![Page 1: Real Time PCR FAM TAMRA Production at FIOCRUZ in GMP condition of Enzymes, Primers and Probes, Mater mix in ready to use format](https://reader030.vdocuments.us/reader030/viewer/2022032703/56649d0c5503460f949e0da2/html5/thumbnails/1.jpg)
![Page 2: Real Time PCR FAM TAMRA Production at FIOCRUZ in GMP condition of Enzymes, Primers and Probes, Mater mix in ready to use format](https://reader030.vdocuments.us/reader030/viewer/2022032703/56649d0c5503460f949e0da2/html5/thumbnails/2.jpg)
Real Time PCR
FAM TAMRA
Production at FIOCRUZ in GMP condition of Enzymes, Primers and Probes, Mater mix in ready to use format.
![Page 3: Real Time PCR FAM TAMRA Production at FIOCRUZ in GMP condition of Enzymes, Primers and Probes, Mater mix in ready to use format](https://reader030.vdocuments.us/reader030/viewer/2022032703/56649d0c5503460f949e0da2/html5/thumbnails/3.jpg)
Detection SequenceDetection Sequence5’ 5’ AGTATTCATCCACAATTTTAGTATTCATCCACAATTTTAAAAAGAAAAGGGGGGATAAAGAAAAGGGGGGATTGGGGGGTTGGGGGGTACAGTGCAGGGGAAAGAATACAGTGCAGGGGAAAGAAT 3’ 3’
Calibration Sequence Calibration Sequence 5’ 5’ AGTATTCATCCACAATTTTAGTATTCATCCACAATTTTAAAAAGAAAGGGGGAAAAGGGGAAAAGGATGGATTGGGGGGTTGGGGGGTACAGTGCAGGGGAAAGAAT ACAGTGCAGGGGAAAGAAT 3’3’
FAM
VIC
Calibration SystemCalibration System
HIV
VCAHCV
FAM
FAM
VIC
PET ou TAMRA
![Page 4: Real Time PCR FAM TAMRA Production at FIOCRUZ in GMP condition of Enzymes, Primers and Probes, Mater mix in ready to use format](https://reader030.vdocuments.us/reader030/viewer/2022032703/56649d0c5503460f949e0da2/html5/thumbnails/4.jpg)
ResultsResults
Calibrator Standart curve
FIOCRUZ - PATENTFIOCRUZ - PATENT
![Page 5: Real Time PCR FAM TAMRA Production at FIOCRUZ in GMP condition of Enzymes, Primers and Probes, Mater mix in ready to use format](https://reader030.vdocuments.us/reader030/viewer/2022032703/56649d0c5503460f949e0da2/html5/thumbnails/5.jpg)
FIOCRUZ NAT Platform FIOCRUZ NAT Platform Bio-Manguinhos/IBMPBio-Manguinhos/IBMP
•Extraction •PCR Setup •Detection
•HTP
•LTP
![Page 6: Real Time PCR FAM TAMRA Production at FIOCRUZ in GMP condition of Enzymes, Primers and Probes, Mater mix in ready to use format](https://reader030.vdocuments.us/reader030/viewer/2022032703/56649d0c5503460f949e0da2/html5/thumbnails/6.jpg)
Liquid Microarrays for Diagnosis
![Page 7: Real Time PCR FAM TAMRA Production at FIOCRUZ in GMP condition of Enzymes, Primers and Probes, Mater mix in ready to use format](https://reader030.vdocuments.us/reader030/viewer/2022032703/56649d0c5503460f949e0da2/html5/thumbnails/7.jpg)
Liquid Microarrays
![Page 8: Real Time PCR FAM TAMRA Production at FIOCRUZ in GMP condition of Enzymes, Primers and Probes, Mater mix in ready to use format](https://reader030.vdocuments.us/reader030/viewer/2022032703/56649d0c5503460f949e0da2/html5/thumbnails/8.jpg)
Liquid Microarrays
![Page 9: Real Time PCR FAM TAMRA Production at FIOCRUZ in GMP condition of Enzymes, Primers and Probes, Mater mix in ready to use format](https://reader030.vdocuments.us/reader030/viewer/2022032703/56649d0c5503460f949e0da2/html5/thumbnails/9.jpg)
Green laserReporterFluorescence
Red laserBeadFluorescence
Liquid Microarrays
![Page 10: Real Time PCR FAM TAMRA Production at FIOCRUZ in GMP condition of Enzymes, Primers and Probes, Mater mix in ready to use format](https://reader030.vdocuments.us/reader030/viewer/2022032703/56649d0c5503460f949e0da2/html5/thumbnails/10.jpg)
Pilot project multi-test
![Page 11: Real Time PCR FAM TAMRA Production at FIOCRUZ in GMP condition of Enzymes, Primers and Probes, Mater mix in ready to use format](https://reader030.vdocuments.us/reader030/viewer/2022032703/56649d0c5503460f949e0da2/html5/thumbnails/11.jpg)
![Page 12: Real Time PCR FAM TAMRA Production at FIOCRUZ in GMP condition of Enzymes, Primers and Probes, Mater mix in ready to use format](https://reader030.vdocuments.us/reader030/viewer/2022032703/56649d0c5503460f949e0da2/html5/thumbnails/12.jpg)
![Page 13: Real Time PCR FAM TAMRA Production at FIOCRUZ in GMP condition of Enzymes, Primers and Probes, Mater mix in ready to use format](https://reader030.vdocuments.us/reader030/viewer/2022032703/56649d0c5503460f949e0da2/html5/thumbnails/13.jpg)
![Page 14: Real Time PCR FAM TAMRA Production at FIOCRUZ in GMP condition of Enzymes, Primers and Probes, Mater mix in ready to use format](https://reader030.vdocuments.us/reader030/viewer/2022032703/56649d0c5503460f949e0da2/html5/thumbnails/14.jpg)
![Page 15: Real Time PCR FAM TAMRA Production at FIOCRUZ in GMP condition of Enzymes, Primers and Probes, Mater mix in ready to use format](https://reader030.vdocuments.us/reader030/viewer/2022032703/56649d0c5503460f949e0da2/html5/thumbnails/15.jpg)
![Page 16: Real Time PCR FAM TAMRA Production at FIOCRUZ in GMP condition of Enzymes, Primers and Probes, Mater mix in ready to use format](https://reader030.vdocuments.us/reader030/viewer/2022032703/56649d0c5503460f949e0da2/html5/thumbnails/16.jpg)
Different Trypanosoma cruzi antigen preparations
![Page 17: Real Time PCR FAM TAMRA Production at FIOCRUZ in GMP condition of Enzymes, Primers and Probes, Mater mix in ready to use format](https://reader030.vdocuments.us/reader030/viewer/2022032703/56649d0c5503460f949e0da2/html5/thumbnails/17.jpg)
Trypanosoma cruzi ORFeome
• 23,083 “genes” (GenBank, Jul 2009)
• Highly redundant, estimated to be ~12,000 distinct gene loci
• Few gene families account for a large proportion of genes (6 families, 4967
“genes”, 21% of gene content)
• The repetitive nature of the genome makes assembly difficult. As a
consequence, the ORF definition is worse than for other organisms.
• Related organisms, as Leishmania sp. and T. brucei, have about 8,000 genes,
which is a good estimation for the lower limit of T. cruzi genes.
![Page 18: Real Time PCR FAM TAMRA Production at FIOCRUZ in GMP condition of Enzymes, Primers and Probes, Mater mix in ready to use format](https://reader030.vdocuments.us/reader030/viewer/2022032703/56649d0c5503460f949e0da2/html5/thumbnails/18.jpg)
Trypanosoma cruzi ORFeome Institute Carlos Chagas/FIOCRUZ
Organism Genome (ORFs)
Suitable Vector(Gateway)
ORFeome(all ORFs in a suitable vector)
ORFeome (Wikipedia)Orfeome is the totality of open reading frames(ORF) from one organism. ORFs are the most important genetic elements in genomes as they code for proteins
![Page 19: Real Time PCR FAM TAMRA Production at FIOCRUZ in GMP condition of Enzymes, Primers and Probes, Mater mix in ready to use format](https://reader030.vdocuments.us/reader030/viewer/2022032703/56649d0c5503460f949e0da2/html5/thumbnails/19.jpg)
1st step. PCR amplification2 PCRs per gene, US$3/gene
2nd step. PCR purificationMagnetic, US$1/gene
4th step. Bacterial transformation,Colony picking and Culture
Agar plates, 4 clones/gene, US$0.25/gene
3rd step. Gateway entryBP reaction, US$5/gene
Pre-processing
• Intense bioinformatics analysis, using all ORFs from Kinetoplastida genome projects, to better define the region to be amplified.
• Primers are 30mer in average, i.e., US$6/gene
5th step. Plasmid purificationMagnetic, US$1/gene
6th step. Plasmid verificationPCR, US$ 0,1/gene
Trypanosoma cruzi ORFeome Institute Carlos Chagas/FIOCRUZ
![Page 20: Real Time PCR FAM TAMRA Production at FIOCRUZ in GMP condition of Enzymes, Primers and Probes, Mater mix in ready to use format](https://reader030.vdocuments.us/reader030/viewer/2022032703/56649d0c5503460f949e0da2/html5/thumbnails/20.jpg)
Trypanosoma cruzi ORFeome ICC/FIOCRUZ
• 3,840 primer pairs designed and ordered.
• 1,920 genes amplified (~85% of them were positive).
• ~7,500 clones collected and certified by PCR.
Current state (v. 0.2)
40%
20%
20%
Completeness
• 7,680 primer pairs designed and ordered.
• Amplification of all analyzed genes.
• All clones (~30,000) collected and certified by PCR.
• All clones sequenced and certified ORFeome produced.
Future prospects (6 months, v. 1.0)
• Information from other T. cruzi strain will be added and used for covering more
ORFs that were excluded or not present in CL Brener.
Future prospects (12-18 months, v. 2.0)
![Page 21: Real Time PCR FAM TAMRA Production at FIOCRUZ in GMP condition of Enzymes, Primers and Probes, Mater mix in ready to use format](https://reader030.vdocuments.us/reader030/viewer/2022032703/56649d0c5503460f949e0da2/html5/thumbnails/21.jpg)
Trypanosoma cruzi ORFeome
Organism Genome (ORFs)
Suitable Vector(Gateway)
ORFeome(all ORFs in a suitable vector)
InteractomeLocalizome
HT protein expression Ag-Ab screening
Downstream Applications(among many others)
![Page 22: Real Time PCR FAM TAMRA Production at FIOCRUZ in GMP condition of Enzymes, Primers and Probes, Mater mix in ready to use format](https://reader030.vdocuments.us/reader030/viewer/2022032703/56649d0c5503460f949e0da2/html5/thumbnails/22.jpg)
Antonio G.P.Ferreira Bio-Manguinhos-FiocruzBruna P.F.Fonseca, Bio-Manguinhos-FiocruzEdimilson D.Silva, Bio-Manguinhos-FiocruzChristiane F.S.Marques Bio-Manguinhos –FiocruzAlexandre Costa IBMPViviane Goes IBMPCristiane Reinarch IBMP Cesar A.B. Duarte, ICC-FiocruzLeonardo Foti ICC-FiocruzChristian M.Probst ICC-FiocruzDaniela Parada Pavoni ICC-FiocruzSamuel Goldenberg, ICC-Fiocruz/IBMP
Marco Aurelio KriegerICC-Fiocruz/IBMP [email protected]