Proc. Natl. Acad. Sci. USAVol. 93, pp. 3088-3093, April 1996Biochemistry

Repression of a matrix metalloprotease gene by E1A correlateswith its ability to bind to cell type-specific transcriptionfactor AP-2KUMARAVEL SOMASUNDARAM*t, GOPALSWAMY JAYARAMAN*, TREVOR WILLIAMSt, ELIZABETH MORAN§,STEVEN FRISCH¶, AND BAYAR THIMMAPAYA*II*Lurie Cancer Center and Department of Microbiology and Immunology, Northwestern University Medical School, 303 East Chicago Avenue, Chicago, IL 60611;tDepartment of Biology, Yale University, Kline Biology Tower, P.O. Box 208103, New Haven, CT 06520; §Fels Institute for Cancer Research and MolecularBiology, Temple University School of Medicine, 3307 North Broad Street, Philadelphia, PA 19140; and ILa Jolla Cancer Research Foundation, 10901 TorreyPines Road, La Jolla, CA 92037

Communicated by Laszlo Lorand, Northwestern University Medical School, Chicago, IL, December 21, 1995 (received for review October 31, 1995)

ABSTRACT Adenovirus ElA 243-amino acid protein canrepress a variety of enhancer-linked viral and cellular pro-moters. This repression is presumed to be mediated by itsinteraction with and sequestration of p300, a transcriptionalcoactivator. Type IV 72-kDa collagenase is one of the matrixmetalloproteases that has been implicated in differentiation,development, angiogenesis, and tumor metastasis. We showhere that the cell type-specific transcription factor AP-2 is animportant transcription factor for the activation of the type IV72-kDa collagenase promoter and that adenovirus E1A 243-amino acid protein represses this promoter by targeting AP-2.Glutathione S-transferase-affinity chromatography studiesshow that the E1A protein interacts with the DNA bind-ing/dimerization region of AP-2 and that the N-terminalamino acids of ElA protein are required for this interaction.Further, ElA deletion mutants which do not bind to p300 canrepress this collagenase promoter as efficiently as the wild-type ElA protein. Because the AP-2 element is present in avariety of viral and cellular enhancers which are repressed byE1A, these studies suggest that EIA protein can represscellular and viral promoter/enhancers by forming a complexwith cellular transcription factors and that this repressionmechanism may be independent of its interaction with p300.

An important and yet poorly understood aspect of eukaryoticgene expression is the negative regulation of gene expression.It is increasingly becoming clear that cells and viruses may usediverse strategies to repress transcription. Adenovirus E1Aprotein has proven to be a powerful tool to probe into cellulartranscriptional regulatory mechanisms. In particular, the viralE1A 243-amino acid (aa) protein has been shown to repress avariety of enhancer-linked cellular and viral promoters (1, 2).This repression seems to be mediated by its interaction with a300-kDa phosphoprotein designated p300 (1-5). The proteinp300 is a member of the CBP protein family whose membersfunction as transcriptional coactivators (6-9). These proteinsbridge DNA-bound, sequence-specific transcription factorsand the basal transcription complex and thereby stimulatetranscription initiation. p300 is likely to stimulate a number ofcellular genes by recruiting multiple sequence-specific tran-scription factors. E1A protein presumably inhibits the func-tions of p300 by binding to it. This binding is presumed to beresponsible for the ElA-mediated repression (6-9).

Pozzatti et al. have reported that secondary rat embryofibroblasts (REFs) transformed by the activated ras oncogene(T24 ras) and E1A 243-aa protein are substantially less met-astatic when compared to REFs transformed by ras oncogenealone (10, 11). This observation was subsequently confirmed in

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertisement" inaccordance with 18 U.S.C. §1734 solely to indicate this fact.

studies using human tumor cells (12). Metastatic tumor cellsexpress matrix-degrading metalloproteases at high levels. Thishigh level of expression correlates with the metastatic potentialof these cells (13-16). The transition from localized to invasivecarcinoma is accompanied by a marked disorganization andlocalized loss of the basement membrane components type IVcollagen and laminin (16). The supression of metastasis byE1A correlates with its ability to down-regulate the expressionof matrix-degrading metalloproteases (12, 13). The matrix-degrading metalloproteases include interstitial collagenase,stromelysin, and two type IV collagenases, 92-kDa and 72-kDacollagenases (17). Because type IV collagen is a major com-ponent of basement membranes and is thought to providestructural integrity, overexpression of type IV 72-kDa colla-genase by invasive tumor cells is believed to be crucial for theinvasion and metastasis of these cells (16). In addition to theirrole in tumor metastasis, the metalloproteases have also beenimplicated in morphogenesis, differentiation, wound healing,and angiogenesis (17). We are studying the molecular mech-anisms by which these metalloprotease genes are transcrip-tionally regulated and, in particular, the mechanism by whichE1A represses the matrix metalloprotease genes and sup-presses metastasis.

In this paper we show that an AP-2 element located in theenhancer region of the type IV 72-kDa collagenase gene iscritical for its activation and that the adenovirus E1A 243-aaprotein represses the enhancer of type IV 72-kDa collagenasegene by targeting the cell type-specific transcription factorAP-2. We present evidence that this repression is mediated byan interaction of E1A protein with the DNA binding/dimerization region of AP-2 and that the N-terminal region ofE1A protein is required for this interaction. We also show thatE1A deletion mutants which do not bind to p300 can repressthis collagenase promoter as efficiently as the wild-type (WT)E1A protein. These studies suggest that the E1A protein canrepress cellular and viral promoter/enhancers by binding tocellular transcription factors and that this repression mecha-nism may be independent of its interaction with p300.

MATERIALS AND METHODSThe type IV 72-kDa collagenase promoter-reporter plasmidsused in this study were described by Frisch and Morisaki (18).Plasmids -1900 (pT4CAT5; names shown in parentheses areoriginal names; ref. 18) and -400 (pT4CAT pro) are type IV

Abbreviations: CAT, chloramphenicol acetyltransferase; GST, gluta-thione S-transferase; EMSA, electrophoretic mobility shift assay; WT,wild-type; HSV, herpes simplex virus; TK, thymidine kinase.tPresent address: Howard Hughes Medical Institute, University ofPennsylvania School of Medicine, 415 Currie Boulevard, Philadel-phia, PA 19104.

llTo whom reprint requests should be addressed.

3088Dow

nloa

ded

by g

uest

on

June

26,

202

0

Proc. Natl. Acad. Sci. USA 93 (1996) 3089

72-kDa promoter constructs which contain 1900- and 400-bpDNA sequences upstream from the cap site, respectively, fusedto the chloramphenicol acetyltransferase (CAT) reportergene. pBLCAT/AP-2-I (pT4CAT r2M) contains the AP-2element taken from 1650 bp upstream of the cap site of thetype IV 72-kDa collagenase gene cloned upstream of theherpes simplex virus (HSV) thymidine kinase (TK) promoterand the CAT reporter gene. pSG AP-2 is a simian virus 40(SV40) early promoter based AP-2 expression plasmid (19).WTE1A 12S, E1A d12-36, E1A d138-67, and RG2 were de-scribed earlier (3, 4). GST-E1A, GST-E1A d12-36, GST-E1Ad138-67, and GST-E1A 928/961 were described by Taylor et al.(20). GST-dlAP-2 contains AP-2 coding sequences from aa165 to 437 fused to glutathione S-transferase (GST) (21).Deletion derivatives ofAP-2 (dlN30 to dlC390) were describedpreviously (22, 23). GST-affinity chromatography of the E1Aproteins was carried out as described by Taylor et al. (20).Electrophoretic mobility shift assays (EMSAs) were per-formed using GST-AP-2 protein synthesised in Escherichia coli(21) as described (18).

RESULTSThe Enhancer Region of the 72-kDa Type IV Collagenase

Gene Contains a Functional AP-2 Element. Previous studieshave shown that the promoter of the human type IV 72-kDacollagenase gene contains an enhancer approximately -1600bp from the cap site (18). This enhancer contains an AP-2element with the sequence GCCTGAACT located at -1685which is essential for high-level expression of the type IV72-kDa collagenase gene (ref. 18; this AP-2 element is desig-nated AP-2-I in this report). Purified HeLa cell AP-2 proteinprotected this sequence in DNase I footprinting assays (18).The transcription factor AP-2 is a 52-kDa (437 aa) protein thatfunctions as a dimer and binds to a GC-rich recognitionsequence with dyad symmetry (22-24). Because many AP-2binding sequences, including that of the enhancer of the72-kDa promoter, deviate from the consensus AP-2 bindingsequence GCCNNNGGC, we determined whether the AP-2element present in the enhancer of the 72-kDa promoter is abona fide AP-2 element. These experiments were done inHepG2 cells, which contain no detectable amounts of AP-2(22). The cells were transfected with a CAT reporter genedriven by 1900 bp of the type IV 72-kDa collagenase promot-

ACOMP: AP-21 hMTIIA AP-21(M)

X X XX X

123 4 5 6 7 8 9

s .-

.

er/enhancer upstream from the start site in the presence orabsence of an AP-2 expression plasmid (pSG AP-2; ref. 19). Asa control, a plasmid containing three copies of human metal-lothionein (hMTIIA) promoter AP-2 motifs cloned upstreamof the HSV TK promoter was transfected into HepG2 cellswith or without the AP-2 expression vector. The AP-2 expres-sion vector stimulated the 72-kDa collagenase promoter/enhancer about 4.5-fold, whereas the TK promoter containingauthentic AP-2 motifs was stimulated by the AP-2 expressionvector about 3-fold (data not shown), indicating that the typeIV 72-kDa collagenase promoter/enhancer contains a func-tional AP-2 element. Examination of the first exon sequencesof the 72-kDa gene also revealed another AP-2 motif locatedat +250 with a sequence, GCCCGGGGC (ref. 25; designatedAP-2-II in this report), that perfectly matched the consensussequence (see below).EMSAs were carried out to determine whether the AP-2

protein binds to the two AP-2 motifs of the 72-kDa promoter.Amino acids 165-437, which contain the DNA binding/dimerization domain of the AP-2 protein, were expressed in E.coli as a GST-fusion protein and used in EMSA with either theAP-2-I or the AP-2-II oligonucleotides as the probe. Fig. 1shows that the AP-2 sequence, located at -1685 (AP-2-I),complexed with E. coli-based AP-2 protein (lane 2) when theAP-2-I sequence was used as a probe. Unlabeled AP-2-Icompeted with the AP-2-I probe efficiently (lanes 3, 4, and 5,respectively), whereas AP-2-I, containing a mutation in theAP-2 recognition sequence, competed poorly (lanes 8 and 9).As expected, unlabeled human hMTIIA AP-2 sequence com-peted with the AP-2-I probe efficiently (lanes 6 and 7). Higherlevels of AP-2 protein bound to the AP-2-II element, indicat-ing that this is a stronger AP-2 site than the AP-2-I site (lane11) and that unlabeled AP-2-II oligonucleotide competed withthe probe efficiently (lanes 12 and 13). AP-2-II oligonucleotidecontaining a mutation in the binding site did not compete(lanes 14 and 15). Unlabeled hMTIIA oligonucleotide alsocompeted efficiently with the AP-2-II probe (lanes 16 and 17).EMSAs in which the hMTIIA AP-2 site was used as a probeand unlabeled WT or mutant AP-2-II oligonucleotides wereused for competition show similar results (lanes 18-24). Thus,several lines of evidence-namely, binding of the purifiedAP-2 protein to the AP-2-I element in DNase I footprintingassays (18), activation of the type IV collagenase promoter/enhancer by an AP-2 expression vector in transient assays

B AP-211 AP-211(04 hMTIIA AP-2 11 AP-211(M) hMTIIA

xOx ^ )x x x x X Ox

x

10 11 12 13 14 15 16 17 18 19 20 21 22 23 24

a,

.A &AAAAA---- ---PROBE: AP-21-I - PROBE: AP-2II - *- PROBE: hMTIIA

FIG. 1. E. coli-based AP-2 protein binds to the -1685 (AP-2-I) and +250 (AP-2-II) sites of the type IV 72-kDa collagenase promoter. EMSAwas carried out with AP-2 protein expressed in E. coli as a GST-fusion protein (21). The probes used are shown at the bottom. Competitoroligonucleotides are shown on the top. - P, sample incubated without protein. C, sample incubated with probe and without competitor. Nucleotidesequences of the probes and competitors: AP-2-I, GATCCACACCCACCAGACAAGCCTGAACTTGTCTGAAGCCCG [underlined bases are

mutated in AP-2-I (M)]; AP-2-II, AGGCGCTAATGQCCCGGGGCGCGCTCACGGG [underlined bases are mutated in AP-2-II (M)]; andhMTIIa, AGGAACTGACCGCCCGCGGCCCGTGTGCAGAG.

irlrr.cy

Biochemistry: Somasundaram et al.

6 400 4m dw0

Dow

nloa

ded

by g

uest

on

June

26,

202

0

3090 Biochemistry: Somasundaram et al.

(data not shown), binding of the E. coli-based AP-2 protein toAP-2-I in EMSA (Fig. 1) and substantial stimulation, intransient assays, of the minimal 400-bp type IV 72-kDapromoter by the AP-2-I element when cloned upstream of theminimal promoter (ref. 18; see below)-suggest that the72-kDa promoter/enhancer contains a functional AP-2 site.Currently we do not know whether the AP-2 site locateddownstream of the cap site at +250 can also function in thetranscriptional regulation of the type IV collagenase pro-moter. In transient assays, CAT activity did not increase whenthe CAT coding sequences were cloned downstream of thesecond AP-2 site (K.S. and B.T., unpublished results).Adenovirus E1A Protein Represses Transcription of the

Type IV Collagenase Promoter by Targeting the AP-2 SiteLocated at -1685. To determine whether the AP-2 site locatedat 1685 is the target of E1A in vivo, this AP-2 site was clonedupstream of the type IV 72-kDa collagenase basal promoterfused to CAT reporter gene (-400/AP-2-1). Previous studieshave defined these 400-bp sequences as the minimal promoterof the type IV 72-kDa collagenase gene containing all ele-ments for basal activity (18). Plasmid -400/AP-2-I was thentested for repression by E1A in transient assays using thehuman fibrosarcoma cell line HT1080. E1A repressed thispromoter construct as efficiently as the WT promoter con-struct (-1900), which contains 1900 bp upstream from thestart site (Fig. 2; compare lanes 1 and 2 and lanes 6 and 7; levelsof repression for the WT and -400/AP-2 constructs were 12-and 10-fold, respectively), whereas the basal promoter withoutthe AP-2 site (-400) was not repressed by E1A (compare lanes4 and 5). In another experiment, the AP-2-I element wascloned upstream of the HSV TK promoter (pBLCAT2/AP-2-I) and this plasmid was tested for repression by E1A. CATexpression from this construct was also repressed by E1A byabout 10-fold (compare lanes 8 and 9). E1A did not affect theexpression of the TK promoter alone in the absence of AP-2-1(pBLCAT; lanes 10 and 11). These studies suggest that theAP-2 site at -1685 is a target of E1A in vivo.The N-Terminal Region of E1A Protein Binds to AP-2 In

Vitro. One mechanism by which the E1A protein may repressthe AP-2-mediated activation of promoters is by binding to

IaL04

0 0 0 0 00-4 0 0 05 0

I + I +

2 3 4 5 6

4diAlt

e Io

AP-2 and interfering in its functions. To test this possibility, weused GST-affinity chromatography to determine whether E1Ainteracts with AP-2. Radiolabeled AP-2 protein was synthe-sized in vitro using rabbit reticulocyte lysates and incubatedwith GST-E1A fusion protein synthesized in E. coli immobi-lized on GST beads and washed to remove the unboundmaterial. The bound material was then eluted with SDS samplebuffer and analyzed on SDS/PAGE. As shown in Fig. 3A,significant amounts of AP-2 bound to WT E1A. No bindingoccurred when a mutant of E1A in which aa 2-36 were deletedwas used (Fig. 3A, lanes 3 and 4, respectively). Lanes 6-8represent a positive control experiment in which a variant ofRB, in which aa 1-378 had been deleted, was used. This mutantretains the ElA-binding region (a gift of P. Raychaudhari,University of Illinois). Lanes 9-14 show results of anotherexperiment in which two additional E1A mutants were testedfor binding to AP-2. A mutant in which aa 38-67 were deletedand a double-point mutant, E1A 928/961, in which Cys at 124and Glu at 135 were changed to Gly and Lys, respectively (3,4), bound to AP-2 as efficiently as WT E1A. Thus, we concludethat E1A can bind to AP-2 and that the N-terminal amino acidsare required for this interaction. Because E1A binds to p300,and because AP-2 was synthesized in rabbit reticulocyte lysatesin vitro, it seemed possible that E1A and AP-2 were heldtogether by p300 present in reticulocyte lysates. Therefore,these experiments were repeated using AP-2 synthesized inwheat germ extracts. Significant amounts of WT E1A proteinand a deletion derivative, d138-67, bound to AP-2 synthesizedin wheat germ extracts, whereas E1A d12-36 did not (Fig. 3B,lanes 17-19). Lanes 21-24 show the results of a positive controlexperiment in which a mutant of RB in which the N-terminal378-aa sequences were deleted was used as the ElA-bindingprotein. These results suggest the p300 may not be involved inthe AP2-E1A interaction. However, we can not rule out thepossibility that a plant protein with properties similar to thatof p300 from wheat germ extracts may bridge the AP-2 andE1A protein in vitro.E1A Protein Binds to the DNA Binding/Dimerization Do-

main of AP-2. The DNA binding and dimerization domains ofAP-2 overlap in a long stretch of about 230 aa in the C-terminal

C0

o<04O-I +7

I-

-JQ.

8

04

I-

4J<

9

4

J1010

04<--) W~ +

It

0.Q0

FIG. 2. The AP-2 motif located in the enhancer of the type IV 72-kDa collagenase promoter is a target of E1A. -1900, WT promoter; -400,basal promoter; -400/AP-2-1, a single copy of the AP-2 site taken from -1685 was cloned upstream of the basal promoter; pBLCAT2, HSV TKpromoter fused to the CAT reporter gene. pBLCAT2/AP-2-I, a single copy of -1685 AP-2 site cloned upstream ofTK CAT. HT1080 cells in 60-mmdishes were cotransfected with various promoter-reporter constructs in the presence or absence of an E1A plasmid using the calcium phosphateprecipitation technique. The ratio of reporter to activator plasmid was maintained at 1:3, with 2 jug of the reporter plasmid and 6 A/g of the E1Aplasmid; DNA concentration was maintained at 10 jig per dish with salmon sperm DNA. Transfection efficiency was determined by including 0.1jug of a cytomegalovirus-luciferase reporter plasmid; <2-fold variation of transfection efficiency was observed between samples. After 48 h oftransfection, cells were lysed and CAT activity was assayed using protein quantities normalized to transfection efficiency. CAT activity was

quantitated by using a Fuji Bioimage analyzer. Data from a representative experiment are shown. The fold repression of the WT, -400/AP-2, andpBLCAT/AP-2-1 promoter constructs by E1A ranged between 10- and 14-fold in different experiments.

Proc. Natl. Acad. Sci. USA 93 (1996)

Dow

nloa

ded

by g

uest

on

June

26,

202

0

Proc. Natl. Acad. Sci. USA 93 (1996)

AP-2 RB

CJ

(0

4

cn(C5

w

(66

(0K)CM

w

C7

7

AP-2

CM

99

cn(98

w

C)

10

(0

I)

I-

:5

w

C'1(c

12

(D

a)4w

Q(

13

B

N

0.

15

15

cn<01414

AP-2 RB

mx:1-

16

w

c917

(0r0

w

-

cn

18

I"-

0

w

CD19

2(20

w

Cl(921

(0i)

(c22

FIG. 3. The N-terminal region of the E1A protein binds to AP-2 in vitro. WT or mutant derivatives of E1A protein were expressed in E. colias GST-fusion proteins and mixed with in vitro-translated [35S]methionine-labeled AP-2 or RB protein (positive control), precipitated withGST-agarose beads, and analyzed on SDS/12% PAGE. In lanes 1, 2, 9, 15, and 16, 1/10th of the in vitro (IVT)-labeled proteins used for bindingassays were loaded directly. The positive-control RB contains a deletion of 378 aa from the 5' end. (A) Binding assays were performed using AP-2or RB protein synthesized in rabbit reticulocyte lysates in vitro. (B) Binding assays were performed using AP-2 or RB protein synthesized in wheatgerm extracts in vitro. Data shown in lanes 1-8, 9-14, and 15-24 were obtained in three separate experiments.

region. AP-2 has an extended DNA binding domain, rich inbasic residues, which maps to the N-terminal region, and adimerization.domain, which maps to the C-terminal region.The DNA binding of AP-2 is mediated by the basic region inassociation with the adjacent dimerization domain (22-24). Todetermine which region of AP-2 binds to E1A, a series ofmutants in which AP-2 coding sequences were deleted eitherat the 5' or at the 3' end were transcribed and translated in vitroand their capacity to bind to E1A was determined as before.As shown in Fig. 4, N-terminal deletion mutants of AP-2 with

deletions extending up to aa 227 bound to E1A efficiently(lanes 13-18), whereas two mutants with deletions extendingup to aa 264 and 278 from the N-terminal end did not bind toE1A (lanes 19 and 20). Two deletion mutants, in whichdeletions extending up to aa 413 and 390 from the C-terminalend, also bound to AP-2 efficiently (lanes 21 and 22). Lanes28-30 of Fig. 4B show the results of an experiment in whichmutants dlN227, dlN264, and dlN278 were tested again withtwice the concentrations of radiolabeled AP-2 used in Fig. 4A;the results were identical to those obtained in lanes 18-20.

IVT

)o 9- a

z z z z zx :65 s :6 0 =6

BBOUND

rCMCMi

zZ5

q.

z:5

aO0

z:0

n 0Y1t)

: :

1 2 3 4 5 6 7 8 9 10 11

0 (

39 5

z z z zXZs<5a5

ql(z

Z

0

zq o))r io

; ;..12 13 14 15 16 17 18 19 20 21 22

IVT BOUND

c,- < co ,- rco

CM <0 f- CM (0 I -NJ CM C C CCNN

- Z Z Z Z Z Z

23 24 25 26 27 28 29 30

iw

FIG. 4. Mapping of the E1A binding domain on AP-2. [35S]Methionine-labeled WT or deletion mutants of AP-2 with deletions at the 5' or

3' end were synthesized in vitro using rabbit reticulocyte lysates, mixed with GST-E1A fusion protein, and the E1A-AP-2 complexes were

precipitated, washed, and analyzed on SDS/12% PAGE. In lanes 1-11 and 23-26, 1/10th of the radiolabeled AP-2 protein used for binding assayswas loaded directly. Lanes 23-30 show the results of an ElA-binding experiment in which twice the amount of radiolabeled AP-2 protein was usedin the binding assays shown in lanes 1-22. Results shown in lanes 1-22 and 23-30 were obtained in two separate experiments.

A

CM

l- >

2

w

C3

3

I(0

23 24

(9(

A

Biochemistry: Somasundaram et al. 3091

.40Oa40

Dow

nloa

ded

by g

uest

on

June

26,

202

0

3092 Biochemistry: Somasundaram et al.

These results suggest that E1A binds to a region of AP-2between aa 227 and 390. The DNA binding/dimerizationdomain of AP-2 has been mapped to this region (22-24). Thus,we conclude that E1A targets the DNA binding and dimer-ization motifs of AP-2.E1A Mutants that Cannot Bind to p300 Can Repress the

Type IV 72-kDa Collagenase Promoter Efficiently in Vivo. Todetermine whether repression of type IV 72-kDa collagenasepromoter by E1A is related to its ability to bind to p300, theE1A mutant RG2, in which the conserved Arg residue at thesecond position was mutated to Gly, and three deletionmutants in which aa 2-36, 38-67, and 70-120, respectively,were deleted (3, 4), were tested for their capacity to represstype IV 72-kDa collagenase promoter in cotransfection assaysin HT1080 cells as described above. As shown in Fig. 5, mutantsd138-67, d170-120, and RG2 repressed the promoter as effi-ciently as the WT E1A with repression ranging from 9- to11-fold, whereas no detectable repression was observed ford12-36. Of these, mutants RG2 and d138-67 do not bind to p300,as evidenced by coimmunoprecipitation experiments in virusinfection studies (4). Because RG2 and d138-67 cannot bind top300 but can repress the type IV 72-kDa collagenase promoteras efficiently as WT E1A, we conclude that E1A protein canrepress the type IV 72-kDa collagenase gene without inter-acting with p300. Because E1A targets AP-2 in vivo and canbind to AP-2 in vitro, it is reasonable to conclude that E1A canrepress 72-kDa collagenase promoter by forming a complexwith AP-2. This is further supported by the results of E1Ad138-67, which can bind to AP-2 and repress the 72-kDacollagenase promoter as efficiently as the WT E1A but isunable to bind to p300 (ref. 4; Figs. 3A and 5).

DISCUSSION

Matrix-degrading metalloproteases play a very important rolein a variety of cellular processes, including tumor metastasis,angiogenesis, cell differentiation, and morphogenesis (15-17).Our interest in the negative regulation of type IV 72-kDacollagenase promoter arose from a previous observation thatE1A protein can suppress metastasis of ras-transformed REFsor human tumor cells in nude mice and that it correlates with

00

0'8<n

r- 0(0 (0Iro

( 0 ONN< ro r8- C

lT+ T+ T+T o o+_ + T l i + 7 + T +2 3 5 6 7

@@-

p300BINDING + -

FIG. 5. Repression of the type IV 72-kDa collagenase promoter/enhancer by various E1A mutants with deletion mutations at theN-terminal end. HT1080 cells were transfected with the full-lengthtype IV 72-kDa collagenase promoter-CAT construct (-1900 plas-mid) with or without WT or mutant ElA-expression plasmids; after 48h, cells were lysed and CAT activity was quantitated. The propertiesof E1A mutants with respect to their ability to bind to p300 are

indicated below the lanes. Details of transfection assay were as

described in the legend to Fig. 2. Lane 4 contained WT control dataas in lane 1, deleted.

the negative regulation of transcription of several matrix-degrading metalloproteases, including type IV 72-kDa colla-genase (10-13). We were also struck by the observation thatthe matrix-degrading metalloproteases type I collagenase andstromelysin and the type IV 92-kDa collagenase, but not thetype IV 72-kDa collagenase, are inducible by phorbol ester andthat the promoters of all three 12-O-tetradecanoylphorbol13-acetate (TPA)-inducible metalloproteases contain theTPA-responsive element (TRE; refs. 26-28). The AP-1 site isan important component of TRE and it is conceivable thatAP-1 may be one of the cellular transcription factors whichrecruit p300 for transcriptional activation. The transcriptionalcontrol region of type IV 72-kDa collagenase gene lacks TREand it is not induced by TPA. This observation combined witha previous report that SV40 large-T binds to AP-2 in vitro andinhibits transcription (29) prompted us to examine the possi-bility of an interaction of E1A with AP-2 as a mechanism forthe repression of type IV 72-kDa collagenase gene by E1A.Our results suggest that E1A can repress the enhancer of the

type IV collagenase gene and possibly other enhancers whichcontain the AP-2 element by E1A binding to AP-2. The DNAbinding and dimerization domains of AP-2 overlap in a longstretch of about 230 aa in the C-terminal region and containa helix-span-helix motif that has some similarities to thehelix-loop-helix motif (23). Our mutational analysis of AP-2suggests that E1A binds to the DNA binding/dimerizationregion of AP-2. Several lines of evidence suggest that E1Abinding to AP-2 contributes to the repression of the type IV72-kDa collagenase promoter. (i) Plasmid constructs in whichthe AP-2 site from the enhancer was cloned upstream of the400-bp minimal type IV 72-kDa collagenase promoter or theTK promoter are repressed by E1A in transient assays, sug-gesting that AP-2 is a target of E1A in the ElA-mediatedrepression (Fig. 2). (ii) E1A binds specifically to the DNAbinding/dimerization domain of AP-2 in vitro (Figs. 3 and 4).(iii) E1A mutants d138-67 and RG2, which do not bind to p300,can still repress the type IV 72-kDa collagenase promoter asefficiently as the WT E1A protein (Fig. 5).

Currently, we do not know the mechanisms by which E1Amediates repression of AP-2 site-containing promoters. Onemechanism by which the E1A protein may repress the AP-2mediated activation of promoters is by interfering in the DNAbinding or dimerization activities of AP-2. A phenomenonsomewhat similar to this has been reported with Jun in twoother systems. c-Jun interferes with the process of myogenicdifferentiation by physically interacting with MyoD and bycompetitively inhibiting the MyoD El2 heterodimer formation(30). Reciprocally, MyoD also inhibits transactivation by Junof genes linked to an AP-1 site. In another case, Jun andglucocorticoid receptors were shown to repress each others'transcriptional activation function by protein-protein interac-tion (31). This mechanism is independent of the DNA bindingproperty of these two transcription factors. Our preliminaryattempts to coimmunoprecipitate AP-2 with anti E1A anti-body or to determine whether E1A interferes in the formationof AP-2-DNA complex in EMSA have not been successful.Antibody-based detection of protein-protein interaction be-tween E1A and cellular transcription factors has provendifficult. Further experiments are necessary to determine themechanism by which ElA-mediated repression of AP-2-containing promoters occurs.

In addition to the enhancer of the type IV 72-kDa collage-nase gene, functional AP-2 sites are present in enhancers ofSV40, HTLV-1, hMTIIA, and the regulatory regions of severalcellular genes, including murine major histocompatibility com-plex H-2Kb, human growth hormone, proenkephalin, andkeratin K14 (refs. 22, 23, and 32-36 and references citedtherein). AP-2 also plays an important role in the differenti-ation of human teratocarcinoma cell line NT2 in response tocell differentiation signals induced by retinoic acid (35). Be-

Proc. Natl. Acad. Sci. USA 93 (1996)D

ownl

oade

d by

gue

st o

n Ju

ne 2

6, 2

020

Biochemistry: Somasundaram et al.

cause many cellular genes are controlled by AP-2, it is con-

ceivable that an interaction of AP-2 with E1A may be one

mechanism by which E1A may repress a variety of cellulargenes. Recently, Taylor et al. have shown that E1A can alsobind to MyoD, a helix-loop-helix protein, in vitro, and that thisbinding may contribute to the ElA-mediated repression ofmuscle cell differentiation (20). It remains to be determinedwhether the binding of the N-terminal region of E1A isrestricted to AP-2 and MyoD or whether it can interact withother sequence-specific transcription factors.Our results and other published reports (3-5, 37, 39, 40)

suggest that the N-terminal region of the E1A protein encodesmultiple functions which may utilize different but overlappingamino acid sequences. The N-terminal region and the con-

served region I of E1A interact with p300; this interaction isresponsible, at least in part, for the stimulation of DNAsynthesis, cell proliferation, transformation, and repression ofcertain cellular genes by E1A (3-5, 37). The p300 bindingregion and the AP-2 binding regions in E1A overlap becausethe E1A mutant d12-36 does not bind to p300 or AP-2.However, these two domains are not identical because E1Amutants d138-67 and RG2, which cannot bind to p300, can

repress the type IV collagenase promoter efficiently. Studieshave shown that the RG2 mutant cannot repress humanimmunodeficiency virus long terminal repeat (HIV LTR) (4),whereas our results suggest that it can repress type IV 72-kDacollagenase promoter, suggesting that the amino acid residuesof E1A protein required for the repression of these two genesare different. Thus, it seems possible that the mechanism bywhich the HIV LTR and type IV collagenase gene are

repressed by E1A may be different. There is also evidence tosuggest that the N-terminal region of the E1A protein containsa transcriptional activation domain which has a capacity toactivate test genes directly (ref. 38; G.J. and B.T., unpublishedresults). Thus, the N-terminal region of E1A protein may bemore complex than previously thought and may interact withseveral host proteins and use multiple mechanisms in theinduction of metabolic perturbations in the host cell.

We especially thank Drs. W. Kraus, P. Kannan, M. Tainsky, and R.Gaynor for contributing various plasmids used in this study. We alsothank the members of the Thimmapaya laboratory for the helpfuldiscussions and comments on the manuscript. This work was supportedby grants from the National Institutes of Health to B.T. (AI18029 andAI 20156), T.W. (GM46770), and E.M. (CA55330) and by a PewScholar Award to T.W.

1. Bayely, S. T. & Mymryk, J. S. (1994) Int. J. Oncol. 5, 425-444.2. Dyson, N. & Harlow, E. (1992) Cancer Surv. 12, 161-194.3. Stein, R. L., Corrigan, M., Yaciuk, P., Whelan, J. & Moran, E.

(1990) J. Virol. 64, 4421-4427.4. Wang, H.-G., Rikitake, Y., Carter, M. C., Yaciuk, P., Abraham,

S. E., Zerler, B. & Moran, E. (1993) J. Virol. 67, 476-488.5. Jelsma, T. N., Howe, J. A., Mymryk, J. S., Evelegh, C. M., Cun-

niff, N. F. A. & Bayley, S. T. (1989) Virology 171, 120-130.6. Eckner, R., Ewen, M. E., Newsome, D., Gerdes, M., DeCaprio,

J. A., Lawrence, B. & Livingston, D. M. (1994) Genes Dev. 8,869-884.

7.

8.

9.

10.

11.

12.

13.

14.

15.

16.

17.

18.

19.

20.

21.

22.

23.24.25.

26.

27.28.29.30.

31.

32.

33.34.

35.

36.

37.

38.

39.

40.

Proc. Natl. Acad. Sci. USA 93 (1996) 3093

Arnay, Z., Newsome, D., Oldread, E., Livingston, D. M. &Eckner, R. (1995) Nature (London) 374, 81-84.Lundblad, J. R., Kwok, R. P. S., Laurance, M. E., Harter, M. L.& Goodman, R. H. (1995) Nature (London) 374, 85-88.Abraham, S. E., Lobo, S., Yaciuk, P., Wang, H.-G. H. & Moran,E. (1993) Oncogene 8, 1639-1647.Pozzatti, R., Muschel, R., Williams, J., Padmanabhan, R.,Howard, B., Liotta, L. & Khoury, G. (1986) Science 232,223-227.Pozzatti, R., McMormick, M., Thompson, M. A. & Khoury, G.(1988) Mol. Cell. Biol. 8, 2984-2988.Frisch, S. M., Reich, R., Collier, E. E., Genrich, L. T., Martin, G.& Goldberg, G. I. (1990) Oncogene 5, 75-83.Garbisa, S., Pozzatti, R. & Muschel, J. (1987) Cancer Res. 47,1523-1528.Sreenath, T., Matrisian, L. M., Stetler-Stevenson, W., Gattoni-Celli, S. & Pozzatti, R. 0. (1992) Cancer Res. 52, 4942-4947.Liotta, L., Steeg, P. S. & Stetler-Stevenson, W. G. (1991) Cell 64,327-336.Stetler-Stevenson, W. G., Aznavoorian, S. & Liotta, L. A. (1993)Annu. Rev. Cell Biol. 9, 541-573.Matrisian, L. M. & Hogan, B. L. M. (1990) Curr. Top. Dev. Biol.24, 219-259.Frisch, S. M. & Morisaki, J. H. (1990) Mol. Cell. Biol. 10,6524-6532.Kannan, P., Buettner, R., Chiao, P. J., Yim, S. O., Sarkiss, M. &Tainsky, M. A. (1994) Genes Dev. 8, 1258-1269.Taylor, D. A., Kraus, V. B., Schwarz, J. J., Olson, E. N. & Kraus,W. E. (1993) Mol. Cell. Biol. 13, 4714-4727.Muchardt, C., Seeler, J. S. & Gaynor, R. B. (1992) EMBO J. 7,2573-2581.Williams, T., Admon, A., Luscher, B. & Tjian, R. (1988) GenesDev. 2, 1557-1569.Williams, T. & Tjian, R. (1991) Genes Dev. 5, 670-682.Williams, T. & Tjian, R. (1991) Science 251, 1067-1071.Huhtala, P., Chow, L. T. & Tryggvasion, K. (1990) J. Biol. Chem.259, 9783-9789.Offringa, R., Gebel, S., van Dam, H., Timmers, M., Smits, A.,Zwart, R., Stein, B., Bos, J. L., van der Eb, A. & Herrlich, P.(1990) Cell 62, 527-538.Gutman, A. & Wasylyk, B. (1990) EMBO J. 9, 2241-2246.Sato, H. & Seiki, M. (1993) Oncogene 8, 395-405.Mitchell, P. J., Wang, C. & Tjian, R. (1987) Cell 50, 847-861.Bengal, E., Ransone, L., Scharfmann, R., Dwarki, V. J., Tapscott,S. J., Weintraub, H. & Verma, I. M. (1992) Cell 68, 507-519.Schule, R., Rangarajan, P., Kliewer, S., Ransone, L. J., Bolado,J., Yang, Na, Verma, I. & Evans, R. M. (1990) Cell 62,1217-1226.Lee, W. A., Haslinger, A., Karin, M. & Tjian, R. (1987) Nature(London) 325, 368-372.Imigawa, M., Chiu, R. & Karin, M. (1987) Cell 51, 251-260.Leask, A., Byrne, C. & Fuchs, E. (1991) Proc. Natl. Acad. Sci.USA 88, 7948-7952.Luscher, B., Mitchell, P. J., Williams, T. & Tjian, R. (1989) GenesDev. 3, 1507-1517.Hyman, S. E., Comb, M., Pearlberg, J. & Goodman, H. M. (1989)Mol. Cell. Biol. 9, 321-324.Subramanian, T., Kuppaswamy, M., Nasrer, R. J. & Chinnadurai,G. (1988) Oncogene 2, 105-112.Bondesson, M., Mannervik, M., Akusjarvi, G. & Svensson, C.(1994) Nucleic Acids Res. 22, 3053-3060.Kraus, V. B., Inostroza, J. A., Yeung, K., Reinberg, D. & Nevins,J. R. (1994) Proc. Natl. Acad. Sci. USA 91, 6279-6282.Song, C.-Z., Loewenstein, P. M., Toth, K. & Green, M. (1995)Proc. Natl. Acad. Sci. USA 92, 10330-10333.

Dow

nloa

ded

by g

uest

on

June

26,

202

0