real time pcr fam tamra production at fiocruz in gmp condition of enzymes, primers and probes, mater...

22

Upload: leslie-williams

Post on 18-Dec-2015

215 views

Category:

Documents


1 download

TRANSCRIPT

Page 1: Real Time PCR FAM TAMRA Production at FIOCRUZ in GMP condition of Enzymes, Primers and Probes, Mater mix in ready to use format
Page 2: Real Time PCR FAM TAMRA Production at FIOCRUZ in GMP condition of Enzymes, Primers and Probes, Mater mix in ready to use format

Real Time PCR

FAM TAMRA

Production at FIOCRUZ in GMP condition of Enzymes, Primers and Probes, Mater mix in ready to use format.

Page 3: Real Time PCR FAM TAMRA Production at FIOCRUZ in GMP condition of Enzymes, Primers and Probes, Mater mix in ready to use format

Detection SequenceDetection Sequence5’ 5’ AGTATTCATCCACAATTTTAGTATTCATCCACAATTTTAAAAAGAAAAGGGGGGATAAAGAAAAGGGGGGATTGGGGGGTTGGGGGGTACAGTGCAGGGGAAAGAATACAGTGCAGGGGAAAGAAT 3’ 3’

Calibration Sequence Calibration Sequence 5’ 5’ AGTATTCATCCACAATTTTAGTATTCATCCACAATTTTAAAAAGAAAGGGGGAAAAGGGGAAAAGGATGGATTGGGGGGTTGGGGGGTACAGTGCAGGGGAAAGAAT ACAGTGCAGGGGAAAGAAT 3’3’

FAM

VIC

Calibration SystemCalibration System

HIV

VCAHCV

FAM

FAM

VIC

PET ou TAMRA

Page 4: Real Time PCR FAM TAMRA Production at FIOCRUZ in GMP condition of Enzymes, Primers and Probes, Mater mix in ready to use format

ResultsResults

Calibrator Standart curve

FIOCRUZ - PATENTFIOCRUZ - PATENT

Page 5: Real Time PCR FAM TAMRA Production at FIOCRUZ in GMP condition of Enzymes, Primers and Probes, Mater mix in ready to use format

FIOCRUZ NAT Platform FIOCRUZ NAT Platform Bio-Manguinhos/IBMPBio-Manguinhos/IBMP

•Extraction •PCR Setup •Detection

•HTP

•LTP

Page 6: Real Time PCR FAM TAMRA Production at FIOCRUZ in GMP condition of Enzymes, Primers and Probes, Mater mix in ready to use format

Liquid Microarrays for Diagnosis

Page 7: Real Time PCR FAM TAMRA Production at FIOCRUZ in GMP condition of Enzymes, Primers and Probes, Mater mix in ready to use format

Liquid Microarrays

Page 8: Real Time PCR FAM TAMRA Production at FIOCRUZ in GMP condition of Enzymes, Primers and Probes, Mater mix in ready to use format

Liquid Microarrays

Page 9: Real Time PCR FAM TAMRA Production at FIOCRUZ in GMP condition of Enzymes, Primers and Probes, Mater mix in ready to use format

Green laserReporterFluorescence

Red laserBeadFluorescence

Liquid Microarrays

Page 10: Real Time PCR FAM TAMRA Production at FIOCRUZ in GMP condition of Enzymes, Primers and Probes, Mater mix in ready to use format

Pilot project multi-test

Page 11: Real Time PCR FAM TAMRA Production at FIOCRUZ in GMP condition of Enzymes, Primers and Probes, Mater mix in ready to use format
Page 12: Real Time PCR FAM TAMRA Production at FIOCRUZ in GMP condition of Enzymes, Primers and Probes, Mater mix in ready to use format
Page 13: Real Time PCR FAM TAMRA Production at FIOCRUZ in GMP condition of Enzymes, Primers and Probes, Mater mix in ready to use format
Page 14: Real Time PCR FAM TAMRA Production at FIOCRUZ in GMP condition of Enzymes, Primers and Probes, Mater mix in ready to use format
Page 15: Real Time PCR FAM TAMRA Production at FIOCRUZ in GMP condition of Enzymes, Primers and Probes, Mater mix in ready to use format
Page 16: Real Time PCR FAM TAMRA Production at FIOCRUZ in GMP condition of Enzymes, Primers and Probes, Mater mix in ready to use format

Different Trypanosoma cruzi antigen preparations

Page 17: Real Time PCR FAM TAMRA Production at FIOCRUZ in GMP condition of Enzymes, Primers and Probes, Mater mix in ready to use format

Trypanosoma cruzi ORFeome

• 23,083 “genes” (GenBank, Jul 2009)

• Highly redundant, estimated to be ~12,000 distinct gene loci

• Few gene families account for a large proportion of genes (6 families, 4967

“genes”, 21% of gene content)

• The repetitive nature of the genome makes assembly difficult. As a

consequence, the ORF definition is worse than for other organisms.

• Related organisms, as Leishmania sp. and T. brucei, have about 8,000 genes,

which is a good estimation for the lower limit of T. cruzi genes.

Page 18: Real Time PCR FAM TAMRA Production at FIOCRUZ in GMP condition of Enzymes, Primers and Probes, Mater mix in ready to use format

Trypanosoma cruzi ORFeome Institute Carlos Chagas/FIOCRUZ

Organism Genome (ORFs)

Suitable Vector(Gateway)

ORFeome(all ORFs in a suitable vector)

ORFeome (Wikipedia)Orfeome is the totality of open reading frames(ORF) from one organism. ORFs are the most important genetic elements in genomes as they code for proteins

Page 19: Real Time PCR FAM TAMRA Production at FIOCRUZ in GMP condition of Enzymes, Primers and Probes, Mater mix in ready to use format

1st step. PCR amplification2 PCRs per gene, US$3/gene

2nd step. PCR purificationMagnetic, US$1/gene

4th step. Bacterial transformation,Colony picking and Culture

Agar plates, 4 clones/gene, US$0.25/gene

3rd step. Gateway entryBP reaction, US$5/gene

Pre-processing

• Intense bioinformatics analysis, using all ORFs from Kinetoplastida genome projects, to better define the region to be amplified.

• Primers are 30mer in average, i.e., US$6/gene

5th step. Plasmid purificationMagnetic, US$1/gene

6th step. Plasmid verificationPCR, US$ 0,1/gene

Trypanosoma cruzi ORFeome Institute Carlos Chagas/FIOCRUZ

Page 20: Real Time PCR FAM TAMRA Production at FIOCRUZ in GMP condition of Enzymes, Primers and Probes, Mater mix in ready to use format

Trypanosoma cruzi ORFeome ICC/FIOCRUZ

• 3,840 primer pairs designed and ordered.

• 1,920 genes amplified (~85% of them were positive).

• ~7,500 clones collected and certified by PCR.

Current state (v. 0.2)

40%

20%

20%

Completeness

• 7,680 primer pairs designed and ordered.

• Amplification of all analyzed genes.

• All clones (~30,000) collected and certified by PCR.

• All clones sequenced and certified ORFeome produced.

Future prospects (6 months, v. 1.0)

• Information from other T. cruzi strain will be added and used for covering more

ORFs that were excluded or not present in CL Brener.

Future prospects (12-18 months, v. 2.0)

Page 21: Real Time PCR FAM TAMRA Production at FIOCRUZ in GMP condition of Enzymes, Primers and Probes, Mater mix in ready to use format

Trypanosoma cruzi ORFeome

Organism Genome (ORFs)

Suitable Vector(Gateway)

ORFeome(all ORFs in a suitable vector)

InteractomeLocalizome

HT protein expression Ag-Ab screening

Downstream Applications(among many others)

Page 22: Real Time PCR FAM TAMRA Production at FIOCRUZ in GMP condition of Enzymes, Primers and Probes, Mater mix in ready to use format

Antonio G.P.Ferreira Bio-Manguinhos-FiocruzBruna P.F.Fonseca, Bio-Manguinhos-FiocruzEdimilson D.Silva, Bio-Manguinhos-FiocruzChristiane F.S.Marques Bio-Manguinhos –FiocruzAlexandre Costa IBMPViviane Goes IBMPCristiane Reinarch IBMP Cesar A.B. Duarte, ICC-FiocruzLeonardo Foti ICC-FiocruzChristian M.Probst ICC-FiocruzDaniela Parada Pavoni ICC-FiocruzSamuel Goldenberg, ICC-Fiocruz/IBMP

Marco Aurelio KriegerICC-Fiocruz/IBMP [email protected]