rd airan et al. nature 000 , 1-5 (2009) doi:10.1038/nature07926

RD Airan et al. Nature 000, 1-5 (2009) doi:10.1038/nature07926 In vivo optoXR modulation of neural activity.

Upload: robin-hooper

Post on 30-Dec-2015

20 views

Category:

Documents

2 download

Report

Download

Embed Size (px):

DESCRIPTION

In vivo optoXR modulation of neural activity. RD Airan et al. Nature 000 , 1-5 (2009) doi:10.1038/nature07926. - PowerPoint PPT Presentation

TRANSCRIPT

RD Airan et al. Nature 000, 1-5 (2009) doi:10.1038/nature07926

In vivo optoXR modulation of neural activity.

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

GI Motility online (May 2006) | doi:10.1038/gimo46

Ecosystem turnover in palaeoecological records: …€¦ · Web viewNature Publishing Group: 53–59. DOI: 10.1038/nature08227. DOI: 10.1038/nature08227. Seddon AW, Macias-Fauria

Guo et al ., Nature Materials, DOI:10.1038/ nmat3234 (2012)

doi: 10.1038/nature09205 SupplementaryInformationfor ...projects.iq.harvard.edu/files/ped/files/nature09205-s1.pdf 2 doi: 10.1038/nature09205 SUPPLEMENTARY INFORMATION 10Asexualreproduction

DOI: 10.1038/NMAT3074 Maltodextrin based imaging … · and in vivo SUPPLEMENTARY INFORMATION DOI: 10.1038/NMAT3074 ©

Nature Genetics: doi:10.1038/ng...Nature Genetics: doi:10.1038/ng.3245 Supplementary Figure 6 Effect of shared controls on conditional posterior probability of association with disease

Nature Genetics doi:10.1038/ng · Aortic stenosis Aortic regurgitation Nature Genetics: doi:10.1038/ng.3618. Cardiomyopathy Hypertrophic card Pericardial Problem Pericarditis Pericardial

DOI: 10.1038/NMAT4143 - Nature Research...in – √ ((− ((((= √ (. (). (in (() (∼ × → in ≃), ∆ = (˜)/ (˜ +) ± × ˜/ = = ˜/ =. × ×−

Nature Structural and Molecular Biology: doi:10.1038/nsmb · Nature Structural and Molecular Biology: doi:10.1038/nsmb.2938 Supplementary Figure 1 Characterization of designed leucine-rich-repeat

Neuropsychopharmacology (2013) 38 , 2150-2159; doi:10.1038/npp.2013.112

Nature Genetics: doi:10.1038/ng · 2014-10-29 · Nature Genetics: doi:10.1038/ng.3105 Supplementary Figure 3 Manhattan plot showing the statistical significance of the association

GI Motility online (May 2006) | doi:10.1038/gimo48

Graphic1 - AIRAN LIMITED

SCIENTIFIC REPORTS | 2 : 592 | DOI: 10.1038/srep00592

doi:10.1038/nature06481 LETTERS

doi:10.1038/nature05150 LETTERS

doi:10.1038/nature12886 Neanderthal from the Altai

DOI: 10.1038/ncomms1280 molecular dynamics of single

Nature Biotechnology: doi:10.1038/nbt

Neuropsychopharmacology (2013) 38 , 1521-1534; doi:10.1038/npp.2013.51

DOI: 10.1038/NCHEM - Nature · NATURE CHEMISTRY | 3 DOI: 10.1038/NCHEM.1870 SUPPLEMENTARY INFORMATION S3 1. Syntheses (i) General methods and instrumentation

DOI: 10.1038/NMAT4801 Metal-Oxide-Semiconductor

Vol 437 15 September 2005 doi:10.1038/nature03943 LETTERS

doi:10.1038/nature05202 LETTERS

DOI: 10.1038/NPHOTON.2015 - media.nature.com PHOTONICS | . 3. DOI: 10.1038/NPHOTON.2015. 181. SUPPEENTAR INORATION 1 polarized laser beams to …

Nature Biotechnology: doi:10.1038/nbt › ... › n2 › extref › nbt.3754-S1.pdf · Nature Biotechnology: doi:10.1038/nbt.3754. Supplementary Figure 2 SuRE genome coverage, reproducibility

Nature Structural & Molecular Biology: doi:10.1038/nsmb Structural & Molecular Biology: doi:10.1038/nsmb.3120. reduction in the pocket volume, we combine the volumes from the closed

1 November 2007 doi:10.1038/nature06221 LETTERS

DOI: 10.1038/NMAT4299 Supplementary file for P … · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4299. NATURE MATERIALS | . 1 1 Supplementary file for Photo-oxidation and quantum

DOI: 10.1038/NGEO2405 Moist convection in hydrogen

Calcium modulates force sensing by the von ... - aj-lab.gitlab.io · ARTICLE nATuRE CommunICATIons | DoI: 10.1038/ncomms1385 nATuRE CommunICATIons | 2:385 | DoI: 10.1038/ncomms1385

Published in Nature Materials (2016) doi:10.1038/nmat4569

Vol 453 1 May 2008 doi:10.1038/nature06733 LETTERS

Neuropsychopharmacology (2014) 39 , 1603-1613; doi:10.1038/npp.2014.7