Immunotopological Analysis of the Treponema denticola MajorSurface Protein (Msp)

Valentina Godovikova,a M. Paula Goetting-Minesky,a John C. Timm,a J. Christopher Fennoa

aDepartment of Biologic and Materials Sciences, School of Dentistry, University of Michigan, Ann Arbor, Michigan, USA

ABSTRACT Treponema denticola, one of several recognized periodontal pathogens,is a model organism for studying Treponema physiology and host-microbe interac-tions. Its major surface protein Msp (or MOSP) comprises an oligomeric outermembrane-associated complex that binds fibronectin, has cytotoxic pore-forming ac-tivity, and disrupts several intracellular responses. There are two hypotheses regard-ing native Msp structure and membrane topology. One hypothesis predicts that theentire Msp protein forms a �-barrel structure similar to that of well-studied outermembrane porins of Gram-negative bacteria. The second hypothesis predicts a bi-partite Msp with distinct and separate periplasmic N-terminal and porin-like �-barrelC-terminal domains. The bipartite model, based on bioinformatic analysis of the or-thologous Treponema pallidum Tpr proteins, is supported largely by studies of re-combinant TprC and Msp polypeptides. The present study reports immunologicalstudies in both T. denticola and Escherichia coli backgrounds to identify a prominentMsp surface epitope (residues 229 to 251 in ATCC 35405) in a domain that differsbetween strains with otherwise highly conserved Msps. These results were thenused to evaluate a series of in silico structural models of representative T. denticolaMsps. The data presented here are consistent with a model of Msp as a large-diameter �-barrel porin. This work adds to the knowledge regarding the diverseMsp-like proteins in oral treponemes and may contribute to an understanding of theevolutionary and potential functional relationships between Msps of oral Treponemaand the orthologous group of Tpr proteins of T. pallidum.

IMPORTANCE Treponema denticola is among a small subset of the oral microbiotacontributing to severe periodontal disease. Due to its relative genetic tractability, T.denticola is a model organism for studying Treponema physiology and host-microbeinteractions. T. denticola Msp is a highly expressed outer membrane-associated oli-gomeric protein that binds fibronectin, has cytotoxic pore-forming activity, and dis-rupts intracellular regulatory pathways. It shares homology with the orthologousgroup of T. pallidum Tpr proteins, one of which is implicated in T. pallidum in vivoantigenic variation. The outer membrane topologies of both Msp and the Tpr familyproteins are unresolved, with conflicting reports on protein domain localization andfunction. In this study, we combined empirical immunological data derived bothfrom diverse T. denticola strains and from recombinant Msp expression in E. coli within silico predictive structural modeling of T. denticola Msp membrane topology, tomove toward resolution of this important issue in Treponema biology.

KEYWORDS porins, spirochetes, structural modeling

Oral spirochetes, most notably Treponema denticola, are associated with the mostsevere forms of periodontal diseases (1). Their numbers are highly elevated in the

deepest recesses of active periodontal lesions, and they persist in cases that arerefractory to standard treatment regimens (2). T. denticola Msp is a highly expressed,outer membrane-associated, oligomeric protein that binds fibronectin (3, 4), has cyto-

Citation Godovikova V, Goetting-Minesky MP,Timm JC, Fenno JC. 2019. Immunotopologicalanalysis of the Treponema denticola majorsurface protein (Msp). J Bacteriol 201:e00528-18. https://doi.org/10.1128/JB.00528-18.

Editor Ann M. Stock, Rutgers University-RobertWood Johnson Medical School

Copyright © 2018 American Society forMicrobiology. All Rights Reserved.

Address correspondence to J. ChristopherFenno, fenno@umich.edu.

Received 30 August 2018Accepted 22 October 2018

Accepted manuscript posted online 29October 2018Published

RESEARCH ARTICLE

crossm

January 2019 Volume 201 Issue 2 e00528-18 jb.asm.org 1Journal of Bacteriology

20 December 2018

on Novem

ber 25, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

toxic pore-forming activity in epithelial cells (5, 6), disrupts intracellular cytoskeletal andcalcium responses in fibroblasts (reviewed in reference 2), and inhibits neutrophilchemotaxis (7). While Msp pore-forming activity has been proposed to be responsiblefor its cytotoxicity, the molecular mechanisms responsible for other effects of Msp,particularly the intracellular responses, remain to be determined. Edwards et al. (4)reported that recombinant polypeptides consisting of Msp residues 14 to 202 or 203 to259 bound immobilized fibronectin, keratin, laminin, collagen type I, fibrinogen, hyal-uronic acid, and heparin, while the C-terminal recombinant polypeptide (residues 272to 543) had no binding activity. In contrast, Jones et al. (7) reported that a recombinantpolypeptide encompassing Msp residues 272 to 406 inhibited neutrophil chemotacticresponses. The locations of specific active Msp domains, relative to Msp structure, andthe mechanism of Msp effects on neutrophils are as yet unknown. Determining thetopology of Msp in the outer membrane is crucial for understanding the role of Msp inTreponema biology, as well as its cellular effects in the host environment.

Msp or Msp-like proteins have been characterized in Treponema spp. (8–10), repre-senting 3 of the 7 phylogroups (composed of over 60 distinct phylotypes) of humanoral treponemes (11, 12). A recent study of 626 clinical samples identified 21 distinctmsp genotypes within at least 5 Treponema species in phylogroups 1 and 2, withgenotypes corresponding to T. denticola being the most frequently detected (13).Putative msp genes have also been identified in Treponema spp. associated with digitaldermatitis and related diseases of domesticated and wild ungulates, most of which fallwithin phylogroup 1 (representative, Treponema vincentii), phylogroup 2 (representa-tive, T. denticola), or Treponema phagedenis (14–18). T. denticola Msps are the most wellstudied and can be divided into 3 groups, 2 of which are very closely related (repre-sented by strains ATCC 35405 and ATCC 33520, which are �90% identical and differonly in a 70-residue central domain) and 1 of which is represented by strain OTK, whichhas only about 40% total homology with the other 2 (13, 19).

A group of orthologous Treponema pallidum rare outer membrane proteins (TprA toTprL) shares evolutionary history with the Msps, although sequence homology with theMsps is rather limited (20). Functional characterization of the Tprs suggests involve-ment in immunogenicity (21) and outer membrane permeability (22) (as with the Msps)and in relatively rapid generation of intrastrain antigenic variants at the TprK locus invivo (23, 24) (unlike Msps). In addition to this genetic mechanism for generating a widerange of sequence variability in a single gene, the other 11 tpr gene sequences showa wide range of diversity while still having conserved domain architectures (25). Therole of Tpr sequence variation and diversity in T. pallidum pathogenesis is an area ofgreat interest. To date, there is no evidence that any Treponema species other than T.pallidum carries more than 1 gene encoding an Msp-like protein.

The outer membrane topologies of both T. denticola Msp and the T. pallidum Tprfamily remain unresolved, with little consensus regarding either the overall structure orthe organization and localization of polypeptide domains within the protein. Severalrecent studies have reported predictive molecular models for T. pallidum Tprs and T.denticola Msps, composed of structurally and functionally distinct domains, i.e., anN-terminal periplasmic domain and a C-terminal porin domain with a �-barrel structure(22, 26, 27). These models are largely supported by expression studies of recombinantT. pallidum TprC/D and T. denticola ATCC 35405 Msp expressed in Escherichia coli, aswell as by cell compartment fractionation studies in T. denticola. In contrast, otherstudies of Msp reported data suggesting that the entire Msp molecule is composed ofa large �-barrel structure (28) with a central surface-exposed domain (4) that isdivergent between strains (13, 19). Similarly, sequence analysis and modeling ofmultiple tpr loci from the various subspecies of T. pallidum revealed colocalization ofdiscrete variable regions with predicted surface-exposed loops consistent with a typical�-barrel porin structure (25). In this study, we combined empirical immunological dataderived both from T. denticola strains and from recombinant Msp expression in E. coliwith in silico predictive structural modeling of T. denticola Msp membrane topology, inorder to advance toward resolution of this important issue in Treponema biology.

Godovikova et al. Journal of Bacteriology

January 2019 Volume 201 Issue 2 e00528-18 jb.asm.org 2

on Novem

ber 25, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

RESULTSThe Msp central domain contains a surface-exposed epitope. In all T. denticola

strains studied to date, a single msp gene encodes a secreted protein, with a calculatedmolecular mass of 56 to 60 kDa, that forms a trimeric, outer membrane-associatedcomplex. As illustrated in Fig. 1, the Msp amino acid sequences of strains ATCC 35405and ATCC 33520 differ only at residues 202 to 271 (ATCC 35405 numbering). Thisdomain encompasses nearly the same polypeptide as the recombinant “rV-Msp” centraldomain of ATCC 35405 (residues 203 to 259), which was reported to have bindingactivity for several extracellular matrix-associated substrates (4). We performed immu-nofluorescence microscopy with intact and detergent-permeabilized cells of these 2 T.denticola strains with polyclonal antibodies raised against native ATCC 35405 Msp (Fig.2), using antibodies specific for the periplasmic FlaA protein (29) as a control for outermembrane integrity. As shown in Fig. 3, antibodies to native ATCC 35405 Msp reactedwith both intact and permeabilized T. denticola ATCC 35405 cells. The same antibodiesalso reacted with permeabilized T. denticola ATCC 33520 cells but did not react withintact ATCC 33520 cells. We interpret this as strong evidence that the 70-residue regionof ATCC 35405 Msp that differs from that of ATCC 33520 Msp contains a prominentsurface-localized epitope.

The Msp surface epitope is localized to residues 229 to 251. To more preciselylocalize the immunogenic Msp surface epitope, we compared the sequences of theATCC 35405 and ATCC 33520 Msp central regions (Fig. 1). Using the predictive methodof Jameson and Wolf (30), we identified two 7-residue areas in ATCC 35405 Msp with

FIG 1 Alignment of the Msp central domains of strains ATCC 35405 and ATCC 33520. Amino acid residue numbers are shown at the sequenceends. Purple-highlighted residues represent areas of high predicted antigenic index values (Ag1 and Ag2). Green-highlighted residues representapproximate boundaries of the central domain (D1 and D2). Blue-highlighted residues represent the region of greatest difference between theMsps other than Ag1 and Ag2 (Xr). Other than the region shown here, the amino acid sequences of the two proteins are identical, with 543 and547 residues, respectively.

FIG 2 Silver-stained polyacrylamide gel of purified native ATCC 35405 Msp. Lane 1, unheatedsample; lane 2, boiled sample. Arrows indicate oligomeric Msp (lane 1, 150 to 200 kDa) andmonomeric Msp (lane 2, approximately 53 kDa). This preparation was used to raise rabbit antibodiesagainst native Msp.

T. denticola Msp Surface Epitope and Structural Models Journal of Bacteriology

January 2019 Volume 201 Issue 2 e00528-18 jb.asm.org 3

on Novem

ber 25, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

high antigenicity scores (Ag1 and Ag2) that are separated by a 17-residue sequence (Xr)that is highly divergent from that of ATCC 33520 Msp. As illustrated in the schematicmap in Fig. 4, we constructed and expressed in E. coli full-length recombinant Mspderivatives lacking Ag1 (deletion of residues 229 to 235), Xr (deletion of residues 237 to251), Ag2 (deletion of residues 253 to 259), or D2 (deletion of residues 263 to 269,constituting the C-terminal end of the divergent domain). We also constructed andexpressed in E. coli a series of recombinant Msp derivatives with deletions in theN-terminal region (deletions of residues 26 to 47, 26 to 69, or 26 to 92), all of whichretained the native Msp signal peptide (residues 1 to 20) and the first 5 residues of themature protein. The N-terminal deletion constructs were included in this experiment asfurther controls for expression and antibody detection of partial Msp polypeptides. Asshown in Fig. 4, antibodies raised against a recombinant N-terminal fragment of Msp(residues 14 to 202) recognized all of the recombinant Msp deletion constructs ex-pressed in E. coli, as well as native Msp from T. denticola ATCC 35405. Antibodies raisedagainst either native ATCC 35405 Msp or whole T. denticola ATCC 35405 cells failed toreact with recombinant Msps with deletions of residues 229 to 235 (Ag1) or 236 to 251(Xr). The combined immunofluorescence and immunoblotting data suggested that aprominent surface-exposed epitope in ATCC 35405 Msp is within the 23-residue region

FIG 3 Immunofluorescence microscopy of T. denticola, revealing the Msp surface domain. T. denticola ATCC 35405 and ATCC 33520,grown to an OD600 of 0.2, were fixed on glass slides with 1% paraformaldehyde, incubated with PBS or PBS plus 0.5% Triton X-100,and probed with rabbit antibodies to native ATCC 35405 Msp or recombinant FlaA, followed by goat anti-rabbit IgG conjugated toAlexa Fluor 568 (Msp) or Alexa Fluor 488 (FlaA), or with DAPI. Images were obtained at a magnification of 600� using an OlympusBX40 microscope fitted with an Olympus DP73 camera.

Godovikova et al. Journal of Bacteriology

January 2019 Volume 201 Issue 2 e00528-18 jb.asm.org 4

on Novem

ber 25, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

of the predicted Ag1 and Xr domains, which includes the sequence that is mostdivergent between the ATCC 35405 and ATCC 33520 Msps. These results indicate thatthis is the predominant surface-localized Msp epitope of strain ATCC 35405. It shouldbe noted that two previous studies proposed that this sequence was within a largeN-terminal domain completely contained within the periplasmic space (26, 27).

Modeling of Msp tertiary structure in a biological context. Having determinedthe location of the major surface-exposed Msp epitope, we next utilized the I-TASSERserver (31) to identify three-dimensional structural models of Msp consistent with thebiological and immunological data. Based on the primary amino acid sequence, theI-TASSER algorithm utilizes multiple, iterative, threading alignments to known struc-tures in the regularly updated Protein Data Bank (PDB) (https://www.rcsb.org) togenerate potential structural models from the primary amino acid sequence of eachprotein. Two sets of 5 predicted ATCC 35405 Msp structural models, generated16 months apart, are shown in Fig. 5A and B. Residues 229 to 251, containing theidentified Msp surface epitope, are highlighted in green in each model. The rather lowconfidence scores (C scores) and the wide range of Msp models reflect the absence ofclosely related proteins with known structures. Model 3 in Fig. 5B shows Msp as a�-barrel protein, with the identified surface epitope localized to a presumably exposedloop. The predicted Msp structure recently published by Puthenveetil et al. (27) as theoptimal model for Msp is model 5 in Fig. 5A. In this model, the surface-exposed Mspepitope is within the portion of the protein predicted by those authors to constitute alarge N-terminal periplasmic domain of Msp (25, 26). It should be noted that this modelis absent in the set of predicted structures based on the most recent PDB templatedatabase (Fig. 5B).

FIG 4 Map and immunoblots of deletion mutations made in msp for expression in E. coli. (Upper) The 543-residue Msp protein, with thesignal peptide (SP) cleavage site indicated (residue 20), is shown above the deletions made in the coding region. The amino acid residuesdeleted in the N-terminal region in each of the three constructs are indicated. Deletions in the central region within the approximateboundaries of the central domain (D1 through D2) include predicted antigenic domains (Ag1 and Ag2), the remaining region of greatestdivergence between Msps of strains ATCC 35405 and ATCC 33520 (Xr), and D2. These mutant Msps were expressed in E. coli. (Lower)Immunoblots of E. coli strains expressing full-length Msps with the indicated Msp residues deleted are shown. T. denticola ATCC 35405serves as a positive control. Blots were probed with rabbit polyclonal antibodies raised against native ATCC 35405 Msp, the Msp N-terminaldomain, or whole T. denticola (Td) cells. All samples were boiled prior to electrophoresis. Lanes contain lysates of E. coli strains. Antibodiesraised against native T. denticola ATCC 35405 Msp or whole T. denticola ATCC 35405 cells do not recognize recombinant Msps lackingresidues 229 to 251.

T. denticola Msp Surface Epitope and Structural Models Journal of Bacteriology

January 2019 Volume 201 Issue 2 e00528-18 jb.asm.org 5

on Novem

ber 25, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

We then generated I-TASSER models of the Msps of T. denticola strains ATCC 33520and OTK (Fig. 6), to determine whether the considerable amino acid sequence differ-ences between these Msps were reflected in the predicted structures. In contrast to theMsps of ATCC 35405 and ATCC 33520, which share �90% sequence identity, ATCC

FIG 5 Models for T. denticola ATCC 35405 Msp generated by I-TASSER. The I-TASSER algorithm generates 5 predicted structural models based onseveral parameters, of which model 1 is the overall best model. Overall model ranking does not necessarily follow the C scores for proteins lackingclosely related known structures. All 5 models are displayed to show the N termini (blue) and C termini (red). The ATCC 35405 Mspsurface-exposed epitope (residues 229 to 251) is highlighted in green in each model. (A) Models 1 to 5 generated using the PDB data availablein June 2017. (B) Models 1 to 5 generated using the PDB data available in October 2018.

FIG 6 T. denticola Msp alignment and structural models for strains ATCC 33520 and OTK. (A) Clustal W alignment of ATCC 33520 and OTK Msps. Identicalresidues are highlighted in green; nonidentical residues and gaps are in red. Residues outlined in gray (residues 232 to 256 in ATCC 33520 Msp and residues230 to 254 in OTK Msp) correspond to the Ag1-Xr epitope of ATCC 35405 Msp (Fig. 1). (B) Side and top views of I-TASSER models of ATCC 33520 and OTK Msps(C scores of �2.16 and �1.67, respectively) displayed to show the N termini (blue) and C termini (red). Residues corresponding to the ATCC 35405 Ag1-Xrsurface-exposed epitope are highlighted in green.

Godovikova et al. Journal of Bacteriology

January 2019 Volume 201 Issue 2 e00528-18 jb.asm.org 6

on Novem

ber 25, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

33520 Msp and OTK Msp share �40% overall homology (Fig. 6A). Interestingly, themost highly ranked structural models of ATCC 33520 and OTK Msps were very similar(C scores of �2.16 and �1.67, respectively), with each showing the Msp as a single�-barrel structure consistent with identification as an outer membrane porin (Fig. 6B).The complete set of I-TASSER models for ATCC 35405, ATCC 33520, and OTK Msps isshown in Fig. S1 in the supplemental material.

Several studies have reported that Msp has porin-like channel-forming activity (5, 6,26–28). The pore diameter of native ATCC 35405 Msp was estimated to be 3.4 nm,based on single-channel conductance studies in black lipid bilayer model mem-branes (28), and recombinant Msp has been shown to have similar conductancecharacteristics (6, 26). Based on the structural models shown here, the porediameters of the ATCC 33520 and OTK Msps are approximately 3.6 nm, calculatedas the average distance between three pairs of residues on opposite sides of thepredicted barrel structure of each molecule.

To investigate potential factors contributing to the considerable differences in thepredicted structure between ATCC 35405 Msp and the Msps of strains ATCC 33520 andOTK, we focused on the sequence of the 70-residue domain in ATCC 35405 (residues202 to 271) that distinguishes the Msps of ATCC 35405 and ATCC 33520. We noted thatthe immunogenic domain in ATCC 35405 Msp contains a single diproline motif(residues 249 and 250) that is absent in ATCC 33520 Msp. Because the significantinherent flexibility of the proline ring (particularly when doubled) could potentiallyinfluence protein structure predictions (32), we performed an in silico analysis of anATCC 35405 Msp sequence in which the unique diproline motif was replaced with thecognate glycine-alanine from ATCC 33520 Msp (Fig. 1). Two of the 5 models of ATCC35405 with the Gly-Ala substitution for Pro-Pro predicted a single �-barrel structureconsistent with identification of Msp as an outer membrane porin (data not shown).The I-TASSER model with the highest score (C score of �1.64) is shown in Fig. S2, withthe surface epitope (residues 229 to 251) labeled as in Fig. 5.

To provide further information validating the high-scoring structural models gen-erated by I-TASSER that resembled outer membrane porins, we used the TMBpro server,which is specifically designed to predict the tertiary structure and membrane orienta-tion of transmembrane �-barrel (TMB) proteins embedded in the outer membranes ofdidermal bacteria (33). It should be noted that the I-TASSER algorithm does not directlypredict the orientation or membrane topology of the structural models generated. InTMBpro, the structures predicted for the Msps of ATCC 35405, ATCC 33520, and OTKvery closely resembled the high-scoring I-TASSER models generated from Msps of ATCC35405 (Pro249Pro250 or Gly249Ala250), ATCC 33520, and OTK. In each case, the TMBproalgorithm identified the surface-exposed ATCC 35405 Msp epitope as part of anoutward-facing loop of the �-barrel porin molecule (Fig. S3).

DISCUSSION

In this study, we utilized several approaches to determining Msp topology in the T.denticola outer membrane. First, we identified a surface-exposed epitope of T. denticolaATCC 35405 Msp within a 23-residue domain in the central region of the protein thatlies between the predicted Msp N-terminal (pfam02707, residues 109 to 208) andC-terminal (pfam02722, residues 360 to 543) domains. Then, using in silico proteinstructural modeling, we showed that (i) the proposed structural model in which theN-terminal half of Msp is localized to the periplasmic space is inconsistent with theimmunological data and (ii) a proposed model of ATCC 35405 Msp as a �-barrel porinis both similarly predicted for very diverse T. denticola Msp molecules and whollyconsistent with the immunological data.

The N- and C-terminal regions of Msp and Msp-like proteins are annotated asdistinct domains with separate Pfam entries in the Conserved Domain Database(CDD; https://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi), which has been reg-ularly updated to incorporate new sequences and structures and improved analyticaltechniques (34, 35). This updating is reflected in several changes in the defined

T. denticola Msp Surface Epitope and Structural Models Journal of Bacteriology

January 2019 Volume 201 Issue 2 e00528-18 jb.asm.org 7

on Novem

ber 25, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

boundaries of the putative Msp N-terminal and C-terminal domains over the past fewyears. Two earlier reports on predicted Msp structure and topology (26, 27) describedthe MOSP-N domain as encompassing residues 113 to 348, including residues 204 to270 (the central domain), based on CDD information current at the time. It should benoted that the latest updated version of the CDD shows that, in ATCC 35405 Msp, theMOSP-N domain (pfam02707) and the MOSP-C domain (pfam02722) encompass resi-dues 109 to 208 and 361 to 543, respectively, such that the neither the N-domain northe C-domain includes the portion of Msp containing the surface epitope identifiedhere. This evolving understanding of the molecular architecture of Msp makes it evenmore important that bioinformatics-based structure and topology predictions areinformed and supported by empirical biological evidence.

Identification of the predominant surface-exposed Msp epitope advances theknowledge of Treponema outer membrane biology in several ways. This epitope definesa major source of antigenic heterogeneity observed among T. denticola strains. This isconsistent with previous studies that showed that (i) human sera from differentsubjects recognized antigenically distinct T. denticola Msp types (36) and (ii) the ATCC35405 Msp central domain containing this epitope also contains a fibronectin-bindingdomain (4). In this context, it is relevant that the major immunogenic epitopes of T.pallidum TprK are localized to the variable regions of this molecule (37). It remains tobe determined whether T. denticola Msp has more than a single surface-exposedepitope. Studies in progress will address this by in-frame deletion of all or part of theidentified epitope. More importantly for the present study, localization of this epitopeconstrains the range of potential models that can accurately represent the native Mspstructure, thus permitting rational choices among the wide range of potential struc-tures predicted by in silico modeling.

Translocation to and oligomerization of bacterial �-barrel-containing proteins inthe outer membrane are generally dependent on specific chaperones such as SurAand the outer membrane �-barrel assembly machinery (BAM) complex, whichincludes BamABCDE and several associated proteins (reviewed in reference 38). T.denticola Msp was recently reported to interact with both BamA and SurA (27),suggesting that its native expression may be BamA dependent. Because recognitionof outer membrane protein precursors by the BAM complex typically involves aconserved C-terminal pattern of aromatic residues (38, 39), both the two-domainand porin models of the Msp structure appear to be consistent with BAM complex-dependent translocation and oligomerization of Msp in the outer membrane.Studies are in progress in our laboratory to address the role of the Msp C terminusin localization to the T. denticola outer membrane.

We relied on two structural modeling algorithms to model potential Msp structures.We primarily utilized I-TASSER, a robust general homology-based prediction algorithm,to generate potential Msp structures consistent with the biological data. The I-TASSERalgorithm produces 5 predicted structural models (ranked 1 to 5). This ranking is basedon a C score combined with a template modeling (TM) score and a root mean squaredeviation (RMSD), which are two measures for quality prediction (40). For proteinshaving homology with known structures, the C score is highly correlated with the TMscore and RMSD. For proteins (such as Msp) that lack solved homologous structures,overall model “quality” ranking does not necessarily follow the C score. We also usedTMBpro, a porin-specific modeling algorithm (33), to compare and to help validatebiologically germane Msp models generated by I-TASSER.

Bioinformatic analysis of Msp structure has been somewhat limited, due to twofactors. First, general prediction algorithms such as I-TASSER rely heavily on data-bases of solved crystal structures to identify similarities between the protein ofinterest and known protein structures, in order to generate models with a high levelof confidence. Proteins such as Msp and Msp-like proteins (including the Tprs of T.pallidum) are Treponema specific, and none has been crystallized to date. Second,structure prediction methodology for porins and porin-like molecules has laggedbehind that for other protein classes because conventional methods relying on

Godovikova et al. Journal of Bacteriology

January 2019 Volume 201 Issue 2 e00528-18 jb.asm.org 8

on Novem

ber 25, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

hydropathy patterns are not very useful for analyzing proteins that consist largelyof amphiphilic �-strands that form a membrane-embedded, water-filled channel(41). Until fairly recently, relatively few porin structures had been described. Whileconsiderable progress has been made, there is still no clear consensus regardingporin structural modeling using general prediction algorithms (42, 43). However,because TMB structures conform to specific construction rules that drasticallyrestrict the conformational space, it is possible for alignment-free methods such asTMBpro to successfully model this class of proteins (33).

One of the I-TASSER structural models generated for ATCC 35405 Msp was recentlypublished as representing the optimal Msp structural model, based on consistency withsequence-based domain predictions (27). As shown in Fig. 5, that model (model 5) hasthe lowest C score of the 5 models generated. More importantly, in that model thesurface-exposed Msp epitope resides within what was proposed as the Msp N-terminalperiplasmic domain. Data presented herein clearly show that the bipartite modelcannot accurately represent the actual structure and membrane topology of Msp.

The highest-ranked I-TASSER models for Msps of strains ATCC 33520 and OTK aresurprisingly similar, given the low level of amino acid homology between theseproteins. Both models strongly indicate an overall �-barrel structure typical of outermembrane porins, with the region corresponding to the surface-exposed epitope inATCC 35405 Msp being localized to an extracellular loop. The finding that the predictedpore diameters of ATCC 33520 and OTK Msp closely match the empirically determinedpore size of ATCC 35405 Msp (6, 26, 28) lends further support to the conclusion thatthese models closely represent the native Msp structure.

We were initially puzzled by the major differences between the structural models ofATCC 35405 Msp (on one hand) and ATCC 33520 and OTK Msps (on the other hand).We find it highly intriguing that replacement of the Pro-Pro motif in the Xr domain ofATCC 35405 with the cognate Gly-Ala motif from ATCC 33520 resulted in I-TASSERmodels for the modified ATCC 35405 Msp that closely resembled those for ATCC 33520and OTK. Two of the 5 I-TASSER models of ATCC 35405 Msp with the Gly-Ala substi-tution for Pro-Pro show a single �-barrel structure consistent with the identification ofMsp as an outer membrane porin (data not shown). I-TASSER modeling of proteins thatlack structurally determined homologs remains somewhat problematic. The most likelyreason for the dramatic change in structure prediction resulting from the Pro-Pro toGly-Ala substitution is considerable loss of potential polypeptide chain flexibility at thatpoint, which likely constrains the range of possible predicted structures. We speculatethat this reflects both the iterative template-based approach and the structural flexi-bility of the diproline motif (32). As to any potential function of a diproline motif in Msp,it should be noted that there are no other proline doublets in any of the 3 Mspsexamined here. Proline doublets are present in a total of 4 of �60 sequenced Msps (13),and all are found at various locations within the predicted Msp central domain.Targeted in vivo mutagenesis of these residues is being pursued for better understand-ing of this issue.

In summary, we have identified the predominant surface-exposed epitope of T.denticola ATCC 35405 Msp as a 23-residue sequence within the central domain of Msp.Identification of this epitope constrains the range of possible three-dimensional struc-tures that are also consistent with Msp porin activity to a �-barrel structure generallysimilar to that of Gram-negative outer membrane porins. Studies in progress includesite-directed mutagenesis throughout the msp gene to characterize potential intramo-lecular interactions between the N-terminal and C-terminal portions of Msp that maycontribute to the stability of the oligomeric �-barrel structure.

MATERIALS AND METHODSBacterial strains and growth conditions. T. denticola strains ATCC 35405 and ATCC 33520 (oral

phylogroup 2) were grown under anaerobic conditions in new oral spirochete (NOS) broth, as describedpreviously (44). All growth media were incubated under anaerobic conditions for at least 18 h prior to use(45). The purity of spirochete cultures was monitored by dark-field microscopy. E. coli strains were grownin LB broth or agar medium supplemented with kanamycin (50 �g ml�1), carbenicillin (50 �g ml�1), or

T. denticola Msp Surface Epitope and Structural Models Journal of Bacteriology

January 2019 Volume 201 Issue 2 e00528-18 jb.asm.org 9

on Novem

ber 25, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

chloramphenicol (34 �g ml�1), as appropriate. Routine cloning was performed in E. coli JM109 (46).Recombinant proteins were expressed in E. coli C41 (47) carrying pLysS (48).

Purification of T. denticola Msp. Native Msp was purified by preparative electrophoresis from 4-literbatch cultures of T. denticola ATCC 35405 as described previously (6), with minor modifications. Briefly,cells were collected by centrifugation (3,500 rpm for 10 min at 4˚C), washed twice in phosphate-bufferedsaline (PBS) containing 5 mM MgCl2 and 1 mM phenylmethylsulfonyl fluoride (PMSF), and then extractedovernight at 4˚C, with gentle stirring, in 100 ml 1% Triton X-114 (ANAPOE-X-114; Anatrace, Maumee, OH)containing 5 mM MgCl2 and 1 mM PMSF. The aqueous supernatant was collected by centrifugation(12,000 rpm for 10 min at 4˚C). Triton X-114 was added to a final concentration of 2%, the mixture wasincubated at 37˚C for 15 min, and then phase partitioning was performed by centrifugation (4,000 rpmfor 10 min at 37˚C). The aqueous phase was subjected to two more rounds of Triton X-114 extraction andthen concentrated in a stirred-cell ultrafiltration unit fitted with an Amicon XM-50 filter (Millipore, Inc.,Beverly, MA). The final aqueous phase (approximately 6 ml) was subjected to preparative SDS-PAGE (5%acrylamide) using a model 491 Prep Cell (Bio-Rad Laboratories, Richmond, CA). Samples were electro-phoresed at 60 mA at 4°C. The cathode buffer contained 25 mM Tris (pH 8.3), 192 mM glycine, and 0.1%SDS, and the anode and elution buffers consisted of 25 mM Tris (pH 8.3) with 192 mM glycine. The eluatewas collected in 5.0-ml fractions, at a flow rate of 1 ml min�1. Fractions were analyzed by SDS-PAGE withsilver staining. Fractions containing Msp were concentrated approximately 10-fold with an AmiconXM-50 filter (Millipore) and then were subjected to buffer exchange by three washes with 10 volumes ofPBS containing 0.1% 3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonate (CHAPS). Followingdetermination of the protein concentration using the bicinchoninic acid (BCA) protein assay (ThermoScientific, Rockford, IL), the purified Msp protein was used to immunize rabbits to generate polyclonalantibodies, as described previously (29).

Immunofluorescence microscopy of T. denticola. T. denticola cells grown to an optical density at600 nm (OD600) of 0.2 were fixed on glass slides with 1% paraformaldehyde, washed with PBS or PBS plus0.5% Triton X-100, blocked, and probed with rabbit antibodies to native ATCC 35405 Msp or recombinantFlaA, followed by goat anti-rabbit IgG conjugated to Alexa Fluor 568 (Msp) or Alexa Fluor 488 (FlaA).Coverslips were sealed with ProLong Gold antifade mounting reagent with 4’,6-diamidino-2-phenylindole (DAPI) (Life Technologies, Carlsbad, CA). Images were obtained at a magnification of 600�,using an Olympus BX40 microscope fitted with an Olympus DP73 camera (49).

Construction of expression plasmids with deletions in the Msp N-terminal and central do-mains. Plasmid pCF31, which carries the full-length msp gene under transcriptional control of the T7 RNApolymerase in pET17b (3), was used as the template for construction of several defined deletions byligation-independent PCR cloning (50, 51). Briefly, using high-fidelity DNA polymerase (Phusion; NewEngland Biolabs, Beverly, MA), partially complementary primers with sequences 5= and 3= of the desireddeletions (Table 1) were used to amplify the entire pCF31 template, minus the deleted sequence. ThePCR templates were removed by overnight digestion with DpnI. E. coli JM109 was then transformed withthe resulting DNA, and transformants were screened by PCR and DNA sequencing to confirm theexpected constructs. The resulting plasmid constructs are listed in Table 2. Recombinant constructs wereconfirmed by PCR and by DNA sequencing at the University of Michigan DNA Sequencing Core Facilityand were analyzed using DNA sequence analysis components of the Lasergene Molecular Biology Suite(DNASTAR Inc., Madison, WI).

Expression of recombinant proteins in E. coli. Plasmid DNAs carrying various msp constructs wereintroduced into the E. coli expression strain C41/pLysS. Briefly, an overnight culture from a single colonywas diluted 1:10 in fresh medium and incubated at 37˚C, with shaking, until reaching an OD600 of 0.5 to0.6. Protein expression was induced by the addition of isopropyl-�-D-thiogalactopyranoside (IPTG) to0.2 mM, and the culture was further incubated for 3 h. Cells were collected by centrifugation for 10 min at4,000 rpm and lysed by suspension in 1� Laemmli sample buffer and repeated passage through a 26-gaugeneedle. Samples were subjected to 10% SDS-PAGE and analyzed by Western blotting with rabbit antibodiesraised against the ATCC 35405 Msp N-terminal domain (residues 14 to 202) (4), native ATCC 35405 Msp (thisstudy), recombinant Msp (3), T. denticola ATCC 35405 cells (8), or T. denticola FlaA (29).

TABLE 1 Oligonucleotide primers used in this study

Primer Sequence Targeta

CX1295 CAAAACCATGTTGAGGTGTAAGTTGAGCAAAAGC N-term-A, Δ76–141 (R)CX1296 ACACCTCAACATGGTTTTGAGAATCTTTTGGAT N-term-A, Δ76–141 (F)CX1297 CTTCGGTCTTTTGAGGTGTAAGTTGAGCAAAAGC N-term-B, Δ76–207 (F)CX1298 ACACCTCAAAAGACCGAAGGTGACGTTCG N-term-B, Δ76–207 (R)CX1299 TATTTGACAATTGAGGTGTAAGTTGAGCAAAAGC N-term-C, Δ76–276 (R)CX1300 ACACCTCAATTGTCAAATAGTGCATCACCCCAT N-term-C, Δ76–276 (F)CX1301 ATATCGGCTTTTGTTTATAATATGTAGCACCGGC Ag1, Δ685–705 (F)CX1302 TTATAAACAAAAGCCGATATTTAGTTCTACAGCA Ag1, Δ685–705 (F)CX1303 TTACCAAATATACGGTAGGAGGAGCAGC Ag2, Δ757–777 (R)CX1304 CTACCGTATATTTGGTAAAGACAGCGTCTACT Ag2, Δ757–777 (F)CX1305 TGCGGGACCTACCAAATATTTTCCGTCTTCACC D2, Δ787–807 (R)CX1306 ATATTTGGTAGGTCCCGCAGCAAACAA D2, Δ787–807 (F)CX1307 CAGCACCTACCTTACCTTCTGCATCGATACCATT Xr, Δ709–753 (R)CX1308 AGAAGGTAAGGTAGGTGCTGGTGAAGACGG Xr, Δ709–753 (F)aNumbering is according to the nucleotide residues in the msp coding region. F, forward; R, reverse.

Godovikova et al. Journal of Bacteriology

January 2019 Volume 201 Issue 2 e00528-18 jb.asm.org 10

on Novem

ber 25, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

Protein gel electrophoresis and immunoblotting. SDS-PAGE and Western immunoblotting wereperformed as described previously (3). Total cell lysates of T. denticola strains and E. coli strains expressing Mspconstructs (either heated at 100° C for 5 min or held on ice) were separated by SDS-PAGE and then stainedor transferred to nitrocellulose membranes, which were probed with rabbit polyclonal antibodies followed byhorseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG (Thermo Scientific). Protein bands of interestwere visualized using the SuperSignal West Pico chemiluminescent substrate (Thermo Scientific).

Predictive bioinformatic analysis of Msp structure. Three-dimensional Msp structural models weregenerated from primary amino acid sequences using two public servers, i.e., the I-TASSER server(https://zhanglab.ccmb.med.umich.edu) and the TMBpro server (http://tmbpro.ics.uci.edu). I-TASSERgenerates 5 potential structural models for each protein, of which model 1 is the overall best modelbased on several parameters, including the RMSD of atomic positions of superimposed proteins, the TMscore, and the C score (40). The TM score assesses the quality of protein structure templates and predictedfull-length models (52), while the C score is calculated based on the significance of threading templatealignments and the convergence parameters of the structure assembly simulations (31). C scores fall in therange of �5 to 2, with a C score of higher value signifying a model with higher confidence. In general, a Cscore greater than �1.5 indicates a model of correct global topology (31). While C scores are highly correlatedwith TM scores and RMSD values for proteins with closely related known structures, overall model rankingdoes not necessarily follow C scores for unknown structures (such as Msp).

TMBpro is a suite of specialized predictors for predicting the secondary structure, �-contacts, andtertiary structure of TMB proteins (33). Because homology-based modeling methods often fail with TMBproteins, TMBpro uses alignment-free methods within a set of specific construction rules that restrict theconformational space. Protein structural models generated with I-TASSER and TMBpro were labeled,scaled, and annotated using the Protean 3D component of the Lasergene Molecular Biology Suite(DNASTAR, Inc.).

SUPPLEMENTAL MATERIALSupplemental material for this article may be found at https://doi.org/10.1128/JB

.00528-18.SUPPLEMENTAL FILE 1, PDF file, 4.4 MB.

ACKNOWLEDGMENTSWe thank Chengxin Zhang (Department of Computational Medicine and Bioinfor-

matics, School of Medicine, University of Michigan) for helpful discussions. We alsothank Howard Jenkinson and Angela Nobbs (University of Bristol, Bristol, UK) forproviding rabbit polyclonal antibodies.

This study was supported by grants DE-025225 and DE-018221 (to J.C.F.) from theNational Institute of Dental and Craniofacial Research.

REFERENCES1. Loesche WJ. 1988. The role of spirochetes in periodontal disease. Adv

Dent Res 2:275–283. https://doi.org/10.1177/08959374880020021201.2. Ellen RP, Galimanas VB. 2005. Spirochetes at the forefront of periodontal

infections. Periodontol 2000 38:13–32. https://doi.org/10.1111/j.1600-0757.2005.00108.x.

3. Fenno JC, Müller K-H, McBride BC. 1996. Sequence analysis, expres-sion and binding activity of recombinant major outer sheath protein(Msp) of Treponema denticola. J Bacteriol 178:2489 –2497. https://doi.org/10.1128/jb.178.9.2489-2497.1996.

4. Edwards AM, Jenkinson HF, Woodward MJ, Dymock D. 2005. Bindingproperties and adhesion-mediating regions of the major sheath proteinof Treponema denticola ATCC 35405. Infect Immun 73:2891–2898.https://doi.org/10.1128/IAI.73.5.2891-2898.2005.

5. Mathers DA, Leung WK, Fenno JC, Hong Y, McBride BC. 1996. Majorsurface protein complex of Treponema denticola depolarizes and inducesion channels in HeLa cell membranes. Infect Immun 64:2904 –2910.

6. Fenno JC, Hannam PM, Leung WK, Tamura M, Uitto V-J, McBride BC.1998. Cytopathic effects of the major surface protein and the chy-motrypsinlike protease of Treponema denticola. Infect Immun 66:1869 –1877.

7. Jones MM, Vanyo ST, Visser MB. 2017. The C-terminal region of the majorouter sheath protein of Treponema denticola inhibits neutrophil che-motaxis. Mol Oral Microbiol 32:375–389. https://doi.org/10.1111/omi.12180.

8. Haapasalo M, Müller K-H, Uitto V-J, Leung WK, McBride BC. 1992.Characterization, cloning, and binding properties of the major 53-

TABLE 2 Plasmids used for expression studies in E. coli

Plasmid Descriptiona Reference or source

pCF31 Full-length msp in pET17b 3pCF965 pCF31 with DNA encoding Msp residues 253–259 (Ag2) deleted This studypCF966 pCF31 with DNA encoding Msp residues 237–251 (Xr) deleted This studypCF967 pCF31 with DNA encoding Msp residues 263–269 (D2) deleted This studypCF968 pCF31 with DNA encoding Msp residues 229–235 (Ag1) deleted This studypCF969 pCF31 with DNA encoding Msp residues 26–69 (N:DelB) deleted This studypCF970 pCF31 with DNA encoding Msp residues 26–47 (N:DelA) deleted This studypCF971 pCF31 with DNA encoding Msp residues 26–92 (N:DelC) deleted This studyaConstruction of these plasmids is described in Materials and Methods.

T. denticola Msp Surface Epitope and Structural Models Journal of Bacteriology

January 2019 Volume 201 Issue 2 e00528-18 jb.asm.org 11

on Novem

ber 25, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

kilodalton Treponema denticola surface antigen. Infect Immun 60:2058 –2065.

9. Heuner K, Choi BK, Schade R, Moter A, Otto A, Gobel UB. 1999. Cloningand characterization of a gene (mspA) encoding the major sheathprotein of Treponema maltophilum ATCC 51939T. J Bacteriol 181:1025–1029.

10. Park K-K, Heuner K, Gobel UB, Yoo Y-J, Kim C-K, Choi B-K. 2002. Cloningand characterization of a major surface protein (MspTL) of Treponemalecithinolyticum associated with rapidly progressive periodontitis. FEMSMicrobiol Lett 207:185–192. https://doi.org/10.1111/j.1574-6968.2002.tb11049.x.

11. Dewhirst FE, Tamer MA, Ericson RE, Lau CN, Levanos VA, Boches SK,Galvin JL, Paster BJ. 2000. The diversity of periodontal spirochetes by 16SrRNA analysis. Oral Microbiol Immunol 15:196 –202. https://doi.org/10.1034/j.1399-302x.2000.150308.x.

12. You M, Mo S, Leung WK, Watt RM. 2013. Comparative analysis of oraltreponemes associated with periodontal health and disease. BMC InfectDis 13:174. https://doi.org/10.1186/1471-2334-13-174.

13. You M, Chan Y, Lacap-Bugler DC, Huo YB, Gao W, Leung WK, Watt RM.2017. Oral treponeme major surface protein: sequence diversity anddistributions within periodontal niches. Mol Oral Microbiol 32:455– 473.

14. Clegg SR, Carter SD, Birtles RJ, Brown JM, Hart CA, Evans NJ. 2016.Multilocus sequence typing of pathogenic treponemes isolated fromcloven-hoofed animals and comparison to treponemes isolated fromhumans. Appl Environ Microbiol 82:4523– 4536. https://doi.org/10.1128/AEM.00025-16.

15. Orsel K, Plummer P, Shearer J, De Buck J, Carter SD, Guatteo R, BarkemaHW. 2017. Missing pieces of the puzzle to effectively control digitaldermatitis. Transbound Emerg Dis 65(Suppl 1):186 –198. https://doi.org/10.1111/tbed.12729.

16. Evans NJ, Murray RD, Carter SD. 2016. Bovine digital dermatitis: currentconcepts from laboratory to farm. Vet J 211:3–13. https://doi.org/10.1016/j.tvjl.2015.10.028.

17. Svartstrom O, Mushtaq M, Pringle M, Segerman B. 2013. Genome-widerelatedness of Treponema pedis, from gingiva and necrotic skin lesions ofpigs, with the human oral pathogen Treponema denticola. PLoS One8:e71281. https://doi.org/10.1371/journal.pone.0071281.

18. Mushtaq M, Manzoor S, Pringle M, Rosander A, Bongcam-Rudloff E. 2015.Draft genome sequence of ‘Treponema phagedenis’ strain V1, isolatedfrom bovine digital dermatitis. Stand Genomic Sci 10:67. https://doi.org/10.1186/s40793-015-0059-0.

19. Fenno JC, Wong GWK, Hannam PM, Müller K-H, Leung WK, McBride BC.1997. Conservation of msp, the gene encoding the major outer mem-brane protein of oral Treponema spp. J Bacteriol 179:1082–1089. https://doi.org/10.1128/jb.179.4.1082-1089.1997.

20. Fraser CM, Norris SJ, Weinstock GM, White O, Sutton GG, Dodson R,Gwinn M, Hickey EK, Clayton R, Ketchum KA, Sodergren E, Hardham JM,McLeod MP, Salzberg S, Peterson J, Khalak H, Richardson D, Howell JK,Chidambaram M, Utterback T, McDonald L, Artiach P, Bowman C, CottonMD, Fujii C, Garland S, Hatch B, Horst K, Roberts K, Sandusky M, WeidmanJ, Smith HO, Venter JC. 1998. Complete genome sequence of Treponemapallidum, the syphilis spirochete. Science 281:375–388. https://doi.org/10.1126/science.281.5375.375.

21. Centurion-Lara A, Castro C, Barrett L, Cameron C, Mostowfi M, VanVoorhis WC, Lukehart SA. 1999. Treponema pallidum major sheath pro-tein homologue Tpr K is a target of opsonic antibody and the protectiveimmune response. J Exp Med 189:647– 656. https://doi.org/10.1084/jem.189.4.647.

22. Anand A, Luthra A, Dunham-Ems S, Caimano MJ, Karanian C, LeDoyt M,Cruz AR, Salazar JC, Radolf JD. 2012. TprC/D (Tp0117/131), a trimeric,pore-forming rare outer membrane protein of Treponema pallidum, hasa bipartite domain structure. J Bacteriol 194:2321–2333. https://doi.org/10.1128/JB.00101-12.

23. LaFond RE, Centurion-Lara A, Godornes C, Van Voorhis WC, Lukehart SA.2006. TprK sequence diversity accumulates during infection of rabbitswith Treponema pallidum subsp. pallidum Nichols strain. Infect Immun74:1896 –1906. https://doi.org/10.1128/IAI.74.3.1896-1906.2006.

24. Centurion-Lara A, LaFond RE, Hevner K, Godornes C, Molini BJ, VanVoorhis WC, Lukehart SA. 2004. Gene conversion: a mechanism forgeneration of heterogeneity in the tprK gene of Treponema pallidumduring infection. Mol Microbiol 52:1579 –1596. https://doi.org/10.1111/j.1365-2958.2004.04086.x.

25. Centurion-Lara A, Giacani L, Godornes C, Molini BJ, Brinck Reid T, Luke-hart SA. 2013. Fine analysis of genetic diversity of the tpr gene family

among treponemal species, subspecies and strains. PLoS Negl Trop Dis7:e2222. https://doi.org/10.1371/journal.pntd.0002222.

26. Anand A, Luthra A, Edmond ME, Ledoyt M, Caimano MJ, Radolf JD. 2013.The major outer sheath protein (Msp) of Treponema denticola has abipartite domain architecture and exists as periplasmic and outermembrane-spanning conformers. J Bacteriol 195:2060 –2071. https://doi.org/10.1128/JB.00078-13.

27. Puthenveetil R, Kumar S, Caimano MJ, Dey A, Anand A, Vinogradova O,Radolf JD. 2017. The major outer sheath protein forms distinct conform-ers and multimeric complexes in the outer membrane and periplasm ofTreponema denticola. Sci Rep 7:13260. https://doi.org/10.1038/s41598-017-13550-6.

28. Egli C, Leung WK, Müller KH, Hancock RE, McBride BC. 1993. Pore-forming properties of the major 53-kilodalton surface antigen from theouter sheath of Treponema denticola. Infect Immun 61:1694 –1699.

29. Bian X-L, Wang H-T, Ning Y, Lee SY, Fenno JC. 2005. Mutagenesis of anovel gene in the prcA-prtP protease locus affects expression of Trepo-nema denticola membrane complexes. Infect Immun 73:1252–1255.https://doi.org/10.1128/IAI.73.2.1252-1255.2005.

30. Jameson BA, Wolf H. 1988. The antigenic index: a novel algorithm forpredicting antigenic determinants. Comput Appl Biosci 4:181–186.https://doi.org/10.1093/bioinformatics/4.1.181.

31. Yang J, Yan R, Roy A, Xu D, Poisson J, Zhang Y. 2015. The I-TASSER Suite:protein structure and function prediction. Nat Methods 12:7– 8. https://doi.org/10.1038/nmeth.3213.

32. Ho BK, Coutsias EA, Seok C, Dill KA. 2005. The flexibility in the prolinering couples to the protein backbone. Protein Sci 14:1011–1018. https://doi.org/10.1110/ps.041156905.

33. Randall A, Cheng J, Sweredoski M, Baldi P. 2008. TMBpro: secondarystructure, �-contact and tertiary structure prediction of transmembrane�-barrel proteins. Bioinformatics 24:513–520. https://doi.org/10.1093/bioinformatics/btm548.

34. Marchler-Bauer A, Bo Y, Han L, He J, Lanczycki CJ, Lu S, Chitsaz F,Derbyshire MK, Geer RC, Gonzales NR, Gwadz M, Hurwitz DI, Lu F,Marchler GH, Song JS, Thanki N, Wang Z, Yamashita RA, Zhang D, ZhengC, Geer LY, Bryant SH. 2017. CDD/SPARCLE: functional classification ofproteins via subfamily domain architectures. Nucleic Acids Res 45:D200 –D203. https://doi.org/10.1093/nar/gkw1129.

35. Finn RD, Coggill P, Eberhardt RY, Eddy SR, Mistry J, Mitchell AL, Potter SC,Punta M, Qureshi M, Sangrador-Vegas A, Salazar GA, Tate J, Bateman A.2016. The Pfam protein families database: towards a more sustainablefuture. Nucleic Acids Res 44:D279–D285. https://doi.org/10.1093/nar/gkv1344.

36. Capone R, Wang HT, Ning Y, Sweier DG, Lopatin DE, Fenno JC. 2008.Human serum antibodies recognize Treponema denticola Msp and PrtPprotease complex proteins. Oral Microbiol Immunol 23:165–169. https://doi.org/10.1111/j.1399-302X.2007.00404.x.

37. Giacani L, Molini BJ, Kim EY, Godornes BC, Leader BT, Tantalo LC,Centurion-Lara A, Lukehart SA. 2010. Antigenic variation in Trepo-nema pallidum: TprK sequence diversity accumulates in response toimmune pressure during experimental syphilis. J Immunol 184:3822–3829. https://doi.org/10.4049/jimmunol.0902788.

38. Plummer AM, Fleming KG. 2016. From chaperones to the membranewith a BAM! Trends Biochem Sci 41:872– 882. https://doi.org/10.1016/j.tibs.2016.06.005.

39. Kim KH, Aulakh S, Paetzel M. 2012. The bacterial outer membrane�-barrel assembly machinery. Protein Sci 21:751–768. https://doi.org/10.1002/pro.2069.

40. Zhang Y. 2008. I-TASSER server for protein 3D structure prediction. BMCBioinformatics 9:40. https://doi.org/10.1186/1471-2105-9-40.

41. Jeanteur D, Lakey JH, Pattus F. 1991. The bacterial porin superfamily:sequence alignment and structure prediction. Mol Microbiol5:2153–2164. https://doi.org/10.1111/j.1365-2958.1991.tb02145.x.

42. Paquet JY, Vinals C, Wouters J, Letesson JJ, Depiereux E. 2000. Topologyprediction of Brucella abortus Omp2b and Omp2a porins after criticalassessment of transmembrane � strands prediction by several second-ary structure prediction methods. J Biomol Struct Dyn 17:747–757.https://doi.org/10.1080/07391102.2000.10506564.

43. Ganguly B, Tewari K, Singh R. 2015. Homology modeling, functionalannotation and comparative genomics of outer membrane protein H ofPasteurella multocida. J Theor Biol 386:18 –24. https://doi.org/10.1016/j.jtbi.2015.08.028.

44. Fenno JC. 2005. Laboratory maintenance of Treponema denticola. CurrProtoc Microbiol Chapter 12:Unit 12B.1.

Godovikova et al. Journal of Bacteriology

January 2019 Volume 201 Issue 2 e00528-18 jb.asm.org 12

on Novem

ber 25, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

45. McMinn MT, Crawford JJ. 1970. Recovery of anaerobic microorganismsfrom clinical specimens in prereduced media versus recovery by routineclinical laboratory methods. Appl Microbiol 19:207–213.

46. Yanisch-Perron C, Vieira J, Messing J. 1985. Improved M13 phage cloningvectors and host strains: nucleotide sequences of the M13mp18 and pUC19vectors. Gene 33:103–119. https://doi.org/10.1016/0378-1119(85)90120-9.

47. Miroux B, Walker JE. 1996. Over-production of proteins in Escherichia coli:mutant hosts that allow synthesis of some membrane proteins andglobular proteins at high levels. J Mol Biol 260:289 –298. https://doi.org/10.1006/jmbi.1996.0399.

48. Studier FW. 1991. Use of bacteriophage T7 lysozyme to improve aninducible T7 expression system. J Mol Biol 219:37– 44. https://doi.org/10.1016/0022-2836(91)90855-Z.

49. Godovikova V, Goetting-Minesky MP, Shin JM, Kapila YL, Rickard AH,

Fenno JC. 2015. A modified shuttle plasmid facilitates expression of aflavin mononucleotide-based fluorescent protein in Treponema denticolaATCC 35405. Appl Environ Microbiol 81:6496 – 6504. https://doi.org/10.1128/AEM.01541-15.

50. Li C, Wen A, Shen B, Lu J, Huang Y, Chang Y. 2011. FastCloning: a highlysimplified, purification-free, sequence- and ligation-independent PCRcloning method. BMC Biotechnol 11:92. https://doi.org/10.1186/1472-6750-11-92.

51. Bryksin AV, Matsumura I. 2010. Overlap extension PCR cloning: a simpleand reliable way to create recombinant plasmids. Biotechniques 48:463– 465. https://doi.org/10.2144/000113418.

52. Zhang Y, Skolnick J. 2004. Scoring function for automated assessment ofprotein structure template quality. Proteins 57:702–710. https://doi.org/10.1002/prot.20264.

T. denticola Msp Surface Epitope and Structural Models Journal of Bacteriology

January 2019 Volume 201 Issue 2 e00528-18 jb.asm.org 13

on Novem

ber 25, 2020 by guesthttp://jb.asm

.org/D

ownloaded from