able to produce P4HB when 4-hydroxybutyric acid (4HB) was supplied as a precursor in the
culture medium [64, 66]. It was also reported that an E. coli JM109 mutant carrying two
plasmids was able to synthesize P4HB using Lysogeny broth (LB) medium containing only
glucose without P4HB related precursor such as 4HB [67].
The interest on using P4HB in medical applications derives from its inherent biocompatibility
and adequate physical properties. Research has focused on heart valves, vascular grafts,
scaffolds, and sutures [53, 66]. Besides being biocompatible, the degradation process of P4HB
is also milder than that of other biomedical polymers: P4HB degrades via surface erosion,
which minimizes the burst release of acids [53]. Moreover, the degradation product, 4-
hydroxybutyrate, is a metabolite commonly found in the human body [38]. Recent studies have
shown that both fiber monofilaments [205] and fiber meshes [206] made of P4HB degraded
without causing any adverse reactions to the surrounding soft tissue (muscle and abdominal
wall, respectively). Regarding physical and chemical properties, P4HB provides a combination
of properties that makes it very useful in biomedical applications: solubility in a range of polar
solvents (e.g., acetone), elastomeric character at room and body temperature, low melt
temperature (that is, easy melt processability), high molecular weight, very high ductility
(>200%), and a moderate resorption rate in vivo [53].
Despite these characteristics and the large amount of data on in vivo animal studies [53, 205-
207], there has been little attention dedicated to the physical properties of P4HB. Specifically,
no work has concentrated on studying changes in mechanical and thermal properties of P4HB
as a function of molecular weight. Given that the bacterial synthesis of these polymers usually
leads to very high molecular weight (Mn ∼106 g mol-1) and that at such high values the melt
Chapter 6: Material properties of P4HB
150
and solvent processability are compromised, we report in this study how the acid-catalyzed
hydrolysis affects the mechanical and thermal properties of the biosynthesized P4HB.
Experimental
Biosynthesis of P4HB
All chemicals were purchased from Sigma-Aldrich (Buchs, Switzerland). Escherichia coli
JM109 carrying plasmid pKSSE5.3 was used in this study for P4HB production. pKSSE5.3
contains a PHA synthase gene (phaC) from Ralstonia eutropha and a 4-hydroxybutyric acid-
coenzyme A transferase gene (orfZ) from Clostridium kluyveri [64]. The JM109 recombinant
cells were used to inoculate a 10 mL LB culture in a 50 mL flask. The cells were incubated at
37 °C and 150 rpm overnight. The culture was then used to inoculate 200 mL of preculture
using modified E2 medium in a 1 L shake flask with a dilution of 1:20 (v v−1). Modified E2
medium contained the following constituents: NaNH4HPO4 · 4H2O 3.5 g L−1, KH2PO4
3.7 g L−1, and K2HPO4 7.5 g L−1, dissolved in 1 L of water. One mL L−1 of 1 M MgSO4 · 7H2O
was added to the medium. One mL L−1 of trace elements (TE) dissolved in 1 M HCl was also
added. TE contained: FeSO4 · 7H2O 2.78 g L−1, CaCl2 · 2H2O 1.47 g L−1, MnCl2 · 4H2O
1.98 g L−1, CoCl2 · 6H2O 2.38 g L−1, CuCl2 · 2H2O 0.17 g L−1, ZnSO4 · 7H2O 0.29 g L−1.
10 g L−1 of xylose and 4 g L−1 of Na-4HB were used as the growth substrate and the precursor
for P4HB synthesis, respectively. One g L−1 of NZ-amines and 0.015 g L−1 of thiamine were
supplemented to support the growth and 100 μg mL−1 of ampicillin was added to maintain the
plasmid. The preculture was incubated at 150 rpm and 32 °C for 16 h. It was then transferred
to 600 mL modified E2 medium in a total volume 1.4 L bioreactor (Infors AG, Bottmingen,
CH) equipped with standard control units. The initial optical density (OD600) value in the
bioreactor was between 0.10 and 0.30. Temperature was controlled at 32 °C with an external
Chapter 6: Material properties of P4HB
151
circulating water bath, and pH was maintained at 7.0 ± 0.1 by automatic addition of 25% NaOH
or 30% H3PO4. Dissolved oxygen tension was monitored continuously with an oxygen probe
(Infors AG, Bottmingen, Switzerland) and kept always above 30% oxygen saturation. The
agitation was set at 500 rpm.
Extraction of P4HB
P4HB was extracted directly from the lyophilized cells (1 mbar, 48–144 h). Cells were
transferred into pure dichloromethane (50 g dried cell biomass in 1.5 L solvent). After the
suspension was stirred at 60 °C for 90 min or at room temperature for 16 h, the solution was
filtered with pressure and concentrated by distillation at 40 °C and 400 mbar in a rotary
evaporator until the solution became viscous. The viscous solution was added dropwise under
stirring to a 6-fold quantity of ice-cold methanol. P4HB was precipitated and dried in a vacuum
dryer (VTR 5036, Heraeus, Hanau, Germany) for at least 24 h at 30 °C and 30 mbar. The
polymer was stored at −20 °C.
Degradation procedure
A solution of 1% P4HB in chloroform was prepared by dissolving the polymer overnight at
room temperature in the solvent. The catalyst solution was prepared by adding 66 μL of
sulphuric acid (95–97%) in 10 mL methanol. Afterwards, the polymer solution was heated in
reflux at 55 °C until evaporation of chloroform started, at which point the catalyst solution was
added (t = 0). At each predefined degradation time point, 500 mL of the degradation solution
were added to 500 mL pre-cooled water in a separation funnel, mixed, and allowed to separate.
The bottom phase, containing the degraded polymer, was then dropped into 1 L of stirred, ice-
cold methanol in order to precipitate it. The polymer was subsequently removed from the
methanol, dried overnight under vacuum at 40 °C and stored at −20 °C until further use.
Chapter 6: Material properties of P4HB
152
Characterization
The native and degraded polymers were characterized by gel permeation chromatography
(GPC), differential scanning calorimetry (DSC) and tensile tests. GPC was performed using a
differential refractive index detector (Viscotek, Houston, USA). Each polymer sample was
dissolved in chloroform (0.1%), and aliquots of 100 μL of the polymer solution were injected
and separated on three sequentially coupled size exclusion chromatography (SEC) columns
(300 mm × 8 mm, pore sizes of 103, 105, and 107 Å, Polymer Standard Services - PSS, Mainz,
Germany) at 35 °C, applying a flow rate of 0.5 mL min-1 of chloroform. Calibration was
performed with 10 narrow standard polystyrene (PS) samples supplied by PSS (from 2 × 103 g
mol-1 to 2.13 × 106 g mol-1). Both number–average (Mn) and weight-average (Mw) molar masses
were determined, as well as the polydispersity index (PI = Mw/Mn).
DSC was performed using a Mettler-Toledo DSC822e apparatus. The following 3-step program
was applied to all specimens: first heating from −100 °C to 100 °C at 10 °C min-1; cooling to
−100 °C at a cooling rate of −10 °C min-1; second heating to 100 °C at 10 °C min-1. The glass
transition temperature (Tg) was obtained during the cooling run, while the melting temperature
(Tm) and the enthalpy of fusion (ΔHm) were obtained from both the first and the second heating
runs.
Mechanical tests were performed in tensile mode with dog-bone specimens in a Zwick Z100
equipped with a 100 N load cell. The specimens (3 mm width and 18 mm parallel length) were
prepared by solvent casting solutions of the polymers in chloroform. Due to the high ductility
of most specimens, two loading speeds were used: 8.33 × 10−5 m s-1 (corresponding to 5 mm
min-1) up to an elongation of 2% for a more accurate determination of tensile modulus, and
8.33 × 10−4 m s-1 (corresponding to 50 mm min-1) for higher elongations. The following
Chapter 6: Material properties of P4HB
153
mechanical properties were determined: tensile strength (σt), yield stress (σy), tensile modulus
(Et), elongation at yield (ϵy), and elongation at break (ϵb).
Statistical data analysis was performed with the “R” program and the “R-commander” package
[208, 209]. One-way analysis of variance (ANOVA) was used to test for differences in means
of groups of samples, with Tukey Contrasts being subsequently used for the multiple
comparisons of means.
Results and discussion
We have previously optimized the biosynthesis of P4HB [66]. However, the material properties
of the polymer have not been investigated. In this paper, we measured thermal and mechanical
properties of both the synthesized polymer and the degraded ones.
Evolution of the molecular weight
Table 6.1 displays the evolution of molecular weight of P4HB degraded for the specified period
of time. Samples degraded for more than 16 h could not be collected at amounts sufficient to
allow further testing. The main reason was the increased difficulty in precipitating such short
oligomers in methanol, resulting in a too low yield of low molecular weight fragments. This is
evidenced by the morphology changes and mass reduction of the obtained polymers with
degradation (Fig. 6.1).
Chapter 6: Material properties of P4HB
154
Table 6.1: Evolution of the molecular weight (in 103 g mol-1) during degradation.
Batch 1
Time (h) 0 0.25 0.5 1 2 4 8 16
Mw 2500 920 170 93 55 30 17 9.5
Mn 870 290 89 49 30 17 10 6
Batch 2
Time (h) 0 0.25 0.85 1.5 3 6
Mw 2000 350 60 30 10 5
Mn 1000 260 30 15 5 1.5
Batch 3
Time (h) 0 0.25 1 3 16 22
Mw 2100 250 60 38 27 17
Mn 520 170 29 19 51 9.2
Figure 6.1: Morphology change of the obtained P4HB after degradation. (a), (b), (c), (d), (e),
(f), (g) and (h) represent the P4HB after degradation of 0, 0.25, 0.5, 1, 2, 4, 8, and 16 h,
respectively.
Chapter 6: Material properties of P4HB
155
As shown in Fig. 6.2, the methodology is also sensitive to the operating conditions: changes in
some of those lead to clear changes in the curve profile. However, the general tendency of decay
of molecular weight with degradation time was kept: the degradation followed a random chain
scission mechanism, where degradation time is proportional to the reciprocal of the molecular
weight (t ∝ 1 Mn-1) [210]. This mechanism is well described in literature for synthetic or bio-
based polymers [210, 211]. We have investigated in detail the effects of process parameters
(temperature, acid and/or methanol concentration) on the molecular weight evolution of
medium-chain-length PHAs for such polymers, whose degradation products are more
hydrophobic than ours, the linearity of a t × 1 Mn-1 curve is kept for the whole degradation time.
(P. Ketikidis, “Modeling molecular weight evolution of methanolyzed medium-chain-length
Poly(3-hydroxyalkanoates)”, personal communication). In the current study, and mainly due to
an increased methanol-solubility of short oligomers of P4HB when compared to mcl-PHA, the
curve deviates from the linearity for longer degradation times; accordingly, the curve profile
was also found to be more sensitive to the process parameters for longer times. Nevertheless,
the optimization of the degradation procedure was not the object of this study; the goal, instead,
was to determine changes in thermal and mechanical properties of our P4HB as a function of
molecular weight.
Chapter 6: Material properties of P4HB
156
Figure 6.2: Evolution of the molecular weight with degradation time. Differences in the curve
profile arise from differences in operator, volume of the aliquot removed at each time point, or
in the method used to recover the polymer, showing the sensitivity of the degradation protocol
to the process parameters. Lines are only to guide the eyes.
Change of thermal properties and crystallinity
Table 6.2 shows the thermal properties of polymers obtained during batch 2. P4HB is a rubbery
polymer, with a Tg well below room temperature and low crystallinity. That means it may
crystallize even when stored at sub-zero temperatures. To account for this effect, we extracted
melting data (Tm and ΔHm) from both the first and second heating runs, while Tg was measured
during cooling.
Chapter 6: Material properties of P4HB
157
Table 6.2: Thermal properties of original and degraded P4HB.
First heating run Second heating run Cooling
Mn (103 g mol-1) Tm (°C) −ΔHm (J g-1) Tm (°C) −ΔHm (J g-1) Tg (°C)
1000 69 63.8 57 36.5 -52
260 69 64.7 61 37.6 -52
30 69 70.5 63 42.5 -51
15 66 78.5 63 51.1 -49
5 69 85.5 61 56.4 -50
In the polymer range, Tm is usually independent of molecular weight, because the contribution
of the molecular weight-independent entropic and enthalpic terms are largely exceeded by those
of each repeating unit [212]. For example, in the case of P3HB, Yu and Marchessault have
shown that Tm is independent of the molecular weight of P3HB for Mn > 30, 000 g mol-1 [213].
In our case, the melting point was rather independent of the Mn for the whole range; there was
only a tendency to lower Tm for the original polymer (highest molecular weight) during the
second heating. Regarding the enthalpy of fusion (and, consequently, the degree of
crystallinity), two important trends are clearly visible: a monotonic increase in the enthalpy of
fusion for both heating runs, and a much higher value of the enthalpy in the first heating run as
compared to the second one. This is also accompanied by higher values of Tm for the first run.
The differences in Tm and ΔHm between the first and second cycles may be explained by the
preparation method: as described in section “Materials and Methods”, specimens were prepared
by precipitation in methanol, vacuum-drying at 40 °C, and storage at −20 °C. Therefore, enough
time and thermal energy has been supplied to allow a much higher extent of crystallization and,
simultaneously, the formation of crystals with less defects and/or thicker lamellae (what
increases the Tm). On the other hand, crystals melting during the second heating had less than
25 min (approximately the total time expended between Tg and Tm during cooling and second
Chapter 6: Material properties of P4HB
158
heating) to be formed. Therefore, only a smaller amount of material could crystallize, resulting
in lower ΔHm. Moreover, during the melt crystallization, the chains do not have as high a
mobility as when in the dissolved state, which contributes both to a lower degree of crystallinity
(that is, lower enthalpy of fusion) and to the formation of crystals with thinner lamellae or more
defects (lower Tm). This effect is especially relevant for polymers of high molecular weight,
because the melt viscosity and chain entanglements are too high and chain mobility is too low.
This results in imperfect packing of the chains and less perfect crystals and could explain the
slightly lower Tm for the original P4HB, with Mn ∼ 106 g mol-1. It also leads to the decrease of
the enthalpy of fusion with increase in molecular weight for both heating runs: the easiness of
the large-scale molecular motions needed for chain folding and lamellae formation decreases
with increasing molecular weight.
Change of mechanical properties
We also determined the evolution of mechanical properties of degraded P4HB. Figure 6.3
shows a representative curve of each sample. Original P4HB (sample “t0”) shows a typical
behaviour for a semi-crystalline polymer, with a well-defined yield point, followed by
necking/cold-drawing and a last region of strain hardening [214]. With decreasing molecular
weight both the yield point and the necking region become less evident. The most degraded
sample (“t4”) was very brittle due to inhomogenity in the specimens. In fact, it was not possible
to prepare a defect-free film of this sample.
Chapter 6: Material properties of P4HB
159
Figure 6.3: Tensile curves of a representative specimen of each sample of original and degraded
P4HB.
Table 6.3 displays a summary of the main mechanical parameters obtained from the curves.
Table 6.3: Mechanical properties of original and degraded P4HB.
Sample Mn (103 g mol-1) σt (MPa) Et (GPa) ϵb (%) σy (MPa) ϵy (%)
t0 520 28a 0.17a 520a 13a 17a
t1 290 17b 0.12b 450ab 9.6b 12b
t2 90 16b 0.12b 470ab 8.4b 10bc
t3 50 11bc 0.13b 220b 7.8bc 10bc
t4 30 5.3c 0.10b 10 5.3c 6.1c
The superscripts identify samples in the same column with significantly different values (at
p < 0.05) for the corresponding property. Tensile strength (σt), tensile modulus (Et), elongation
at break (ϵb), yield stress (σy), and elongation at yield (ϵy).
Different mechanical properties are influenced differently by the structure of the polymer. For
example, tensile strength depends on the number of ends of polymer chains and should therefore
follow a relation of the type: σt=a−b/Mn (1)
Chapter 6: Material properties of P4HB
160
even if Mn is in the polymer range [212]. The modulus, on the other hand, is mainly influenced
by the degree of crystallinity; and elongation at break depends on both the degree of crystallinity
and molecular weight [212, 215]. Our data in Table 6.3 indicates for P4HB a higher sensitivity
of mechanical properties on the molecular weight than on the degree of crystallinity. Tensile
strength, for example, agrees fairly well with a relation of the type shown in equation (1) (Fig.
6.4). In fact, even the yield strength which, according to the discussion above should be more
dependent on the degree of crystallinity, follows the same trend (Fig. 6.4), being strongly
influenced by the molecular weight. Moreover, the modulus was roughly constant for all
degraded samples (no significant differences were observed among these samples). The main
reason for this is the small change in degree of crystallinity of degraded fractions when
compared to the original P4HB, as inferred from the enthalpy of fusion in Table 6.2. The
increase in crystallinity achieved by the decrease of Mn from 106 to 3 × 104 g mol-1 was of only
about 11%. This relatively small increase in crystallinity was therefore masked by the 17-fold
decrease in molecular weight of samples shown in Table 6.3.
Figure 6.4: Tensile (σt) and yield (σy) strength as a function of the molecular weight. The fitting
of each dataset with Eq. (1) is also shown: σt = 23.574 − 581103x (r2 = 0.81), and
σy = 11.703 − 217927x (r2 = 0.85).
Chapter 6: Material properties of P4HB
161
Influence on solution and melt processing
As mentioned previously, the melt and solvent processability of bacterial synthesized P4HB is
compromised by its ultra-high molecular weight. With a Mn close to or even above 106 g mol-
1, P4HB is only soluble at low concentration in chlorinated solvents, and the molten polymer
does not flow, even at temperatures well above the Tm (Fig. 6.5 a). The degraded fractions, on
the other hand, show a typical polymeric behaviour: a viscous fluid when molten (Fig. 6.5 a)
and solubility in common solvents such as acetone (Fig. 6.5b). Fractions with Mn between ca.
50 × 106 g mol-1 and 300 × 106 g mol-1 had both suitable mechanical properties (Table 6.3) and
melt/solvent processability to allow their processing by standard polymer processing
techniques.
Figure 6.5: (a) Molten original and degraded P4HB at 100 °C. (b) Solubility of original and
degraded P4HB in acetone after 24 h at room temperature. There is a clear precipitate in the
solution of the two original P4HB specimens; all others are clear solutions. For both images,
the molecular weight (Mn, in 103 g/mol) is (from left to right): 520 (foam), 520 (film), 290, 90,
50, 30, and 17.
Chapter 6: Material properties of P4HB
162
Conclusions
We showed here that the degradation of P4HB through random chain scission has clear effects
on both thermal and mechanical properties. The decrease of molecular weight induced an
increase in the degree of crystallinity, but neither the melt nor the glass transition temperature
were affected. Despite this increase in crystallinity, the decrease of the molecular weight was
the predominant factor controlling the mechanical properties of the degraded fractions: both the
tensile strength and the modulus decreased with the decrease of molecular weight. By carefully
controlling the molecular weight of the degraded polymer, materials with adequate mechanical,
thermal and processability properties may be obtained to allow their use in biomedical
applications as a strong yet ductile polymer.
Acknowledgement
The authors acknowledge Bernhard Henes and Eric Falk for performing the degradation
experiments, Karl Kehl for the GPC, E. Falk for the DSC experiments, and Prof. Guoqiang
Chen (Tsing Hua University) for providing the plasmid pKSSE5.3. KTI (“Komission für
Technologie und Innovation”) is acknowledged for the partial financial support of this work
through project number 12409.2 PFLS-LS.
Chapter 7
General discussion
Chapter 7: General discussion
164
Agricultural waste
Overview of the main research topics of this thesis
The main goal of this thesis was to identify and render inexpensive carbon sources accessible
for the biosynthesis of high added-value biopolymers such as mcl-PHAs or P4HB by genetic
engineering and bioprocess optimization. Different recombinant strains were constructed and
cultivated in bioreactors on low-cost growth carbon substrates such as xylose, a hemicellulose
derivative and glycerol, a waste byproduct from the biodiesel industry (Fig. 7.1). This strategy
to reduce costs has to be followed in order that PHA biopolymers can compete with petroleum-
based plastics. However, current fluctuation of oil price makes it difficult to predict at which
price PHAs will become cheaper than conventional plastics. Despite this, there is no doubt that
utilization of renewable resources to produce bioplastics is essential for our environment and
society.
Figure 7.1: Overview of the main research topics of this thesis
As mentioned above, costs of production of PHAs needs to be reduced. In order to reach this
objective, various scientific studies were initiated and their results described in the different
chapters.
GGTGAGGTGGTTGCTTCGC
AAACGGAAAAGCTGACCGT
TTCGCGCCCGCATCCACTC
TGGTCGGAACAAGACCCGG
AACAGTGGTGGCAGGCAAC
TGATCGCGCAATGAAAGCT
CTGGGCGATCAGCATTCTC
TGCAGGACGTTAAAGCATT
ww
w.tru
ckingin
fo
.com
http
://ecuriechezso
i.blo
gspo
t.fr
OR
Zinn M
. /Emp
a
Le Me
ur S. /Emp
a
Le Me
ur S. /Emp
a
Le Me
ur S. /Emp
a
Le Me
ur S. /Emp
a
OR
Le Me
ur S. /Emp
a
5 µm
Side-products from
biodiesel industries
Cultivation under optimized
growth conditions
Cells with
accumulated
PHAs
P4HB “bioplastic”
mcl-PHA “bioplastic”
Selected strains
Genetic modifications
Chapter 7: General discussion
165
Mcl-PHAs from xylose
In a first approach, accumulation of mcl-PHAs was examined using xylose as carbon source.
As mentioned in Chapter 2, Pseudomonas putida KT2440 is unable to use xylose as a carbon
source. In order to enable this strain to grow with xylose, the xylAB genes from Escherichia
coli W3110 were cloned into P. putida KT2440 resulting in the recombinant strain P. putida
KT2440 (pSLM1). Efficient xylose uptake was observed in the recombinant without including
any specific transporter system such as XylE or XylFGH. Hence, xylose seems to enter the cell
through the PTS system present in P. putida in a similar way as reported for fructose [154].
Pentose and hexose transporters have been shown to be promiscuous [92], thus xylose uptake
may be accomplished by glucose uptake systems in P. putida KT2440 (pSLM1).
The maximum specific growth rate of P. putida KT2440 (pSLM1) found with 10 g L-1 of xylose
was similar to that with 10 g L-1 of glucose. However, P. putida KT2440 (pSLM1) did not
accumulate mcl-PHAs from xylose even though the parental strain P. putida KT2440 produces
mcl-PHAs from “ PHA-unrelated” carbon sources (e.g. gluconate) under nitrogen limitation
[119]. Huijberts and coworkers also demonstrated that P. putida KT2442, a spontaneous
rifampicin mutant of KT2440, was able to produce mcl-PHAs from “PHA-unrelated” carbon
sources such as glucose, fructose or glycerol when cultured under nitrogen-limited conditions
[79]. In our study using batch cultivation, nitrogen limitation was reached after 13 hours of
growth of P. putida KT2440 (pSLM1) (see Fig. 2.2) and although ample xylose was still
available, no mcl-PHA was accumulated for another 15 h. It is possible that a xylose
concentration of less than 10 g L-1 was insufficient to induce mcl-PHA accumulation under our
cultivation conditions, because PHA biosynthesis is favored in batch cultures in response to
unbalanced growth conditions and the amount of accumulated polymer becomes larger with the
increase of the C/N ratio the culture medium [16, 114]. Another strain of P. putida was isolated
Chapter 7: General discussion
166
from soil and studied by Diniz and coworkers for its ability to accumulate large amounts of
mcl-PHAs from carbohydrates. P. putida IPT 046 cultured on a minimal medium with
equimolar mixture of glucose and fructose as carbon sources either limited by nitrogen or
phosphorus. In nitrogen-limited fed-batch experiments, P. putida IPT 046 accumulated only
21% (w w-1) mcl-PHAs, whereas in the phosphorous-limited one, 63% (w w-1) mcl-PHA was
obtained [216]. This suggests that the recombinant P. putida KT2440 (pSLM1) should also be
grown on phosphorous-limited media to verified whether this has a beneficial effect on mcl-
PHA production.
Interestingly, an enzymatic link seems to be missing to convert xylose to mcl-PHA in the
recombinant Pseudomonas putida KT2440 (pSLM1). It is known that P. putida GPo1
(previously known as P. oleovorans GPo1) accumulates only trace amounts of mcl-PHAs from
glucose [69]. PhaG (3-hydroxy-acyl carrier protein (ACP)-CoA transacylase) is the key enzyme
that links fatty acid de novo synthesis with the β-oxidation pathway in Pseudomonas for the
accumulation of mcl-PHAs from unrelated carbon sources (see Chapter 1, Fig. 1.9) [69]. It is
known that P. putida GPo1 misses a functional PhaG enzyme which hinders production of mcl-
PHAs from unrelated carbon sources [75]. Hence, we can suppose that the expression of xylAB
genes may interact with this key enzyme and may lead to a non-functional PhaG. To confirm
this hypothesis under the conditions tested, expression levels of PHA synthesis genes such as
phaG or phaC (PHA synthase) should be measured.
Adaptation of the bioprocess, namely the sequential feeding of P. putida KT2440 (pSLM1)
cultures using xylose as growth substrate and octanoic acid as mcl-PHA precursor allowed
reaching a yield of 0.37 g of tailor-made mcl-PHAs per g of octanoic acid. This approach is a
pragmatic way to achieve more cost-effective mcl-PHA production, because the cells grew first
on the cheap xylose for cell proliferation and second on the more expensive fatty acid that leads
to mcl-PHA biosynthesis.
Chapter 7: General discussion
167
Inducible vectors for P4HB production
In Chapter 3, the PHA-accumulation ability of genetically engineered E. coli strains were
assessed for their capacity of poly(4-hydroxybutyrate) (P4HB) accumulation. In order to enable
P4HB biosynthesis in E. coli, IPTG-inducible vectors allowing expression of genes for a PHA
synthase (phaC) from Ralstonia eutropha (DSM 428) and a 4-hydroxybutyric acid-CoA
transferase (orfZ) from Clostridium kluyveri (DSM 555) were constructed (pSLM20, pSLM21
and pSLM22 plasmids). However, growth studies revealed that none of the three plasmids led
to intracellular accumulation of significant amounts of P4HB and was investigated in detail.
SDS-PAGE did not reveal formation of inclusion bodies of PhaC or OrfZ upon induction by
IPTG. Furthermore, no differences in expression levels were observed between induced and
non-induced cultures for the three recombinant strains (E. coli BL21 (DE3) (pSLM20), E. coli
BL21 (DE3) (pSLM21) and E. coli BL21 (DE3) (pSLM22)). Problems of codon usage and
instability of the PhaC and OrfZ enzymes produced in E. coli can be excluded because these
genes were already expressed by integrating the plasmid pKSSE5.3 in E. coli XL1-Blue [64],
and S17-1 [174]. However, frame shift mutations may have taken place during subcloning and
could explain the non-functionality of PhaC and OrfZ. Catabolite repression due to growth on
glucose can be excluded as an explanation for the very low P4HB accumulation because E. coli
BL21 (DE3) strain was used, which has three point mutations that differ from the wild-type lac
promoter. In detail, this mutation of the lambda DE3 prophage encoding T7 RNA polymerase
in pET expression hosts carries the L8-UV5 promoter and thus allows a strongly IPTG-
dependent induction of T7 RNA polymerase and high expression even in the presence of
glucose [217]. When glycerol or xylose were used as carbon substrates for growth instead of
glucose, very low polymer amounts were accumulated. To verify, whether the newly
constructed plasmids pSLM20, pSLM21 and pSLM22 were able to induce the transcription of
Chapter 7: General discussion
168
phaC and orfZ, they should be transformed in another E. coli strain that contains a plasmid with
T7 expression genes, such as E. coli JM109 (DE3) as well as the original plasmid.
The key enzyme in P4HB biosynthesis is PhaC which catalyzes the polymerization of 4-
hydroxybutyryl with the hydroxylgroup of the PHA polymer chain with the release of CoA.
Langenbach and coworkers subcloned the coding region of P. aeruginosa PHA synthase
(phaC1) into the vector pBluescript SK- under lac promoter control and transformed it into E.
coli K12, JM109 and XL1-Blue exhibiting wild-type fatty acid metabolism [218]. Only a very
weak mcl-PHA accumulation (1% w w-1) was obtained when glucose was used as growth
substrate [218]. Sim and coworkers also demonstrated only tight control of phaC transcription
through trc promoter when 0.4 mM IPTG was added to the culture broth [219]. The reason for
the insufficient expression may be that both genes require their own promoter systems. To
confirm or disprove this hypothesis, new plasmids with their own promoters should be
constructed and tested in order to verify whether phaC and orfZ genes are being expressed
efficiently.
In addition to ensure the induction of PHA biosynthesis genes, optimization of bioprocesses
can play an important part for reducing the cost of PHA production. Various steps can be
optimized and are discussed in the next section.
Bioprocess optimization approaches
To reach high specific PHA productivity and yield, many factors have to be considered such as
the type of production strain, the efficient expression of relevant genes, and the nature of carbon
source selected for favoring PHA biosynthesis.
Chapter 7: General discussion
169
To identify good PHA-producing strains, various environmental niches were screened to isolate
wild-type strains [117, 121, 220]. For example, marine strains isolated from mangrove
sediments, were able to accumulate PHAs when cultivated on a range of different carbon
sources including acetate, glycerol, succinate, glucose and sucrose. All isolated and
characterized species belonged to Vibrio spp., and accumulated P3HB with a maximum content
of 41% (w w-1) [117]. As an another example, exotic microbiological samples from sediment
of an atoll of Rangiroa located in French Polynesia allowed the isolation of a new bacterial
strain, Pseudomonas guezennei, able to accumulate mcl-PHAs mainly composed of 3-
hydroxydecanaote (64 mol%) and 3-hydroxyoctanoate (24 mol%) from a single, nonrelated
carbon substrate, i.e. glucose [121].
Another approach is to search for a strain able to produced PHAs from a certain cheap carbon
source. For example, water, sediments and garden soil samples from India allowed the isolation
of 41 strains capable of utilizing Jatropha oil, a biodiesel byproduct. From this selection, two
bacteria, identified as Bacillus sonorensis and Halomonas hydrothermalis were able to
accumulate 72% and 75% (w w-1) of P3HB, respectively [116].
In Chapter 4, we followed a different strategy for the biosynthesis of P4HB, namely the genetic
recombination of the E. coli laboratory strains (W3110, DH5α, JM109, S17-1, BL21 (DE3) and
XL1-Blue) with the pKSSE5.3 plasmid. The goal of this study was to compare different host
strains for the expression of genes needed for P4HB biosynthesis, an interesting task since these
strains differed in their metabolic background [66].
This study was limited to E. coli strains because they exhibit several advantages which make
them ideal candidates for the production of PHAs. Firstly, extensive knowledge on E. coli
genetics and biochemistry is available. Secondly, this bacterium grows fast and is able to utilize
Chapter 7: General discussion
170
a broad range of carbon sources. Thirdly, the fragility of E. coli cells allows to easily recover
the intracellularly accumulated polymer. Furthermore, E. coli does not possess any PHA
depolymerases which avoids intracellular degradation of accumulated PHAs [128, 221].
Recombinant E. coli strains harboring R. eutropha PHA biosynthesis genes responsible for
P3HB production were shown to accumulate up to 73% (w w-1) of P3HB in fed-batch
cultivation, leading to a P3HB concentration of 149.7 g L-1 with a volumetric productivity of
3.4 g L-1 h-1 [200]. By cloning the biosynthesis genes from Alcaligenes latus, Choi and
coworkers succeeded to reach a final P3HB concentration of 141 g L-1 using fed-batch strategy
as well and reaching the very high volumetric productivity of 4.63 g L-1 h-1 [96].
As mentioned in Chapter 1 (section 6, Production of PHAs), the carbon substrate used to grow
the selected strain needs to be inexpensive and abundant. Furthermore, the fermentation process
has to be efficient to satisfy the cost issues. Finally, the PHA purification method needs to be
optimal to recover the maximal amount of polymer from the biomass while not altering the
material properties of the polymer.
Potential strategies to further optimize P4HB production
A crucial factor in using recombinant E. coli strains for P4HB biosynthesis is the stable gene
expression of phaC or orfZ. This problem can be avoided when the genes are inserted into the
chromosome. As a benefit, the addition of antibiotics which are usually needed to stabilize
plasmids in recombinant strains, can be avoided; this also improves the cost-efficiency.
However, the use of recombinant strains for bioplastic production is not well received by the
agro-food industries when they should be used for packaging of food. This conception urges
some scientists to use wild-type strains such as A. latus and to optimize PHA accumulation in
different ways [222].
Chapter 7: General discussion
171
A further increase of performance can be achieved by optimizing the culture medium and by
selecting appropriate growth conditions. A suitable approach when very little information or
experience is available, is an optimization technique referred to as “design of experiments”
(DOE) [223]. Here the interaction of parameters that are considered to generate the process
response primarily are taken into account. Evaluation of the results can be done using statistical
analysis system (SAS) software run under MATLAB®. Typically, the influence of various
parameters is analyzed, like pH, carbon-to-nitrogen ratio in the feed, concentration of
substrates, concentration of trace elements, agitation intensity as dissolved oxygen tension. As
mentioned above, this approach only helps to understand the flexibility of the system and to
indicate the direction of optimization. Further experiments then have to be carried out in order
to establish an optimal feed strategy of Na-4HB in fed-batch cultivations. In addition, also
bioprocess studies have to be performed that address the question of high cell density cultures
in order to achieve a high volumetric productivity.
The productivity and yield differ considerably depending on the synthesized polymer (e.g. scl-
PHAs vs mcl-PHAs) even when using the same carbon substrate. A comparison of the
productivities for different kinds of PHAs is tricky and complex because the biosynthetic
pathways involved are sometimes peculiar as well as strains and the growth conditions. Even
when we compare the productivity for two scl-PHAs e.g. P3HB and P4HB, under so-called
“optimized conditions”, the highest reported yields are actually quite distinct. Wang and co-
workers have succeeded in achieving a P3HB content of 88% of CDW with the highest P3HB
productivity (4.94 g L-1 h-1) reported to date using sucrose as the carbon source in a fed-batch
process. In our study, a P4HB productivity of 0.207 g L-1 h-1 was reached using glycerol as the
carbon source under fed-batch conditions, which is the highest productivity for P4HB reported
so far. The achieved productivity by Lee’s group is 23-times higher; however, not only the
Chapter 7: General discussion
172
selling price but also the applications and properties of P3HB and P4HB are very different,
which makes a comparison very difficult.
Sustainable PHA production: an outlook
Knowing that microalgae accumulate fatty acids to more than 60% (w w-1) of their dry biomass
and exhibit rapid growth and high productivity, the strategy to employ carbon source from
marine feedstocks might be a feasible option for the production of the PHAs investigated in this
thesis. Microalgae are photosynthetic microorganisms that convert sunlight, water and carbon
dioxide to algal biomass which could be used as a source of a sustainable carbon substrate for
PHA accumulation [224]. The yield of fatty acid from algal cultivations is over 200-times the
yield of the best-performing plant [224]. Moreover, industrial reactors for algal cultures are
available, allowing the production of very high amounts of oil that may be needed to support
hypothetically the industry-scale production of PHAs using wild-type strains fed with algal
fatty acids [130, 224].
Also marine bacteria, such as the free-living, photoautotrophic prokaryotic cyanobacteria are
good candidates for PHA production. They get energy from sunlight and use carbon dioxide as
the primary source of carbon. Some cyanobacteria are also able to fix atmospheric nitrogen
[225] and consequently the cultivation medium could be simplified. The genomes of 65
cyanobacteria have already been sequenced, which means that a variety of genetic
manipulations can be conducted in order to achieve production of different high added-value
PHAs such as mcl-PHAs and P4HB (http://www.ncbi.nlm.nih.gov/genomes). Moreover, much
experience in cultivation of cyanobacteria is now available as they have been studied for a long
time as bioremediation agents [226]. For example, wastewater from food and brewery industries
may be a suitable carbon source for PHA production with cyanobacteria such as Spirulina
platensis and Synechocystis species. This should result in a reduction of costs for nutrients as
Chapter 7: General discussion
173
well as for the clean-up of the wastewater [227]. Various cyanobacterial species were already
studied for their ability to accumulate PHAs [35]. Up to now, only reports on the biosynthesis
of P3HB polymers by wild-type and recombinant cyanobacteria are available [35].
Recombinant Synechococcus sp. PCC7002, harboring phaCAB (GenBank Acc. No.
AM260479) and recA genes from E. coli was shown to accumulate up to 52% (w w-1) of P3HB
under nitrogen-limited conditions [32]. Under optimized conditions, a P3HB accumulation of
up to 85% (w w-1) was reported for Aulosira fertilissima cultures but with a low polymer
concentration of only 1.59 g L-1 after a cultivation of 5 days [28]. Consequently, this bioprocesss
needs to be improved to reach a high volumetric productivity which is required for industrial
production. Currently, the types of biosynthesized PHAs is restricted to P3HB in cyanobacteria,
but it may be expanded to mcl-PHAs by the exchange of the P3HB synthase with an appropriate
mcl-PHA synthase. PHA accumulation by recombinant cyanobacteria would be an attractive
option in the future allowing the remediation of wastes and at the same time reduction of the
nutrient costs.
Conclusions
The results obtained in this doctoral thesis demonstrate that high added-value PHAs can be
efficiently biosynthesized and that inexpensive carbon sources combined with optimized
fermentation processes can be used to reduce the production cost. A bioprocess for the tailor-
made mcl-PHAs production in E. coli with xylose as the growth carbon substrate and fatty acids
as polymer precursors are reported for the first time [98]. Novel is also the finding that
biosynthesis of P4HB in E. coli JM109 (pKSSE5.3) is separated from growth and that it takes
place mainly after the end of the exponential growth phase. Production of P4HB by simple
batch culture using xylose and Na-4HB was achieved with a high conversion rate, a process
that previously was only possible through fed-batch cultures with glucose [66]. Furthermore,
Chapter 7: General discussion
174
the use of glycerol, an inexpensive carbon source and waste product from biodiesel production,
allowed efficient P4HB accumulation from Na-4HB which was further stimulated by amino-
acid limitation and addition of acetic acid. This fed-batch process, using exponential feeding,
allows to reach a P4HB concentration of 15 g L-1, leading to a productivity of 0.207 g L-1 h-1,
which is the highest productivity for P4HB reported so far [68]. The fermentation processes
described in this doctoral thesis provides new prospects for industrial production of high added-
value PHAs.
175
References
1. American Chemistry Council: Life cycle of a plastic product. 2011. Accessed on
9.3.2014 from : http://plastics.americanchemistry.com/Education-Resources/Plastics-
101/Lifecycle-of-a-Plastic-Product.html.
2. Vert M, Doi Y, Hellwich K-H, Hess M, Hodge P, Kubisa P, Rinaudo M, Schué F:
Terminology for biorelated polymers and applications (IUPAC recommendations
2012). Pure Appl Chem 2012, 84(2):377.
3. Last year, new year, next year. Picture accessed on 9.3.2014 from:
https://journeytotheplasticocean.wordpress.com/2013/01/13/last-year-new-year-next-
year/
4. Yamamoto Biology: Rare sea turtles eating plastic at record rate. 2013. Picture
accessed on 9.3.2014 from: https://yamamotobiology.wikispaces.com/Tai+Manu-
Olevao.
5. Barnes DKA, Galgani F, Thompson RC, Barlaz M: Accumulation and fragmentation
of plastic debris in global environments. Philos Trans R Soc Lond B Biol Sci 2009,
364(1526):1985-1998.
6. Knight GD: Plastic Pollution, Edited by Raintree, Heinemann Library ; 2012.
7. Association of Plastic Europe: The compelling facts about plastics: An analysis of
European plastics production, demand and recovery for 2008. 2009. Accessed on
9.5.2014 from: http://www.plasticseurope.org/Documents/Document/
20100225141556-Brochure_UK_FactsFigures_2009_22sept_6_Final-20090930-001-
EN-v1.pdf.
8. European bioplastics: Fivefold growth of the bioplastics market by 2016. 2012.
Accessed on 9.5.2014 from: http://en.european-bioplastics.org/blog/2012/10/10/pr-
bioplastics-market-20121010/
9. SRI Consulting: Biodegradable polymers report. 2010. Accessed on 9.5.2014 from:
www.sriconsulting.com/CEH/Public/Reports/580.0280.
10. European commission: Techno-economic feasibility of large-scale production of bio-
based polymers in Europe. 2005. Accessed on 9.5.2014 from:
http://ftp.jrc.es/EURdoc/eur22103en.pdf.
11. Barker M, Safford R: Industrial use for crops: Markets for bioplastics, project
report no. 450. Accessed on 9.12.2014 from: http://www.hgca.com/media/408426/
pr450-final-project-report.pdf.
12. Metabolix Bioplastics. Accessed on 9.12.2014 from: http://www.mirelplastics.com/
13. European commission: PD CEN/TR 15932 Plastics – Recommendations for
terminology and characterisation of bio-plastics. 2010.
14. Bordes P, Pollet E, Avérous L: Nano-biocomposites: Biodegradable
polyester/nanoclay systems. Prog Polym Sci 2009, 34(2):125-155.
15. Lemoigne M: Produits de déshydration et de polymerisation de l’acide β-
oxobutyrique. Bull Soc Chem Biol (Paris) 1926, 8:770–782.
176
16. Macrae RM, Wilkinson JF: Poly-β-hyroxybutyrate metabolism in washed
suspensions of Bacillus cereus and Bacillus megaterium. J Gen Microbiol 1958,
19(1):210-222.
17. Wallen LL, Rohwedder. WK: Poly-β-hydroxyalkanoate from activated sludge.
Environ Sci Technol 1974, 8:576–579.
18. Howells E: Opportunities in biotechnology for the chemical industry. Chem Ind
1982, 8:508–511.
19. Anderson AJ, Dawes EA: Occurrence, metabolism, metabolic role, and industrial
uses of bacterial polyhydroxyalkanoates. Microbiol Rev 1990, 54(4):450-472.
20. Steinbüchel A: Polyhydroxyalkanoic acids. In: Biomaterials. Edited by Byrom D.
MacMillan: Basingstoke 1991: 125–213.
21. Rehm BHA, Steinbüchel A: Biochemical and genetic analysis of PHA synthases and
other proteins required for PHA synthesis. Int J Biol Macromol 1999, 25(1–3):3-19.
22. Steinbüchel A, Valentin HE: Diversity of bacterial polyhydroxyalkanoic acids.
FEMS Microbiol Lett 1995, 128(3):219-228.
23. Lageveen RG, Huisman GW, Preusting H, Ketelaar P, Eggink G, Witholt B: Formation
of polyesters by Pseudomonas oleovorans: Effect of substrates on formation and
composition of poly-(R)-3-hydroxyalkanoates and poly-(R)-3-hydroxyalkenoates.
Appl Environ Microbiol 1988, 54(12):2924-2932.
24. Kim YB, Lenz RW, Fuller RC: Poly(β-hydroxyalkanoate) copolymers containing
brominated repeating units produced by Pseudomonas oleovorans. Macromolecules
1992, 25(7):1852-1857.
25. Fritzsche K, Lenz RW, Fuller RC: An unusual bacterial polyester with a phenyl
pendant group. Makromol Chem 1990, 191(8):1957-1965.
26. Kim DY, Kim YB, Rhee YH: Evaluation of various carbon substrates for the
biosynthesis of polyhydroxyalkanoates bearing functional groups by Pseudomonas
putida. Int J Biol Macromol 2000, 28(1):23-29.
27. Kai D, Loh XJ: Polyhydroxyalkanoates: Chemical modifications toward
biomedical applications. ACS Sustainable Chem Eng 2013, 2(2):106-119.
28. Samantaray S, Mallick N: Production and characterization of poly-β-
hydroxybutyrate (PHB) polymer from Aulosira fertilissima. J Appl Phycol 2012,
24(4):803-814.
29. Hartmann R, Hany R, Pletscher E, Ritter A, Witholt B, Zinn M: Tailor-made olefinic
medium-chain-length poly[(R)-3-hydroxyalkanoates] by Pseudomonas putida
GPo1: Batch versus chemostat production. Biotechnol Bioeng 2006, 93(4):737-746.
30. Sun Z, Ramsay J, Guay M, Ramsay B: Carbon-limited fed-batch production of
medium-chain-length polyhydroxyalkanoates from nonanoic acid by Pseudomonas
putida KT2440. Appl Microbiol Biotechnol 2007, 74(1):69-77.
31. Sawada H: ISO standard activities in standardization of biodegradability of
plastics-development of test methods and definitions. Polym Degrad Stabil 1998,
59(1–3):365-370.
177
32. Akiyama H, Okuhata H, Onizuka T, Kanai S, Hirano M, Tanaka S, Sasaki K, Miyasaka
H: Antibiotics-free stable polyhydroxyalkanoate (PHA) production from carbon
dioxide by recombinant cyanobacteria. Bioresour Technol 2011, 102(23):11039-
11042.
33. Doi Y, Kanesawa Y, Kunioka M, Saito T: Biodegradation of microbial copolyesters:
Poly(3-hydroxybutyrate-co-3-hydroxyvalerate) and poly(3-hydroxybutyrate-co-4-
hydroxybutyrate). Macromolecules 1990, 23(1):26-31.
34. Zinn M, Witholt B, Egli T: Occurrence, synthesis and medical application of
bacterial polyhydroxyalkanoate. Adv Drug Deliv Rev 2001, 53(1):5-21.
35. Samantaray S, Bhati R, Mallick N: Cyanobacterial polyhydroxyalkanoates: An
alternative source for plastics. In: Cyanobacteria. John Wiley & Sons, Ltd; 2014: 227-
244.
36. Jendrossek D, Schirmer A, Schlegel HG: Biodegradation of polyhydroxyalkanoic
acids. Appl Microbiol Biotechnol 1996, 46(5-6):451-463.
37. Williams SF, Martin DP: Applications of polyhydroxyalkanoates (PHA) in medicine
and pharmacy. In: Biopolymers Online. Wiley-VCH Verlag GmbH & Co. KGaA;
2005.
38. Nelson T, Kaufman E, Kline J, Sokoloff L: The extraneural distribution of γ-
hydroxybutyrate. J Neurochem 1981, 37(5):1345-1348.
39. Lee SY: Bacterial polyhydroxyalkanoates. Biotechnol Bioeng 1996, 49(1):1-14.
40. Nebe B, Forster C, Pommerenke H, Fulda G, Behrend D, Bernewski U, Schmitz KP,
Rychly J: Structural alterations of adhesion mediating components in cells cultured
on poly-β-hydroxybutyric acid. Biomaterials 2001, 22(17):2425-2434.
41. Rivard CH, Chaput C, Rhalmi S, Selmani A: Bioabsorbable synthetic polyesters and
tissue regeneration: A study on the three-dimensional proliferation of ovine
chondrocytes and osteoblasts. Ann Chir 1996, 50(8):651-658.
42. Yao Y-C, Zhan X-Y, Zhang J, Zou X-H, Wang Z-H, Xiong Y-C, Chen J, Chen G-Q: A
specific drug targeting system based on polyhydroxyalkanoate granule binding
protein PhaP fused with targeted cell ligands. Biomaterials 2008, 29(36):4823-4830.
43. Lenz RW, Marchessault RH: Bacterial polyesters: Biosynthesis, biodegradable
plastics and biotechnology. Biomacromolecules 2004, 6(1):1-8.
44. Holmes PA: Biologically produced (R)-3-hydroxy-alkanoate polymers and
copolymers. In: Developments in Crystalline Polymers. Edited by Bassett DC: Springer
Netherlands; 1988: 1-65.
45. Eggink G, De waard P, Huijberts GNM: Formation of novel poly(hydroxyalkanoates)
from long-chain fatty acids. Can J Microbiol 1995, 41(1):14-21.
46. Chen G-Q, Wu Q: The application of polyhydroxyalkanoates as tissue engineering
materials. Biomaterials 2005, 26(33):6565-6578.
47. Sudesh K, Abe H, Doi Y: Synthesis, structure and properties of
polyhydroxyalkanoates: biological polyesters. Prog Polym Sci 2000, 25(10):1503-
1555.
48. Doi Y: Microbial Polyesters. New York VCH Publishers; 1990.
178
49. Saito Y, Doi Y: Microbial synthesis and properties of poly(3-hydroxybutyrate-co-
4-hydroxybutyrate) in Comamonas acidovorans. Int J Biol Macromol 1994, 16(2):99-
104.
50. Gross RA, DeMello C, Lenz RW, Brandl H, Fuller RC: Biosynthesis and
characterization of poly(β-hydroxyalkanoates) produced by Pseudomonas
oleovorans. Macromolecules 1989, 22(3):1106-1115.
51. Brandrup J, Immergut EH: Polymer. New York: handbookWiley; 1975.
52. Speight JG: Handbook of industrial hydrocarbon processes: Elsevier Science; 2010.
53. Martin DP, Williams SF: Medical applications of poly-4-hydroxybutyrate: A strong
flexible absorbable biomaterial. Biochem Eng J 2003, 16(2):97-105.
54. Repaske R, Repaske AC: Quantitative requirements for exponential growth of
Alcaligenes eutrophus. Appl Environ Microbiol 1976, 32(4):585-591.
55. Dawes EA, Senior PJ: The role and regulation of energy reserve polymers in micro-
organisms. In: Advances in microbial physiology. Edited by Rose AH, Tempest DW,
vol. Volume 10: Academic Press; 1973: 135-266.
56. Ward AC, Rowley BI, Dawes EA: Effect of oxygen and nitrogen limitation on poly-
β-hydroxybutyrate biosynthesis in ammonium-grown Azotobacter beijerinckii. J
Gen Microbiol 1977, 102(1):61-68.
57. Strange RE: Bacterial "Glycogen" and Survival. Nature 1968, 220(5167):606-607.
58. Obst M, Steinbüchel A: Cyanophycin-an ideal bacterial nitrogen storage material
with unique chemical properties. In: Inclusions in Prokaryotes. Edited by Shively J,
vol. 1: Springer Berlin Heidelberg; 2006: 167-193.
59. Pallerla SR, Knebel S, Polen T, Klauth P, Hollender J, Wendisch VF, Schoberth SM:
Formation of volutin granules in Corynebacterium glutamicum. FEMS Microbiol
Lett 2005, 243(1):133-140.
60. Henrysson T, McCarty PL: Influence of the endogenous storage lipid poly-β-
hydroxybutyrate on the reducing power availability during cometabolism of
trichloroethylene and naphthalene by resting methanotrophic mixed cultures. Appl
Environ Microbiol 1993, 59(5):1602-1606.
61. Senior PJ, Dawes EA: The regulation of poly-β -hydroxybutyrate metabolism in
Azotobacter beijerinckii. Biochem J 1973, 134(1):225-238.
62. Schubert P, Steinbüchel A, Schlegel HG: Cloning of the Alcaligenes eutrophus genes
for synthesis of poly-β-hydroxybutyric acid (PHB) and synthesis of PHB in
Escherichia coli. J Bacteriol 1988, 170(12):5837-5847.
63. Peoples OP, Sinskey AJ: Poly-beta-hydroxybutyrate (PHB) biosynthesis in
Alcaligenes eutrophus H16. Identification and characterization of the PHB
polymerase gene (phbC). J Biol Chem 1989, 264(26):15298-15303.
64. Hein S, Söhling B, Gottschalk G, Steinbüchel A: Biosynthesis of poly(4-
hydroxybutyric acid) by recombinant strains of Escherichia coli. FEMS Microbiol
Lett 1997, 153:411-418.
179
65. Song S, Hein S, Steinbüchel A: Production of poly(4-hydroxybutyric acid) by fed-
batch cultures of recombinant strains of Escherichia coli. Biotechnol Lett 1999,
21(3):193-197.
66. Le Meur S, Zinn M, Egli T, Thöny-Meyer L, Ren Q: Poly(4-hydroxybutyrate) (P4HB)
production in recombinant Escherichia coli: P4HB synthesis is uncoupled with cell
growth. Microb Cell Fact 2013, 12(1):123.
67. Zhou X-Y, Yuan X-X, Shi Z-Y, Meng D-C, Jiang W-J, Wu L-P, Chen J-C, Chen G-Q:
Hyperproduction of poly(4-hydroxybutyrate) from glucose by recombinant
Escherichia coli. Microb Cell Fact 2012, 11(1):54.
68. Le Meur S, Zinn M, Egli T, Thöny-Meyer L, Ren Q: Improved productivity of poly
(4-hydroxybutyrate) (P4HB) in recombinant Escherichia coli using glycerol as the
growth substrate with fed-batch culture. Microb Cell Fact 2014, 13(1):131.
69. Rehm BH, Kruger N, Steinbüchel A: A new metabolic link between fatty acid de novo
synthesis and polyhydroxyalkanoic acid synthesis. The phaG gene from
Pseudomonas putida KT2440 encodes a 3-hydroxyacyl-acyl carrier protein-
coenzyme a transferase. J Biol Chem 1998, 273(37):24044-24051.
70. Nomura CT, Taguchi K, Gan Z, Kuwabara K, Tanaka T, Takase K, Doi Y: Expression
of 3-ketoacyl-acyl carrier protein reductase (fabG) genes enhances production of
polyhydroxyalkanoate copolymer from glucose in recombinant Escherichia coli
JM109. Appl Environ Microbiol 2005, 71(8):4297-4306.
71. Witholt B, Kessler B: Perspectives of medium-chain-length
poly(hydroxyalkanoates), a versatile set of bacterial bioplastics. Curr Opin
Biotechnol 1999, 10(3):279-285.
72. Kellerhals MB, Kessler B, Witholt B: Closed-loop control of bacterial high-cell-
density fed-batch cultures: Production of mcl-PHAs by Pseudomonas putida
KT2442 under single-substrate and cofeeding conditions. Biotechnol Bioeng 1999,
65(3):306-315.
73. Ouyang S-P, Luo RC, Chen S-S, Liu Q, Chung A, Wu Q, Chen G-Q: Production of
polyhydroxyalkanoates with high 3-hydroxydodecanoate monomer content by
fadB and fadA knockout mutant of Pseudomonas putida KT2442.
Biomacromolecules 2007, 8(8):2504-2511.
74. Wang HH, Zhou XR, Liu Q, Chen GQ: Biosynthesis of polyhydroxyalkanoate
homopolymers by Pseudomonas putida. Appl Microbiol Biotechnol 2011, 89(5):1497-
1507.
75. Hoffmann N, Steinbüchel A, Rehm BH: Homologous functional expression of cryptic
phaG from Pseudomonas oleovorans establishes the transacylase-mediated
polyhydroxyalkanoate biosynthetic pathway. Appl Microbiol Biotechnol 2000,
54(5):665-670.
76. Kessler B, Witholt B: Factors involved in the regulatory network of
polyhydroxyalkanoate metabolism. J Biotechnol 2001, 86(2):97-104.
77. Chen G-Q: Plastics completely synthesized by bacteria: Polyhydroxyalkanoates. In:
Plastics from Bacteria. Edited by Chen GG-Q, vol. 14: Springer Berlin Heidelberg;
2010: 17-37.
180
78. Ren Q, de Roo G, Ruth K, Witholt B, Zinn M, Thöny-Meyer L: Simultaneous
accumulation and degradation of polyhydroxyalkanoates: Futile cycle or clever
regulation? Biomacromolecules 2009, 10(4):916-922.
79. Huijberts GN, Eggink G, Waard Pd, Huisman GW, Witholt B: Pseudomonas putida
KT2442 cultivated on glucose accumulates poly(3-hydroxyalkanoates) consisting
of saturated and unsaturated monomers. Appl Environ Microbiol 1992, 58(2):536-
544.
80. Eggink G, van der Wal H, Huijberts GNM, de Waard P: Oleic acid as a substrate for
poly-3-hydroxyalkanoate formation in Alcaligenes eutrophus and Pseudomonas
putida. Ind Crop Prod 1992, 1(2–4):157-163.
81. de Smet MJ, Eggink G, Witholt B, Kingma J, Wynberg H: Characterization of
intracellular inclusions formed by Pseudomonas oleovorans during growth on
octane. J Bacteriol 1983, 154(2):870-878.
82. Ashby RD, Foglia TA: Poly(hydroxyalkanoate) biosynthesis from triglyceride
substrates. Appl Microbiol Biotechnol 1998, 49(4):431-437.
83. Brandl H, Knee EJ, Jr., Fuller RC, Gross RA, Lenz RW: Ability of the phototrophic
bacterium Rhodospirillum rubrum to produce various poly (β-hydroxyalkanoates):
Potential sources for biodegradable polyesters. Int J Biol Macromol 1989, 11(1):49-
55.
84. Choi JI, Lee SY: Process analysis and economic evaluation for poly(3-
hydroxybutyrate) production by fermentation. Bioprocess Eng 1997, 17(6):335-342.
85. Chen GQ, Zhang G, Park SJ, Lee SY: Industrial scale production of poly(3-
hydroxybutyrate-co-3-hydroxyhexanoate). Appl Microbiol Biotechnol 2001, 57(1-
2):50-55.
86. Solaiman DK, Ashby RD, Foglia TA, Marmer WN: Conversion of agricultural
feedstock and coproducts into poly(hydroxyalkanoates). Appl Microbiol Biotechnol
2006, 71(6):783-789.
87. Lee SY: Plastic bacteria? Progress and prospects for polyhydroxyalkanoate
production in bacteria. Trends Biotechnol 1996, 14(11):431-438.
88. Ashby RD, Solaiman DKY, Foglia TA: Synthesis of short-/medium-chain-length
poly(hydroxyalkanoate) blends by mixed culture fermentation of glycerol.
Biomacromolecules 2005, 6(4):2106-2112.
89. Ashby R, Solaiman DY, Foglia T: Bacterial poly(hydroxyalkanoate) polymer
production from the biodiesel co-product stream. J Polym Environ 2004, 12(3):105-
112.
90. Xu F, Sun JX, Liu CF, Sun RC: Comparative study of alkali- and acidic organic
solvent-soluble hemicellulosic polysaccharides from sugarcane bagasse.
Carbohydrate research 2006, 341(2):253-261.
91. Sun Y, Cheng J: Hydrolysis of lignocellulosic materials for ethanol production: A
review. Bioresour Technol 2002, 83(1):1-11.
92. Song S, Park C: Utilization of D-ribose through D-xylose transporter. FEMS
Microbiol Lett 1998, 163(2):255-261.
181
93. Bertrand JL, Ramsay BA, Ramsay JA, Chavarie C: Biosynthesis of poly-β-
hydroxyalkanoates from pentoses by Pseudomonas pseudoflava. Appl Environ
Microbiol 1990, 56(10):3133-3138.
94. Ramsay JA, Hassan M-CA, Ramsay BA: Hemicellulose as a potential substrate for
production of poly(β-hydroxyalkanoates). Can J Microbiol 1995, 41(13):262-266.
95. Young FK, Kastner JR, May SW: Microbial production of poly-β-hydroxybutyric
acid from D-xylose and lactose by Pseudomonas cepacia. Appl Environ Microbiol
1994, 60(11):4195-4198.
96. Choi JI, Lee SY, Han K: Cloning of the Alcaligenes latus polyhydroxyalkanoate
biosynthesis genes and use of these genes for enhanced production of poly(3-
hydroxybutyrate) in Escherichia coli. Appl Environ Microbiol 1998, 64(12):4897-
4903.
97. Meijnen JP, de Winde JH, Ruijssenaars HJ: Engineering Pseudomonas putida S12 for
efficient utilization of D-xylose and L-arabinose. Appl Environ Microbiol 2008,
74(16):5031-5037.
98. Le Meur S, Zinn M, Egli T, Thöny-Meyer L, Ren Q: Production of medium-chain-
length polyhydroxyalkanoates by sequential feeding of xylose and octanoic acid in
engineered Pseudomonas putida KT2440. BMC Biotechnol 2012, 12(1):53.
99. Thompson JC, He BB: Characterization of crude glycerol from biodiesel production
from multiple feedstocks. Appl Eng Agric 2006, 22(2):261-265.
100. Hill J, Nelson E, Tilman D, Polasky S, Tiffany D: Environmental, economic, and
energetic costs and benefits of biodiesel and ethanol biofuels. Proc Natl Acad Sci U
S A 2006, 103(30):11206-11210.
101. REN21 (Renewable Energy Policy Network for the 21st Century) : Renewables global
status report. Accessed on 10.6.2014 from: http://www.ren21.net/ren21activities/
globalstatusreport.aspx .
102. Braunegg G, Lefebvre G, Renner G, Zeiser A, Haage G, Loidl-Lanthaler K: Kinetics
as a tool for polyhydroxyalkanoate production optimization. Can J Microbiol 1995,
41(13):239-248.
103. da Silva GP, Mack M, Contiero J: Glycerol: A promising and abundant carbon
source for industrial microbiology. Biotechnol Adv 2009, 27(1):30-39.
104. Heller KB, Lin ECC, Hastings Wilson T: Substrate specificity and transport
properties of the glycerol facilitator of Escherichia coli. J Bacteriol 1980,
144(1):274-278.
105. Voegele RT, Sweet GD, Boos W: Glycerol kinase of Escherichia coli is activated by
interaction with the glycerol facilitator. J Bacteriol 1993, 175(4):1087-1094.
106. Darbon E, Ito K, Huang HS, Yoshimoto T, Poncet S, Deutscher J: Glycerol transport
and phosphoenolpyruvate-dependent enzyme I- and HPr-catalysed
phosphorylation of glycerol kinase in Thermus flavus. Microbiology 1999,
145(11):3205-3212.
107. Lee SY, Choi J-i, Wong HH: Recent advances in polyhydroxyalkanoate production
by bacterial fermentation: Mini-review. Int J Biol Macromol 1999, 25(1–3):31-36.
182
108. Escapa IF, del Cerro C, Garcia JL, Prieto MA: The role of GlpR repressor in
Pseudomonas putida KT2440 growth and PHA production from glycerol. Environ
Microbiol 2013, 15(1):93-110.
109. Elbahloul Y, Steinbüchel A: Large-scale production of poly(3-hydroxyoctanoic
acid) by Pseudomonas putida GPo1 and a simplified downstream process. Appl
Environ Microbiol 2009, 75(3):643-651.
110. Pirt SJ: Principles of microbe and cell cultivation. Oxford; London; Edinburgh:
Blackwell Scientific; 1975.
111. Huijberts GNM, Eggink G: Production of poly(3-hydroxyalkanoates) by
Pseudomonas putida KT2442 in continuous cultures. Appl Microbiol Biotechnol
1996, 46(3):233-239.
112. Preusting H, Kingma J, Witholt B: Physiology and polyester formation of
Pseudomonas oleovorans in continuous two-liquid-phase cultures. Enzyme Microb
Technol 1991, 13(10):770-780.
113. Ramsay BA, Saracovan I, Ramsay JA, Marchessault RH: Continuous production of
long-side-chain poly-β-hydroxyalkanoates by Pseudomonas oleovorans. Appl
Environ Microbiol 1991, 57(3):625-629.
114. Durner R, Zinn M, Witholt B, Egli T: Accumulation of poly[(R)-3-
hydroxyalkanoates] in Pseudomonas oleovorans during growth in batch and
chemostat culture with different carbon sources. Biotechnol Bioeng 2001, 72(3):278-
288.
115. Lee SY, Choi JI: Effect of fermentation performance on the economics of poly(3-
hydroxybutyrate) production by Alcaligenes latus. Polym Degrad Stab 1998, 59(1–
3):387-393.
116. Shrivastav A, Mishra SK, Shethia B, Pancha I, Jain D, Mishra S: Isolation of promising
bacterial strains from soil and marine environment for polyhydroxyalkanoates
(PHAs) production utilizing Jatropha biodiesel byproduct. Int J Biol Macromol
2010, 47(2):283-287.
117. Chien CC, Chen CC, Choi MH, Kung SS, Wei YH: Production of poly-β-
hydroxybutyrate (PHB) by Vibrio spp. isolated from marine environment. J
Biotechnol 2007, 132(3):259-263.
118. Yamanè T, Shimizu S: Fed-batch techniques in microbial processes. In: Bioprocess
Parameter Control. vol. 30: Springer Berlin Heidelberg; 1984: 147-194.
119. Follonier S, Panke S, Zinn M: A reduction in growth rate of Pseudomonas putida
KT2442 counteracts productivity advances in medium-chain-length
polyhydroxyalkanoate production from gluconate. Microb Cell Fact 2011, 10(1):25.
120. Lee SY, Lee Y, Wang F: Chiral compounds from bacterial polyesters: Sugars to
plastics to fine chemicals. Biotechnol Bioeng 1999, 65(3):363-368.
121. Simon-Colin C, Alain K, Colin S, Cozien J, Costa B, Guezennec JG, Raguénès GHC:
A novel mcl PHA-producing bacterium, Pseudomonas guezennei sp. nov., isolated
from a ‘kopara’ mat located in Rangiroa, an atoll of French Polynesia. J Appl
Microbiol 2008, 104(2):581-586.
183
122. Restaino OF, Bhaskar U, Paul P, Li L, De Rosa M, Dordick JS, Linhardt RJ: High cell
density cultivation of a recombinant E. coli strain expressing a key enzyme in
bioengineered heparin production. Appl Microbiol Biotechnol 2013, 97(9):3893-
3900.
123. Williams SF, Martin DP: Therapeutic uses of polymers and oligomers comprising
γ-hydroxybutyrate. In. Edited by Tepha I, Metabolix, Inc., vol. US Patent Appl
661948: Google Patents; 2000.
124. GHB, GBL and 1,4BD as date rape drugs. Edited by Administration UDE; 2012.
Accessed on 10.11.2014 from: http://web.archive.org/web/20120510
151441/http://www.justice.gov/dea//ongoing/daterapep.html.
125. Schep LJ, Knudsen K, Slaughter RJ, Vale JA, Mégarbane B: The clinical toxicology
of γ-hydroxybutyrate, γ-butyrolactone and 1,4-butanediol. Clin Toxicol 2012,
50(6):458-470.
126. Braunegg G, Lefebvre G, Genser KF: Polyhydroxyalkanoates, biopolyesters from
renewable resources: Physiological and engineering aspects. J Biotechnol 1998,
65(2–3):127-161.
127. Williams Simon F, Rizk S, Martin David P: Poly-4-hydroxybutyrate (P4HB): A new
generation of resorbable medical devices for tissue repair and regeneration.
Biomed Tech 2013, 58(5): 439-452.
128. Lee SY: E. coli moves into the plastic age. Nat Biotechnol 1997, 15(1):17-18.
129. Life Science Intelligence: Worldwide markets and emerging technologies for tissue
engineering and regenerative medicine. 2009. Accessed on 10.11.2014 from:
http://lifescienceintelligence.com/market-reports-page.php?id=IL600.
130. Chisti Y: Biodiesel from microalgae. Biotechnol Adv 2007, 25(3):294-306.
131. Senior PJ, Dawes EA: The regulation of poly-β-hydroxybutyrate metabolism in
Azotobacter beijerinckii. Biochem J 1973, 134(1):225-238.
132. Chen G: A microbial polyhydroxyalkanoates (PHA) based bio- and materials
industry. Chem Soc Rev 2009, 38(8):2434-2446.
133. Lokesh BE, Hamid ZAA, Arai T, Kosugi A, Murata Y, Hashim R, Sulaiman O, Mori
Y, Sudesh K: Potential of oil palm trunk sap as a novel inexpensive renewable
carbon feedstock for polyhydroxyalkanoate biosynthesis and as a bacterial growth
medium. CLEAN 2012, 40(3):310-317.
134. Lee WH, Loo CY, Nomura CT, Sudesh K: Biosynthesis of polyhydroxyalkanoate
copolymers from mixtures of plant oils and 3-hydroxyvalerate precursors.
Bioresour Technol 2008, 99(15):6844-6851.
135. Solaiman DK, Swingle BM: Isolation of novel Pseudomonas syringae promoters and
functional characterization in polyhydroxyalkanoate-producing pseudomonads. N
Biotechnol 2010, 27(1):1-9.
136. Beall DS, Ohta K, Ingram LO: Parametric studies of ethanol production form xylose
and other sugars by recombinant Escherichia coli. Biotechnol Bioeng 1991,
38(3):296-303.
137. Yup Lee S: Poly(3-hydroxybutyrate) production from xylose by recombinant
Escherichia coli. Bioprocess Eng 1998, 18(5):397-399.
184
138. Franklin FC, Bagdasarian M, Bagdasarian MM, Timmis KN: Molecular and
functional analysis of the TOL plasmid pWWO from Pseudomonas putida and
cloning of genes for the entire regulated aromatic ring meta cleavage pathway. P
Natl Acad Sci USA 1981, 78(12):7458-7462.
139. Bachmann B: Derivations and genotypes of some mutant derivatives of Escherichia
coli K12, In: Escherichia coli and Salmonella: cellular and molecular biology, vol. 2.
Washington DC: ASM Press; 1987.
140. Yanisch-Perron C, Vieira J, Messing J: Improved M13 phage cloning vectors and
host strains: Nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 1985,
33(1):103-119.
141. Sambrook J, Fritsch EF, Maniatis T: Molecular cloning, vol. 1: Cold spring harbor
laboratory press New York; 1989.
142. Kessler B, de Lorenzo V, Timmis KN: A general system to integrate lacZ fusions into
the chromosomes of gram-negative eubacteria: Regulation of the Pm promoter of
the TOL plasmid studied with all controlling elements in monocopy. Mol Gen Genet
1992, 233(1-2):293-301.
143. de Lorenzo V, Eltis L, Kessler B, Timmis KN: Analysis of Pseudomonas gene
products using lacIq/Ptrp-lac plasmids and transposons that confer conditional
phenotypes. Gene 1993, 123(1):17-24.
144. Durner R, Witholt B, Egli T: Accumulation of Poly[(R)-3-hydroxyalkanoates] in
Pseudomonas oleovorans during growth with octanoate in continuous culture at
different dilution rates. Appl Environ Microbiol 2000, 66(8):3408-3414.
145. Callens M, Kersters-Hilderson H, Van Opstal O, De Bruyne CK: Catalytic properties
of D-xylose isomerase from Streptomyces violaceoruber. Enzyme Microb Technol
1986, 8(11):696-700.
146. Eliasson A, Boles E, Johansson B, Osterberg M, Thevelein JM, Spencer-Martins I,
Juhnke H, Hahn-Hagerdal B: Xylulose fermentation by mutant and wild-type strains
of Zygosaccharomyces and Saccharomyces cerevisiae. Appl Microbiol Biotechnol
2000, 53(4):376-382.
147. Ren Q, Grubelnik A, Hoerler M, Ruth K, Hartmann R, Felber H, Zinn M: Bacterial
poly(hydroxyalkanoates) as a source of chiral hydroxyalkanoic acids.
Biomacromolecules 2005, 6(4):2290-2298.
148. Hayashi K, Morooka N, Yamamoto Y, Fujita K, Isono K, Choi S, Ohtsubo E, Baba T,
Wanner BL, Mori H et al: Highly accurate genome sequences of Escherichia coli K-
12 strains MG1655 and W3110. Mol Syst Biol 2006, 2(1):2006.0007.
149. Hoffmann N, Rehm BHA: Regulation of polyhydroxyalkanoate biosynthesis in
Pseudomonas putida and Pseudomonas aeruginosa. FEMS Microbiol Lett 2004,
237(1):1-7.
150. Timm A, Steinbüchel A: Formation of polyesters consisting of medium-chain-length
3-hydroxyalkanoic acids from gluconate by Pseudomonas aeruginosa and other
fluorescent Pseudomonads. Appl Environ Microbiol 1990, 56(11):3360-3367.
151. Fuhrer T, Fischer E, Sauer U: Experimental identification and quantification of
glucose metabolism in seven bacterial species. J Bacteriol 2005, 187(5):1581-1590.
185
152. Meijnen JP, de Winde JH, Ruijssenaars HJ: Establishment of oxidative D-xylose
metabolism in Pseudomonas putida S12. Appl Environ Microbiol 2009, 75(9):2784-
2791.
153. Saier MH: Bacterial phosphoenolpyruvate: Sugar phosphotransferase systems:
Structural, functional, and evolutionary interrelationships. Bacteriol Rev 1977,
41(4):856-871.
154. Sawyer MH, Baumann P, Baumann L, Berman SM, Cánovas JL, Berman RH:
Pathways of D-fructose catabolism in species of Pseudomonas. Arch Microbiol 1977,
112(1):49-55.
155. Koller M, Atlić A, Dias M, Reiterer A, Braunegg G: Microbial PHA production from
waste raw materials. In: Plastics from Bacteria. Edited by Chen GG-Q, vol. 14:
Springer Berlin Heidelberg; 2010: 85-119.
156. Sun Z, Ramsay JA, Guay M, Ramsay B: Increasing the yield of mcl-PHA from
nonanoic acid by co-feeding glucose during the PHA accumulation stage in two-
stage fed-batch fermentations of Pseudomonas putida KT2440. J Biotechnol 2007,
132(3):280-282.
157. Sun Z, Ramsay J, Guay M, Ramsay B: Enhanced yield of medium-chain-length
polyhydroxyalkanoates from nonanoic acid by co-feeding glucose in carbon-
limited, fed-batch culture. J Biotechnol 2009, 143(4):262-267.
158. Sun Z, Ramsay JA, Guay M, Ramsay BA: Automated feeding strategies for high-
cell-density fed-batch cultivation of Pseudomonas putida KT2440. Appl Microbiol
Biotechnol 2006, 71(4):423-431.
159. Kim GJ, Lee IY, Yoon SC, Shin YC, Park YH: Enhanced yield and a high production
of medium-chain-length poly(3-hydroxyalkanoates) in a two-step fed-batch
cultivation of Pseudomonas putida by combined use of glucose and octanoate.
Enzyme Microb Technol 1997, 20(7):500-505.
160. Heider J: A new family of CoA-transferases. FEBS Letters 2001, 509(3):345-349.
161. Söhling B, Gottschalk G: Molecular analysis of the anaerobic succinate degradation
pathway in Clostridium kluyveri. J Bacteriol 1996, 178(3):871-880.
162. Schubert P, Krüger N, Steinbüchel A: Molecular analysis of the Alcaligenes
eutrophus poly(3-hydroxybutyrate) biosynthetic operon: Identification of the N
terminus of poly(3-hydroxybutyrate) synthase and identification of the promoter.
J Bacteriol 1991, 173(1):168-175.
163. Braunegg G, Sonnleitner B, Lafferty R: A rapid gas chromatographic method for the
determination of poly-3-hydroxybutyric acid in microbial biomass. Appl Microbiol
Biotechnol 1978, 6:29-37.
164. Gogolewski S, Jovanovic M, Perren SM, Dillon JG, Hughes MK: Tissue response and
in vivo degradation of selected polyhydroxyacids: Polylactides (PLA), poly(3-
hydroxybutyrate) (PHB), and poly(3-hydroxybutyrate-co-3-hydroxyvalerate)
(PHB/PHV). J Biomed Mater Res 1993, 27(9):1135-1148.
165. Brandl H, Bachofen R, Mayer J, Wintermantel E: Degradation and applications of
polyhydroxyalkanoates. Can J Microbiol 1995, 41:143-153.
186
166. Rathbone S, Furrer P, Lubben J, Zinn M, Cartmell S: Biocompatibility of
polyhydroxyalkanoate as a potential material for ligament and tendon scaffold
material. J Biomed Mat Res 2010, 93A(4):1391-1403.
167. Engelberg I, Kohn J: Physico-mechanical properties of degradable polymers used
in medical applications: A comparative study. Biomaterials 1991, 12(3):292-304.
168. Kim JS, Lee BH, Kim BS: Production of poly(3-hydroxybutyrate-co-4-
hydroxybutyrate) by Ralstonia eutropha. Biochem Eng J 2005, 23(2):169-174.
169. Saito Y, Nakamura S, Hiramitsu M, Doi Y: Microbial synthesis and properties of
poly(3-hydroxybutyrate-co-4-hydroxybutyrate). Polym Int 1996, 39(3):169-174.
170. Choi JI, Lee SY: High-level production of poly(3-hydroxybutyrate-co-3-
hydroxyvalerate) by fed-batch culture of recombinant Escherichia coli. Appl
Environ Microb 1999, 65(10):4363-4368.
171. Sudesh K, Fukui T, Taguchi K, Iwata T, Doi Y: Improved production of poly(4-
hydroxybutyrate) by Comamonas acidovorans and its freeze-fracture morphology.
Int J Biol Macromol 1999, 25(1–3):79-85.
172. Luli GW, Strohl WR: Comparison of growth, acetate production, and acetate
inhibition of Escherichia coli strains in batch and fed-batch fermentations. Appl
Environ Microbiol 1990, 56(4):1004-1011.
173. Murata T, Horinouchi S, Beppu T: Production of poly(L-aspartyl-L-phenylalanine)
in Escherichia coli. J Biotechnol 1993, 28(2–3):301-312.
174. Zhang L, Shi Z-Y, Wu Q, Chen G-Q: Microbial production of 4-hydroxybutyrate,
poly-4-hydroxybutyrate, and poly(3-hydroxybutyrate-co-4-hydroxybutyrate) by
recombinant microorganisms. Appl Microbiol Biotechnol 2009, 84(5):909-916.
175. Hanahan D: Studies on transformation of Escherichia coli with plasmids. J Mol Biol
1983, 166(4):557-580.
176. YanischPerron C, Vieira J, Messing J: Improved M13 phage cloning vectors and host
strains: Nucleotide sequences of the M13mp18 and Puc19 vectors. Gene 1985,
33(1):103-119.
177. Bullock W, Fernandez J, Short J: XL1-blue: High efficiency plasmid transforming
recA Escherichia coli strain with β-galactosidase selection. BioTechniques 1987,
5(376-378).
178. Simon R, Priefer U, Puhler A: A broad host range mobilization system for in vivo
genetic engineering: Transposon mutagenesis in gram-negative bacteria. Nat
Biotechnol 1983, 1(9):784-791.
179. Daegelen P, Studier FW, Lenski RE, Cure S, Kim JF: Tracing ancestors and relatives
of Escherichia coli B, and the derivation of B strains REL606 and BL21(DE3). J
Mol Biol 2009, 394(4):634-643.
180. Marvel CS, Birkhimer ER: The preparation of the sodium salts of ω-
hydroxybutyric,-valeric and-caproic acids. J Am Chem Soc 1929, 51(1):260-262.
181. Chang DE, Shin S, Rhee JS, Pan JG: Acetate metabolism in a pta mutant of
Escherichia coli W3110: Importance of maintaining acetyl coenzyme a flux for
growth and survival. J Bacteriol 1999, 181(21):6656-6663.
187
182. Wang FL, Lee SY: High cell density culture of metabolically engineered Escherichia
coli for the production of poly(3-hydroxybutyrate) in a defined medium. Biotechnol
Bioeng 1998, 58(2-3):325-328.
183. Lee SY, Chang HN: Production of poly(3-hydroxybutyric acid) by recombinant
Escherichia coli strains: Genetic and fermentation studies. Can J Microbiol 1995,
41(13):207-215.
184. Li ZJ, Cai L, Wu Q, Chen GQ: Overexpression of NAD kinase in recombinant
Escherichia coli harboring the phbCAB operon improves poly(3-hydroxybutyrate)
production. Appl Microbiol Biotechnol 2009, 83(5):939-947.
185. Riesenberg D: High cell-density cultivation of Escherichia coli. Curr Opin Biotechnol
1991, 2(3):380-384.
186. Madison LL, Huisman GW: Metabolic engineering of poly(3-hydroxyalkanoates):
From DNA to plastic. Microbiol Mol Biol R 1999, 63(1):21-53.
187. Ren Q, Ruth K, Thöny-Meyer L, Zinn M: Enatiomerically pure hydroxycarboxylic
acids: Current approaches and future perspectives. Appl Microbiol Biotechnol 2010,
87(1):41-52.
188. Ward PG, O'Connor KE: Bacterial synthesis of polyhydroxyalkanoates containing
aromatic and aliphatic monomers by Pseudomonas putida CA-3. Int J Biol
Macromol 2005, 35(3-4):127-133.
189. Opitz F, Schenke-Layland K, Richter W, Martin DP, Degenkolbe I, Wahlers T, Stock
UA: Tissue engineering of ovine aortic blood vessel substitutes using applied shear
stress and enzymatically derived vascular smooth muscle cells. Ann Biomed Eng
2004, 32(2):212-222.
190. Shojaosadati SA, Kolaei SMV, Babaeipour V, Farnoud AM: Recent advances in high-
cell-density cultivation for production of recombinant protein. Iran J Biotechnol
2008, 6(2):63-84.
191. Korz DJ, Rinas U, Hellmuth K, Sanders EA, Deckwer WD: Simple fed-batch
technique for high cell-density cultivation of Escherichia coli. J Biotechnol 1995,
39(1):59-65.
192. Lee SY, Lee KM, Chan HN, Steinbuchel A: Comparison of recombinant Escherichia
coli strains for synthesis and accumulation of poly-(3-hydroxybutyric acid) and
morphological changes. Biotechnol Bioeng 1994, 44(11):1337-1347.
193. Lee SY: High cell-density culture of Escherichia coli. Trends Biotechnol 1996,
14(3):98-105.
194. Waegeman H, Soetaert W: Increasing recombinant protein production in
Escherichia coli through metabolic and genetic engineering. J Ind Microbiol
Biotechnol 2011, 38(12):1891-1910.
195. Clomburg J, Gonzalez R: Biofuel production in Escherichia coli: The role of
metabolic engineering and synthetic biology. Appl Microbiol Biotechnol 2010,
86(2):419-434.
196. Palmeri R, Pappalardo F, Fragalà M, Tomasello M, Damigella A, Catara AF:
Polyhydroxyalkanoates (PHAs) production through conversion of glycerol by
188
selected strains of Pseudomonas mediterranea and Pseudomonas corrugata. Chem
Eng 2012, 27.
197. Ren Q, Henes B, Fairhead M, Thöny-Meyer L: High level production of tyrosinase in
recombinant Escherichia coli. BMC Biotechnol 2013, 13(1):1-10.
198. Valentin HE, Zwingmann G, Schonebaum A, Steinbüchel A: Metabolic pathway for
biosynthesis of poly(3-hydroxybutyrate-co-4-hydroxybutyrate) from 4-
hydroxybutyrate by Alcaligenes eutrophus. Eur J Biochem FEBS 1995, 227(1-2):43-
60.
199. Cutayar JM, Poillon D: High-cell-density culture of E. coli in a fed-batch system
with dissolved oxygen as substrate feed indicator. Biotechnol Lett 1989, 11(3):155-
160.
200. Wang F, Lee SY: Production of poly(3-hydroxybutyrate) by fed-batch culture of
filamentation-suppressed recombinant Escherichia coli. Appl Environ Microbiol
1997, 63(12):4765-4769.
201. Kämpf MM, Thöny-Meyer L, Ren Q: Biosynthesis of poly(4-hydroxybutyrate) in
recombinant Escherichia coli grown on glycerol is stimulated by propionic acid. Int
J Biol Macromol 2014, 71:8-13.
202. Roe AJ, O'Byrne C, McLaggan D, Booth IR: Inhibition of Escherichia coli growth by
acetic acid: A problem with methionine biosynthesis and homocysteine toxicity.
Microbiol-Sgm 2002, 148:2215-2222.
203. Lin H, Castro N, Bennett G, San K-Y: Acetyl-CoA synthetase overexpression in
Escherichia coli demonstrates more efficient acetate assimilation and lower acetate
accumulation: A potential tool in metabolic engineering. Appl Microbiol Biotechnol
2006, 71(6):870-874.
204. Hori Y, Yamaguchi A, Hagiwara T: Chemical synthesis of high molecular weight
poly(3-hydroxybutyrate-co-4-hydroxybutyrate). Polymer 1995, 36(24):4703-4705.
205. Odermatt EK, Funk L, Bargon R, Martin DP, Rizk S, Williams SF: MonoMax suture:
A new long-term absorbable monofilament suture made from poly-4-
hydroxybutyrate. Int J Polym Sci 2012, 2012:12.
206. Martin DP, Badhwar A, Shah DV, Rizk S, Eldridge SN, Gagne DH, Ganatra A, Darois
RE, Williams SF, Tai H-C et al: Characterization of poly-4-hydroxybutyrate mesh
for hernia repair applications. J Surg Res 2013, 184(2):766-773.
207. Mendelson K, Aikawa E, Mettler BA, Sales V, Martin D, Mayer JE, Schoen FJ: Healing
and remodeling of bioengineered pulmonary artery patches implanted in sheep.
Cardiovasc Pathol 2007, 16(5):277-282.
208. Team RC: R: A language and environment for statistical computing. Edited by
Computing RFfS: http://www.R-project.org/; 2012.
209. Fox J: Getting started with the R commander: A basic-statistics graphical user
interface to R. J Stat Softw 2005, 14(9):1-42.
210. Martens AA, Besseling NAM, Rueb S, Sudhölter EJR, Spaink HP, De Smet LCPM:
Random scission of polymers: Numerical simulations, and experiments on
hyaluronan hydrolosis. Macromolecules 2011, 44(8):2559-2567.
189
211. Majid MIA, Ismail J, Few LL, Tan CF: The degradation kinetics of poly(3-
hydroxybutyrate) under non-aqueous and aqueous conditions. Eur Polym J 2002,
38(4):837-839.
212. Billmeyer Jr. FW: Textbook of polymer science. Edited by Sons JW; 1984: 261-360.
213. Yu G-e, Marchessault RH: Characterization of low molecular weight poly(β-
hydroxybutyrate)s from alkaline and acid hydrolysis. Polymer 2000, 41(3):1087-
1098.
214. Ward IM: Mechanical properties of solid polymers. In: Mechanical Properties of
Solid Polymers. John Wiley & Sons; 1985: 329-373.
215. Callister Jr. WD: Materials science and engineering: An introduction. Edited by
Sons JW; 1997: 466-485.
216. Diniz SC, Taciro MK, Cabrera Gomez JG, Pradella JGC: High-cell-density cultivation
of Pseudomonas putida IPT 046 and medium-chain-length polyhydroxyalkanoate
production from sugarcane carbohydrates. Appl Biochem Biotechnol 2004,
119(1):51-69.
217. Grossman TH, Kawasaki ES, Punreddy SR, Osburne MS: Spontaneous cAMP-
dependent derepression of gene expression in stationary phase plays a role in
recombinant expression instability. Gene 1998, 209(1-2):95-103.
218. Langenbach S, Rehm BH, Steinbüchel A: Functional expression of the PHA synthase
gene phaC1 from Pseudomonas aeruginosa in Escherichia coli results in poly(3-
hydroxyalkanoate) synthesis. FEMS Microbiol Lett 1997, 150(2):303-309.
219. Sim SJ, Snell KD, Hogan SA, Stubbe J, Rha C, Sinskey AJ: PHA synthase activity
controls the molecular weight and polydispersity of polyhydroxybutyrate in vivo.
Nat Biotech 1997, 15(1):63-67.
220. Quillaguamán J, Guzmán H, Van-Thuoc D, Hatti-Kaul R: Synthesis and production
of polyhydroxyalkanoates by halophiles: Current potential and future prospects.
Appl Microbiol Biotechnol 2010, 85(6):1687-1696.
221. Fidler S, Dennis D: Polyhydroxyalkanoate production in recombinant Escherichia
coli. FEMS Microbiol Rev 1992, 9(2-4):231-235.
222. Wang F, Lee SY: Poly(3-hydroxybutyrate) production with high productivity and
high polymer content by a fed-batch culture of Alcaligenes latus under nitrogen
limitation. Appl Environ Microbiol 1997, 63(9):3703-3706.
223. Fisher RA: The design of experiments, 9th edition edn. New York Macmillan; 1935.
224. Demirbas A, Fatih Demirbas M: Importance of algae oil as a source of biodiesel.
Energ Convers Manage 2011, 52(1):163-170.
225. Carr NG, Whitton BA: The biology of cyanobacteria, vol. 19: Univ of California Press;
1982.
226. de-Bashan LE, Bashan Y: Immobilized microalgae for removing pollutants: Review
of practical aspects. Bioresour Technol 2010, 101(6):1611-1627.
227. Abed RM, Dobretsov S, Sudesh K: Applications of cyanobacteria in biotechnology.
J Appl Microbiol 2009, 106(1):1-12.
190