rights / license: research collection in copyright - non …25863/et… · filamentous...

Research Collection

Master Thesis

Generation and characterization of monospecific antibodiesagainst Sm- and LSm-Proteins

Author(s): Hänni, Sandra Silvia

Publication Date: 2002

Permanent Link: https://doi.org/10.3929/ethz-a-004432542

Rights / License: In Copyright - Non-Commercial Use Permitted

This page was generated automatically upon download from the ETH Zurich Research Collection. For moreinformation please consult the Terms of use.

ETH Library

https://doi.org/10.3929/ethz-a-004432542

http://rightsstatements.org/page/InC-NC/1.0/

https://www.research-collection.ethz.ch

https://www.research-collection.ethz.ch/terms-of-use

Generation and Characterization of

monospecific antibodies against

Sm- and LSm- Proteins

Diploma Thesis

of

Sandra Silvia Hänni

Citizen of Gurzelen BE

Supervisor: Prof. Dr. P. A. Schubiger

Supervisor: Dr. C. Kambach March 4 – July 26 2002

Departement Angewandte Biowissenschaften Institut für Pharmazeutische Wissenschaften

Diploma Thesis Structural Biology Sandra Haenni Paul Scherrer Institute

TABLE OF CONTENTS

1. SUMMARY .....................................................................................................................................................4

2. INTRODUCTION ............................................................................................................................................5

2.1 Aim of the project .......................................................................................................................................5

2.2 RNA Splicing and Sm- Proteins ................................................................................................................5

3. MATERIALS AND METHODS.......................................................................................................................8

3.1 Construction of Expression vectors ........................................................................................................8 3.1.1 D2D1(78):pRK172...................................................................................................................................9 3.1.2 D2(27-118)D1:pRK172..........................................................................................................................11 3.2.3 D3B(91):pQE30 ....................................................................................................................................12 3.1.4 D3(75)B:pQE30 ....................................................................................................................................12

3.2 Protein Expression and Purification ......................................................................................................13 3.2.1 D2D1(78):pRK172.................................................................................................................................13 3.2.2 D2(27-118)D1:pRK172..........................................................................................................................14

3.3 Phage Library Screening .........................................................................................................................15

4. RESULTS.....................................................................................................................................................18

4.1 Cloning of Expression vectors ...............................................................................................................18 4.1.1. D2D1(78):pRK172................................................................................................................................18 4.1.2 D2(27-118)D1:pRK172..........................................................................................................................18 4.1.3 D3B(91):pQE30 ....................................................................................................................................19 4.1.4 D3(75)B:pQE30 ....................................................................................................................................20

4.2 Protein Expression and Purification ......................................................................................................20 4.2.1 Protein Expression of D2D1(78):pRK172 .............................................................................................20 4.2.2 Protein Expression of D2(27-118)D1:pRK172 ......................................................................................22

4.3 Phage Library Screening .........................................................................................................................22 4.3.1 LSm2-3 antibodies from ETH-2 Library ...............................................................................................23 4.3.2 D3B antibodies from Griffin.1 Library ...................................................................................................23 4.3.3 D1D2 antibodies from Griffin.1 Library..................................................................................................24 4.3.4 BSA......................................................................................................................................................24

5. DISCUSSION ...............................................................................................................................................25

6. OUTLOOK....................................................................................................................................................27

7. LITERATURE...............................................................................................................................................28

8. APPENDIX ...................................................................................................................................................30

8.1 Primer sequences and specifications ....................................................................................................30 8.1.1 Primers for D1(78) ................................................................................................................................30 8.1.2 Primers for D2(27-118).........................................................................................................................30


3

8.2 Cation Exchange Chromatography ........................................................................................................30 8.2.1 Programs .............................................................................................................................................30 8.2.2 Chromatograms D2D1(78):pRK172......................................................................................................31 8.2.3 Chromatogram D2(27-118)D1:pRK172 ................................................................................................32

8.3 Protocols Phage Display .........................................................................................................................33 8.3.1 ETH-2 Library.......................................................................................................................................33 8.3.2 Griffin.1 Library ....................................................................................................................................35

8.4 ELISA .........................................................................................................................................................42 8.4.1 LSm2-3 ................................................................................................................................................42 8.4.2 D3B.......................................................................................................................................................44 8.4.3 D1D2 .....................................................................................................................................................45 8.4.4 BSA......................................................................................................................................................45

8.5 Buffers and Media ....................................................................................................................................46 8.5.1 Cloning steps .......................................................................................................................................46 8.5.2 Protein Expression...............................................................................................................................47 8.5.3 Cation exchange chromatography.......................................................................................................48 8.5.4 Phage Display......................................................................................................................................48


4

1. Summary

Sm- and LSm- proteins are a protein family whose members are involved in various RNA

processing events. They are only functional in form of multimeric complexes, the

composition and architecture of which determines the RNA target and function. For the

assessment of the role of the individual Sm/LSm-proteins in a given function, tools are

required to distinguish first between the individual complexes and then between the

individual proteins.

Sm- and LSm- proteins show a common fold and share epitopes. Native anti-Sm-

autoantibodies from patients suffering from Systemic Lupus Erythematosus as well as

most available monoclonal antibodies show cross-reactivity. To obtain tools to distinguish

between the different complexes, phage display libraries were screened for monospecific

antibodies. The generation of peptide repertoires and their selection by display on

filamentous bacteriophage by fusion to a phage coat protein (pIII) has provided a means

for displaying folded antibody fragments in bacteria. The ETH-2 Library was screened for

antibodies against LSm2-3, several monoclonal antibodies could be selected. All clones

were tested for cross-reactivity and were monospecific for LSm2-3.

Since in previous experiments it had not been possible to isolate monospecific antibodies

against D1D2 and D3B from this library, another library had to be screened with these

antigens, the Griffin.1 Library from the MRC LMB Cambridge. Eight positive clones against

D3B could be isolated, they need to be tested for cross-reactivity. The screening for D1D2

did not isolate monospecific antibodies. Phages were grown from the secondary stocks,

and screening was performed using BSA as control antigen. This screening did not lead to

positive clones.

Sm- proteins can only be expressed as heterodimers and heterotrimers, respectively. To

distinguish between the individual proteins several truncated versions of the complexes

D1D2 and D3B were constructed in order to avoid cross-reactivity. Protein expression was

performed of the truncated versions of D1D2. Assessment of protein expression was

inconclusive. Expressed material was purified with Cation Exchange Chromatography, but

due to technical problems the proteins were lost. The cloning of the truncated versions of

the D3B complex did not work properly, none of the colonies after transformation contained

an insert of the correct size. Several measures were taken to inhibit expression of

potentially toxic protein after transformation, but all to no avail. Cloning of these constructs

will have to be repeated.


5

2. Introduction

2.1 Aim of the project

The main aim of this project was the generation and characterization of monospecific

antibodies against Sm- and LSm- proteins. These proteins are involved in various RNA

processing events. They are only functional in form of multimeric complexes, the

composition and architecture of which determines the RNA target and function. For the

assessment of the role of the individual Sm/LSm-proteins in a given function, tools are

required to distinguish first between the individual complexes and then between the

individual proteins. One possible tool are monospecific antibodies.

Sm- and LSm- proteins show a common fold and share epitopes. Native autoantibodies of

patients suffering from Systemic Lupus Erythematosus as well as most available

monoclonal antibodies show cross-reactivity between complexes. To obtain tools to

distinguish between the different complexes, phage display libraries were screened for

monospecific antibodies using LSm2-3, D3B and D1D2 as chosen targets. These

complexes were already available in the laboratory.

Sm- proteins can only be expressed as heterodimers and heterotrimers, respectively. To

distinguish between the individual proteins several truncated versions of the complexes

D1D2 and D3B were constructed in order to avoid cross-reactivity. For these mutants

cloning and expression vectors had to be constructed, proteins expressed and purified.

2.2 RNA Splicing and Sm- Proteins

The protein coding sequence of the majority of eucaryotic genes is interrupted by

noncoding intervening sequences (introns). Following transcription into mRNA precursors,

the introns are excised within a macromolecular assembly called the spliceosome to form

continuous coding sequences. The major components of the spliceosome are four RNA-

protein complexes, the U1, U2, U4/U6, and the U5 small nuclear ribonucleoprotein

particles (snRNPs). These snRNPs recognize short conserved sequences at the intron-

exon junctions and the branchpoint within the introns and assemble together with non-

snRNP splicing factors into catalytically active spliceosomes in which these sites are

brought into close proximity by a network of interactions.


6

The functional roles of the spliceosomal snRNPs are the following:

U2

x U1 U2

x U1

U4 U5 U6

x U1

U4 U5U6 x

U2 U1

U5U6x

U2

U5 initially complexed with U4 and U6, binds exon sequences upstream of the 5’-splice

site and downstream of the 3’-splice site

U6 initially complexed with U4 and U5, displaces U1 from 5’-splice site, forming duplex

with intron sequences. Complexes with U2, bringing the intron 5’-splice site close to

the branchpoint.

Fig.2: Proposed Higher-Order Assembly of the Human Core snRNP Proteins. The seven core Sm proteins (B/B’, D1, D2, D3, E, F, G) are arranged within the seven-membered ring based on crystal structures of the D1 D2 and D3B complexes and pairwise interactions deduced from biochemical and genetic experiments. The heptameric complex is only stable in the presence of RNA. Kambach, C. et al.; Crystal Structures of Two Sm Protein Complexes and Their Implications for the Assembly of the Spliceosomal snRNPs; Cell, Vol. 96, 375-387, 1999.

A second group of proteins, closely related in sequence, has been identified in recent

years, the so-called LSm- proteins. Although not much is known about these proteins yet,

it has been established that they are involved in splicing, too.

U1 initially bound to 5’-splice site, is

released upon recruitment of U4/U5/U6

U2 initially binds the branchpoint recognition

sequence, forms two duplexes with U6,

bringing the intron 5’-splice site close to

the branchpoint

U4 initially complexed with U6, keeps U6 in

an inactive conformation and is released

after delivering U6 to the 5’-splice site.

Then complexed with U5 and U6.

Fig.1: Model for nuclear pre-mRNA splicing. Fromwww.biology.ucsc.edu/classes/bio115/lectures/lecture%2009/lecture_09b.da

One class of spliceosomal proteins are the Sm- proteins

forming the protein core of the U1, U2, U4 and U5

spliceosomal snRNPs. The seven known Sm- proteins bind

to the so-called Sm site in the RNA moieties of these

snRNPs and are believed to form a doughnut-shaped

complex.


7

Sm- and LSm- proteins are associated with many patho-physiological processes. Anti-Sm-

proteins have first been isolated from the sera of patients suffering from Systemic Lupus

Erythematosus (SLE). SLE is a chronic, inflammatory autoimmune disorder that may affect

many organ systems including the skin, joints and internal organs. SLE is characterized by

the presence of various autoantibodies directed against a large number of intracellular

antigens. Among the antinuclear antibodies, anti-Sm- autoantibodies are the most

prominent and are diagnostic for the disease.

One other disease associated with Sm- protein biochemistry is Spinal Muscular Atrophy

(SMA), one of the most common fatal autosomal recessive diseases. SMA is

characterized by degeneration of motor neurons and muscular atrophy. The SMA disease

gene, termed Survival of Motor Neurons (SMN), is deleted or mutated in over 98% of SMA

patients. The function of the SMN protein is unknown. SMN is tightly associated with a

novel protein, SIP1, and together they form a specific complex with several spliceosomal

snRNP proteins. SMN interacts directly with several of the snRNP Sm core proteins,

including B, D1–3, and E. This interaction between SMN and Sm- proteins is required for

the snRNP assembly in motor neurons. A point mutation in a given SMA patient proved to

be defective in Sm- binding, thus the loss of binding leads to the disease.

Systemic Lupus Erythematosus and Spinal Muscular Atrophy are only two examples of

diseases which are associated with splicing defects. It is important to study these

processes in order to better understand the diseases that are associated with them.


8

3. Materials and Methods

All enzymes and buffers for the cloning reactions were from Fermentas if not specified

otherwise. Kits for PCR Purification and Gel Extraction were provided by QIAgen, the kit

for Plasmid Extraction by Amersham. E. coli strains XL1blue and B834(DE3) were

available in the laboratory. Primers were ordered from Microsynth, sequences and

specifications can be found in the appendix.

For buffers, stock solutions and media the references can be found in the appendix (8.5).

All chemical substances were provided by Fluka, Merck, Sigma, Difco, Bio101, Gerbu.

Eppendorf, falcon, and nunc provided plastic tubes and immunotubes.

3.1 Construction of Expression vectors

To obtain monospecific antibodies against individual proteins, several truncated versions

of the complexes D3B and D1D2 were constructed. In all constructs one compound was

kept full length, the other compound was reduced to the so-called Sm-motif which is

necessary and sufficient to keep the complex soluble, e.g. the construct D3(75)B contains

the protein B full length, the compound D3(75) consists only of the Sm-motif. The aim of

this approach is to raise monospecific antibodies against epitopes outside the Sm-motif

that should be specific for a given Sm- protein.

Fig.3: Cloning scheme of the truncated versions of the D1D2 and D3B complexes. SD_SEQ Shine-Dalgarno sequence, or ribosome binding site, His-tag for later protein purification with affinity chromatography, TEV-site Tobacco etch virus protease cleavage site. The construct D3(75)B contains the protein B full length, the compound D3(75) consists only of the Sm-motif which is necessary and sufficient to keep the complex soluble. The aim of this approach is to raise monospecific antibodies against the N-Terminus of B. The other constructs are based on the same principle.

D2D1 full length:

D3B full length:

D3(75)B:


9

3.1.1 D2D1(78):pRK172

For this vector one construct was available, D2D1:pRK172. The fragment D1(78) had to be

obtained by PCR.

Tab.1: PCR conditions for D2D1(78):pRK172

DNA template (10ng/ml) 3µl

Pfu Buffer 10x (Stratagene) 10µl

Pfu Turbo (2.5U/µl, Stratagene) 1µl

dNTPs (10mM) 2µl

5’ primer (10µM) 5µl

3’ primer (10µM) 5µl

Water (Millipore) 72µl

The PCR was done with a temperature gradient from 60°C up to 70°C:

• 95°C, 1 minute Hot start

• 95°C, 1 minute Denaturation of DNA strands

• Gradient 64°C - 70°C, 1 minute Annealing of primers

• 72°C, 1 minute Extension

• 72°C, 5 minutes Finish, repairs

• 4°C, hold Cool down, storage

The PCR was run for 28 cycles. After purification of the fragment with gel electrophoresis,

fragment and vector, D2D1:pRK172, were digested. Tab.2: Restriction digestion of D2D1(78):pRK172

Vector Insert

DNA (vector, insert) 3µl 10µl

BglII (10u/µl) 2µl 2µl

HindIII (10u/µl) 2µl 2µl

NEB2 10x 10µl 10µl

Water (Millipore) 83µl 76µl

The restriction reaction was incubated at 37°C for 2 hours. Then another 2µl of each

enzyme were added and the reaction was incubated for another 2 hours. The restricted

1 cycle


10

vector was incubated with 5µl Calf Intestine Alkaline Phosphatase (CIAP, 1u/µl) for two

hours. This enzyme dephosphorylates the vector and the excised fragment, therefore

inhibiting re-ligation. After that time the vector was purified with the QIAgen PCR

Purification Kit according to protocol.

The restricted PCR fragment was purified with gel electrophoresis using a 2% agarose gel.

The fragment was cut out of the gel and purified with the QIAgen Gel Extraction Kit

according to protocol and eluted with 50µl buffer EB (10mM Tris/Cl pH 8.5, QIAgen).

After restriction digestion and purification ligation was performed under the following

conditions:

Tab.3: Ligation Reaction of D2D1(78):pRK172.

Vector 2.0µl

Insert 6.5µl

T4 Ligase Buffer 10x 1.0µl

T4 Ligase (30 Weiss u/µl) 0.5µl

Negative controls were prepared: Negative control 1 contained water (Millipore) instead of

insert, negative control 2 contained water (Millipore) instead of insert and ligase.

The recombinant plasmid was introduced into competent bacteria, in this case E. coli

XL1blue (prepared by Inoue method, 8.5.), according to the following protocol:

• add 100µl cell suspension to each ligation reaction

• put on ice for 30 minutes

• Heat shock: 42°C for 1 minute

• Add 500µl SOC medium, mix gently

• Put in the incubator for 30 minutes, shake at 200rpm, 37°C

• Use 100µl of each tube to obtain colonies on agar plates containing 100µg/ml

ampicillin.

The agar plates were incubated over night at 37°C or left at room temperature (≈23°C)

over the weekend.

After transformation all the plates showed colonies, although there were 2 to 10x fewer

colonies visible on the plates that served as negative controls.

Of the positive ligation reactions four clones were picked for testing, using 3ml LB-Medium

and 100µg/ml ampicillin. The cultures were incubated over night at 37°C, 200rpm. In the


11

morning plasmid extraction was done with the corresponding kit from Amersham according

to protocol. The plasmids were then tested by control restriction with the corresponding

enzymes.

Tab.4: Restriction analysis of D2D1(78):pRK172

Miniprep DNA 3µl

Enzyme 1 0.5µl

Enzyme 2 0.5µl

Buffer 10x 1µl

BSA 100x (if necessary) 0.1µl

Water (Millipore) ad 10µl

Restriction analysis was performed to confirm correct insertion of the transferred fragment,

using a 2% agarose gel for size determination. Clones tested positive were used for

protein expression.

3.1.2 D2(27-118)D1:pRK172

For this vector one construct was available, D2D1:pRK172. The fragment D2(27-118) had

to be obtained by PCR. PCR was run under the same conditions as described above. After

purification of the PCR fragment as described above, restriction digestion was carried out.

Tab.5: Restriction digestion of D2(27-118)D1:pRK172

Vector Insert

DNA 3µl 10µl

Nde1 (20u/µl) 2µl 2µl

BglII (10u/µl) 2µl 2µl

NEB3 10x 10µl 10µl


Restriction, purification and ligation were performed as described above. After

transformation four clones were picked and tested. Protein expression was tried using the

clones tested positive.


12

3.2.3 D3B(91):pQE30

This vector had to be constructed from two other vectors that were already available,

namely D3(75)B(91):pQE30 as recipient and D3B:pQE30 as donor. Since pQE30 is an

expression vector, the cloning steps were carried out in pUC18, which is a high copy

number plasmid, so much better yields and a higher DNA quality can be obtained. Both

plasmids were cut with BamH1 and Xba1.

Tab.6: Restriction digestion of D3B(91):pUC18

D3(75)B(91):pUC18 D3B:pUC18

DNA 3µl 10µl

BamH1 (10u/µl) 2µl 2µl

Xba1 (10u/µl) 2µl 2µl

NEB2 10x (New England Biolabs) 10µl 10µl

BSA 100x (New England Biolabs) 1µl 1µl


The following steps – purification, ligation, transformation and restriction analysis - were

performed as described above.

3.1.4 D3(75)B:pQE30

This vector needed to be constructed from two other vectors that were already available,

namely D3(75)B(91):pQE30 as recipient and D3B:pQE30 as donor. The restriction reaction

was carried out with Nde1 and HindIII. Since pQE30 contains two Nde1 restriction sites, a

prior subcloning reaction into pUC19Nde1rm was necessary, a plasmid in which the

vector-resident Nde1 site had been removed by point mutation.

Tab.7: Subcloning restriction digestion of D3(75)B:pUC18

pUC19Nde1rm D3(75)B(91):pUC18

DNA (vector, insert) 3µl 10µl

EcoR1 (10u/µl) 2µl 2µl


EcoR1 Buffer 10x 10µl 10µl



13

The next cloning steps – ligation, transformation, colony testing – were performed under

the same conditions as described for D3B(91):pQE30.

Clones tested as positive were cut once again, this time with Nde1 and HindIII.

Tab.8: Restriction digestion of D3(75)B:pUC19Nde1rm

D3(75)B(91):pUC19Nde1rm D3B:pUC18

DNA 3µl 10µl

Nde1(10u/µl) 2µl 2µl


NEB2 Buffer 10x 10µl 10µl


After restriction digestion, the fragments were subjected to the same treatment as

described above.

3.2 Protein Expression and Purification

3.2.1 D2D1(78):pRK172

First clones tested positive of D2D1(78):pRK172 had to be transformed into E. coli

B834(DE3), which is a T7 expression strain. 100µl cell suspension were mixed with 2µl

Miniprep DNA (QIAgen), then transformation was carried out as described above. The

transformation reaction was plated out on agar plates containing ampicillin (100µg/ml) and

stored at room temperature over night.

The next day 20ml 2xTY medium were inoculated with one colony and incubated at 37°C,

200rpm for 2 hours. They were then left shaking at 25°C over night. 100ml 2xTY medium

were pre-warmed over night at 37°C.

The next morning the pre-warmed medium was inoculated with 2ml of the start-up cultures

and incubated (37°C, 200rpm) until the optical density, measured at 600nm (OD600),

reached 0.8. Then a sample (t0) was taken and protein expression was induced with 100µl

IPTG (1M, to a final concentration of 1mM) at 15°C, 200rpm over night.

The sample t18 was taken the next morning after 18 hours of induction. The 100ml culture

was spun down at 4krpm for 15 minutes and the pellet was resuspended in 20ml lysis

buffer. The suspension was first processed on the CSP (constant pressure system cell),


14

then on the sonicator (pulse 0.5sec on, 1.0sec off, 40% amplitude, micro-probe) for

approximately 1 minute to lyse the cells. The resulting suspension was equilibrated and

centrifuged for 30 minutes, 50krpm at 4°C (rotor Ti75, Beckman centrifuge XL100K). A

sample was taken of the supernatant, the pellets were resuspended in 20ml lysis buffer

and stored at 4°C until further processing.

An ammonium sulphate precipitation was carried out of the supernatant, first from 0% to

35% saturation (NH4)2SO4 stirring at 4°C for two hours. A light precipitation was visible, so

the sample was spun down at 12krpm for 15 minutes using an SS34 rotor. Then the

supernatant was precipitated once more, from 35% to 60% saturation (NH4)2SO4 stirring at

4°C over night.

The next morning the suspension was once again centrifuged at 12krpm for 15 minutes

using the same rotor, and the resulting pellet was resuspended in 10ml Mono SA200 buffer.

This suspension was transferred to a dialysis tube (Spectrapore, molecular weight cut-off

6-8kDa) and dialysed against 5l Mono SA200 buffer for 2 hours. After that time the dialysis

tube was transferred into freshly prepared buffer (5l) and dialysed for another 2 hours. The

conductivity of the sample was measured before further processing to see whether the

ammonium sulphate had been dialysed out sufficiently. The conductivity of the sample had

to be the same as the conductivity of Mono SA200 to within 10%.

Cation Exchange Chromatography was performed of the sample using the column

ResourceS 1ml, the program specifications and the resulting chromatogram can be found

in the appendix (8.2). As elution buffer Mono SB2000 was used.

After the chromatography a 12% High-TEMED SDS gel (8.5) was run with samples of the

flow-through and the gradient peak fractions. High-TEMED gels have better resolution

from 10 to 15kDa than standard SDS gels, therefore making differentiation of D1, D2 and

D3 possible.

Protein Expression of D2D1(78):pRK172 was repeated in a 1liter trial according to the

same protocol.

3.2.2 D2(27-118)D1:pRK172

Protein Expression was also carried out with the construct D2(27-118)D1:pRK172. A one

liter test expression was done under the same conditions as described above.


15

3.3 Phage Library Screening

The generation of peptide repertoires and their selection by display on filamentous

bacteriophage by fusion to a phage coat protein (pIII) has provided a means for displaying

folded antibody fragments in bacteria.

Phages can also be used to isolate peptide ligands against antibodies and receptors.

Fig.4: Antigens view of an antibody fragment of the ETH-2-phage-display library (left) and schematic representation of different formats of antibodies and antibody fragments (right). In the libraries used in this project the antibodies were displayed as scFv. From www.pharma.ethz.ch/bmm/protocols/eth.html

In the phage libraries used in this project antibodies were displayed as single chain Fv

fragments (scFv) in which the VH and VL domains are linked by a flexible polypeptide. The

selections were performed with pure antigen, which had been immobilized on an

immunotube (nunc) through non-specific interactions. To block uncoated sites, the column

was incubated with a 2% solution of skimmed milk powder (Rapilait, Migros) in PBS

buffer.

The selection was carried out in a 4% solution of skimmed milk powder (Migros). The

column was washed with PBS buffer and PBS-Tween 0.1%, and the bound phages were

eluted with a solution of triethylamine (100mM) and neutralized immediately with 1M

Tris/Cl pH 7.4. The eluted phages were used to infect bacteria and were thus amplified.

The phages obtained from these infected bacteria were then used for the next selection

round.


16

Fig. 5: Schematic representation of antibodies from phage display libraries, showing the enrichment of an antigen-specific phage-antibody (circle) from a background of non specific phage-antibodies (square). From www.pharma.ethz.ch/bmm/protocols/eth.html

In a first step the ETH-2 human antibody phage library from the group of Dario Neri (ETH

Zurich) was screened for antibodies against LSm2-3. These proteins form a heterodimeric

complex, LSm2 had a His6 –tag attached.

The next library to be screened was the Griffin.1 Library from the MRC LMB Cambridge.

First, phages and helper phages of this library had to be grown according to the protocol

provided in the appendix (8.3.2).

The Griffin.1 Library was screened for antibodies against D3B and D1D2. Secondary stocks

were grown (8.3.2) and screened with BSA as control antigen as described above for the

ETH-2 Library.

Three selection rounds were perfomed, then the eluted phages were checked for binding

by ELISA. The ETH-2 phagemid vector appends at the C-terminal extremity of the

recombinant antibody a D3SD3-FLAG-HIS6 versatile tag which provides:

- a phosphorylation site for labeling of the antibody with radioactive P-32.

- the FLAG-tag sequence for detecting the antibody with an anti-FLAG antibody

- the His6 -sequence, allowing rapid purification by nickel-chelate chromatography

- the recognition site for the endopeptidase enterokinase.

ELISA was performed using mouse anti-FLAG as primary antibody and goat anti-mouse-

HRP as secondary antibody. As substrate ready to use BM Blue POD substrate (Roche)

was used.


17

The phagemid vector of the Griffin.1 Library contains a His6- tag and a myc-tag sequence:

Fig.6: Phagemid vectors of the Griffin.1 Library contain a His6 –tag and a myc-tag, both of them can be used for detection in ELISAs. From Protocol for the use of the Human Synthetic VH + VL scFv Library (Griffin.1 Library); www.mrc-cpe.cam.ac.uk/phage/g1p.html.

For the Griffin.1 phages ELISA was performed using mouse anti-His5 as primary antibody

and anti-mouse-HRP as secondary antibody. A second ELISA was performed of the D3B

phages using a mouse anti-myc-antibody as primary antibody. As substrate ready to use

BM Blue POD substrate (Roche) was used.

Fig. 7: Enzyme linked Immunoassay ELISA. Each well of a 96-well plate is coated with antigen solution and incubated with the eluted phages resulting from the screening of a phage library. A primary monoclonal antibody is added and binds to the phages. A secondary antibody binds to the primary antibody and is tagged with an enzyme, in this case Horse Radish Peroxidase (HRP). A specific substrate is added; in this project BM Blue POD substrate (Roche) was used. After incubation at room temperature a blue color develops. The reaction is stopped by addition of sulfuric acid (1M), and a yellow color is visible immediately which can be measured at 410nm. From www.ntri.tamuk.edu/protocols/ elisa.html

His6- tag

TGCAGGAGCTCGATATCAAACGGGCG GCC GCA CAT CAT CAT CAC CAT CAC GGG GCC

GCA

A A A H H H H H H G A A

pHEN-SEQ

myc-tag <-----------------Amber

GAA CAA AAA CTC ATC TCA GAA GAG GAT CTG AAT GGG GCC GCA TAG ACT GTT GAA

E Q K L I S E E D L N G A A *


18

4. Results

4.1 Cloning of Expression vectors

4.1.1. D2D1(78):pRK172

For this construct one fragment had to be obtained by PCR. Since the optimal temperature

settings were not known, a temperature gradient was performed. All samples were

analysed on a 2% agarose gel to determine optimal PCR settings. The best annealing

temperature for this PCR is 68 - 70°C according to the bands on the gel. Expected

fragment size was 300bp.

Fig.8: PCR of D2D1(78):pRK172. Every sample had a different annealing temperature, starting at 60°C and going up to 70°C. The best annealing temperature for this PCR is 68 - 70°C according to the bands on the gel. Expected fragment size was 300bp.

After PCR, restriction digestion, purification, ligation and transformation, colonies were

visible on the agar plates. Four colonies were tested by restriction analysis. All of the

tested colonies contained an insert of the right size, so all the clones could be used for

protein expression.

4.1.2 D2(27-118)D1:pRK172

Also for this construct the fragment D2(27-118) had to be obtained by PCR. Since the

optimal annealing temperature was not known, PCR was done with a temperature gradient

as described above. All samples were run on a 2% agarose gel to determine optimal PCR

conditions. The fragment was expected to appear just below 300bp.

Marker 60°C 62°C 64°C 66°C 68°C 70°C

500bp 400bp 300bp


19

Fig.9: PCR of D2(27-118)D1:pRK172. Every sample had a different annealing temperature, starting at 60°C and going up to 70°C. The best annealing temperature for this PCR is 62 - 64°C according to the bands on the gel. Expected fragment size 300bp.

After PCR, restriction digestion, purification, ligation and transformation colonies were

visible on the agar plates. Restriction analysis was performed. All but one of the tested

colonies contained an insert of the right size, so protein expression was tried.

4.1.3 D3B(91):pQE30

Restriction digestion was performed as described above. To check whether the restricted

vector and insert had the right size, both were put on a 2% agarose gel. The insert should

be around 400bp long and should be clearly visible on the gel with a strong band. The cut

vector has an expected size of over 3000bp.

Fig.10: Gel of D3B:pQE 30 cut with BamH1, Xba1. Of the insert only a thin band is visible.

After restriction digestion, purification, ligation and transformation was performed as

described above. Colonies were visible, although not as many as with the other constructs.

Restriction analysis was run on a 2% agarose gel, testing four colonies for inserts.

Restriction analysis showed that none of the tested clones contained an insert of the

appropriate size. Eighteen more colonies were tested, but none of them showed a correct

insert. Even after repeating the restriction digestion and the following processes several

Marker 60°C 62°C 64°C 66°C 68°C 70°C

Restriction digestion of the vector always worked

well, but the insert showed only a thin band and

a lot of uncut vector was visible, even when

digested over night or with higher concentrations

of restriction enzymes.

500bp 400bp 300bp

500bp 400bp 300bp


20

times and changing conditions by digesting over night or using agar plates containing

glucose no clones could be obtained which contained an insert of the correct size. Some

clones showed several inserts, some showed no insert at all. This construct is not

available at the moment.

Fig.11: Restriction analysis of D3B(91):pUC18. None of the tested clones show an insert of the appropriate size.

4.1.4 D3(75)B:pQE30

Cloning was performed as described above. This construct was tested as described for

D3B(91):pQE30, with similar results. An additional subcloning step was necessary for this

vector, as mentioned above. Also the additional restriction digestion was verified by gel

electrophoresis, data not shown. The same problem occurred as described for

D3B(91):pQE30. Some clones showed several inserts, some clones showed no insert at

all. Changing of conditions as described above did not help with this construct, either. Up

to now the construct is not available.

4.2 Protein Expression and Purification

4.2.1 Protein Expression of D2D1(78):pRK172

The Miniprep DNA of this construct was transformed into E. coli B834(DE3) cells. Colonies

were picked and grown over night as described in 3.2.1.

Before inducing the cells with IPTG a sample was taken (t0). Sample t18 was taken 18

hours after induction, and more samples were taken as protein expression and purification

proceeded. All the samples were loaded on a 12% high-TEMED SDS gel.

There was no big difference between samples t0 and t18, the bands all showed the same

density. Bands of the protein are expected at 14kDa for D2 and 8kDa for D1(78). Bands

with this size could be found both in the pellet and the supernatant.

500bp 400bp 300bp


21

For protein purification an ammonium sulphate precipitation, dialysis and cation exchange

chromatography were performed.

Fig.12: Cation Exchange Chromatogram of D2D1(78):pRK172. Multiple tiny peaks were visible where the protein was expected to appear. The gradient peak fractions were put on a High-TEMED SDS gel.

Several small peaks were visible where the protein was expected to appear according to

experiences with the wildtype. The gradient peak fractions were put on a High-TEMED

SDS gel.

Fig.13: 12% High-TEMED SDS gel with the gradient peak fractions from the Cation Exchange Chromatography. Fractions B12 and C1/2 had to be concentrated. Fraction B12 showed some bands around 22kDa which could be the protein. There was also a high variety of impurities still in this fraction. Also C1/2 showed these bands, but fewer impurities.

The individual proteins have a size of 8kDa and 14kDa, respectively. It is known from

previous experiments that they tend to run slower on a gel, the bands appear at a higher

level, around the 17’200 kb band of the marker. This gel showed some bands in this

M ft B12 C1/2 B10 B11 B13 C3 C4

Marker: 78’000 76’000 66’200 42’700 30’000 17’200 12’300


22

region. Since the proteins did not have His6- tags, they could not be detected by Western

Blot.

The 1liter expression trial did not show a good chromatogram, and on the gel none of the

fractions contained any proteins. We later realized that there had been some technical

problems with the Cation Exchange Chromatography.

4.2.2 Protein Expression of D2(27-118)D1:pRK172

Protein Expression and Purification was performed as described in 3.2.2. The 1 liter test

expression of this construct did not show a good chromatogram, either. Also on the 12%

High-TEMED SDS gel no proteins were visible in the fractions. Although the lane t18

showed expression of proteins in the expected size range (see box), without further

evidence expression of D2(27-118)D1:pRK172 has to be regarded as inconclusive.

Fig.14: 12% High-TEMED SDS gel of Protein Expression of D2(27-118)D1:pRK172. Some bands were visible of t0 and t18, but none of the fractions collected after Cation Exchange Chromatography showed any proteins at all.

4.3 Phage Library Screening

Chosen targets for Phage Library Screening were LSm2-3, D1D2 and D3B since

monospecific antibodies are needed for various biochemical and functional assays.

LSm2-3 formed a stable complex and contained a His6- tag which could not be cleaved off.

D1D2 and D3B also formed heterodimeric complexes, D1D2 did not have a His6-tag and the

His6-tag of D3B had been cleaved off prior to phage selection.

Marker: 78’000 76’000 66’200 42’700 30’000 17’200 12’300

M t0 t18 3 4 5 6 7 8


23

4.3.1 LSm2-3 antibodies from ETH-2 Library

The first ELISA from this screening showed promising results, which could be verified with

two more ELISA tests. Four of the clones showed absorptions (λ 410nm) of over 0.800, six

more clones showed absorptions between 0.700 and 0.799. The background in these

experiments was 0.067 of medium only and 0.079 of medium and Tg1 cells. The

signal/noise ratio was 1:11.3, calculated from medium only and the clone with the highest

absorption. A table with the absorption of all clones in all ELISA tests can be found in the

appendix (8.4.1).

The ten phages with the highest absorptions were tested for cross-reactivity against a

number of closely related proteins. BSA was used as negative control, LSm2-3 served as

positive control. None of the clones reacted with BSA. The clones were tested against

LSm4, LSm5-6-7, LSm8 and D1D2, which is the paralogue of LSm2-3. None of the clones

showed a good absorption with one of these antigens, so they are all monospecific for

LSm2-3. All the original absorptions can be found in the appendix (8.4.1).

The ten clones with the highest absorption were transformed into XL1blue cells for later

sequencing. Tab.9: Absorptions of antibodies against LSm2-3 and cross reactivity tests against similar complexes and proteins. BSA served as negative control, LSm2-3 as positive control. Original data can be found in the appendix (8.4.1).

A3 C2 C4 E2 F6 G2 G4 G5 H5 H7 LSm2-3 0.800 0.844 0.790 0.827 0.775 0.767 0.869 0.701 0.827 0.739LSm4 0.073 0.062 0.064 0.070 0.062 0.060 0.069 0.063 0.080 0.061LSm5-6-7 0.063 0.078 0.073 0.067 0.084 0.065 0.064 0.066 0.062 0.064LSm8 0.061 0.056 0.069 0.066 0.056 0.096 0.060 0.069 0.068 0.061D1D2 0.089 0.074 0.079 0.081 0.076 0.094 0.073 0.071 0.079 0.071BSA 0.079 0.090 0.072 0.075 0.072 0.087 0.070 0.077 0.096 0.067

4.3.2 D3B antibodies from Griffin.1 Library

The ELISAs for these clones did not show as much absorption as the clones for LSm2-3.

This may be due to some differences between the ETH-2 Library and the Griffin.1 Library,

this protocol is not established yet in the laboratory. The first ELISA was done using mouse anti-His5 as primary antibody, and was repeated

with a mouse anti-myc antibody as primary antibody. In both ELISAs some positive clones

were visible. The highest absorption was 0.263, with a background of 0.068. A table with

all absorptions can be found in the appendix (8.4.2). Four clones showed absorptions over

0.200, four more were between 0.200 and 0.120. They have not yet been tested for cross-

reactivity.


24

4.3.3 D1D2 antibodies from Griffin.1 Library

The ELISA of this screening did not show any positive results. None of the clones had a

higher absorption than the background. A table with the absorption of all clones in the

ELISA test can be found in the appendix (8.4.3).

Up to now there are no monospecific antibodies available against D1D2 from this library.

4.3.4 BSA

Secondary stocks from the Griffin.1 Library were grown and tested with BSA as control

antigen to check the quality and diversity of this library. None of the tested clones showed

any absorption in the ELISA, either the screening or the growth of secondary stocks did

not work out. A table with all absorptions can be found in the appendix (8.4.4).


25

5. Discussion

The first aim of this project, producing monospecific antibodies against LSm2-3, was

achieved by screening the ETH-2 Phage Display Library, using the purified complex as

antigen. In a first ELISA ten clones which led to strongly positive ELISA results could be

isolated (4.3.1). These clones were then tested for cross-reactivity against a number of

closely related proteins, using LSm2-3 as positive control and BSA as negative control.

None of the clones reacted with any of the other proteins, therefore they are monospecific

for the complex LSm2-3. After plasmid extraction the clones were transformed into E. coli

XL1blue and, after a second plasmid extraction, to be sent in for sequencing to check

whether some of the clones were identical.

The second aim of the project, monospecific antibodies against D3B and D1D2, had to be

achieved by screening the Griffin.1 Library. Prior screening of the ETH-2 Library with these

antigens had not led to monospecific antibodies of good quality, the signal/noise ratio in

the ELISA was 1:4. Panning had been repeated, but no better results could be achieved.

The Griffin.1 Library first had to be grown (8.3.2), and a first screening, using D3B and

D1D2 as antigens, was performed. Some positive clones could be isolated against D3B, but

none of the selected clones against D1D2 showed any absorption. There are eight clones

with high absorptions available against D3B, they have yet to be tested for cross-reactivity.

Phages were grown from the secondary stocks, and panning was repeated with BSA as

control antigen. This ELISA did not show any positive clones. Either the screening or the

growth of the secondary stocks did not work out.

The first two parts of the project were aimed at obtaining monospecific antibodies against

protein complexes. In a third part monospecific antibodies targeted against a single

compound were to be isolated. Since Sm- proteins all show a common fold and share

epitopes, and can only be overexpressed as heterodimers and heterotrimers, respectively,

truncated versions of individual proteins had to be constructed as described in 3.1. The

vectors D2D1(78):pRK172 and D2(27-118)D1:pRK172 could be obtained by standard

cloning methods without major difficulties, and protein expression and purification was

tried with both constructs. Due to some technical problems with the Cation Exchange

Chromatography the proteins were not loaded on the column but directly transferred to the

waste. They could not be recovered.


26

The truncated versions of the complex D3B did not work out. Restriction digestion of

D3(75)B(91):pUC18 never properly worked, there was only a faint band visible on the gel

and a large part of uncut vector. Restriction digestion was tried with high concentration of

restriction enzymes as well as over night restriction, but to no avail. Ligation and

transformation were tried, and colonies were visible the next day. None of the clones ever

contained an insert of the correct size. Transformation was also tried using agar plates

containing 0.1% glucose to inhibit the expression of potentially toxic protein, but only one

colony was visible the next day, and it did not contain an insert of the correct size.

Similar problems occurred with the other construct. After subcloning restriction reaction

none of the clones contained an insert of the correct size. Cloning of the D3B constructs

will have to be tried again. If it does not work, one could try to get the fragments D3(75)B

and D3B(91) by PCR.


27

6. Outlook

Several parts of this project need to be continued in the future. The clones producing

monospecific antibodies against LSm2-3 will have to be sequenced. Quantitative binding

assays and, if necessary, affinity maturation will have to be performed.

The isolated phages of the screening with D3B as antigen will have to be tested for cross-

reactivity as described for LSm2-3. The clones producing monospecific antibodies will

then, too, have to be sequenced, put through binding assays and, if necessary, affinity

maturation.

The screening of the Griffin.1 Library using D1D2 as antigen will have to be repeated, so

does the testing of the secondary stocks using BSA as control antigen.

Protein expression and purification of the D2D1 constructs will have to be tried again. The

purified complexes can then be used as antigens, and the Griffin.1 Library will have to be

screened for monospecific antibodies. If any are found, they will have to be treated as

described above. The purified truncated complexes can also be used as antigens in an

ELISA test to check whether some phages against the original D1D2 complex are specific

for one compound.

Cloning of the D3B constructs will have to be repeated. If the vectors can be constructed

protein expression and purification will be performed, and the Griffin.1 Library will have to

be screened for antibodies against these constructs. If any are found, they will have to be

treated as described above. The purified truncated complexes can also be used as

antigens in an ELISA test to check whether some phages against the original D3B complex

are specific for one compound.

All monospecific antibodies will be used in various biochemical and functional assays.

They are necessary to determine the role of specific complexes in a given function or the

role of one compound in a complex.


28

7. Literature

Kambach, C. et al.; Crystal Structures of Two Sm Protein Complexes and Their Implications for the Assembly of the Spliceosomal snRNPs; Cell, Vol. 96, 375-387, 1999. Steitz, JA; "Snurps"; Sci Am 1988 Jun;258(6):56-60, 63 Studier, F.; Use of bacteriophage T7 RNA polymerase to direct selective high-level expression of cloned genes; J Mol Biol, 1986 May 5;189(1):113-30. Viti, F. et al.; The ETH-2 human antibody phage library; www.pharma.ethz.ch/bmm/protocols/eth.html Protocol for the use of the Human Synthetic VH + VL scFv Library (Griffin.1 Library); www.mrc-cpe.cam.ac.uk/phage/g1p.html Pini, A. et al,; Design and Use of a Phage Display Library; Journal of Biological Chemistry; Vol. 273, No. 34, pp. 21769-21776; 1998 Harrison, J. et al.; Screening of Phage Antibody Libraries; Achsel, T. et al.; A doughnut-shaped heteromer of human Sm-like proteins binds to the 3’-end of U6 snRNA, thereby facilitating U4/U6 duplex formation in vitro; EMBO Journal, Vol. 18, No.20, pp.5789-5802; 1999 Rondot, S. et al.; A helper phage to improve single-chain antibody presentation in phage display; Nature Biotech., Vol. 19; 2001 MEDLINEplus Medical Encyclopedia: Systemic lupus erythematosus; www.nlm.nih.gov/medlineplus/ency/article/000435.htm Handout on Health: Systemic Lupus Erythematosus; www.niams.nih.gov/hi/topics/lupus/slehandout/ Lupus Fact Sheet; Lupus Foundation of America, Inc.; 2001 Kaufmann, K. et al.; Lupus autoantibodies recognize the product of an alternative reading frame of SmB/B’; Biochem Biophys Res Commun 2001, Aug 3, 285(5):1206-12 McClain M. et al.; Anti-Sm autoantibodies in systemic lupus target highly basic surface structures of complexed spliceosomal autoantigens; J Immunol 2002 Feb 15; 168(4):2054-62 Eystathioy T. et al.; Autoantibody to hLSm4 and the heptameric LSm complex in anti-Sm sera; Arthritis Rheum 2002 Mar;46(3):726-34 Deshmukh U. et al.; Immune responses to small nuclear ribonucleoproteins; J Immunol 2002 May 15; 168(10):5326-32


29

Vanderbilt Medical Center; Spinal Muscular Atrophy; 1998; www.mc.vanderbilt.edu/peds/pidl/neuro/spineatr.htm FSMA: Quick facts about Spinal Muscular Atrophy; www.fsma.org/sma_facts.shtml FSMA; Understanding SMA: A Comprehensive Guide; www.fsma.org/booklet.htm Meister, G, et al.; Characterization of a nuclear 20S complex containing the survival of motor neurons (SMN) protein and a specific subset of spliceosomal Sm proteins; Hum Mol Genet 2000 Aug 12;9(13):1977-86 Friesen W. et al.; Specific sequences of the Sm and Sm-like (LSm) proteins mediate their interaction with the spinal muscular atrophy disease gene product (SMN); J Biol Chem 2000 Aug 25;275(34):26370-5 Narayanan U. et al.; SMN, the spinal muscular atrophy protein, forms a pre-import snRNP complex with snurportin1 and importin beta; Hum Mol Genet 2002 Jul 15;11(15):1785-95 Yong J. et al.; Sequence-specific interaction of U1 snRNA with the SMN complex; EMBO J 2002 Mar 1;21(5):1188-96 Brahms H. et al.; Symmetrical dimethylation of arginine residues in spliceosomal Sm protein B/B’ ant the Sm-like protein LSm4, and their interaction with the SMN protein; RNA 2001 Nov;7(11):1531-42 Sendtner M.; Molecular mechanisms in spinal muscular atrophy: models and perspectives; Curr Opin Neurol 2001 Oct;14(5):629-34 Selenko P. et al.; SMN tudor domain structure and its interaction with the Sm proteins; Nat Struct Biol 2001 Jan;8(1):27-31 Loeffler G.; Biochemie mit Pathobiochemie; Springer Verlag; 3. Auflage; 1999 Voet Donald, Voet Judith G.; Biochemistry; John Wiley & Sons, Inc.; 2nd edition; 1995

Sambrook, J.; Russell, D.W.; Molecular Cloning, a laboratory manual; Vol. 1-3, Cold Spring Harbor Laboratory Press; third edition, 2001 Will, C. et al.; Analysis of RNP interactions; RNA processing, Vol.I; Oxford University Press; 1994


30

8. Appendix

8.1 Primer sequences and specifications

8.1.1 Primers for D1(78)

5’ primer for cloning into pRK172 using BglII site: GGAGATCTTCGGCTACTAGTGGAG 3’ primer for cloning into pRK172 using HindIII site: GGAAGCTTGTCGACTCATTAGGTGTCCAGCGGCAGGGAGTCCGGCAGG

8.1.2 Primers for D2(27-118)

5’ primer for cloning into pRK172 using Nde site: CCCATATGGGTCCACTCTGTGTGCTCACACAG 3’ primer for cloning into pRK172 using BglII site: GGAGATCTCACTACTTGCCGGCGATGAGCGG

8.2 Cation Exchange Chromatography

8.2.1 Programs

Program for D2D1(78):pRK172, 100ml expression trial (left) and 1 liter expression trials D2(27-118)D1:pRK172 and D2D1(78):pRK172.


31

8.2.2 Chromatograms D2D1(78):pRK172


32

8.2.3 Chromatogram D2(27-118)D1:pRK172


33

8.3 Protocols Phage Display

8.3.1 ETH-2 Library

How to store and use the library The libraries are generally stored at -70°C as bacteria harbouring phagemid or phage DNA (at least 108 bacteria per 10 µl in 2xTY-15% glycerol). To make phage for selection, the primary library is grown, infected with helper phage and the phage harvested from bacterial supernatant. For a library of 5x108 clones, inoculation with at least 5x108 bacteria (50 µl stock, and preferably more) is essential. ETH-2 library • Inoculate each of the glycerol stocks into 50 ml 2xTY-AMP-GLU, until OD = 0.1 • Grow to OD 0.4 - 0.5 at 37°C (about 1-1.5 hrs). An aliquot can be taken at this stage to make a

secondary stock (see below). • Infect each of the 50ml cultures with helper phage (0.5 ml of >1012 tu/ml VCS-M13) (The bacterial

concentration is = 8x108 bacteria/ml with an OD600= 1.0 ). Infections are carried out at 37°C in water bath for at least 30 min.

• Spin down the infected bacteria at 3,300 g for 10 min. Gently resuspend the pellet in 500 ml of 2xTY-AMP-KAN. (Total volume: 2 litres in four 2 l flasks). Sub-libraries can be mixed at this point.

• Incubate with shaking 30°C overnight. • Spin down the culture at 10,800 g for 10 min and immediately PEG precipitate the phage from the

supernatant. • Resuspend phages in 15 ml PBS + 10% glycerol. Titrate phages. Typically 30 aliquots of 0.5 ml

each can be produced. Each aliquot will be sufficient for at least one selection. (use at least 1011 (and ideally 1012) phages for selection)

• Store aliquots at -20°C. These aliquots will be all of the same quality and will ensure the reproducibility of the selection procedure.

Secondary Stocks An excellent secondary stock is the frozen phage obtained from the primary library stock. Antibodies on phage may be proteolysed or get denatured, but phage particles are resistant and maintain a good infectivity. A titre of phage larger than the library size can therefore be used to infect exponential TG1 and produce a second generation of phage library. Protocols for the isolation and use of antibodies from phage display libraries • Bacteria and phage are grown in liquid media at 37°C in an orbital shaker at 250-300 rpm. • Agar plates are grown at 37°C. However, if time allows it, it is advisable to grow plates always at

30°C. Two sizes of agar plates are used: round 9 cm diameter for titre determination, or large (20 cm diameter) round plates for rescue of bacteria infected by phages at the end of a selection round.

• Phage infections are carried out for 30 min in a 37°C water bath without shaking, using exponentially growing bacteria.

• Absorbance of bacterial cultures is measured at 600 nm. • Centrifugations are carried out at 4°C. Exponential bacterial cultures • Transfer a bacterial colony from a minimal media plate into 5 ml of 2xTY medium and grow

overnight. • Next day subculture by diluting 1:100 (OD 0.1) into fresh 2xTY medium, grow until OD 0.4-0.5 and

then infect with phage. Efficiency of infection is greatly reduced above OD = 0.5. Preparation of helper phage • Infect 200 µl E. coli TG1 (or other suitable strain) at OD 0.2 with 10 µl serial dilutions of helper phage

(in order to get well separated plaques). Add to 3 ml H-top agar (42°C) and pour onto warm TYE plates. Allow to set and then incubate overnight.


34

• Pick a small plaque into 3-4 ml of an exponentially growing culture of TG1. Grow for about 2 hr. • Inoculate into 500 ml 2xTY in a 2 litre flask and grow for 1 hr and then add kanamycin (25 mg/ml in

water) to a final concentration of 50-70 µg/ml. Grow for a further 8 - 16 hr. • Spin down bacteria at 10,800 g for 15 min. To the phage supernatant add 1/4 volume PEG/NaCl

(20% polyethylene glycol 6000-2.5 M NaCl) and incubate for a minimum of 30 min on ice. Spin 10,800 g for 15 min.

• Resuspend pellet in 2 ml TE and filter sterilize the stock through a 0.45 µm filter (Minisart NML; Sartorius).

• Determine the titre of the stock and then dilute to about 1x1012 p.f.u./ml. Store aliquots at -20°C. Purification of phage The phage can be concentrated (and any soluble antibodies removed) by precipitation with polyethylene glycol (PEG) 6000. The protocol described here is valid for 300 ml phage-containing supernatant, but can be up- or down- scaled proportionally. • Transfer the phage supernatant to a tube and add 75 ml PEG/NaCl (20% polyethylene glycol 6000-

2.5 M NaCl). • Mix well and leave for a minimum of 1 hr at 4°C or at least 40 min on ice. • Spin 10,800 g for 30 min. • Resuspend the pellet in around 40 ml water, and add 1/5 volume PEG/NaCl (e.g. 10 ml PEG/NaCl

to 40 ml. Mix and leave for a minimum of 20 min at 4°C. • Spin 10,800 g for 30 min and aspirate off the supernatant. • Respin briefly and aspirate off any remainings of PEG/NaCl. • Resuspend the pellet in 2 ml PBS . Phage yields are normally 1-5 x 1013 t.u./ml phage suspension. • Spin 3,300 g for 10 min or 11,600 g for 2 min to remove any residual bacterial cell debris. • Store the phage supernatant either at 4°C for short term storage or in PBS-15% glycerol for longer

term storage at -70°C. Protocol adapted from Viti, F., et al.; The ETH-2 human antibody phage library; www.pharma.ethz.ch/bmm/protocols/eth.html


35

8.3.2 Griffin.1 Library

Protocol for use of the Griffin.1 Library Helper phages • Infect 200 microl E. coli TG1 at OD 0.2 with 10 microl serial dilutions of helper phage (in order to get

well separated plaques) at 37degC (waterbath) without shaking for 30 min. Add to 3 ml molten H-top agar (42degC) and pour onto warm TYE (note 7) plates. Allow to set and then incubate overnight at 37degC.

• Pick a small plaque into 3-4 ml of an exponentially growing culture of TG1 (see above). Grow for about 2 hr shaking at 37degC.

• Inoculate into 500 ml 2xTY in a 2 liter flask and grow as before for 1 hr and then add kanamycin (25 microg/ml in water) to a final concentration of 50-70 microg/ml. Grow for a further 8 - 16 hr.

• Spin down bacteria at 10,800 g for 15 min. To the phage supernatant add 1/5 volume PEG/NaCl (20% polyethylene glycol 6000-2.5 M NaCl) and incubate for a minimum of 30 min on ice. Spin 10,800 g for 15 min.

• Resuspend pellet in 2 ml TE and filter sterilise the stock through a 0.45 micron filter (Minisart NML; Sartorius).

• Titre the stock and then dilute to about 1x1012 p.f.u./ml. Store aliquots at -20degC. Phages • Inoculate the whole of the bacterial library stock (about 1x1010 clones) into 500 ml 2xTY (note 1)

containing 100 microg/ml ampicillin and 1% glucose. • Grow with shaking at 37degC until the OD at 600 nm is 0.5 (this should take about 1.5-2 hours). • Infect 25 ml (1x1010 bacteria) from this culture with VCS-M13 (note 3) or M13KO7 (note 3) helper

phage by adding helper phage in the ratio of 1:20 (number of bacterial cells:helper phage particles, taking into account that 1 OD bacteria at 600 nm = around 8x108 bacteria/ml). Use the remaining 475 ml of this culture to make a secondary stock of the library.

• Incubate without shaking in a 37degC water bath for 30 min. • Spin the infected cells at 3,300 g for 10 min. Resuspend the pellet gently in 30 ml of 2xTY containing

100 microg/ml ampicillin and 25 microg/ml kanamycin. • Add 470 ml of prewarmed 2xTY containing 100 microg/ml ampicillin and 25 microg/ml kanamycin

and incubate shaking at 30degC overnight. • Spin the culture at 10,800 g for 10 min (or 3,300 g for 30 min). • Add 1/5 volume PEG/NaCl (20% Polyethylene glycol 6000, 2.5 M NaCl) to the supernatant. Mix well

and leave for 1 hr or more at 4degC. • Spin 10,800 g for 30 min. Resuspend the pellet in 40 ml water and add 8 ml PEG/NaCl. Mix and

leave for 20 min or more at 4degC. • Spin at 10,800 g for 10 min or 3,300 g for 30 min and then aspirate off the supernatant. • Respin briefly and then aspirate off any remaining dregs of PEG/NaCl. • Resuspend the pellet in 5 ml PBS and spin 11, 600 g for 10 min in a microcentrifuge to remove most

of the remaining bacterial debris. • Store the phage supernatant at 4degC for short term storage or in PBS, 15% glycerol for longer term

storage at -70degC. To titre the phage stock dilute 1 microl phage in 1 ml PBS and use 1 microl of this to infect 1 ml of TG1 at an OD600 0.4-0.6; incubate 30 min in 37degC waterbath. Plate 50 microl of this, 50 microl of a 1:102 dilution and 50 microl of a 1:104 on TYE plates containing 100 microg/ml ampicillin and 1 % glucose and grow overnight at 37degC. Phage stock should be 1012-1013/ml.

Growth of a Secondary Stock • Allow the remaining 475 ml from the culture to grow for a further 2 hr at 37degC with shaking. • Spin down the cells at 3,300 g for 10 min. Resuspend the cells in 10 ml of 2xTY, 15% glycerol and

make 10x1ml aliquots of the library. • Store this secondary stock at -70degC. Titre the stock and take at least 1x1010 clones for further

phage preparations. Protocol was adapted from Protocol for use of the Human Synthetic VH + VL scFv Library (Griffin.1 Library), MRC LMB Cambridge.


36

Phage display protocol Day 1 (Monday)

1. Tg1 cells Plate out Tg1 cells on a 2xTY plate in the morning and let them grow at 37oC throughout the day Inoculate 3 ml of 2xTY with a single Tg1 colony and let the culture grow over night at 37oC, 200 rpm 2. Coating a column with the antigen Thaw a fresh tube of protein from the liquid nitrogen stock Coat the column with 50 µg/ml protein in PBS, for example D1D2: 20 µl antigen (stock: 375 µM) + 3980 µl PBS D3B: 16 µl antigen (stock: 413 µM) + 3984 µl PBS EFG: 15 µl antigen (stock: 480 µM) + 3985 µl PBS Seal the column with paraffin, mix well by inverting Leave at room temperature over night

Day 2 (Tuesday)

1. Coated column Prepare 2% MPBS: 0.5 g milk powder + 25 ml PBS and 4% MPBS: 1.0 g milk powder + 25 ml PBS Wash the column 3 times with PBS Add 4 ml of 2% MPBS and leave it at room temperature for 2 hours Wash the column 3 times with PBS Add 2 ml 4% MPBS 0.5 ml phage display sublibrary 1 0.5 ml phage display sublibrary 1A 0.5 ml phage display sublibrary 1B 0.5 ml phage display sublibrary 1C Seal well with paraffin and shake overhead for 30 min Leave at room temperature for 1 hour 30 min Wash the column 15 times with PBS-Tween and 10 times with PBS Add 1 ml of 100 mM Triethylamine (700 µl Triethylamine + 50 ml water) Shake overhead for less than 10 min Neutralize immediately by pouring the eluted phages into 500 µl 1M Tris/Cl pH 7.4 Vortex and store on ice until later use

2. Tg1 cells Inoculate 30 ml of 2xTY with 300 µl of the 3 ml cultures Incubate at 37oC, 200 rpm until the OD reaches 0.4-0.6 (λ = 600 nm) Store on ice until later use 3. Infect bacteria with eluted phages Mix 10 ml of Tg1 cells (from 2.) with 1.5 ml of phages (from 1.) Incubate 30-40 min at 37oC in a waterbath Plate out the following dilutions on small 2xTY-Amp-1%Glucose plates 100 µl undiluted Tg1 cells 10 µl undiluted Tg1 cells


37

10 µl diluted 1:100 10 µl diluted 1:10’000 Centrifuge the rest for 10 min, 4000 rpm, 4oC Discard the supernatant and resuspend the pellet in 400 µl 2xTY Plate it out on a big 2xTY-Amp-1%Glucose plate Incubate all plates over night at 30oC

Day 3 (Wednesday)

1. Bacteria / phages Count the colonies on the small selective plates Add 7 ml of 2xTY to the big selective plate, resuspend the bacteria, and collect them in a falcon tube Add 3 ml of 2xTY to the big selective plate to collect the remaining bacteria Resuspend well the bacteria Mix 2 ml of bacteria with 2 ml of 50% glycerol Freeze out a backup stock in aliquots of 1 ml at –80oC (no shock freezing in liquid nitrogen!) Add to a 500 ml erlenmeyer: 100 ml 2xTY 100 µl Amp (of the 100 µg/µl stock) 5 ml 20% Glucose (final concentration: 1%) 100 µl collected bacteria Incubate at 30oC, 200 rpm until OD reaches 0.4-0.6 (λ = 600 nm) Mix 10 ml of the above culture with 100 µl of helper phage Incubate at 37oC in a waterbath for 30-45 min Centrifuge for 10 min at 4000 rpm, 4oC Resuspend the pellet in 50 ml 2xTY 50 µl Amp (of the 100 µg/µl stock) 50 µl Kan (of the 25 µg/µl stock) Incubate over night at 30oC, 200 rpm 2. Tg1 cells Inoculate 3 ml 2xTY with a Tg1 colony and incubate over night at 37oC, 200 rpm 3. Coating a column with the antigen Use the thawed tube of protein from day 1 Coat the column with 50 µg/ml protein in PBS Seal the column with paraffin, mix well by inverting Leave at room temperature over night

Day 4 (Thursday)

1. Collect phages Precool the centrifuge, the SW28-rotor, and the swinging buckets at 4oC Equilibrate the 50 ml culture in two ultra clear centrifuge tubes Spin for 20 min at 10’000g (= 9000 rpm), 4oC Transfer the supernatant (45 ml) to a falcon tube Add 10 ml PEG, mix well, and incubate on ice for 1 hour Equilibrate the phage solution in two ultra clear centrifuge tubes Spin for 30 min at 10’000g (= 9000 rpm), 4oC Discard the supernatant and resuspend both pellets in 20 ml water (total of 40 ml)


38

Add to each tube 5 ml of PEG (total of 10 ml) and incubate on ice for 20 min Equilibrate the two ultra clear tubes containing the phage solution Spin for 30 min at 10’000g (= 9000 rpm), 4oC Discard the supernatant and resuspend both pellets in 1 ml PBS (total of 2 ml) Transfer phage solution to a 2 ml eppendorf tube Spin at 13’000 rpm for 2 min Transfer supernatant to a new eppendorf tube Store on ice until later use

2. Tg1 cells Inoculate 30 ml of 2xTY with 300 µl of the 3 ml cultures Incubate at 37oC, 200 rpm until the OD reaches 0.4-0.6 (λ = 600 nm) Store on ice until later use 3. Coated column

Prepare 2% MPBS: 0.5 g milk powder + 25 ml PBS and 4% MPBS: 1.0 g milk powder + 25 ml PBS Wash the column 3 times with PBS Add 4 ml of 2% MPBS and leave it at room temperature for 2 hours Wash the column 3 times with PBS Add 3 ml 4% MPBS + 1 ml phage solution (from 1.) Seal well with paraffin and shake overhead for 30 min Leave at room temperature for 1 hour 30 min Wash the column 15 times with PBS-Tween and 10 times with PBS Add 1 ml of 100 mM Triethylamine (700 µl Triethylamine + 50 ml water) Shake overhead for less than 10 min Neutralize immediately by pouring the eluted phages into 500 µl 1M Tris/Cl pH 7.4 Vortex and store on ice until later use 4. Infect bacteria with eluted phages Mix 10 ml of Tg1 cells (from 2.) with 1.5 ml of phages (from 3.) Incubate 30-40 min at 37oC in a waterbath Plate out the following dilutions on small 2xTY-Amp-1%Glucose plates (100 µl undiluted Tg1 cells) 10 µl undiluted Tg1 cells 10 µl diluted 1:100 (10 µl diluted 1:10’000) Centrifuge the rest for 10 min, 4000 rpm, 4oC Discard the supernatant and resuspend the pellet in 400 µl 2xTY Plate it out on a big 2xTY-Amp-1%Glucose plate Incubate all plates over night at 30oC

Day 5 (Friday)

1. Bacteria / phages

Count the colonies on the small selective plates Add 7 ml of 2xTY to the big selective plate, resuspend the bacteria, and collect them in a falcon tube Add 3 ml of 2xTY to the big selective plate to collect the remaining bacteria


39

Resuspend well the bacteria Mix 2 ml of bacteria with 2 ml of 50% glycerol Freeze out a backup stock in aliquots of 1 ml at –80oC (no shock freezing in liquid nitrogen!)

Day 6 (Monday)

1. Bacteria / phages Thaw one aliquot of the glycerol stock from day 5 (Friday) Add to a 500 ml erlenmeyer: 100 ml 2xTY 100 µl Amp (of the 100 µg/µl stock) 5 ml 20% Glucose (final concentration: 1%) 100 µl collected bacteria Incubate at 30oC, 200 rpm until OD reaches 0.4-0.6 (λ = 600 nm) Mix 10 ml of the above culture with 100 µl of helper phage Incubate at 37oC in a waterbath for 30-45 min Centrifuge for 10 min at 4000 rpm, 4oC Resuspend the pellet in 50 ml 2xTY 50 µl Amp (of the 100 µg/µl stock) 50 µl Kan (of the 25 µg/µl stock) Incubate over night at 30oC, 200 rpm

2. Tg1 cells Inoculate 3 ml 2xTY with a Tg1 colony and incubate over night at 37oC, 200 rpm 3. Coating a column with the antigen Use the thawed tube of protein from day 1 Coat the column with 50 µg/ml protein in PBS Seal the column with paraffin, mix well by inverting Leave at room temperature over night

Day 7 (Tuesday)

1. Collect phages Precool the centrifuge, the SW28-rotor, and the swinging buckets at 4oC Equilibrate the 50 ml culture in two ultra clear centrifuge tubes Spin for 20 min at 10’000g (= 9000 rpm), 4oC Transfer the supernatant (45 ml) to a falcon tube Add 10 ml PEG, mix well, and incubate on ice for 1 hour Equilibrate the phage solution in two ultra clear centrifuge tubes Spin for 30 min at 10’000g (= 9000 rpm), 4oC Discard the supernatant and resuspend both pellets in 20 ml water (total of 40 ml) Add to each tube 5 ml of PEG (total of 10 ml) and incubate on ice for 20 min Equilibrate the two ultra clear tubes containing the phage solution Spin for 30 min at 10’000g (= 9000 rpm), 4oC Discard the supernatant and resuspend both pellets in 1 ml PBS (total of 2 ml) Transfer phage solution to a 2 ml eppendorf tube Spin at 13’000 rpm for 2 min Transfer supernatant to a new eppendorf tube


40

Store on ice until later use 2. Tg1 cells Inoculate 30 ml of 2xTY with 300 µl of the 3 ml cultures Incubate at 37oC, 200 rpm until the OD reaches 0.4-0.6 (λ = 600 nm) Store on ice until later use 3. Coated column

Prepare 2% MPBS: 0.5 g milk powder + 25 ml PBS and 4% MPBS: 1.0 g milk powder + 25 ml PBS Wash the column 3 times with PBS Add 4 ml of 2% MPBS and leave it at room temperature for 2 hours Wash the column 3 times with PBS Add 3 ml 4% MPBS + 1 ml phage solution (from 1.) Seal well with paraffin and shake overhead for 30 min Leave at room temperature for 1 hour 30 min Wash the column 15 times with PBS-Tween and 10 times with PBS Add 1 ml of 100 mM Triethylamine (700 µl Triethylamine + 50 ml water) Shake overhead for less than 10 min Neutralize immediately by pouring the eluted phages into 500 µl 1M Tris/Cl pH 7.4 Vortex and store on ice until later use 4. Infect bacteria with eluted phages Mix 10 ml of Tg1 cells (from 2.) with 1.5 ml of phages (from 3.) Incubate 30-40 min at 37oC in a waterbath Plate out the following dilutions on small 2xTY-Amp-1%Glucose plates 100 µl undiluted Tg1 cells 10 µl undiluted Tg1 cells 10 µl diluted 1:100 Centrifuge the rest for 10 min, 4000 rpm, 4oC Discard the supernatant and resuspend the pellet in 400 µl 2xTY Plate it out on a big 2xTY-Amp-1%Glucose plate Incubate all plates over night at 30oC

Day 8 (Wednesday)

1. 96-well plate Count colonies on the small selective plates and choose the plate with the most single colonies Add 200 µl of medium to each well of a 96-well plate Medium: 50 ml 2xTY 50 µl Amp (100 µg/µl stock) 250 µl 20% Glucose (final concentration: 0.1%) Pick 93 colonies with a yellow tip from the plate and transfer it to a well Use 2 wells for Tg1 cells in 2xTY and 1 well blank with medium only Incubate for 4 hours at 30oC, 200 rpm


41

Prepare a 96-well plate containing 50 µl of glycerol solution (100% glycerol : 2xTY = 1 : 1) Mix 50 µl of bacteria with the glycerol solution in each well and freeze the plate out at –80oC (no shock freezing in liquid nitrogen!) Induce the remaining bacteria with 50 µl IPTG-Medium (induce Tg1 cells with 2xTY only) IPTG-Medium: 7 ml 2xTY 7 µl Amp (100 µg/µl stock) 35 µl 1M IPTG Grow over night at 30oC, 200 rpm 2. Bacteria / phages Add 7 ml of 2xTY to the big selective plate, resuspend the bacteria, and collect them in a falcon tube Add 3 ml of 2xTY to the big selective plate to collect the remaining bacteria Resuspend well the bacteria Mix 2 ml of bacteria with 2 ml of 50% glycerol Freeze out a backup stock in aliquots of 1 ml at –80oC (no shock freezing in liquid nitrogen!) 3. ELISA plate Coat each well of an ELISA plate with 100 µl of antigen solution (10 µg/ml) Seal with paraffin and leave at room temperature over night

Day 9 (Thursday)

1. 96-well plate Spin down the bacteria for 15 min at 4000 rpm, 4oC 2. ELISA plate Prepare 2% MPBS and 10% MPBS Wash the ELISA plate 3x with PBS and remove remaining PBS as good as possible Add 200 µl 2% MPBS per well and leave at room temperature for 2 hours Wash 3x with PBS and remove remaining PBS as good as possible Add per well: 30 µl 10% MPBS 80 µl supernatant of the 96-well plate 15 µl anti-FLAG (diluted 1 : 100) and goat anti-mouse-HRP (diluted 1 : 100) in 2% MPBS Prepare this solution shortly before use Incubate at room temperature for 45 min Wash 12x with PBS-Tween (= PBS containing 0.1% Tween 20) Wash 10x with PBS and remove remaining PBS as good as possible Add 100 µl ready-to-use BM blue POD substrate to each well Let develop at room temperature for approximately 20 min Stop the reaction with 100 µl 1M sulfuric acid Measure the OD with program #13 in Alma’s OD detector

Protocol optimized and adapted by Simone Locher, Structural Biology, Paul Scherrer Institute


42

8.4 ELISA

8.4.1 LSm2-3

1 2 3 4 5 6 7 8 9 10 11 MediumA1 0.126 0.118 0.958 0.104 0.303 0.095 0.114 0.873 0.069 0.067 0.092 0.072A2 0.509 0.183 0.641 0.136 0.263 0.124 0.105 0.494 0.069 0.070 0.094 0.081A3 0.214 0.227 0.706 0.567 0.669 0.526 0.055 0.427 0.055 0.059 0.307 0.079MW 0.3175 0.1505 0.7995 0.12 0.283 0.1095 0.1095 0.6835 0.069 0.0685 0.093 0.0765B1 0.212 0.372 0.501 0.173 0.25 0.07 0.788 0.961 0.069 0.417 0.234 0.064B2 0.809 0.372 0.164 0.373 0.4 0.082 0.472 0.118 0.068 0.086 0.088 0.068B3 0.082 0.626 0.552 0.721 0.066 0.063 0.724 0.065 0.062 0.086 0.22 0.061MW 0.3677 0.4567 0.4057 0.4223 0.2387 0.63 0.6613 0.3813 0.0663 0.1963 0.1807 0.0643C1 0.23 0.981 0.166 0.956 0.103 0.278 1.045 0.253 0.114 0.889 0.065 0.069C2 0.304 0.605 0.352 0.617 0.123 0.261 0.364 0.172 0.073 0.364 0.071 0.079C3 0.0588 0.945 0.837 0.797 0.599 0.681 0.574 0.383 0.062 0.768 0.073 0.076MW 0.1976 0.8437 0.4517 0.79 0.275 0.4067 0.661 0.2693 0.083 0.6737 0.0697 0.0747D1 0.403 0.222 0.837 0.158 0.345 0.344 0.915 0.427 0.344 0.072 0.85 0.156D2 0.438 0.53 0.545 0.289 0.264 0.075 0.453 0.21 0.111 0.073 0.312 0.076D3 0.768 0.877 0.705 0.656 0.725 0.063 0.357 0.772 0.369 0.062 0.754 0.068MW 0.5363 0.543 0.6957 0.3677 0.4447 0.1607 0.575 0.4697 0.2747 0.069 0.6387 0.1E1 0.105 1.045 0.181 0.642 0.396 0.119 0.504 0.146 0.128 0.077 0.133 0.118E2 0.414 0.636 0.216 0.433 0.23 0.113 0.177 0.15 0.124 0.064 0.095 0.072E3 0.639 0.801 0.282 0.873 0.793 0.083 0.577 0.677 0.632 0.062 0.533 0.583MW 0.386 0.8273 0.2263 0.6493 0.473 0.105 0.4193 0.3243 0.2947 0.0677 0.2537 0.2577F1 0.196 0.137 0.106 0.099 0.182 0.966 0.927 0.069 0.143 0.101 0.123 0.065F2 0.338 0.171 0.13 0.173 0.188 0.405 0.415 0.073 0.124 0.104 0.094 0.07F3 0.582 0.696 0.711 0.517 0.923 0.955 0.064 0.08 0.658 0.79 0.765 0.084MW 0.372 0.3347 0.3157 0.263 0.431 0.7753 0.4687 0.074 0.3083 0.3317 0.3273 0.073G1 0.79 0.932 0.757 0.979 0.96 0.098 0.07 0.382 0.084 0.067 0.433 0.067G2 0.599 0.63 0.109 0.644 0.459 0.091 0.066 0.096 0.067 0.067 0.104 0.067G3 0.061 0.74 0.56 0.984 0.683 0.539 0.058 0.073 0.065 0.065 0.822 0.068MW 0.4833 0.7673 0.4753 0.869 0.7007 0.2427 0.0647 0.1837 0.072 0.0663 0.453 0.0673H1 0.084 0.081 0.153 0.136 0.779 0.109 0.767 0.09 0.093 0.9 0.064 0.076H2 0.184 0.197 0.244 0.252 0.515 0.118 0.49 0.095 0.062 0.251 0.066 0.07H3 0.077 0.826 0.82 0.067 1.186 0.062 0.961 0.795 0.085 0.21 0.065 0.053MW 0.115 0.368 0.4057 0.1517 0.8267 0.0963 0.7393 0.3267 0.08 0.4537 0.065 0.0663


43

Cross-Reactivity Check LSm2-3

A3 C2 C4 E2 F6 G2 G4 G5 H5 H7 MediumLSm2-3 0.800 0.844 0.790 0.827 0.775 0.767 0.869 0.701 0.827 0.739 0.067LSm4 0.065 0.056 0.062 0.071 0.061 0.062 0.069 0.060 0.063 0.063 0.066 0.080 0.067 0.066 0.068 0.063 0.058 0.068 0.066 0.097 0.059 0.065MW 0.073 0.062 0.064 0.070 0.062 0.060 0.069 0.063 0.080 0.061 LSm5-6-7 0.064 0.084 0.072 0.069 0.097 0.067 0.064 0.064 0.062 0.065 0.074 0.061 0.072 0.074 0.064 0.070 0.062 0.063 0.068 0.062 0.062 0.070MW 0.063 0.078 0.073 0.067 0.084 0.065 0.064 0.066 0.062 0.064 LSm8 0.067 0.054 0.070 0.062 0.057 0.062 0.057 0.066 0.067 0.062 0.061 0.055 0.057 0.067 0.069 0.055 0.129 0.063 0.071 0.069 0.060 0.150MW 0.061 0.056 0.069 0.066 0.056 0.096 0.060 0.069 0.068 0.061 D1D2 0.124 0.071 0.076 0.083 0.070 0.094 0.073 0.066 0.080 0.075 0.162 0.069 0.075 0.081 0.071 0.081 0.087 0.075 0.073 0.082 0.068 0.079 0.075 0.075 0.081 0.088 0.077 0.101 0.072 0.075 0.076 0.069 0.072MW 0.089 0.074 0.079 0.081 0.076 0.094 0.073 0.071 0.079 0.071 BSA 0.080 0.077 0.077 0.082 0.080 0.084 0.066 0.084 0.077 0.069 0.077 0.077 0.069 0.070 0.069 0.064 0.088 0.069 0.075 0.136 0.065 0.080 0.081 0.123 0.068 0.073 0.071 0.090 0.074 0.073 0.074 0.068 0.071MW 0.079 0.090 0.072 0.075 0.072 0.087 0.070 0.077 0.096 0.067


44

8.4.2 D3B

1 2 3 4 5 6 7 8 9 10 11 12A anti-His5 0.085 0.068 0.067 0.066 0.065 0.075 0.066 0.073 0.065 0.066 0.069 0.068A anti-myc 0.075 0.067 0.064 0.065 0.071 0.075 0.071 0.070 0.071 0.071 0.095 0.083MW 0.080 0.068 0.066 0.066 0.068 0.075 0.069 0.072 0.068 0.069 0.082 0.076B anti-His5 0.103 0.060 0.063 0.068 0.060 0.057 0.058 0.081 0.162 0.090 0.067 0.067B anti-myc 0.106 0.069 0.070 0.069 0.066 0.057 0.063 0.066 0.068 0.066 0.113 0.076MW 0.105 0.065 0.067 0.069 0.063 0.057 0.061 0.074 0.115 0.078 0.090 0.072C anti-His5 0.067 0.070 0.066 0.069 0.063 0.302 0.061 0.065 0.063 0.061 0.065 0.063C anti-myc 0.069 0.068 0.070 0.068 0.065 0.160 0.066 0.067 0.070 0.068 0.070 0.074MW 0.068 0.069 0.068 0.069 0.064 0.231 0.064 0.066 0.067 0.065 0.068 0.069D anti-His5 0.067 0.067 0.065 0.074 0.069 0.068 0.065 0.081 0.067 0.272 0.280 0.066D anti-myc 0.069 0.069 0.068 0.066 0.064 0.067 0.067 0.101 0.067 0.137 0.166 0.179MW 0.068 0.068 0.067 0.070 0.067 0.068 0.066 0.091 0.067 0.205 0.223 0.123E anti-His5 0.067 0.066 0.065 0.074 0.087 0.070 0.062 0.076 0.073 0.065 0.067 0.067E anti-myc 0.070 0.073 0.072 0.073 0.070 0.069 0.068 0.067 0.071 0.070 0.073 0.114MW 0.069 0.070 0.069 0.074 0.079 0.070 0.065 0.072 0.072 0.068 0.070 0.091F anti-His5 0.070 0.068 0.069 0.070 0.077 0.362 0.059 0.061 0.062 0.062 0.065 0.066F anti-myc 0.078 0.075 0.072 0.070 0.069 0.164 0.065 0.067 0.068 0.068 0.070 0.073MW 0.074 0.072 0.071 0.070 0.073 0.263 0.062 0.064 0.065 0.065 0.068 0.070G anti-His5 0.063 0.065 0.064 0.065 0.061 0.143 0.059 0.073 0.060 0.061 0.059 0.063G anti-myc 0.072 0.068 0.069 0.067 0.070 0.150 0.069 0.084 0.064 0.065 0.067 0.070MW 0.068 0.067 0.067 0.066 0.066 0.147 0.064 0.079 0.062 0.063 0.063 0.067H anti-His5 0.067 0.067 0.065 0.063 0.064 0.062 0.063 0.065 0.063 0.230 0.067 0.243H anti-myc 0.069 0.070 0.069 0.069 0.069 0.065 0.066 0.076 0.065 0.124 0.073 0.137MW 0.068 0.069 0.067 0.066 0.067 0.064 0.065 0.071 0.064 0.177 0.070 0.190 M. Medium only

M.


45

8.4.3 D1D2

1 2 3 4 5 6 7 8 9 10 11 MediumA1 0.135 0.097 0.082 0.078 0.075 0.078 0.076 0.068 0.079 0.068 0.075 0.073A2 0.083 0.084 0.091 0.077 0.069 0.067 0.068 0.068 0.066 0.071 0.082 0.079MW 0.109 0.0905 0.0865 0.0775 0.072 0.0725 0.072 0.068 0.0725 0.0695 0.0785 0.076B1 0.078 0.075 0.07 0.067 0.073 0.071 0.075 0.073 0.078 0.064 0.067 0.073B2 0.071 0.068 0.079 0.131 0.069 0.064 0.077 0.077 0.065 0.064 0.074 0.065MW 0.0745 0.0715 0.0745 0.099 0.071 0.0675 0.076 0.075 0.0715 0.064 0.0705 0.069C1 0.076 0.075 0.075 0.082 0.071 0.073 0.074 0.078 0.078 0.071 0.067 0.077C2 0.09 0.074 0.117 0.08 0.09 0.068 0.084 0.074 0.072 0.075 0.149 0.074MW 0.083 0.0745 0.096 0.081 0.0805 0.0705 0.079 0.076 0.075 0.073 0.108 0.0755D1 0.074 0.075 0.075 0.079 0.079 0.068 0.096 0.075 0.074 0.075 0.068 0.069D2 0.087 0.079 0.082 0.078 0.072 0.079 0.074 0.075 0.073 0.079 0.073 0.079MW 0.0805 0.077 0.0785 0.0785 0.0755 0.0735 0.085 0.075 0.0735 0.077 0.0705 0.074E1 0.143 0.077 0.083 0.071 0.075 0.076 0.059 0.062 0.069 0.075 0.09 0.098E2 0.074 0.074 0.072 0.075 0.068 0.072 0.077 0.074 0.074 0.081 0.076 0.076MW 0.1085 0.0755 0.0775 0.073 0.0715 0.074 0.068 0.068 0.0715 0.078 0.083 0.087F1 0.114 0.087 0.077 0.086 0.082 0.09 0.072 0.074 0.076 0.078 0.074 0.076F2 0.113 0.08 0.075 0.077 0.07 0.078 0.075 0.081 0.071 0.081 0.083 0.076MW 0.1135 0.0835 0.076 0.0815 0.076 0.084 0.0735 0.0775 0.0735 0.0795 0.0785 0.076G1 0.095 0.077 0.083 0.069 0.106 0.073 0.07 0.068 0.074 0.07 0.078 0.074G2 0.08 0.104 0.069 0.079 0.067 0.072 0.066 0.07 0.07 0.069 0.073 0.067MW 0.0875 0.0905 0.076 0.074 0.0865 0.0725 0.068 0.069 0.072 0.0695 0.0755 0.0705H1 0.086 0.075 0.079 0.068 0.085 0.09 0.069 0.065 0.071 0.066 0.073 0.061H2 0.075 0.08 0.072 0.08 0.075 0.075 0.066 0.076 0.065 0.07 0.086 0.061MW 0.0805 0.0775 0.0755 0.074 0.08 0.0825 0.0675 0.0705 0.068 0.068 0.0795 0.061

8.4.4 BSA

1 2 3 4 5 6 7 8 9 10 11 12A 0.073 0.068 0.069 0.074 0.068 0.072 0.072 0.074 0.074 0.071 0.071 0.073B 0.065 0.068 0.066 0.064 0.066 0.065 0.069 0.069 0.066 0.067 0.065 0.079C 0.074 0.068 0.063 0.079 0.068 0.070 0.066 0.069 0.068 0.070 0.071 0.070D 0.074 0.066 0.085 0.079 0.070 0.074 0.069 0.070 0.070 0.074 0.072 0.066E 0.073 0.076 0.073 0.076 0.070 0.072 0.070 0.071 0.078 0.075 0.079 0.069F 0.081 0.080 0.078 0.085 0.082 0.077 0.070 0.074 0.072 0.074 0.073 0.068G 0.091 0.069 0.069 0.072 0.068 0.074 0.073 0.069 0.066 0.068 0.070 0.067H 0.076 0.075 0.077 0.072 0.072 0.074 0.074 0.070 0.070 0.074 0.070 0.069

Medium


46

8.5 Buffers and Media

8.5.1 Cloning steps

Agarose gel 2% Agarose 0.8g

TBE-Buffer 0.5x 40ml

Ethidium bromide (10mg/ml) 5µl

Running in TBE buffer 0.5x

LB-Medium (Luria – Bertani Medium) Tryptone 10g

Yeast extract 5g

Millipore water 950ml

2xTY Medium

Tryptone 16g

Yeast extract 10g

NaCl 5g


SOC Medium Tryptone 20g

Yeast extract 5g

NaCl 0.5g

20mM glucose solution 1M 20ml


Competent E. coli Prepared according to the Inoue method, for details see e.g. Sambrook, J.; Russell, D.W.; Molecular

Cloning, a laboratory manual; Vol. 1-3, Cold Spring Harbor Laboratory Press; third edition, 2001

TBE Buffer pH 8.3 10x Tris(hydroxymethyl)aminomethan 540g

Boric acid 275g

EDTA 46.5g

Millipore water to 5 L

Adjust pH to 8.3


47

8.5.2 Protein Expression

Lysis Buffer 20mM 1M Tris/Cl pH8.0 20ml

0.5M NaCl 5M 10ml

0.5M Urea (MG 60.06g) 3.0g

5mM β- Mercaptoethanol 30µl

dist. Water to 100ml

SDS-Page SDS-dye 6x 10ml

4x Tris-HCl/SDS pH6.8 7ml

Glycerol 3ml

SDS 1g

DTT 0.93g

Bromphenolblau 1.2g

Stacking gel

Acrylamide 30% 1.66ml

0.5M Tris/Cl pH 6.8, 0.4% SDS 2.5ml

Ammonium persulphate 10% 50µl

TEMED 25µl

Millipore water 5.84ml

Running gel

Acrylamide 30% 12ml

1.5M Tris/Cl pH 8.8, 0.4% SDS 7.5ml

Ammonium persulphate 10% 100µl

TEMED 100µl

Millipore water 10.5ml

Laemmli Buffer 10x (SDS Buffer) Sodium lauryl sulfate (SDS) 20g

Glycine 288g

Tris base 60g



48

Staining solutions

Fairbanks A:

0.05% Coomassie

20% Isopropanol

10% acetic acid

Fairbanks B

0.005% Coomassie

10% Isopropanol

10% acetic acid

Fairbanks D (Destainer)

10% acetic acid

8.5.3 Cation exchange chromatography

Mono SA200 20mM Hepes pH7.5 100ml

200mM NaCl 58.44g

5mM DTT 3.86g

dist. Water to 5l

Mono SB2000 (Elution Buffer) 20mM Hepes pH7.5 10ml

2M NaCl 58.44g

5mM DTT 0.38g

dist. Water to 500ml

8.5.4 Phage Display

10x Phosphate – buffered saline (PBS)

360mM di-Sodium hydrogen phosphate (141.96g/mol) 51.11g

140mM Sodium dihydrogen phosphate (137.99g/mol) 19.32g

1M NaCl (58.44g/mol) 58.44g


Adjust to pH 7.4


49

1x Phosphate buffered saline (PBS) 10x PBS (pH 7.4) 100ml


PBS-Tween 0.1% 10x PBS (pH 7.4) 100ml

0.1% Tween 20 1ml


PEG 20% polyethylene glycol 6000 100g

2.5M NaCl (54.88 g/mol) 73.05g

Millipore water to 500ml

Tris/Cl (pH 7.4) 1M Tris-hydrochloride (157.56 g/mol) 78.78 g

Millipore water to 500ml

Adjust to pH 7.4

Triethylamine 100mM 100mM Triethylamine 700 µl

Millipore water 50 ml

Prepare shortly before use.

rights / license: research collection in copyright - non …25863/et… · filamentous...

Documents