rat strains differ in susceptibility to maternal and fetal infection with mycoplasma pulmonis

Rat Strains Differ in Susceptibilityto Maternal and Fetal Infectionwith Mycoplasma pulmonis

INTRODUCTION

The role of genital mycoplasmas such as Ureaplasmaurealyticum as reproductive pathogens is still contro-versial as women with normal pregnancies can becolonized with the microorganism in the genital tract.In spite of this, U. urealyticum has been implicated inspontaneous abortion, preterm labor, chorioamnio-nitis, and premature birth.1–4 The pathogenic mecha-nisms of ureaplasmal-induced adverse pregnancyoutcome have yet to be determined, but some infer-ences can be made from the epidemiologic data. Forinstance, ureaplasmal-associated adverse pregnancyoutcome occurs more frequently in women who haveintra-amniotic infections in conjunction with highlevels of pro-inflammatory cytokines such as tumornecrosis factor-a (TNF-a), interleukin (IL)-6 andIL-8.3,4 This implies that the host response to infection

may play an integral role in the pathogenesis ofdisease. What is not clear is whether the inflammatoryresponse is a direct result of microorganism load orindependent of microorganism number. This informa-tion can only be accurately derived through the use ofan animal model.

Mycoplasma pulmonis genital tract infection inSprague–Dawley (SD) rats is an established modelfor understanding the host–pathogen relationships ofgenital mycoplasmosis on pregnancy outcome.5–9

Intrauterine infection can be established throughboth hematogenous and intravaginal inoculation.5–9

Once infected, dams develop varying complicationssimilar to ureaplasmal-associated reproductive diseaseof humans, including chorioamnionitis, fetal infectionof the lung and central nervous system, low birthweight, and fetal and neonatal death.6,7,9 Different ratstrains have varying susceptibility and degree of

American Journal of Reproductive ImmunologyAJRI 2004; 51: 211–219Copyright � Blackwell Munksgaard, 2004

ISSN 1046-7408

Reyes L, Shelton M, Riggs M, Brown MB. Rat strains differ insusceptibility to maternal and fetal infection with Mycoplasma pulmonis.AJRI 2004; 51:211–219 � Blackwell Munksgaard, 2004

PROBLEM: Vaginally infected Sprague–Dawley (SD) rats are moresusceptible to adverse pregnancy outcomes than Wistar (WIS) rats. Wepostulated that SD rats have enhanced hematogenous spread ofMycoplasma pulmonis to fetal tissues.METHOD OF STUDY: WIS and SD dams were infectedintravenously with 107, 106, and 105 colony-forming units ofM. pulmonis at gestation day 14. Dams and six randomly selectedfetuses were cultured at days 15, 16, 17, and 18 of gestation.RESULTS: In the high-dose group, 100% of fetuses were colonizedregardless of rat strain. Significantly higher numbers of M. pulmoniswere isolated from placenta (low dose, P < 0.0001; medium dose,P < 0.024; high dose, P < 0.0001), amniotic fluid (lowdose, P < 0.003; medium dose, P < 0.017), and fetuses (low dose,P < 0.0011) of SD rats. Spread of M. pulmonis to the amniotic fluidand fetus occurred 1 day earlier in SD rats.CONCLUSIONS: The difference in susceptibility between the two ratstrains cannot be explained by hematogenous spread alone. Therelative resistance to adverse pregnancy outcomes in WIS rats may be afunction of a more robust innate immune system. These rat strains mayrepresent an animal model to address host resistance factors tointrauterine infection.

Leticia Reyes1, Micheal Shelton1,Margaret Riggs2, Mary B. Brown11Department of Pathobiology, College of VeterinaryMedicine, University of Florida, Gainesville, FL; 2Divisionof Epidemiology, Statistics and Prevention Research,National Institute of Child Health and HumanDevelopment, The National Institutes of Health, Bethesda,MD, USA

Keywords: Chorioamnionitis, fetal infection, genitalmycoplasmosis, Mycoplasma pulmonis

Address reprint requests to Leticia Reyes, Departmentof Pathobiology, College of Veterinary Medicine, Univer-sity of Florida, Gainesville, Florida 32611–0880, USA.E-mail: [email protected]

Submitted July 14, 2003;revised September 8, 2003;accepted October 10, 2003.

AMERICAN JOURNAL OF REPRODUCTIVE IMMUNOLOGY VOL. 51, 2004

complications to genital mycoplasmosis. Intravaginallyinoculated Wistar (WIS) rats readily develop intra-uterine infection with M. pulmonis without the adversepregnancy outcomes seen in the SD rat.8 In this study,WIS dams had significantly lower numbers of Myco-plasma in the upper genital tract than SD dams.Therefore, WIS rats may have immune mechanismsthat confer resistance to disease. Thus, the host-specificmechanisms that are different between these rat strainsmay prove useful in identifying potential resistance orsusceptibility factors that apply to human myco-plasmal genital disease.

The increased susceptibility of SD rats to adversepregnancy outcome may be due to impaired immunity,which allows M. pulmonis to spread hematogenouslyfrom the genital tract and infect the fetus throughbreach of the materno-fetal barrier. We postulated thatintravenous inoculation of M. pulmonis would bypassmucosal immune mechanisms and should producesimilar rates of fetal infection in both rat strains. Inthis study, we intravenously challenged pregnant SDand WIS rats with different doses of M. pulmonis. Weexamined the rate of placental, amniotic fluid and fetalcolonization with M. pulmonis in both rat strains. Wefound that intravenous inoculation does increase therate of fetal infection in WIS dams. However, com-pared with SD rats, WIS dams are still relativelyresistant to M. pulmonis infection.

MATERIALS AND METHODS

MycoplasmasMycoplasma pulmonis UAB strain · 1048 was origin-ally obtained from Maureen K. Davidson, Universityof Florida. Genital disease in SD rats with thismycoplasma strain is well characterized.5–9 In orderto ensure identical inocula for all experiments, a large-volume culture was grown to late log phase in Frey’smedium, aliquoted and frozen at )80�C. Inocula wereprepared by diluting thawed M. pulmonis UABstrain · 1048 in sterile phosphate-buffered saline toobtain a concentration of 105, 106, and 107 CFU per100 lL of medium. The number of colony-formingunits (CFU) in each inoculum was verified by culturefor each experiment.

Unless otherwise noted, all cultures obtained fromanimals at necropsy were serially diluted 10-fold inFrey’s broth to 10)12. For CFU determination, 20 lLfrom each sample and its corresponding dilutions (up to10)12) were plated on Frey’s agar. Agar plates wereincubated at 37�C in 5% CO2; broth cultures wereincubated at 37�C in ambient air. Broth tubeswere checked daily for a color change, and the reciprocalof the last dilution to show growth was deemed the

color-changing unit. Agar cultures were incubated for atleast 5 days before colonies were counted.

AnimalsSpecific pathogen-free timed pregnant SD and WIS ratswere purchased from a commercial vendor (HarlanSprague–Dawley, Inc., Indianapolis, IN, USA). Ratswere monitored and maintained free of the followingpathogens: Sendai virus, H-1 virus, rat corona virus,sialodacryoadenitis virus, reovirus type 3, Kilham ratvirus, Hantaan virus, M. pulmonis, respiratory andenteric bacterial pathogens, endoparasites and ectopar-asites. All animals were handled in accordance withprocedures approved by the University of FloridaInstitutional Animal Care and Use Committee.

HusbandryIn order to maintain barrier conditions, all animals werehandled within a laminar flow hood. Rats were housedin Microisolator� (Lab Products, Inc., Maywood, NJ,USA) cages in the same room under the same tempera-ture and light conditions. In order to prevent crosscontamination, control animals were always handledfirst and housed in separate cages from inoculatedanimals. All food, water and caging were autoclavedbefore use.

Processing and Experimental Infection of RatsPrevious studies have demonstrated that intravenousinoculation at day 14 of gestation is the most efficienttime point for inducing fetal infection.9 Female rats atday 14 of gestation were anesthetized with a ketamine(Ketaset, Bristol Laboratories, Syracuse, NY, USA)xylazine (Rompun, Haver-Lockhart, Shawnee, KS,USA) cocktail (100 mg ketamine + 150 mg xylazine)administered intraperitoneally at a dosage of 0.1 mL/100 g of body weight. While anesthetized, animalswere intravenously inoculated with 100 lL of sterileFrey’s broth (control group) or M. pulmonis UABstrain · 1048 containing 105 (low), 106 (medium) or107 (high) CFU in an equal volume of Frey’s medium.A minimum number of five dams per rat strain pertreatment group were included in the overall study.Experimental repetitions to achieve these numberswere designed such that a minimum of two animalsfrom each rat strain and for each treatment group wereincluded in each individual repetition.

NecropsyDams inoculated with sterile medium, 105, or 107 CFUof M. pulmonis were necropsied at day 18 of gestation.Dams inoculated with sterile medium or 106 CFU ofM. pulmonis were necropsied at day 15, 16, 17, and 18of gestation. Each rat strain, each dose, and eachgestation time point had at least five dams per group.

212 / REYES ET AL.

� BLACKWELL MUNKSGAARD, 2004

Each gestation time point had a corresponding groupof control animals. All rats were deeply anesthetizedwith an intraperitoneal injection of sodium pento-barbital (30–40 mg/kg body weight), and exsanguinat-ed by transection of a femoral artery and vein. Thedam was cultured for the presence of M. pulmonis inthe spleen, vagina, and uterus as previously des-cribed.7,8 For fetal cultures, six fetal units wererandomly selected from one uterine horn from eachdam. Placenta, amniotic fluid and fetus from each unitwere specifically labeled so that inferences aboutprogression of infection from placenta to fetus couldbe made. In order to eliminate contamination from theamniotic fluid, fetal skin was disinfected with 70%ethanol prior to mincing for culture.

HistopathologyRemaining placental units from day 18 necropsies wereleft in the uterus and fixed in 10% buffered formalin for18–24 hr. At least three placentas per dam per treatmentgroup were randomly selected for histopathologic eval-uation. After fixation in buffered formalin, the amnioticsac was punctured and the fetus removed. The endome-trium with attached placenta and amniotic membraneswas transected so that a cross-sectional view of endome-trium, decidua/labyrinth and chorioamnion would bepresent on each section. Tissues were processedroutinely, and stained with hematoxylin and eosin.

Detection of M. pulmonis by In Situ HybridizationParaffin-embedded placental sections from day 18gestation were processed at room temperature. Paraffinwas removed by soaking slides in three xylene washes(10 min per wash) followed by two washes in 95%ethanol (5 min each). In order to inactivate anyendogenous peroxidase, placental sections were incu-bated in 3% H2O2 in methanol for 10 min. Slides werethen washed in 80% ethanol for 5 min followed by a5-min wash in 70% ethanol, and a 5-min wash in 50%ethanol. Slides were air-dried before digestion. Prote-inase digestion was performed at 37�C for 5 and10 min with 0.1 lg/mL of proteinase K in lysis buffer(30 mm Tris–Cl, pH. 7.4; 100 mm NaCl; 5 mm ethylene-diaminetetraacetic acid; 1% sodium dodecyl sulfate).

A chromogenic in situ hybridization system was usedto detect a portion of the 16s gene sequence ofM. pulmonis in placental sections (DNA detectorTM;KPL, Inc. Gaithersburg, MD, USA). The hybridiza-tion protocol provided in the kit was used for allhybridization experiments and a corresponding negat-ive control slide was included in each experiment.Approximately 50 lL of hybridization cocktail wasapplied to each slide. The hybridization cocktailcontained 50% formamide and approximately 1 ng/lLof biotinylated probe. Hybridization was performed at

41�C overnight. The following day slides were washedwith 2 · SSC at 41�C for 10 min, followed by twowashes in 2 · SSC at room temperature (5 min each).Slides were then incubated at 37�C for 20 min in a1:100 dilution of HRP-Streptavidin in conjugate dilu-ent buffer. Slides were washed three times with biotinwash solution and probe signal was detected withTrueblueTM. Rat placental cells were counterstainedwith eosin.

Preparation of M. pulmonis Biotinylated ProbeDetectorTM, PCR DNA biotinylation kit (KPL, Inc.)was used to label the mycoplasma probe. The follow-ing primers were used to amplify a 720 bp sequence ofthe 16s ribosomal gene of M. pulmonis (MP1: ATGGTGTGACGGGCGGTGTGTA; MP2: AGTGAAGCGGTGAAATGTGTAG). A DNA thermocycler(Perkin-Elmer, Corp., Norwalk, CT, USA) was used toamplify the probe by PCR. The thermocycler reactionconsisted of 25 cycles at 94�C for 1 min (denaturation),55�C for 30 s (annealing), and 72�C, for 4 min(extension).

Statistical AnalysisData from multiple experiments were grouped togetherfor statistical analysis. Data were analyzed by two-wayanalysis of variance. Fisher’s multiple comparison testwas used when the analysis of variance indicated asignificant difference among group means. Contin-gency table analysis was used to compare nominal data(positive vs. negative). Linear regression analysis wasperformed on day 18 placenta, amniotic fluid, and fetalcultures. For all analyses a probability of P £ 0.05 wasconsidered significant.

RESULTS

Infection of Pregnant Dam Tissues with M. pulmonisNo control dam necropsied at any time point wasculture positive for M. pulmonis. There were nodifferences in the frequency of isolation of M. pulmonisor log CFU recovered from the vagina and endo-metrium of SD and WIS dams inoculated with106 CFU. In these animals, endometrial and vaginalcolonization did not occur until day 16 of gestation.However, placental colonization in these same damsoccurred at day 15 of gestation. Although not statis-tically different, a consistent trend was observed in thatthe mean log CFU of mycoplasmas isolated fromspleens of WIS dams over a 4-day course of infectionwas always higher than SD dams (data not shown).Both rat strains showed a slight decrease in the numberof organisms in the spleen by day 16 followed by agradual increase at days 17 and 18. The log number of

RAT STRAIN SUSCEPTIBILITY TO GENITAL MYCOPLASMOSIS / 213


mycoplasmas isolated from day 18 spleens was similarto what was isolated at day 15.

Regardless of the inoculum dose of M. pulmonis,there were no differences in the frequency or log CFUof M. pulmonis isolated from the endometrium orvagina of SD and WIS dams cultured at day 18 ofgestation (data not shown). The log CFU isolated fromthe spleens of WIS dams at day 18 of gestation tendedto be higher than SD dams. This difference increasedwith increasing inoculum dose of M. pulmonis (Fig. 1).

Time Course of Infection in Fetal TissuesNo fetal tissues obtained from control dams necrop-sied at any time point were culture positive forM. pulmonis. Fig. 2 summarizes the frequency ofinfection in dams that were inoculated with 106 CFUof M. pulmonis. The frequency of placental infection inSD rats was significantly higher than WIS rats at days16 (P < 0.036) and 17 (P < 0.05) of gestation.Amniotic fluid and fetal infections occurred by day16 of gestation in SD rats but not until day 17 in WISrats. Amniotic fluid infection preceded fetal infectionin all WIS rats. In one SD rat, the fetus was colonizedwith M. pulmonis but the amniotic fluid was culture

negative. One SD fetus was infected by day 16 ofgestation whereas no WIS fetuses became infected untilday 17 of gestation. By day 18, the percentage of

Fig. 1. The log CFU of Mycoplasma pulmonis isolated from the

spleen of dams inoculated with low (105), medium (106), and high

(107) CFU of M. pulmonis. Values represent the mean � standard

deviation of log CFU cultured from the spleen of dams. Rats were

inoculated intravenously at day 14 and necropsied at day 18 of

gestation. n values for each dose were as follows: low, n ¼ 5;

medium, n ¼ 6; and high, n ¼ 5. Values that were significantly dif-

ferent between rat strains are labeled with the corresponding P-value.

Fig. 2. Percentage of fetal tissue cultures positive for Mycoplasma

pulmonis over the time course of infection. Dams were inoculated

with 106 CFU of M. pulmonis at day 14 of gestation. Sample size for

each treatment group is as follows: day 15: WIS ¼ 30, SD ¼ 30; day

16: WIS ¼ 30, SD ¼ 30; day 17: WIS ¼ 36, SD ¼ 30; day 18:

WIS ¼ 30, SD ¼ 36. Six fetal units from each dam were selected for

culture. Data is a combination of three separate experiments. Values

that were significantly different between rat strains are labeled with

their corresponding P-value.

214 / REYES ET AL.


infected SD fetuses was significantly higher than WISrats (P < 0.047).

Table I summarizes the log CFU of M. pulmonisisolated from the placenta, amniotic fluid and fetus ofWIS and SD rats necropsied at days 15, 16, 17, and 18of gestation. Both rat strains had equivalent amountsof M. pulmonis isolated from day 15 placentas. Fromday 16 and thereafter, SD had significantly higher logCFU of M. pulmonis isolated from placentas than WISrats. Further, the log CFU in placenta of SD ratsincreased steadily at each time point. A differentpattern was observed in WIS rats. Although the initialnumbers recovered at day 15 were similar between thetwo rat strains, no increases in log CFU were observeduntil day 17 in WIS rats. At this time point andthereafter, amniotic fluid and fetal cultures from WISrats had log CFU values similar to SD rats. Amnioticfluid cultures from SD dams became positive by day 16of gestation. No remarkable differences were observedwith respect to fetal colonization.

Effect of Inoculum Dose on Fetal Infectionwith M. pulmonisNone of the fetuses obtained from control dams wereculture positive for M. pulmonis. Fig. 3 summarizes thefrequency of infection in fetal tissues obtained at day18 of gestation from dams inoculated with 105, 106,and 107 CFU of M. pulmonis. WIS dams that wereinoculated with 105 CFU had significantly fewerinfections in the placenta (P < 0.0011), amnioticfluid (P < 0.0002), and fetus (P < 0.0001) than SDrats. Although the frequency of infection in the

placenta and amniotic fluid of WIS rats inoculatedwith 106 and 107 CFU was slightly less than SD rats,the difference was not significant. However, thefrequency of fetal infection in WIS rats inoculatedwith 106 CFU was significantly lower than SD rats(P < 0.047). There was no difference in the frequencyof placental, amniotic fluid and fetal infection betweenboth rat strains inoculated with 107 CFU.

Table II summarizes the log CFU of M. pulmonisrecovered from day 18 fetal tissues of WIS and SDrats. Regardless of inoculum dose, log CFU recoveredfrom placentas of WIS rats were significantly lowerthan SD rats. Both rat strains inoculated with107 CFU had equivalent levels of M. pulmonis isolatedfrom the amniotic fluid and fetus. In animals inocu-lated with 106 and 105 log CFU, amniotic fluidcultures from WIS rats had significantly lower CFUthan SD rats. In rats inoculated with 105 CFU,significantly lower log CFU were recovered fromWIS fetuses than SD fetuses (P < 0.0011).

By regression analysis, the log CFU recovered fromamniotic fluid and fetus of WIS rats was positivelycorrelated with the placental log CFU (P < 0.0001).Therewasnocorrelationbetween the logCFU recoveredfrom placenta, amniotic fluid and fetus in SD rats.

Histopathology of Placental TissuesPlacental sections from control and infected WIS andSD rats are shown in Fig. 4. Both WIS and SD controlrats had degenerative changes that are consistent withday 18 placentas. These changes consisted of occasionalsmall necrotic cells and occasional polymorphonuclear

TABLE I. Log Colony-Forming Unit

(CFU) Recovered from Fetal Tissues

of Rats Inoculated with 106 CFU of

Mycoplasma pulmonisa

Site Day WIS (n) SD (n) P-value

Placenta 15 1.11 � 0.82b (30)c 1.26 � 1.64 (30) NSd

16 2.37 � 1.82 (30) 5.16 � 2.73 (36) P < 0.0001

17 5.61 � 3.7 (42) 7.33 � 3.08 (30) P < 0.043

18 10.47 � 2.15 (36) 11.31 � 0.47 (36) P < 0.024

Amniotic fluid 15 0 (30) 0 (30) NSd

16 0 (30) 1.34 � 1.54 (36) P < 0.0001

17 2.29 � 2.16 (42) 2.81 � 2.34 (30) NS

18 4.72 � 2.22 (36) 5.75 � 1.16 (36) P < 0.017

Fetus 15 0 (30) 0 (30) NSd

16 0 (30) 0.08 � 0.5 (36) NS

17 1.17 � 1.45 (42) 1.59 � 1.61 (30) NS

18 2.58 � 1.71 (36) 3.23 � 1.48 (36) NS

WIS, Wistar; SD, Sprague–Dawley.aRats necropsied at gestation days 15, 16, 17, and 18. A minimum of five dams were included in

each treatment group.bValues represent the mean � standard deviation of log CFU recovered from tissues.cNumbers represent the sample size for each group.dData between rat strains within each gestation time point that were significant show the corres-

ponding P-value.



(PMN) cells. Placental tissues from infected rats showedvarying degrees of neutrophilic infiltrate within theendometrium, decidua, and the yolk sac.

In situ Location of M. pulmonis in Placental TissuesTrueBlueTM staining of erythrocytes was present incontrol slides. This was considered non-specific stain-ing and discounted from the evaluation of infectedplacental tissues. There were no differences in thedistribution of TrueBlueTM positive aggregates withinthe placentas of both rat strains. Multifocal aggregatesof TrueBlueTM positive material were found mostly inthe decidua, the giant cell layer, spongiotrophoblast,and within the PMN infiltrates that penetrate the yolksac (Fig. 5) in both rat strains. Scant amounts ofTrueBlueTM stained aggregates were also present in thelabyrinth of placentas that were examined.

DISCUSSION

Vaginal inoculation of M. pulmonis in the SD ratproduces metritis, placentitis, and an inflammatory cellinfiltrate within the decidual and basal layers of theplacenta.7,9 Amniotic fluid infection usually precedesfetal infection.6,7,9 Intravenous inoculation in ourstudy produced microscopic lesions in both rat strainsthat are similar to vaginal inoculation withM. pulmonis. Fetal infection predominantly occursfrom extension of infection from the decidua andspongiotrophoblast with extension into the yolk sac.The inflammatory infiltrate that accumulates at theedge of the yolk sac probably contributes to breach ofthe maternal–fetal barrier. In this study, we noted thatamniotic fluid infection preceded fetal infection in allexcept for one SD rat. As SD rats intravenously orintravaginally inoculated with M. pulmonis havesimilar placental lesions and similar rates of fetalinfection, the immune responses within the placentathat contribute to disease may be the same. Bothmethods of inoculation can be used to identify thehost-specific mechanisms that lead to fetal infection,but the benefit of intravenous inoculation is thatorganism delivery and the precise timing of infectionduring gestation can be controlled. This model pro-vides us with the opportunity to study host responseeffects that are time dependent.

The increased incidence of fetal infection seen withintravenous delivery of M. pulmonis is most likely dueto the higher number of microorganisms directlydelivered to the placenta. In our current study,intravenous inoculation successfully induced fetalinfection in both rat strains, and breach of thematernal–fetal barrier occurred when the log CFU ofM. pulmonis recovered from the placenta was at leastlog 5.0 or higher. This is similar to what has beenpreviously reported.9 WIS dams also exhibited a directcorrelation between the number of mycoplasmas in theplacenta and in the amniotic fluid and fetus. Perhaps a

Fig. 3. Percentage of fetal tissue cultures positive for Mycoplasma

pulmonis at day 18 of gestation. Dams were inoculated with low

(105), medium (106), and high (107) CFU of M. pulmonis at day 14 of

gestation. Sample size for each treatment group is as follows: low,

n ¼ 30; medium, n ¼ 36; and high, n ¼ 30. Six fetal units from each

dam were selected for culture. Data are a combination of three

separate experiments. Values that were significantly different between

rat strains are labeled with their corresponding P-value.

216 / REYES ET AL.


threshold number of mycoplasmas are necessary toinduce an inflammatory response that results in breachof the maternal–fetal barrier and subsequent adversepregnancy outcome. The presence of M. pulmonis inthe amniotic fluid of SD rats induces TNF-a and IL-69

Pro-inflammatory cytokines such as TNF-a inducethe expression of matrix metalloproteinases in theamnion.10,11 This in turn can lead to breach of the

TABLE II. Log Colony-Forming

Unit (CFU) Recovered from Fetal

Tissues of Rats Inoculated with 105,

106, and 107 CFU of Mycoplasma

pulmonisa

Site Dose WIS (n) SD (n) P-value

Placenta 107 8.70 � 0.82b (30)c 10.9 � 1.40 (30) P < 0.0001

106 10.47 � 2.15 (36) 11.31 � 0.47 (36) P < 0.024

105 6.70 � 5.20 (30) 11.0 � 0.50 (30) P < 0.0001

Amniotic fluid 107 4.24 � 0.91 (30) 3.71 � 1.20 (30) NS

106 4.72 � 2.23 (36) 5.75 � 1.16 (36) P < 0.017

105 2.69 � 2.68 (30) 4.75 � 1.18 (30) P < 0.003

Fetus 107 4.65 � 0.766 (30) 4.77 � 1.06 (30) NS

106 2.58 � 1.71 (36) 3.23 � 1.47 (36) NS

105 1.50 � 1.99 (30) 2.97 � 1.22 (30) P < 0.0011

WIS, Wistar; SD, Sprague–Dawley.aRats were necropsied at day 18 of gestation.bValues represent the mean � standard deviation of log CFU recovered from tissues.cNumbers represent the sample size for each group.dData between rat strains within each gestation time point that were significant show the corres-

ponding P-value.

Fig. 4. Transection of gestation day 18 placentas from infected (A)

and control (B) rats (magnification · 128 for both figures). Note the

polymorphonuclear cell infiltrate within the yolk sac cavity of the

infected rat placenta.

Fig. 5. Transection of gestation day 18 placentas from control (A)

and infected (B) rats (magnification · 1275 for both figures). Biotin-

labeled M. pulmonis probe was detected with TrueBlueTM Peroxidase

Substrate. Rat cell cytoplasm was counterstained with eosin. Black

multifocal aggregates of biotin-labeled M. pulmonis (within circles)

are interspersed through decidua and spongiotrophoblast layer (solid

white arrows).



maternal–fetal barrier, premature rupture of mem-branes, and premature birth.12 Studies are currentlyunderway to determine whether a similar relationshipbetween cytokine expression and matrix metallopro-teinase expression exists in the placenta of infectedrats.

An unexpected finding in our study was that WISrats were more resistant to fetal infection than SD rats.The frequency of fetal infection in WIS rats signifi-cantly dropped with decreasing inoculum dose ofM. pulmonis. Furthermore, amniotic fluid and fetalinfection were delayed by 1 day in WIS rats. Both ofthese factors can be critical in adverse pregnancyoutcome. WIS rats may have more effective innateimmune mechanisms that help protect the fetus frominfection and reduce the risk of adverse pregnancyoutcome. Possible explanations for this may be sys-temic innate immune mechanisms involved in microbialkilling13,14 or more efficient scavenging by the reticu-loendothelial system.15,16 Although WIS dams inocu-lated with 106 and 107 CFU of M. pulmonis had thesame frequency of placental infection as SD rats, thefrequency of placental infection in WIS dams inocula-ted with 105 CFU was significantly reduced by 30%. Innatural infections it is unlikely that a massive numberof organisms such as 106 CFU would be circulating inthe blood. Therefore, this line of defense may besufficient to protect against most potential cases ofintrauterine infection and may be of similar importancein human genital tract infections during pregnancy.

Innate immune mechanisms within the placenta mayalso confer disease resistance in WIS rats. Regardlessof inoculum dose, WIS rats had significantly lowernumbers of M. pulmonis recovered from the placentathan SD rats. Moreover, a significant increase in thenumber of organisms found in the placenta of WIS ratsdid not occur until day 17 of gestation; this time pointalso coincided with the first onset of amniotic fluid andfetal infection. In SD rats, there was a steady rise in thenumber of mycoplasmas cultured from the placenta.Furthermore, both amniotic fluid and fetal infectionswere seen at day 16 of gestation. In WIS rats, fetalinfection was influenced by the degree of placentalinfection. The higher the log number of organisms inthe placenta, the higher the number present in theamniotic fluid and consequently the fetus. This rela-tionship did not exist in the SD rat in that the log CFUisolated from the amniotic fluid and fetus, was notinfluenced by the log CFU within the placenta. This ismost likely because the numbers of mycoplasmaisolated from the placentas of SD rats reached veryhigh numbers regardless of inoculation dose, suggest-ing a saturation state may have occurred. Perhaps WISrats are more efficient at microbial killing, or theplacental microenvironment is able to inhibit myco-

plasmal growth at least until day 17 of gestation. Forexample, changes in the expression of growth factorsand cytokines within the placenta are known to occurduring different phases of gestation.17,18 These differ-ences could have an indirect effect on the growth andsurvival of mycoplasmas within the infected tissue.

Breach of the maternal–fetal barrier appears to bethe driving factor for the expression of pro-inflamma-tory cytokines, which are primarily responsible forfetal morbidity and mortality.4,19,20 In previous studieswith SD rats, the presence of pro-inflammatorycytokines in the amniotic fluid occurred only in thepresence of amniotic fluid infection,9 which most likelyreflects a fetal inflammatory response. The moreprolonged the infection and inflammatory response,the greater likelihood of fetal morbidity and mortality.These results parallel observations in clinical studies ofhuman pregnancy and ureaplasmal infection.3,9 Com-pared with SD rats, amniotic fluid infection and fetalinfection in WIS rats was delayed by 1 day. This delaymay minimize adverse pregnancy outcome in WIS ratsby reducing the actual amount of time the fetus isinfected, thus decreasing the potential time of produc-tion and exposure to pro-inflammatory cytokines thatcontribute to morbidity.

In most mycoplasmal infections, the host is seldomcapable of eliminating the organism quickly or com-pletely, and the host response is an integral part oflesion production and disease pathogenesis. Thelesions of mycoplasmal genital disease in rats aresimilar to ureaplasmal genital disease in humans.3,9

Although, mycoplasmas and ureaplasmas have somegenetic and metabolic dissimilarities, the similar clin-ical course of disease in both species suggests that someof the host–pathogen relationships in human androdent genital disease induced by mollicutes may besimilar. We have demonstrated host susceptibilitydifferences to M. pulmonis-induced intrauterine infec-tion and disease in WIS and SD rats. Therefore, thisrat model may be useful for specifically identifying thehost factors within the placental microenvironmentthat are involved in the resistance to disease orexacerbation of disease and subsequent adverse preg-nancy outcome. Intravenous inoculation withM. pulmonis in pregnant rats is a particularly usefulmodel for identifying the temporal and coordinatedevents that contribute to fetal infection and adversepregnancy outcome.

AcknowledgmentsThis project was funded by a grant obtained throughChildren’s Miracle Network, University of Florida,Department of Pediatrics. L. Reyes is sponsored on aMinority Supplement to NIAID, grant numberR01-AI45875–01.

218 / REYES ET AL.


REFERENCES

1. Quinn PA, Butany J, Taylor J, Hannah W: Chorio-amnionitis: its association with pregnancy outcome andmicrobial infection. Am J Obstet Gynecol 1987; 156:379–387.

2. Cassell GH, Waites KB, Watson HL, Crouse DT,Harasawa R: Ureaplasma urealyticum intrauterineinfection: role in prematurity and disease in newborns.Clin Microbiol Rev 1993; 6:69–87.

3. Davis JK, Crouse DT, Robertson JA, Davidson MK,Brown MB, Reyes L: The role of Ureaplasma urealyti-cum in human reproductive and neonatal diseases. InfectDis Rev 1999; 1:200–207.

4. Yoon BH, Romero R, Park JS, Chang JW, Kim YA, KimJC, Kim KS: Microbial invasion of the amniotic cavitywith Ureaplasma urealyticum is associated with a robusthost response in fetal, amniotic, and maternal compart-ments. Am J Obstet Gynecol 1998; 179:1254–1260.

5. Brown MB, Steiner DA: Experimental genital myco-plasmosis: time of infection influences pregnancy out-come. Infect Immun 1996; 64:2313–2321.

6. Steiner DA, Brown MB: Impact of experimental genitalmycoplasmosis on pregnancy outcome in Sprague–Dawley rats. Infect Immun 1993; 61:633–639.

7. Steiner DA, Uhl EW, Brown MB: In utero transmissionof Mycoplasma pulmonis in experimentally infectedSprague–Dawley rats. Infect Immun 1993; 61:2985–2990.

8. Reyes L, Steiner D, Hutchison J, Crenshaw B, BrownMB: Mycoplasma pulmonis genital disease: effect of ratstrain on pregnancy outcome. Comp Med 2000; 6:622–627.

9. Brown MB, Peltier M, Hillier M, Crenshaw B, Reyes L:Genital mycoplasmosis in rats: a model for intrauterineinfection. Am J Reprod Immun 2000; 46:232–241.

10. Arechavaleta-Velasco F, Ogando D, Parry S, Vadillo-Ortega F: Production of matrix metalloproteinase-9 inlipopolysaccharide – stimulated human amnion occurs

through an autocrine and paracrine proinflammatorycytokine-dependent system. Biol Repro 2002; 67:1952–1958.

11. Fortunato SJ, Menon R, Lombardi SJ: Role of tumornecrosis factor-alpha in the premature rupture of mem-branes and preterm labor pathways. Am J Obstet Gyn-ecol 2002; 187:1159–1162.

12. Romero R, Chaiworapongsa T, Espinoza J, Gomez R,Yoon BH, Edwin S, Mazor M, Maymon E, Berry S:Fetal plasma MMP-9 concentrations are elevated inpreterm premature rupture of the membranes. Am JObstet Gynecol 2002; 187:1125–1130.

13. Bredt W, Kist M, Jacobs E: Phagocytosis and comple-ment action. Isr J Med Sci 1981; 17:637–640.

14. Davis JK, Davidson MK, Schoeb TR, Lindsay JR:Decreased intrapulmonary killing of Mycoplasma pul-monis after exposure to NO2 is associated with damagedalveolar macrophages. A Rev Respir Dis 1992; 145:406–411.

15. Lydard P, Grossi C: Cells in the immune response. InImmunology, 2nd edn, I Roitt, J Brostoff, D Male (eds).St Louis, Mosby, 1989, pp 2.2–2.17.

16. Junqueira LC, Carneiro J: Basic Histology Text andAtlas, 10th edn. New York, McGraw Hill MedicalPublishing Division, 2003.

17. Bowen JA, Hunt JS: The role of integrins in reproduc-tion. Proc Soc Exp Biol Med 2000; 223:331–343.

18. Dealtry GB, O’Farrell MK, Fernandez N: The TH2cytokine environment of the placenta. Int Arch AlergyImmunol 2000; 123:107–119.

19. Dammann O, Kuban CK, Leviton A: Perinatal infec-tion, fetal inflammatory response, white matter damage,and cognitive limitations in children born preterm.Mental Retard Devel Disabil 2002; 8:46–50.

20. Yoon BH, Romero R, Kim KS, Park JS, Ki SH, Kim BI,Jun JK: A systemic fetal inflammatory response and thedevelopment of bronchopulmonary dysplasia. Am JObstet Gynecol 1999; 181:773–779.



rat strains differ in susceptibility to maternal and fetal infection with mycoplasma pulmonis

Documents