1

RESEARCH ARTICLE

Plastidial NAD-Dependent Malate Dehydrogenase: A Moonlighting Protein Involved in Early Chloroplast Development Through its Interaction with an FtsH12-FtsHi Protease Complex Tina B. Schreier1, Antoine Cléry2, Michael Schläfli1, Florian Galbier1, Martha Stadler1, Emilie Demarsy3,4, Daniele Albertini1, Benjamin A. Maier1, Felix Kessler3, Stefan Hörtensteiner5, Samuel C. Zeeman1* and Oliver Kötting1 1 Institute of Molecular Plant Biology, ETH Zurich, Universitätstrasse 2, CH-8092 Zurich, Switzerland. 2 Institute of Molecular Biology and Biophysics, Department of Biology, ETH Zurich, CH-8093 Zurich, Switzerland. 3 Laboratory of Plant Physiology, University of Neuchâtel, CH-2000 Neuchâtel, Switzerland 4 Department of Botany and Plant Biology, University of Geneva, 30 Quai E. Ansermet, CH-1211 Geneva, Switzerland. 5 Institute of Plant Biology, University of Zürich, Zollikerstrasse 107, CH-8008 Zürich, Switzerland. *Corresponding Author: szeeman@ethz.ch Short title: Moonlighting role of plastidial NAD-MDH One-sentence summary: Plastid NAD-dependent malate dehydrogenase is essential for chloroplast development, not because of its enzymatic activity, but because it interacts with FtsH proteases at the inner envelope membrane. The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantcell.org) is: Samuel C. Zeeman (szeeman@ethz.ch). ABSTRACT Malate dehydrogenases (MDH) convert malate to oxaloacetate using NAD(H) or NADP(H) as a cofactor. Arabidopsis thaliana mutants lacking plastidial NAD-dependent MDH (pdnad-mdh) are embryo-lethal, and constitutive silencing (miR-mdh-1) causes a pale, dwarfed phenotype. The reason for these severe phenotypes is unknown. Here, we rescued the embryo lethality of pdnad-mdh via embryo-specific expression of pdNAD-MDH. Rescued seedlings developed white leaves with aberrant chloroplasts and failed to reproduce. Inducible silencing of pdNAD-MDH at the rosette stage also resulted in white newly emerging leaves. These data suggest that pdNAD-MDH is important for early plastid development, which is consistent with the reductions in major plastidial galactolipid, carotenoid and protochlorophyllide levels in miR-mdh-1 seedlings. Surprisingly, the targeting of other NAD-dependent MDH isoforms to the plastid did not complement the embryo lethality of pdnad-mdh, while expression of enzymatically inactive pdNAD-MDH did. These complemented plants grew indistinguishably from the wild type. Both active and inactive forms of

Plant Cell Advance Publication. Published on June 22, 2018, doi:10.1105/tpc.18.00121

©2018 American Society of Plant Biologists. All Rights Reserved

2

pdNAD-MDH interact with a heteromeric AAA-ATPase complex at the inner membrane of the chloroplast envelope. Silencing the expression of FtsH12, a key member of this complex, resulted in a phenotype that strongly resembles miR-mdh-1. We propose that pdNAD-MDH is essential for chloroplast development due to its moonlighting role in stabilizing FtsH12, distinct from its enzymatic function. INTRODUCTION 1

2

Malate dehydrogenases (L-malate-NAD-oxidoreductase [MDH]; EC 1.1.1.37) 3

catalyse the reversible interconversion of malate and oxaloacetate, using NAD(H) or 4

NADP(H) as a cofactor. Plant MDHs form a family of enzymes, with isoforms that are 5

present in several compartments within the cell. The Arabidopsis thaliana genome 6

encodes nine isoforms of MDH - two plastidial, two peroxisomal, two mitochondrial, 7

and three that are assumed to be cytosolic, as they have no predicted localisation 8

sequence. All of these isoforms use NAD+ as a cofactor, with the exception of one 9

plastidial isoform that is NADP-dependent (NADP-MDH). Although it is well 10

established that MDHs play an important role in central metabolism in plants, the 11

exact role(s) of many of the individual isoforms in Arabidopsis remains unclear - 12

particularly for the plastidial and cytosolic isoforms. 13

14

MDHs play a critical role in the tricarboxylic acid (TCA) cycle in the mitochondria, 15

where they generate NADH by oxidising malate to oxaloacetate. They can also 16

reduce oxaloacetate back to malate in order to generate NAD+ for the 17

decarboxylation reaction that occurs during the conversion of glycine to serine 18

(Journet et al., 1981). An Arabidopsis double mutant lacking both mitochondrial MDH 19

isoforms is viable but has defects in seed germination, stunted growth, and altered 20

leaf respiration and photorespiration rates (Tomaz et al., 2010; Sew et al., 2016). 21

Mitochondrial MDHs are also involved in the carbon-concentrating mechanism in 22

plants that conduct the NAD-malic enzyme type of C4 photosynthesis (Hatch and 23

Osmond, 1976). The two peroxisomal MDH isoforms generate NAD+, which is mainly 24

required for the β-oxidation of fatty acids. An Arabidopsis mutant deficient in both of 25

these isoforms does not efficiently mobilise triacylglycerols and requires the 26

exogenous supply of sugars for seedling establishment (Pracharoenwattana et al., 27

2007, 2010). 28

29

3

In the plastids, NADP-MDH was proposed to be the key enzyme in the malate valve 30

– a mechanism by which reducing equivalents can be indirectly transported across 31

membranes of organelles (Heber, 1974; Scheibe, 2004; Taniguchi and Miyake, 32

2012). NADP-MDH is redox-regulated by the ferredoxin-thioredoxin system and is 33

therefore thought to be active only in the light (Scheibe, 1987). According to the 34

malate valve hypothesis, NADPH is generated in the chloroplast through the electron 35

transport chain during the day but does not readily diffuse out of the chloroplast. 36

NADP-MDH reduces oxaloacetate to malate by oxidising NADPH to NADP, and the 37

malate is shuttled to the cytosol in exchange for oxaloacetate via the dicarboxylate 38

transporter, AtpOMT1. In the cytosol, malate is oxidised back to oxaloacetate by the 39

cytosolic MDHs, regenerating a reducing equivalent in the form of NADH in that 40

compartment (Kinoshita et al., 2011). However, the importance of the malate valve is 41

unclear. Previous studies of the nadp-mdh knockout mutant have reported either no 42

reduction in the growth of mutants compared to the wild type (Hebbelmann et al., 43

2012) or a slight reduction (Heyno et al., 2014). The latter study also reported that 44

the mutant had higher H2O2 levels under high light conditions, probably because it 45

could not reversibly inactivate catalase activity. 46

47

Unlike NADP-MDH, the activity of the plastidial NAD-dependent malate 48

dehydrogenase (pdNAD-MDH) is not redox sensitive (Berkemeyer et al., 1998). 49

pdNAD-MDH was thus proposed to play an important role in the malate valve in dark 50

and non-green plastids. In contrast to the nadp-mdh mutant, the homozygous pdnad-51

mdh knockout mutant is embryo-lethal (Beeler et al., 2014; Selinski et al., 2014) - a 52

phenotype that was not reported for mutants of any other MDH isoform so far. An 53

artificial microRNA silencing construct was used to generate the miR-mdh-1 line, 54

with constitutively reduced pdNAD-MDH levels using the 35S promoter (Beeler et al., 55

2014). This line was viable but had pale leaves with disordered chloroplast 56

ultrastructure and was severely compromised in growth. Levels of malate, starch, 57

and glutathione during the night were higher in miR-mdh-1 compared to the wild 58

type. The night-time respiration rate was also lower in the silencing line. These 59

findings are consistent with a role for pdNAD-MDH in metabolism in the dark, but it is 60

difficult to pinpoint a specific role for the enzyme due to the highly pleiotropic nature 61

of the miR-mdh-1 phenotype. In addition, Selinski et al. (2014) showed that pollen 62

tube growth is affected in pdnad-mdh in vitro, but not in vivo and proposed that the 63

4

maternal tissue is able to supply substrates for an enzyme generating NAD+, 64

allowing proper tube elongation in vivo. Together, these data suggest that pdNAD-65

MDH is important for embryogenesis and subsequent growth and that its loss cannot 66

be compensated by the presence of the NADP-MDH in the plastid or of NAD-MDH in 67

other compartments. However, the link between the activity of the enzyme and the 68

phenotypes resulting from its loss remain unclear. Here, we aimed to investigate the 69

role of pdNAD-MDH in both embryo development and post-embryonic growth, 70

focusing on chloroplast development, and to test the importance of NAD-MDH 71

activity in these processes. 72

73

74

RESULTS 75

76

Embryo-Specific Expression of pdNAD-MDH Complements the Embryo 77

Lethality of pdnad-mdh 78

79

We previously reported that the Arabidopsis pdnad-mdh knockout mutant has an 80

embryo-lethal phenotype and that the silencing line with reduced pdNAD-MDH 81

expression, miR-mdh-1 (carrying a 35S promoter-driven artificial microRNA 82

construct), has a pale, dwarfed phenotype with aberrant chloroplast ultrastructure 83

(Beeler et al., 2014). To investigate how the complete loss of pdNAD-MDH affects 84

post-embryogenic growth, we expressed pdNAD-MDH specifically in the embryos of 85

pdnad-mdh. For this, we cloned a PABI3:pdNAD-MDH-YFP construct encoding the 86

pdNAD-MDH protein with a C-terminal YFP tag, driven by the embryo-specific ABI3 87

promoter (Figure 1A). Previous studies have effectively used the ABI3 promoter to 88

rescue the embryo lethality of various mutants (Despres et al., 2001; Gómez et al., 89

2010; Candela et al., 2011; Bodi et al., 2012). We transformed heterozygous pdnad-90

mdh plants with the construct and selected transformed T1 plants using a BASTA-91

resistance marker. The genotype of these T1 plants were determined by PCR 92

amplification of the pdnad-mdh T-DNA insertion, as previously described (Beeler et 93

al., 2014). Four independent lines were selected for further analysis. Plants 94

homozygous for the PABI3:pdNAD-MDH-YFP transgene and heterozygous for pdnad-95

mdh were identified in the T3 generation. When we opened the siliques of these 96

plants, we found that all seeds within the silique were green (Figure 1B). All seeds 97

were also green in siliques of wild type Ler plants, and of heterozygous pdnad-mdh 98

5

plants that were complemented with pdNAD-MDH-YFP expressed under its native 99

promoter (homozygous for the PpdNAD-MDH:pdNAD-MDH-YFP construct, described in 100

Beeler et al., 2014). In contrast, approximately one quarter of the seeds contained in 101

siliques of untransformed (UT) heterozygous pdnad-mdh plants were white. 102

Expression of pdNAD-MDH-YFP under the control of the ABI3 promoter was 103

visualised in isolated embryos using fluorescence microscopy, where we observed 104

YFP signal in embryos at various stages of embryogenesis (globular, heart and 105

torpedo stage) (Figure 1C). These findings suggest that the embryo-specific 106

expression of pdNAD-MDH-YFP can overcome the embryo-lethal phenotype of 107

pdnad-mdh. 108

109

We germinated the progeny from plants that were heterozygous for pdnad-mdh and 110

homozygous for the PABI3:pdNAD-MDH-YFP transgene. At the seedling stage, most 111

of these plants resembled the wild-type (Ler) or heterozygous pdnad-mdh plants, but 112

approximately one quarter had pale cotyledons resembling those observed in miR-113

mdh-1 (Figure 2A). These pale seedlings grew very slowly, and once enough 114

material could be harvested for genotyping, they were confirmed to be homozygous 115

for pdnad-mdh. These findings confirmed that the PABI3:pdNAD-MDH-YFP construct 116

could rescue the embryo-lethal phenotype of pdnad-mdh but show that after 117

embryogenesis when the ABI3 promoter is no longer active, these plants become 118

greatly compromised. Aside from the pale cotyledons, plants homozygous for pdnad-119

mdh initiated albino ‘true leaves’ that failed to undergo proper organogenesis, 120

remaining as small white primordia-like stubs on the meristem (Figure 2B). These 121

plants died 2-4 weeks after germination and failed to reach the reproductive stage. 122

The addition of sucrose in the growth medium did not prevent the seedling-lethality 123

of these plants, nor did it improve growth (Supplemental Figure 1). By contrast, 124

homozygous pdnad-mdh plants that were complemented with pdNAD-MDH-YFP 125

expressed under its native promoter were indistinguishable from the wild type 126

(Figure 2A). 127

128

We previously observed that the young leaves of miR-mdh-1 had compromised 129

chloroplast ultrastructure, with fewer thylakoid membranes and starch granules 130

(Beeler et al., 2014). We therefore investigated chloroplast ultrastructure in pdnad-131

mdh PABI3:pdNAD-MDH-YFP seedlings using transmission electron microscopy 132

6

(TEM). We fixed and embedded cotyledon and true leaf samples from 3-4-week-old 133

Ler and pdnad-mdh plants rescued with PABI3:pdNAD-MDH-YFP. The chloroplasts in 134

cotyledons of the rescued pdnad-mdh seedlings contained thylakoid membranes, but 135

they were not as structured as those in wild-type cotyledons (Figure 2C). However, 136

in the white true leaves, no mature chloroplast structures were observed, only 137

proplastid-like structures. We suspect that the chloroplasts in the cotyledons 138

developed further than those in the true leaves due to residual pdNAD-MDH derived 139

from its PABI3-driven expression in cotyledons during embryogenesis (Figure 1C). To 140

confirm that homozygous pdnad-mdh PABI3:pdNAD-MDH-YFP plants do not express 141

pdNAD-MDH protein after embryogenesis, we extracted proteins from these 142

seedlings and performed immunoblots with the pdNAD-MDH antibody, as well as 143

native-PAGE gels followed by MDH activity staining. No bands corresponding to 144

pdNAD-MDH or pdNAD-MDH-YFP were detected in these extracts on the 145

immunoblot (Figure 3A). We observed several unspecific bands on the blot, but our 146

previous cross-reactivity test of this antibody suggests that they are unlikely to be 147

other MDH isoforms (Beeler et al., 2014). These bands were visible in all lines but 148

variable in abundance, possibly due to variation in the amounts of chloroplast 149

proteins such as Rubisco between the lines (gels were loaded on an equal protein 150

basis). On native-PAGE gels, pdNAD-MDH runs as three distinct activity bands – 151

where the lower band corresponds to the free dimer, while the upper bands 152

correspond to pdNAD-MDH in protein-protein interactions. The lower band is difficult 153

to resolve from other NAD-MDH isoforms (Beeler et al., 2014). Thus, it should be 154

noted that only part of the total pdNAD-MDH in the extract can be observed with this 155

technique. The two upper pdNAD-MDH activity bands were clearly observed in 156

extracts of Ler, but not in miR-mdh-1 and pdnad-mdh PABI3:pdNAD-MDH-YFP 157

(Figure 3B). These data confirm that PABI3:pdNAD-MDH-YFP was only active during 158

embryogenesis. Any residual protein from the embryonic tissues was either inactive 159

by this time or below the level of detection. 160

161

Inducible Silencing of pdNAD-MDH at the Rosette Stage Results in the 162

Formation of White Leaves from the Meristem 163

164

To further investigate the post-embryonic role of pdNAD-MDH, we generated 165

Arabidopsis lines where pdNAD-MDH silencing could be induced at later growth 166

stages. The identical microRNA silencing cassette used in miR-mdh-1 was cloned 167

7

downstream of the XVE/OlexA ß–estradiol-inducible promoter system. Wild-type 168

plants were transformed with the construct, and transformed T1 seedlings were 169

selected using the Hygromycin resistance marker. Prior to ß-estradiol treatment, 3-170

week-old resistant T2 plants were phenotypically indistinguishable from the wild type. 171

A ß-estradiol solution was then sprayed onto the entire rosettes, and this treatment 172

was repeated every two days. Six days into the treatment, newly emerging leaves 173

were noticeably pale, whereas the old leaves stayed green (Figure 4A). Paleness 174

was not observed in any leaves of wild-type plants treated with ß-estradiol. 175

Immunoblot analysis of proteins extracted from these rosettes confirmed that 176

pdNAD-MDH protein levels were undetectable in the young white leaves of the 177

transgenic line, and only residual amounts of protein were present in the old green 178

leaves (Figure 4B and C). The phenotype of the newly emerging leaves suggests 179

that pdNAD-MDH deficiency particularly affects tissues in which chloroplasts are 180

developing. The severe reduction in pdNAD-MDH levels did not have a visible effect 181

on the older leaves, which contain mature chloroplasts. 182

183

pdNAD-MDH is Important for Early Etioplast and Chloroplast Development 184

185

To investigate the role of pdNAD-MDH in chloroplast development in more detail, we 186

studied the de-etiolation process in dark-grown miR-mdh-1 seedlings. During de-187

etiolation, plastids undergo a rapid conversion from partially developed chloroplasts 188

(etioplast) to photosynthetic chloroplasts upon illumination (Solymosi and Aronsson, 189

2013). The prolamellar body (PLB), a crystalline lattice structure within etioplasts, 190

contains structural building blocks for the photosynthetic apparatus, including 191

protochlorophyllide, the enzyme protochlorophyllide oxireductase A (PORA), 192

carotenoids, and fragments of membranes that will form the thylakoids 193

(prothylakoids) (Bahl et al., 1976; Ryberg and Sundqvist, 1982, 1988; Park et al., 194

2002). 195

196

Surprisingly, when grown in the dark, the etiolated miR-mdh-1 seedlings were 197

indistinguishable from the wild type, indicating that skotomorphogenic growth is 198

unaffected by pdNAD-MDH deficiency (Figure 5A). Quantification of the hypocotyl 199

length showed no significant difference between miR-mdh-1 and the wild type 200

(Figure 5B). However, growth of the seedlings in the light was affected in the miR-201

8

mdh-1 seedlings. When grown under a 12-h light/12-h dark regime, miR-mdh-1 202

seedlings had cotyledons that were paler and smaller than those of the wild type 203

(Figure 5A). When grown under continuous light, root growth was further 204

compromised in miR-mdh-1. 205

206

We then examined etioplast structure in cotyledons of etiolated wild-type and miR-207

mdh-1 seedlings using TEM. Etioplasts were imaged from sections produced from 208

three different six-day-old seedlings for both miR-mdh-1 and the wild type. The 209

observed etioplasts were categorised according to their PLB structure – either 210

normal, compromised (with a less ordered structure), or absent (no internal structure 211

observed within the etioplast). Examples of wild-type and miR-mdh-1 etioplasts 212

within each category are shown in Supplemental Figure 2. In wild-type cotyledons, 213

we observed that the vast majority of etioplasts (88.5% - example shown in Figure 214

5C) had normal PLB structure, and only 1.4% had compromised structure (Figure 215

5D). PLBs were absent in 10.1% of etioplasts, but this is likely because they were 216

not visible within that thin section of the etioplast. However, in miR-mdh-1, most 217

etioplasts had compromised PLB morphology (59.8% - example shown in Figure 5C) 218

and a substantial proportion had no visible PLB (36.3%). 219

220

We then quantified the abundance of major prolamellar body components in 221

etiolated miR-mdh-1 seedlings. First, we quantified protochlorophyllide and its 222

binding protein, PORA, using a fluorescence-based assay (Cheminant et al., 2011) 223

and immunoblots, respectively. The levels of both components were greatly reduced 224

in 5-day-old etiolated miR-mdh-1 seedlings compared to the wild type (Figure 6A-B). 225

We also quantified major galactolipids and carotenoids in 6-day-old etiolated 226

seedlings and, since these molecules are also major components of mature 227

chloroplasts, we simultaneously analysed extracts of photomorphogenically grown 228

seedlings. Several monogalactosyl- and digalactosyl-diacylglycerol (MGDG, DGDG) 229

species were detected in the extracts. The most abundant MGDG species was 230

MGDG-18:3/16:3, while DGDG-18:3/18:3 was the most abundant DGDG. 231

Interestingly, the levels of MGDG-18:3/16:3 and DGDG-18:3/18:3 were greatly 232

reduced in miR-mdh-1 in both dark-grown and light-grown seedlings, even though 233

there was no difference in the levels of diacylglycerol (DAG) precursor (Figure 6C-E). 234

Similar trends were observed for most other detectable MGDG and DGDG species 235

9

(Supplemental Table 1). Levels of major carotenoids, such as ß-carotene, were also 236

reduced in miR-mdh-1 etiolated seedlings, as well as light-grown seedlings, relative 237

to the wild type (Figure 6F). Similar trends were observed for lutein and 238

viola/zeaxanthin (Supplemental Table 1). In summary, miR-mdh-1 seedlings were 239

deficient in major lipids and carotenoids that are normally present in etioplasts or 240

chloroplasts. Etioplast development is greatly affected by pdNAD-MDH deficiency, 241

even though etiolated growth is not affected. These data further suggest a critical 242

role of pdNAD-MDH in the early stages of chloroplast development. 243

244

The pdNAD-MDH Protein is Required for Proper Embryo and Chloroplast 245

Development, but its Enzymatic Activity is Not 246

247

We tested whether we could complement the pdnad-mdh mutant by introducing 248

other NAD-MDH isoforms into the plastid – thereby restoring NAD-MDH activity. The 249

Arabidopsis NAD-MDH isoforms in the mitochondria, peroxisome and the cytosol 250

have amino acid sequences that are similar to pdNAD-MDH (Supplemental Figure 251

3). We therefore chose one isoform from each compartment (AtcyMDH1, AtmMDH1 252

and AtpMDH1) and a more distantly related mitochondrial MDH from yeast 253

(Saccharomyces cerevisiae; ScmMDH1). The coding sequences of the different 254

MDH isoforms were fused directly downstream of the plastidial transit peptide from 255

the RubisCO small subunit (RbcS; amino acids 1-80). For the mitochondrial 256

isoforms, the mitochondrial transit sequence was first predicted using the TargetP 257

1.1 program (Nielsen and Engelbrecht, 1997; Emanuelsson et al., 2000), and this 258

sequence was replaced with the plastidial one. The constructs were driven by the 259

native pdNAD-MDH promoter and encoded a YFP tag fused to the C-terminal end of 260

each MDH protein (Figure 7A). Constructs were also generated with the smaller 261

Flag-HA peptide tag in place of the YFP. Heterozygous pdnad-mdh plants were 262

transformed with these constructs, and T1 seedlings were selected via BASTA 263

resistance. Expression of the transgene was verified by immunoblotting. All resistant 264

T1 plants were genotyped (5-15 plants per line) for the parental pdnad-mdh 265

mutation, but no homozygous mutant plants were found. We therefore selected T1 266

plants that were both expressing the transgene and heterozygous for pdnad-mdh, 267

and genotyped the BASTA-resistant T2 progeny (120-180 plants per construct from 268

5 independent T1 lines [30-36 T2 plants each]). However, we were not able to isolate 269

any plants that were homozygous for pdnad-mdh (Figure 7B). We verified that all of 270

10

the fusion-proteins were correctly targeted to the chloroplast using confocal 271

microscopy on heterozygous pdnad-mdh plants that were transformed with the YFP-272

tagged constructs. In all lines, YFP-signal was detected exclusively in the 273

chloroplasts (Figure 7C). We also verified that the constructs encoded active MDH 274

isoforms via native-PAGE with activity staining. Additional activity bands were 275

observed in extracts from plants expressing AtmMDH1 or ScmMDH1, suggesting 276

that these proteins were indeed active (Supplemental Figure 4). The other isoforms 277

are also potentially active, but their activity on the native-PAGE gel might be masked 278

by the activity bands of the endogenous MDH isoforms. In summary, restoring 279

plastidial NAD-MDH activity alone in pdnad-mdh could not complement the embryo-280

lethal phenotype. 281

282

Given these findings, we questioned whether the enzymatic activity of pdNAD-MDH 283

is required at all. Therefore, we generated inactive versions of the pdNAD-MDH 284

protein using site-directed mutagenesis to test whether they could complement the 285

pdnad-mdh mutant. The catalytic site of the malate dehydrogenases is highly 286

conserved among all homologs and includes a histidine, two aspartate and three 287

arginine residues (Birktoft and Banaszak, 1983; Musrati et al., 1998; Minárik et al., 288

2002) (Figure 8A). These amino acids are required to co-ordinate both the substrate 289

and nicotinamide ring of the cofactor within the catalytic pocket. The MDH reaction is 290

initiated by cofactor binding, which then facilitates substrate binding (Silverstein and 291

Sulebele, 1969). When the ternary complex is formed, an external loop closes over 292

the substrate and the residues involved in catalysis (Nicholls et al., 1992; Goward 293

and Nicholls, 1994). Additionally, two conserved arginines on a flexible loop are 294

brought into close proximity to the substrate (Clarke et al., 1986; Grau et al., 1981; 295

Wigley et al., 1992). We mutated the arginines at positions 162 (on the flexible loop) 296

and 234 (in the active site) to glutamines, resulting in three different pdNAD-MDH 297

variants - two single amino acid mutations and one containing both mutations. Both 298

Arg162 and Arg234 interact directly with malate, and substitution with glutamine, 299

which has a smaller side chain and lacks a positive charge, should destabilise the 300

substrate-binding site. We tested the effect of these mutations on enzyme activity in 301

vitro. Wild-type pdNAD-MDH protein and proteins containing the mutations were 302

expressed in and purified from Escherichia coli and incubated with oxaloacetate and 303

NADH. The reduction of NADH was monitored spectrophometrically at 340 nm. No 304

11

activity was detected for any of the three mutated proteins (Figure 8B). We then 305

created plant expression constructs encoding these enzymatically-inactive pdNAD-306

MDH proteins fused to a Flag-HA tag at the C-terminal end, and driven by the native 307

pdNAD-MDH promoter. Heterozygous pdnad-mdh plants were transformed with the 308

constructs, and transformed T1 plants were selected via BASTA resistance. As 309

described above for the experiments shown in Figure 7B, we selected T1 individuals 310

that were both expressing the transgene and heterozygous for pdnad-mdh and 311

genotyped their T2 progeny (69-78 plants per construct from 3 independent lines 312

[23-26 plants each]). Surprisingly, we identified individuals that were homozygous for 313

pdnad-mdh in the T2 generation for all catalytically-inactive pdNAD-MDH constructs, 314

indicating that each of them could complement the embryo-lethal phenotype (Figure 315

8C). The complemented pdnad-mdh plants grew like the wild type, showing that the 316

enzymatically-inactive pdNAD-MDH variants also complemented the growth 317

phenotypes of pdnad-mdh (Figure 8D). We confirmed (using native-PAGE) that no 318

activity bands corresponding to pdNAD-MDH were detected in extracts from 319

complemented pdnad-mdh plants (Figure 8E). Thus, the embryo-lethal phenotype of 320

pdnad-mdh, as well as the pale dwarfed phenotype of miR-mdh-1, are caused 321

primarily by the lack of pdNAD-MDH protein itself, rather than the deficiency of NAD-322

MDH activity. 323

324

pdNAD-MDH Interacts with the FtsH12-FtsHi Complex, which is Involved in 325

Chloroplast Development 326

327

Since the pdNAD-MDH protein itself is indispensable for chloroplast and embryo 328

development, we investigated whether it interacts with other plastidial proteins. We 329

generated stable Arabidopsis transgenic lines overexpressing YFP-tagged pdNAD-330

MDH under the control of the constitutive 35S promoter and extracted protein from 331

these lines at three different developmental stages – etiolated and light grown 332

seedlings, as well as rosette leaves. We then conducted immunoprecipitation (IP) 333

experiments with these extracts using beads that specifically bind YFP. Proteins in 334

the IP were digested with trypsin, and the resulting peptides were analysed using 335

LC-MS/MS. The identified peptides (Table 1, Supplemental Data Set 1) were 336

searched against the TAIR10 genome annotation database. As a control, we also 337

analysed IPs conducted on extracts from wild-type plants. 338

339

12

Within the IP, the largest number of peptides, apart from pdNAD-MDH itself, 340

matched hypothetical chloroplast open reading frame 2 (Ycf2), suggesting that it 341

was present in the highest abundance – although it should be noted that our analysis 342

is semi-quantitative, as peptide counts are not strictly correlated with protein 343

abundance. Ycf2 is encoded in the chloroplast genome. It is an essential protein in 344

tobacco (Nicotiana tabacum) and green algae (Chlamydomonas reinhardtii) 345

(Drescher et al., 2000; Nickelsen, 2005). Strikingly, many peptides also matched the 346

FtsH (filamentous temperature sensitive) proteases, chloroplast isoforms of which 347

are also essential (Wagner et al., 2012). The second largest functional group of 348

proteins identified in the IP experiment consists of the proteins involved in starch 349

degradation (including Like SEX4 1 (LSF1), BETA-AMYLASE1 (BAM1) and BETA-350

AMYLASE3 (BAM3)). These proteins were detected particularly at the rosette stage. 351

Although these proteins are involved in starch turnover in the leaf mesophyll and 352

stomatal guard cells, no defects in chloroplast structure were reported for mutants 353

deficient in these proteins (Fulton et al., 2008; Comparot-Moss et al., 2010; Horrer et 354

al., 2016). Given the essential nature of the identified FtsH12-FtsHi complex 355

subunits, we focused on the interaction between pdNAD-MDH and these proteins. 356

The possible role of pdNAD-MDH in starch turnover is being pursued in a separate 357

study. 358

359

FtsH proteins are a family of membrane-bound proteases containing an ATPase 360

associated with various cellular activities (AAA-ATPase) domain and a zinc-binding 361

metalloprotease domain. FtsH proteins are restricted to the mitochondria and 362

chloroplasts in eukaryotes (Wagner et al., 2012). The Arabidopsis genome encodes 363

17 FtsH genes – twelve predicted proteolytic isoforms and five predicted non-364

proteolytic FtsH isoforms that lack the zinc-binding motif for proteolytic activity 365

(FtsHi1-5). FtsH12, along with FtsHi1, FtsHi2, FtsHi3, FtsHi4 and FtsHi5, are located 366

at the inner membrane of the chloroplast envelope, and these subunits are proposed 367

to form a hetero-hexameric complex, as deduced from co-expression analysis and 368

proteomics data (Ferro et al., 2010). FtsH12 and its associated FtsHi subunits (with 369

the exception of FtsHi3) were consistently detected in the IP with pdNAD-MDH at all 370

three of the developmental stages tested. 371

372

13

For further analysis, we focused on FtsH12, as it was the only FtsH protein identified 373

in the IP that has an intact zinc-binding motif, and therefore the potential for 374

proteolytic activity. To confirm the interaction with pdNAD-MDH, we conducted a 375

reciprocal immunoprecipitation with tagged FtsH12 protein. The FtsH12 coding 376

sequence was cloned downstream of the UBIQUITIN10 promoter, and in frame with 377

a YFP-tag on the C-terminal end (UBI10:FtsH12-YFP). Wild-type plants were 378

transformed with the construct, and the IP was performed as described above on T1 379

plants overexpressing FtsH12-YFP. Within the immunoprecipitate, we found 380

peptides matching pdNAD-MDH, as well as those matching all of the FtsHi subunits 381

that were identified in the IP with pdNAD-MDH-YFP and Ycf2 (Table 2). The correct 382

plastidial localisation of the FtsH12-YFP protein was confirmed via confocal 383

microscopy (Supplemental Figure 5A). 384

385

To investigate the function of FtsH12, four independent Arabidopsis mutants 386

harbouring T-DNA insertions in the FtsH12 gene were obtained. We confirmed that 387

ftsh12 mutants are embryo-lethal, as previously described (Patton et al., 1991; 388

Franzmann et al., 1995; Patton et al., 1998). Like pdnad-mdh, the ftsh12 mutants 389

arrested near the globular-to-heart transition stage. However, the exact stage at 390

which the embryo arrested varied between lines, likely due to the position of the T-391

DNA insertions having different effects on transcript and protein accumulation 392

(Supplemental Figure 5B-F). 393

394

To further study the effect of FtsH12 deficiency, we generated lines constitutively 395

expressing artificial microRNAs. We designed microRNA silencing cassettes 396

targeting regions 3259-3279 (amiRNA target B) and 4777-4797 (amiRNA target A) of 397

the FtsH12 coding sequence, respectively (Figure 9A) (Ossowski et al., 2008). Both 398

cassettes were cloned downstream of the constitutive 35S promoter. Wild-type 399

plants were transformed with the constructs, and T1 seedlings were selected via 400

Kanamycin resistance. For both silencing constructs, the T1 plants had varying 401

degrees of paleness - from wild-type-like plants to very pale plants that were stunted 402

in growth (Figure 9B). Notably, the pale plants strongly resembled miR-mdh-1 plants. 403

Immunoblots were performed on protein extracts from the leaves of these silencing 404

lines, using antibodies against FtsH12 and pdNAD-MDH to test the impact of FtsH12 405

silencing on these proteins. The molecular weight of FtsH12 is 115 kDa, including 406

14

the chloroplast transit peptide (49 amino acids), and the mature peptide is predicted 407

to be 110 kDa. No FtsH12 protein was detectable in the T1 plants with the strongest 408

pale phenotype (amiRNA FtsH12 A 3-1, amiRNA FtsH12 B 2-1), and those with 409

intermediate levels of paleness had reduced amounts of FtsH12 protein (Figure 9C). 410

Surprisingly, there was also no detectable FtsH12 protein in the miR-mdh-1 plants. 411

Quantitative immunoblot analysis showed a 7-fold reduction in FtsH12 protein 412

abundance in miR-mdh-1 leaves relative to wild type (Supplemental Figure 6. 413

However, pdNAD-MDH protein levels were unaffected by FtsH12 silencing. 414

415

pdNAD-MDH Activity is not Required for its Interaction with the FtsH12-FtsHi 416

Complex 417

418

We tested whether the FtsH12-FtsHi complex could also interact with the NAD-MDH 419

isoforms from other cellular compartments that could not complement the embryo 420

lethality of pdnad-mdh when targeted to chloroplasts. We extracted proteins from 4-421

week-old rosettes of heterozygous pdnad-mdh plants expressing the YFP-tagged 422

NAD-MDH isoforms (Figure 7A) and performed anti-YFP IPs for analysis by LC-423

MS/MS. IPs were also performed with extracts from pdnad-mdh PpdNAD-MDH:pdNAD-424

MDH-YFP plants (as a positive control) and from wild-type Ler plants (as a negative 425

control). We did not detect peptides matching Ycf2, FtsH12 or the FtsHi proteins in 426

the IPs with most NAD-MDH-YFP isoforms. One exception was the IP with 427

AtmMDH1-YFP, where four peptide hits were found matching Ycf2 and four 428

matching FtsH12, but none matching FtsHi subunits. These peptide counts were 429

very low compared to those found in the pdNAD-MDH-YFP IP, which yielded 193 430

and 155 peptides matching Ycf2 and FtsH12, respectively, and many peptides 431

matching FtsHi subunits (Table 3). Thus, none of these NAD-MDH isoforms readily 432

associated with the FtsH12-FtsHi complex. However, in the IPs of the NAD-MDH 433

isoforms, peptides matching pdNAD-MDH were found. This suggests that the NAD-434

MDH isoforms may dimerise with the endogenous pdNAD-MDH protein, since MDHs 435

are known to form dimers (Minárik et al., 2002). 436

437

We conducted a similar experiment with the enzymatically-inactive pdNAD-MDH-438

FlagHA proteins, which complemented the embryo lethality of homozygous pdnad-439

mdh plants. Instead of beads conjugated to an anti-YFP antibody, we used beads 440

15

conjugated to an anti-HA antibody, since the inactive pdNAD-MDH proteins were 441

tagged with a Flag-HA tag. Again, pdnad-mdh plants complemented with PpdNAD-442

MDH:pdNAD-MDH-Flag-HA and wild-type plants served as positive and negative 443

controls, respectively. Peptides matching the Flag-HA-tagged pdNAD-MDH proteins 444

were present with the highest abundance within each IP, indicating that each of the 445

fusion proteins was effectively enriched. All of the components of the FtsH12-FtsHi 446

complex co-purified with the different pdNAD-MDH catalytic mutants, with peptide 447

counts that were similar to those in the IPs with wild-type protein (Table 4). Thus, the 448

point mutations in the catalytic centre did not affect the protein-protein interaction 449

between pdNAD-MDH with the FtsH12-FtsHi complex. 450

451

Mutated Forms of pdNAD-MDH that Cannot Bind NADH Still Complement the 452

Knockout Phenotype 453

454

Our data show that the enzymatic activity of pdNAD-MDH is dispensable, yet the 455

protein has a critical role within the FtsH12-FtsHi complex. Our strategy to abolish 456

the enzymatic activity of pdNAD-MDH disrupted the malate/oxaloacetate binding 457

site. However, it is still possible that the mutants can bind their cofactor NADH and 458

might function as a redox sensor for the AAA-ATPase complex. To investigate this, 459

we performed Isothermal Titration Calorimetry (ITC) with the enzymatically-inactive 460

pdNAD-MDH proteins to test if they were still capable of binding NADH. ITC 461

measures the heat released or taken up as the titrated cofactor (NADH) binds the 462

protein (pdNAD-MDH), depending on whether it is an exothermic or endothermic 463

binding event. We titrated NADH into the wild-type pdNAD-MDH recombinant protein 464

in four independent experiments, each using freshly purified recombinant protein, 465

and observed binding with a mean dissociation constant (Kd) of 7.54 ± 0.53 µM 466

(Figure 10A). Titration of NADH into the R162Q variant resulted in binding with a 467

similar mean Kd (6.75 ± 0.15 µM, from 2 independent experiments; Figure 10B), 468

suggesting that this mutation does not abolish co-factor-binding. However, no NADH 469

binding could be detected for the R234Q variant or for the R162Q R234Q variant 470

(Figure 10C-D). Since these two variants could also complement pdnad-mdh, we 471

can rule out the possibility that co-factor binding of the pdNAD-MDH protein plays a 472

significant role in the FtsH12-FtsHi complex. 473

474

16

DISCUSSION 475

476

pdNAD-MDH is Required for Chloroplast Development 477

478

Our results demonstrate that the pdNAD-MDH protein plays a vital role in plastid 479

development, both during and after embryogenesis in Arabidopsis. During 480

embryogenesis, plastids start to differentiate into chloroplasts in cotyledons at the 481

late globular stage. They expand during the early heart stage, as thylakoids and 482

grana stacks begin to develop (Mansfield and Briarty, 1991). Embryos of the pdnad-483

mdh knockout mutant arrest in the globular-to-heart transition stage (Beeler et al., 484

2014), like many other mutants that are defective in genes essential for chloroplast 485

biogenesis (Yu et al., 2004; Ruppel and Hangarter, 2007; Feng et al., 2014; Lu et al., 486

2014). 487

488

Previously, we studied the viable constitutive silencing line, miR-mdh-1, where 489

pdNAD-MDH levels were reduced, but not abolished, at most or all stages of plant 490

growth. Using the ABI3 promoter to drive embryo-specific expression of pdNAD-491

MDH enabled us to complement the embryo lethality of homozygous pdnad-mdh 492

plants and determine the role of pdNAD-MDH in vegetative growth (Figure 1). These 493

plants were seedling-lethal, with albino leaves containing highly aberrant plastids 494

(Figure 2, 3). This confirms the notion that pdNAD-MDH plays a vital role in post-495

embryogenesis chloroplast development. The phenotype of seedlings resulting from 496

the embryo-specific complementation of pdnad-mdh is more severe than – but 497

consistent with - those observed in miR-mdh-1 plants, which also have pale leaves 498

with aberrant chloroplast ultrastructure. This pale phenotype of miR-mdh-1 results 499

from MDH-deficiency during leaf development rather than from defective 500

embryogenesis. This is further supported by the finding that inducible silencing of 501

pdNAD-MDH at the rosette stage resulted in white/pale newly emerging leaves 502

(Figure 4). 503

504

We propose that pdNAD-MDH is required for the early stages of plastid 505

differentiation. This is most obviously reflected by the absence of internal membrane 506

structure in leaf plastids of embryo-complemented pdnad-mdh and by the reduced 507

thylakoid structure in miR-mdh-1 chloroplasts. However, the aberrant formation of 508

17

internal structure was even observed in etioplasts of miR-mdh-1, the majority of 509

which lacked normal prolamellar bodies (PLBs; Figure 5) and were deficient in many 510

of the precursors required for forming photosynthetic chloroplasts 511

(protochlorophyllide, PORA, galactolipids, and carotenoids; Figure 6). Thus, the 512

presence of pdNAD-MDH is required – either directly or indirectly - for the proper 513

synthesis of several component classes, which serve as the building blocks of 514

thylakoid membranes. Deficiency of these components, caused by other mutations, 515

is known to lead to aberrant PLBs. For example, etioplasts of Arabidopsis carotenoid 516

and chloroplast regulation (ccr) mutants have reduced lutein levels and lack PLBs, 517

suggesting that specific carotenoids are essential for PLB formation (Park et al., 518

2002). PLB formation is absent or aberrant in mutants that cannot make 519

protochlorophyllide (Mascia, 1978; Solymosi and Aronsson, 2013) and in the 520

constitutive photomorphogenic 1 (cop1) mutant (Deng et al., 1991; Lebedev et al., 521

1995), where the lack of PLBs is attributed to a deficiency in PORA or PORB 522

(Sperling et al., 1998). 523

524

Monogalactosyl diacylglycerol (MGDG) and diagalactosyl diacylglycerol (DGDG) are 525

the most abundant lipids in thylakoid membranes in chloroplasts, and MGDG is the 526

most dominant lipid in PLBs. The interaction between PORA and MGDG is thought 527

to stabilize the formation of PLBs (Klement et al., 1999; Engdahl et al., 2001; 528

Selstam et al., 2002). There are conflicting data regarding the effects of suppressing 529

MGDG synthase 1 (MGD1) involved in MGDG synthesis (Jarvis et al., 2000; 530

Kobayashi et al., 2007), possibly resulting from differences between the T-DNA 531

alleles. However, recent findings suggest that MGD1 is involved in the initial step of 532

etioplast development by providing a lipid matrix for protochlorophyllide biosynthesis 533

(Fujii et al., 2017). The silencing of MGD1 decreased MGDG levels in etiolated 534

seedlings, as well as total protochlorophyllide levels. Given that these reports show 535

that the deficiency of one component can cause a pleiotropic decrease in the 536

accumulation of another, the finding that the levels of all major PLB components are 537

reduced in miR-mdh-1 does not allow us to pin down a specific metabolic pathway 538

where pdNAD-MDH is required. 539

540

In seedlings undergoing photomorphogenesis, proplastids develop into chloroplasts, 541

bypassing the etioplast stage, and the extent to which the etioplast is a good model 542

18

for this direct route of chloroplast development is debatable (Solymosi and Schoefs, 543

2010). However, it is important to note that all major PLB components, with the 544

exception of protochlorophyllide and PORA, are also major components of 545

developed chloroplasts, and we observed similar reductions in the levels of these 546

compounds in miR-mdh-1 relative to the wild type in photomorphogenic seedlings. 547

The reduced amounts of these compounds suggest that pdNAD-MDH is required for 548

their proper synthesis in both etioplast-dependent and independent routes of 549

chloroplast development. 550

551

552

Enzymatically-Inactive pdNAD-MDH Complements the pdnad-mdh Mutant 553

554

Unexpectedly, we discovered that the embryo-lethal phenotype of the pdnad-mdh 555

mutant is not caused by the loss of plastidial NAD-MDH activity. On one hand, three 556

different mutated forms of the enzyme that were enzymatically-inactive and, in two 557

cases, that additionally could not bind NADH, could complement the embryo-lethal 558

phenotype when expressed in pdnad-mdh (Figure 8, 10). The complemented plants 559

grew normally and were not pale or albino, as were miR-mdh-1 or embryo-560

complemented pdnad-mdh plants. On the other hand, expressing other NAD-MDH 561

isoforms in chloroplasts failed to complement the pdnad-mdh phenotype (Figure 7). 562

These observations suggest that the phenotypes of pdnad-mdh plants are 563

specifically caused by the absence of the pdNAD-MDH protein itself (Figure 8). 564

565

Our data do not rule out the previously proposed role of pdNAD-MDH in balancing 566

redox equivalents via its enzymatic interconversion of malate and oxaloacetate (i.e. 567

the malate valve model; Scheibe, 2004), but we argue that this is not the essential 568

function of the protein. Nevertheless, it is important to note that the pdNAD-MDH 569

protein has MDH activity and that the catalytic residues are conserved among 570

orthologous proteins in other plants (Supplemental Figure 7). Thus, it is likely that the 571

enzymatic activity is important under specific conditions or tissues, such as in pollen 572

tubes during expansion (Selinski et al., 2014). Indeed, in a recent genome-wide 573

association study, pdNAD-MDH was mapped as a quantitative trait locus for malate 574

levels in Arabidopsis (Fusari et al., 2017). Furthermore, mutations in pdNAD-MDH 575

rescued the phenotype of the mosaic death 1 (mod1) mutant, which accumulates 576

19

reactive oxygen species (ROS) and shows abnormal patterns of programmed cell 577

death (PCD) (Zhao et al., 2018). Interestingly, the mod1 mutant is proposed to 578

generate ROS in the mitochondria in response to a signal from the chloroplast. The 579

fact that mMDH1 mutations could also suppress the mod1 phenotype suggests that 580

a malate valve may facilitate the communication between mitochondria and 581

chloroplasts (Zhao et al., 2018). These findings are consistent with our results, as 582

they suggest that the malate valve is not essential. 583

584

Interestingly, we found slightly fewer than the expected 25% of pdnad-mdh plants in 585

the T2 generation (Figure 8C), particularly for the construct that encoded proteins 586

with two amino acid substitutions. This may reflect incomplete complementation by 587

these non-enzymatic proteoforms at certain developmental stage, either because 588

MDH activity is beneficial or because the introduction of amino-acid substitutions in 589

the catalytic centre may affect the integrity or half-life of the protein itself. Further 590

work will be required to assess the importance of NAD-MDH activity in the 591

chloroplast and the extent to which its role can be compensated by the presence of 592

NADP-MDH. As the loss of NADP-MDH activity alone also has a relatively mild 593

impact on plant growth (Hebbelmann et al., 2012), generating lines expressing the 594

inactive pdNAD-MDH constructs in the pdnad-mdh nadp-mdh double mutant 595

background would be highly valuable for reassessing the importance of MDH activity 596

and the malate valve in the chloroplast. 597

598

pdNAD-MDH Functions in Complex with AAA-Proteases at the Chloroplast 599

Inner Envelope 600

601

We demonstrate that pdNAD-MDH interacts with members of a proposed large AAA 602

protease complex localised to the chloroplast inner envelope composed of FtsH12 603

and FtsHi subunits, as well as with Ycf2 (Table 1, 2; Figure 11). Proteomics data 604

indicate that most of the pdNAD-MDH protein is localized to the stroma and 605

chloroplast envelope, and only a minority of the protein associated to the thylakoid 606

membranes (Ferro et al., 2010), suggesting that a fraction of total pdNAD-MDH is 607

stably involved in this interaction. Further, Cvetić et al. (2008) identified pdNAD-MDH 608

in both the stromal and chloroplast envelope fractions of spinach leaf chloroplasts. 609

Plants lacking FtsH12 (emb1047, emb156), FtsHi2 (emb2083), FtsHi4 (emb3144) or 610

20

FtsHi5 (emb2458) are all embryo-lethal (Patton et al., 1991; Franzmann et al., 1995; 611

Patton et al., 1998; Sokolenko et al., 2002; Wagner et al., 2012; Lu et al., 2014). 612

Although no Arabidopsis mutant for the chloroplast genome-encoded Ycf2 is 613

currently available, a knockout mutant of the gene could not be generated using 614

plastome transformation in tobacco, suggesting that it is also essential (Drescher et 615

al., 2000). We verified that FtsH12 knockout plants were embryo-lethal and arrested 616

near the globular-to-heart transition stage, similar to pdnad-mdh. Furthermore, 617

Arabidopsis lines with constitutive silencing of FtsH12 expression had a striking 618

resemblance to the miR-mdh-1 line. Thus, the phenotypes observed from the loss of 619

pdNAD-MDH could be explained by the loss of FtsH12 function. Interestingly, in miR-620

mdh-1, FtsH12 protein levels were strongly reduced compared to wild type, whereas 621

the converse was not true; in the amiRNA FtsH12 lines, pdNAD-MDH protein levels 622

were similar to the wild type (Figure 9C). Taken together, these data support a 623

hypothesis where pdNAD-MDH plays a role in stabilising FtsH12, and possibly the 624

entire complex. The exact mechanism by which pdNAD-MDH stabilises FtsH12 is 625

still unknown, but it does not require pdNAD-MDH catalytic activity or NADH-binding, 626

as the inactive pdNAD-MDH proteins could still interact with FtsH12-FtsHi complex 627

members in plants (Table 4). However, other MDH isoforms from different cell 628

compartments could not interact with FtsH12, and no other MDH isoform was 629

identified in the immunoprecipitation experiment with FtsH12, suggesting that the 630

interaction is specific to pdNAD-MDH in chloroplasts (Table 2, 3). 631

632

Possible Role of the FtsH12-FtsHi Complex 633

634

AAA-type proteins generally form hexamers, where each subunit has an N-terminal 635

transmembrane segment and a C-terminal AAA-ATPase domain expanded in the 636

stroma. The FtsH12-FtsHi complex contains several members of the FtsHi family 637

(FtsHi1, FtsHi2, FtsHi4 and FtsHi5), which lack the zinc-binding motif that is 638

considered essential for its metalloprotease activity. In a co-expression network, all 639

members of the FtsH12-FtsHi complex clustered together with genes involved in 640

plastid translation, division and positioning, as well as amino acid metabolism 641

(Majsec et al., 2017). Non-proteolytic FtsHi proteins were reported to be absent from 642

the cyanobacterium Synechocystis and are thought to have evolved at a later stage 643

of evolution through gene duplication (Sokolenko et al., 2002). However, the activity 644

21

of the AAA protease complex does not require all six subunits to be active (Martin et 645

al., 2005). AAA-type proteases are also known to generate a pulling force. The 646

mechanism of target protein unfolding by AAA-type proteases includes a 647

conformational change in the AAA domain, which moves conserved, substrate-648

binding hydrophobic residues towards the inner pore of the hexameric complex. This 649

draws the substrate proteins inside the pore and unfolds them (Lee et al., 2001; 650

Langklotz et al., 2012). In mitochondria, the m-AAA protease, described as an ATP-651

dependent protease that degrades misfolded proteins and mediates protein 652

processing, is proposed to be further involved in the dislocation of imported 653

preproteins from the inner membrane by functioning as an ATP-driven molecular 654

motor (Tatsuta et al., 2007; Botelho Calado et al., 2013). In yeast mitochondria, 655

many nucleus-encoded preproteins are imported into the mitochondrial matrix via the 656

TIM23 translocon (Demishtein-Zohary and Azem, 2017). The FtsH12-FtsHi complex 657

could potentially play a similar role in chloroplasts. 658

659

Nakai (2018) recently proposed a novel ATP-driven import motor associated with the 660

TIC (translocon on the inner chloroplast membrane) complex at the inner chloroplast 661

envelope membrane. It is likely that the FtsH12-FtsHi complex, together with 662

pdNAD-MDH, is the proposed ATP-driven motor that imports pre-proteins across the 663

chloroplast envelopes. Consistent with this hypothesis, we also found large numbers 664

of peptides matching components of the chloroplast protein import machinery (e.g. 665

Ycf1 and Toc159) in our IP with FtsH12 (Table 2). However, further investigations 666

are needed to determine whether the function of FtsH12 in chloroplast development 667

is dependent on its proteolytic activity or solely on its ATPase activity. Further 668

studies will provide exciting new insights into the role of the FtsH12-FtsHi complex in 669

chloroplast development and function. 670

671

In conclusion, our data define pdNAD-MDH as a moonlighting protein essential for 672

chloroplast development. Moonlighting enzymes perform more than one function, 673

often serving a structural or regulatory function in addition to their known catalytic 674

function (Jeffrey, 1999, 2003; Copley, 2003; Moore, 2004). Moonlighting functions 675

occur frequently in highly conserved proteins and are thought to evolve more 676

commonly for soluble, highly abundant proteins that are constitutively expressed 677

(Huberts and van der Klei, 2010; Copley, 2015). Soluble abundant proteins are likely 678

22

to encounter many more biomolecular interactions within their environment, and 679

advantageous interactions can evolve over time (Copley, 2015). It has also been 680

proposed that acquiring a moonlighting function might be an easier way to expand 681

the functional tool box of an organism without the drawbacks resulting from an 682

expanding genome (Jeffery, 1999). Interestingly, lactate dehydrogenase, a homolog 683

of the MDH family, also plays a moonlighting role as a structural protein in the lenses 684

of bird eyes, and was one of the first examples of moonlighting proteins described 685

(Wistow et al., 1987; Hendriks et al., 1988; Huberts and van der Klei, 2010). A well-686

known example of a moonlighting enzyme in plant metabolism is hexokinase, which 687

is a key enzyme in central metabolism but also acts as a sugar sensor (Jang, 1997; 688

Moore, 2003). Also, Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) 689

isoforms, aside from their roles in glycolysis and the Calvin-Benson-Bassham cycle, 690

can regulate DNA stability, control gene expression, function in apoptosis, and act as 691

redox sensors (Zaffagnini et al., 2013; He et al., 2013; Yang and Zhai, 2017). 692

Recently, AROGENATE DEHYDRATASE2 (ADT2) was shown to localise to the 693

chloroplast division machinery in Arabidopsis, suggesting an additional non-694

enzymatic function besides its enzymatic role in phenylalanine biosynthesis (Bross et 695

al., 2017). However, pdNAD-MDH appears thus far to be a unique example in which 696

the moonlighting function is essential for plant survival. 697

698

METHODS 699

700

Plant Growth 701

Arabidopsis thaliana plants were grown in soil in growth cabinets (Percival AR-95 702

[CLF Plant Climatics]; OR Kälte 3000) fitted with fluorescent lamps and 703

supplemented with red LED panels. Unless stated otherwise, the chambers provided 704

a 12-h light/12-h dark cycle, with light intensity of 150 μmol photons m−2 s−1, 705

temperature of 20°C, and relative humidity of 65%. 706

707

For experiments with plate-grown seedlings, seeds were surface sterilized and 708

placed onto ½-strength Murashige and Skoog (MS) medium with vitamins and MES 709

(Duchefa Biochemie BV) at pH 5.8, solidified with 0.8 % (w/v) agar. The seeds were 710

stratified by incubating the plates in the dark at 4°C for two days. For etiolated 711

seedlings, germination was stimulated by placing the seeds on plates under white 712

23

light (150 μmol photons m−2 s−1) for 4-6 h, followed by growth for 5-6 days in the 713

dark. Light-grown seedlings were placed in either standard growth conditions (as 714

above for plants grown in soil) or in continuous light. For seedlings for lipid, 715

carotenoid and protochlorophyllide/PORA analysis, seeds were germinated on a 100 716

μm nylon mesh placed on solid medium to aid harvest. Dark-grown seedlings were 717

harvested under low green light illumination. 718

719

To select transformants on plates, the growth medium contained either 15 mg/L 720

BASTA, 15 mg/L Hygromycin or 50 mg/L Kanamycin, depending on the resistance 721

marker on the transgene. pdnad-mdh plants transformed with the constructs 722

encoding inactive pdNAD-MDH (R162Q, R234Q and R162Q R234Q) were selected 723

on soil by spraying them with BASTA (final concentration of 0.018% (w/v) glufosinate 724

(Omya). 725

726

The pdnad-mdh T-DNA insertion mutant (ET8629) and constitutive pdNAD-MDH 727

silencing line, miR-mdh-1, were characterized in (Beeler et al., 2014). The ftsh12 T-728

DNA lines (emb1047-1, emb1047-2, ftsh12 1-1, emb156-1) were ordered from the 729

Nottingham Arabidopsis Stock Centre (NASC). The heterozygous pdnad-mdh 730

mutant is in the Landsberg erecta (Ler) background, while miR-mdh-1 and ftsh12 T-731

DNA insertion lines are in the Columbia (Col-0) background. 732

733

Recombinant Protein Expression in Escherichia coli 734

735

All sequences of oligonucleotide primers used for cloning the following constructs 736

are listed in Supplemental Table 2. For the recombinant expression of pdNAD-MDH-737

His and its catalytic inactive variants in E. coli, pdNAD-MDH was cloned into the 738

pET21a+ expression vector. First, the length of the chloroplast transit peptide (cTP) 739

was predicted using the Target P server (http://www.cbs.dtu.dk/services/TargetP/). 740

The full-length coding sequence of pdNAD-MDH without the cTP was amplified with 741

NdeI and NotI restriction sites, using the pdNAD-MDH:pDONR221 vector as a 742

template (Beeler et al., 2014). The PCR product was cloned into the pET21a+ vector 743

(Novagen) using the restriction sites. The point mutations in the catalytic centre of 744

pdNAD-MDH were generated in the pdNAD-MDH:pDONR221 vector using a 745

QuikChange Site-Directed Mutagenesis Kit (Agilent Technologies) according to the 746

24

manufacturer’s instructions. The mutated coding sequences were then cloned into 747

pET21a+ as described for the wild-type sequence. 748

749

For protein expression, the vectors were transformed into E. coli BL21 (DE3) 750

CodonPlus cells (Agilent Technologies). The cells were cultured in LB medium at 751

37°C until OD600 of 0.5-0.7. Protein expression was induced by adding 1 mM 752

Isopropyl β-D-1-thiogalactopyranoside (IPTG), and the cultures were incubated 753

overnight at 20°C. Cell lysis and purification of the His-tagged proteins were carried 754

out as described in (Seung et al., 2013). 755

756

NAD-MDH Enzyme Activity Measurements 757

758

Enzyme activity of the pdNAD-MDH recombinant proteins was measured 759

spectrophotometrically in an infinite® M1000 Pro plate reader (Tecan). Each reaction 760

contained 0.092 M Tris-HCl, pH 7.9, 0.01 M MgCl2, 0.2 mM NADH, and 0.01 μg 761

recombinant protein. The baseline rate at 340 nm was acquired for 5 min at 20°C, 762

measuring absorbance every 20 s. The reaction was started by adding 0.09 mM 763

oxaloacetate. The linear decline in absorbance at 340 nm was monitored and used 764

to calculate the rate of NADH consumption. Activity was determined three times on 765

the same protein preparation to calculate the mean ± SE. 766

767

Immunoblotting and Native PAGE 768

769

To extract soluble proteins, young leaves were homogenised in protein extraction 770

medium (100 mM 3-[N-Morpholino]-2-hydroxypropanesulfonic acid [MOPS, pH 7.2], 771

1 mM EDTA, 10% (v/v) ethylene glycol, 2 mM dithiothreitol, 1 x Complete Protease 772

Inhibitor cocktail [Roche]). Insoluble material was pelleted at 20,000 g. Protein 773

content in the supernatant was determined using the Bradford assay. To extract total 774

protein from leaves (Figure 4), frozen 7-mm leaf disc were ground with 2-3 glass 775

beads in a mixer mill (Retsch MM 200). The powder was suspended in SDS-PAGE 776

loading buffer (50mM Tris-HCl, pH 6.8, 100 mM DTT, 2% [w/v] SDS, 30% [v/v] 777

glycerol, 0.005% [w/v] bromophenol blue) and heated to 95°C for 5 min. Insoluble 778

material was removed via centrifugation, and 5 µl samples were loaded onto SDS-779

PAGE gels. To extract total protein from seedlings (Figure 6), frozen seedling 780

25

samples were extracted with SDS-PAGE loading buffer (at 100 mg/mL) and 10 µl 781

samples were loaded onto SDS-PAGE gels. 782

783

For immunodetection of pdNAD-MDH, we used rabbit antisera raised against the 784

Arabidopsis pdNAD-MDH protein (Beeler et al., 2014). For FtsH12, we used rabbit 785

antisera raised against the Arabidopsis FtsH12 protein, which was a gift from Dr. 786

Masato Nakai (Osaka University). For the detection of epitope-tagged proteins, we 787

used α-GFP/YFP (ab290, Abcam), α-HA (ab9110, Abcam), α-Flag M2 (F1804, 788

Sigma), and α-PORA (Agrisera). Proteins were detected based on infrared 789

fluorescence using IR800-conjugated secondary antibodies and an Odyssey CLx 790

detection system (Li-cor). Where actin was detected as a loading control, the rabbit 791

primary antibody was co-incubated with a mouse monoclonal antibody against plant 792

actin (A0480, Sigma), which was detected in the same blot using a 680RD-793

conjugated anti-mouse secondary antibody. Primary antibody dilutions are as 794

follows: α-pdNAD-MDH - 1:2,000, α-FtsH12 - 1:1000, α-GFP/YFP - 1:10,000, α-HA - 795

1:7,000, α-Flag M2 - 1:5,000, α-PORA – 1:2,000, α-actin - 1:10,000. 796

797

Native PAGE observation of NAD-MDH activity was performed as described (Beeler 798

et al., 2014). 799

800

Bioinformatic Analyses 801

802

For amino acid sequence alignments, all Arabidopsis MDH isoform sequences were 803

retrieved from TAIR, while pdNAD-MDH sequences from different plant species were 804

retrieved from the Phytozome v12 database 805

(https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3245001/). Sequences were aligned 806

using Clustal Omega. 807

808

For homology-based modelling of the pdNAD-MDH protein structure, the pdNAD-809

MDH protein sequence without the cTP was modelled using SWISS-MODEL 810

(https://www.ncbi.nlm.nih.gov/pubmed/24782522) onto the human MMDH2 structure 811

as a template (PDB: 2DFD), which was co-crystallized with malate and NAD. 812

813

26

Cloning of Expression Vectors for Plant Transformation 814

815

Constructs for Arabidopsis transformation were assembled using Gateway 816

technology (Invitrogen). For multi-site Gateway assembly, we prepared the promoter, 817

coding sequence or tag in appropriate pENTR or pDONR vectors. The ABI3 818

promoter (2176 bp) was amplified from Arabidopsis genomic DNA, flanked with 819

HindIII restriction sites, and ligated into the pENTR vector between the attL4 and 820

attR1 recombination sites at the 5’ and 3’ ends, respectively. The pdNAD-MDH 821

promoter in pDONR P4-P1r and the pdNAD-MDH coding sequence in pDONR221 822

were described previously. The coding sequences of the various NAD-MDH isoforms 823

fused to the chloroplast transit peptide of the Rubisco small subunit were 824

synthesized by Biomatik, flanked by attB1 and atttB2 recombination sites. These 825

sequences were recombined directly into the pDONR221 vector. The eYFP and 826

Flag-HA tags were cloned into pDONR P2R-P3 (Beeler et al., 2014; Tschopp et al., 827

2017). The appropriate promoter, coding sequence, and C-terminal tag were 828

recombined via an LR Clonase reaction into the multisite Gateway binary vector 829

pB7m34GW,0. 830

831

To generate overexpressor lines of pdNAD-MDH and FtsH12, the pDONR221 vector 832

containing the corresponding coding sequence was recombined in a LR Clonase 833

reaction into the single Gateway binary vector pB7YWG2,0 (with a 35S promoter and 834

C-terminal YFP tag, Karimi et al., 2002) and pUBC-YFP (Grefen et al., 2010), 835

respectively. 836

837

To generate artificial microRNA silencing constructs, we recombined the amiRNA 838

miR-mdh-1 cassette in pDONR221 (described previously; Beeler et al., 2014) into a 839

vector containing an estradiol inducible cassette (XVE) driven by the UBIQUITIN10 840

promoter, via the LR Clonase reaction (Lee et al., 2013; Gujas et al., 2017). Two 841

artificial microRNA silencing cassettes for FtsH12 were designed and cloned using 842

the Web MicroRNA Designer tool (WMD3, wmd3.weigelworld.org; Ossowski et al., 843

(2008) according to the provided instructions. The primers used are provided in 844

Supplemental Table 2., The assembled amiRNAs were flanked with attB1 and attB2 845

recombination sites using the ‘attB1-amiRNA FW’ and ‘attB2-amiRNA REV’ primers 846

(Supplemental Table 2) and recombined in pDONR221 vectors using the BP 847

27

Clonase reaction. Instead of the pART27 vector, we further recombined the insert 848

into the binary pJCV52 vector via an LR Clonase reaction. 849

850

To generate stable Arabidopsis lines, the appropriate constructs were transformed 851

into Agrobacterium tumefaciens (strain GV3101). Wild-type Columbia and 852

heterozygous pdnad-mdh plants were transformed using the floral dip method as 853

described previously (Zhang et al., 2006). The T1 generation of transformants were 854

selected using the BASTA or Hygromycin selection marker (as described above for 855

plant growth). Up to 10 seedlings per line were screened for transgene expression 856

using immunoblotting (using the antibody against the epitope tag) and genotyped for 857

the pdnad-mdh T-DNA insertion in the case of transformed pdnad-mdh plants. For 858

plants expressing the transgene, the number of T-DNA insertion loci was determined 859

by segregation analysis of the resistance marker gene in the T2 generation. Two 860

independent transformants with single insertions, originating from different T0 861

parents, were selected for further analysis - either in the T2 generation (BASTA 862

resistant plants that are heterozygous or homozygous for the transgene) or T3 863

generation (plants that are homozygous for the transgene), as specified. 864

865

Transient expression in Nicotiana benthamiana leaves was performed according to 866

Seung et al. (2015). 867

868

Immunoprecipitation Experiments 869

870

Proteins were extracted from leaf tissue of Arabidopsis plants expressing the epitope 871

tagged proteins by homogenising in immunoprecipitation medium (50 mM Tris-HCl, 872

pH 8.0, 150 mM NaCl, 1% [v/v] Triton X-100, 1 mM DTT and Complete Protease 873

Inhibitor cocktail [Roche]). Insoluble material was removed by centrifugation. The 874

supernatant was incubated for 1 h at 4°C with µMACS magnetic beads conjugated to 875

α-YFP or α-HA (Miltenyi Biotec). After incubation, the beads were recovered using a 876

µColumn (Miltenyi Biotec) on a magnetic stand. The beads were washed five times 877

with immunoprecipitation medium before eluting the bound proteins with elution 878

buffer (50 mM Tris-HCl, pH 7.5, 2% [w/v] SDS). The proteins were precipitated by 879

the addition of 10% (w/v) TCA. After two washes with cold acetone, the protein pellet 880

was dissolved in 10 mM Tris, pH 8.2, 2 mM CaCl2 and digested with trypsin for 30 881

28

min at 60°C. The resulting peptides were dried, dissolved in 0.1% (v/v) formic acid, 882

and analysed by LC-MS/MS on a nanoAcquity UPLC (Waters Inc.) connected to a Q 883

Exactive mass spectrometer (Thermo Scientific) equipped with a Digital PicoView 884

source for electrospray ionisation (New Objective). Peptides were trapped on a 885

Symmetry C18 trap column (5 µm, 180 µm x 20 mm, Waters Inc.) and separated on 886

a BEH300 C18 column (1.7 µm, 75 µm x 150 m, Waters Inc.) at a flow rate of 250 887

nl/min using a gradient from 1% solvent B (0.1% formic acid in acetonitrile, 888

Romil)/99% solvent A (0.1% formic acid in water, Romil) to 40% solvent B/60% 889

solvent A within 90 min. The mass spectrometer settings were as follows: Data 890

dependent analysis; Precursor scan range 350 – 1500 m/z, resolution 70,000, 891

maximum injection time 100 ms, threshold 3e6; Fragment ion scan range 200 – 2000 892

m/z, Resolution 35,000, maximum injection time 120 ms, threshold 1e5. Proteins 893

were identified using the Mascot search engine (Matrix Science, version 2.4.1) 894

against the TAIR10 Arabidopsis proteome database, with fragment ion mass 895

tolerance of 0.030 Da, parent ion tolerance of 10.0 PPM, and oxidation of methionine 896

was specified in Mascot as a variable modification. Scaffold (Proteome Software 897

Inc.) was used to validate MS/MS based peptide and protein identifications. Peptide 898

identifications were accepted if they achieved a false discovery rate (FDR) of less 899

than 0.1% by the Scaffold Local FDR algorithm. Protein identifications were 900

accepted if they achieved an FDR of less than 1.0% and contained at least 2 901

identified peptides. 902

903

904

Light and Electron Microscopy 905

906

Transmission electron microscopy analyses were conducted as previously described 907

(Beeler et al., 2014). For DIC images of embryos, seeds were cleared with a 908

glycerin:chloral hydrate:water (1:8:3, w/w/w) solution for 2-6 h, depending on the 909

developmental stage of the seeds (Breuninger et al., 2008). Embryos were imaged 910

under an Axio Imager 2 microscope with ZEN pro 2011 software (Zeiss). For imaging 911

of YFP in leaf tissue, confocal laser scanning microscopy was conducted as 912

previously described (Beeler et al., 2014). 913

914

915

Isothermal Titration Calorimetry 916

917

29

Binding of NADH to recombinant pdNAD-MDH proteins (WT, R162Q, R234Q, 918

R162Q R234Q) was measured with a VP-ITC instrument at 25°C. 40 injections of 919

cofactor solution (400 µM NADH), each with a volume of 6 µL, were made into a 920

recombinant protein solution (40 µM). An injection spacing of 300 s was selected, 921

and duration was automatically calculated. An initial injection of 2 µL was excluded 922

from data analysis. Default sample cell volume was 1.4644 mL. Stirring speed and 923

reference power were set to 307 RPM and 10 µCal.sec-1, respectively. Before 924

measurement, samples were degassed for 5 min at 23°C. The proteins were 925

desalted into ITC buffer (20 mM Tris-HCl, pH 7.5, 10 mM NaCl) with and without 2.5 926

mM 2-Mercaptoethanol (Sigma) using Illustra NAP-5 (Fisher Scientific AG) prior to 927

the experiment. The ligand tested was NADH (Grade I, Roche) dissolved directly into 928

the ITC buffer. Concentrations of the proteins and NADH were determined 929

spectrophotometrically using following extinction coefficients (Ɛ340nm [NADH] = 930

6220 M-1 cm-1; Ɛ280nm [pdNAD-MDH] = 8940 M-1 cm-1). 931

932

933

Lipid and Carotenoid Measurements 934

935

For targeted lipid profiling, 6-day-old light or dark-grown seedlings were ground into 936

a fine powder in liquid nitrogen using a mortar and pestle. Ground plant material (30-937

60 mg, precisely weighed for each sample) was extracted with 0.4 mL 938

tetrahydrofuran/methanol (50:50, v/v) including 5 µg/mL hydrogenated MDGD 939

(Matreya) as an internal standard. 10-15 glass beads were added and the samples 940

were homogenized for 3 min at 30 Hz in a tissue lyser (Qiagen). Insoluble material 941

was removed by two-rounds of centrifugation at 16,000 g for 3 min. 200 µL of 942

supernatant was transferred to an appropriate glass vial for immediate UHPLC-943

QTOF-MS analysis (Waters) as previously described (Martinis et al., 2011; Kessler 944

and Glauser, 2014). Raw data were processed using MassLynx version 4.1 (waters) 945

for automatic peak analysis. Identification and relative quantification were performed 946

as described in Spicher et al., 2017. 947

Protochlorophyllide Measurements 948

Six-day-old etiolated seedlings were harvested and ground into fine powder in liquid 949

nitrogen using a mortar and pestle. Protochlorophyllide was extracted twice in 9:1 950

30

mix (v/v) of acetone:0.1 M NH4OH, and insoluble material was removed by pelleting 951

at 13,000 g for 10 min after each extraction (Cheminant et al., 2011). The two 952

extractions were combined, and emission spectra were recorded from 500-750 nm 953

following excitation at 440 nm using a fluorescence spectrophotometer (Tecan 954

infinite M1000). Protochlorophyllide was quantified at the emission peak of 632 nm, 955

and expressed as fluorescence per mg of fresh weight. 956

Accession Numbers 957

Sequence data from this article can be found in TAIR (www.arabidopsis.org) under 958

the following accession numbers: pdNAD-MDH (At3g47520), FtsH12 (At1g79560), 959

FtsHi1 (At4g23940), FtsHi2 (At3g16290), FtsHi4 (At5g64580), FtsHi5 (At3g04340), 960

and YCF2 (AtCg00860). TAIR accession numbers of potential interaction partners 961

are provided in Tables 1–4. 962

Supplemental Data 963

Supplemental Figure 1 Exogenous supply of sucrose did not rescue pdnad-mdh 964

seedlings. 965

Supplemental Figure 2 Examples of normal, compromised, and absent prolamellar 966

body structures in Col and miR-mdh-1, observed via transmission electron 967

microscopy. 968

Supplemental Figure 3 Multiple protein sequence alignment of all nine Arabidopsis 969

thaliana malate dehydrogenase isoforms. 970

Supplemental Figure 4 Native-PAGE gel analysis of heterozygous pdnad-mdh 971

plants expressing various NAD-MDH isoforms. 972

Supplemental Figure 5 FtsH12 localisation and embryo lethality of the ftsh12 973

mutant. 974

Supplemental Figure 6 Quantification of FtsH12 in miR-mdh-1. 975

976

Supplemental Figure 7 Sequence alignment of pdNAD-MDH isoforms in various 977

plant species, algae and E. coli. 978

Supplemental Table 1 Total set of lipids measured in 6-day-old wild-type (Col) and 979

miR-mdh-1 seedlings. 980

Supplemental Table 2 Oligonucleotide primers used in this study. 981

31

Supplemental Data Set 1 Complete list of proteins identified in immunoprecipitates 982

by MS/MS. 983

984

ACKNOWLEDGMENTS 985

986

This work was funded by the Swiss National Foundation (SNF) (Grant Number 987

31003A_156987 to O.K. and S.C.Z.) and by ETH Zurich. We thank Claudia Di 988

Césaré from the Neuchâtel Platform of Analytical Chemistry for technical assistance, 989

as well as Peter Hunziker, Yolanda Joho-Auchli and Simone Wüthrich from the 990

Functional Genomic Centre Zurich (FGCZ) for mass spectrometry analysis. We 991

thank Masato Nakai for sharing his unpublished work and his thoughts with us, 992

Enrico Martinoia and Alisdair Fernie for fruitful discussions during the course of this 993

work and Andrea Ruckle for help in plant culture. 994

995

AUTHOR CONTRIBUTIONS 996

997

T.B.S., S.C.Z., and O.K. conceived and directed the research; T.B.S., A.C., S.C.Z., 998

and O.K. designed the experiments; T.B.S., A.C., E.D., M.S., F.G., M.S., F.K., S.H., 999

D.A., and B.A.M. performed research and analysed data; T.B.S. and S.C.Z. wrote1000

the manuscript with input from all of the authors. 1001

1002

REFERENCES 1003 1004

Bahl, J., Francke, B., and Monéger, R. (1976). Lipid composition of envelopes, prolamellar bodies 1005 and other plastid membranes in etiolated, green and greening wheat leaves. Planta 129: 193–1006 201. 1007

Beeler, S., Liu, H.-C., Stadler, M., Schreier, T., Eicke, S., Lue, W.-L., Truernit, E., Zeeman, S.C., 1008 Chen, J., and Kotting, O. (2014). Plastidial NAD-Dependent Malate Dehydrogenase Is Critical 1009 for Embryo Development and Heterotrophic Metabolism in Arabidopsis. Plant Physiol. 164: 1010 1175–1190. 1011

Berkemeyer, M., Scheibe, R., and Ocheretina, O. (1998). A novel, non-redox-regulated NAD-1012 dependent malate dehydrogenase from chloroplasts of Arabidopsis thaliana L. J. Biol. Chem. 1013 273: 27927–27933. 1014

Birktoft, J.J. and Banaszak, L.J. (1983). The presence of a histidine-aspartic acid pair in the active 1015 site of 2-hydroxyacid dehydrogenases. X-ray refinement of cytoplasmic malate dehydrogenase. 1016 J. Biol. Chem. 258: 472–482.1017

Bodi, Z., Zhong, S., Mehra, S., Song, J., Graham, N., Li, H., May, S., and Fray, R.G. (2012). 1018 Adenosine Methylation in Arabidopsis mRNA is Associated with the 3′ End and Reduced Levels 1019 Cause Developmental Defects. Front. Plant Sci. 3: 1–10. 1020

Botelho Calado, S., Tatsuta, T., Von Heijne, G., and Kim, H. (2013). Dislocation by the m-AAA 1021 protease increases the threshold hydrophobicity for retention of transmembrane helices in the 1022 inner membrane of yeast mitochondria. J. Biol. Chem. 288: 4792–4798. 1023

Breuninger, H., Rikirsch, E., Hermann, M., Ueda, M., and Laux, T. (2008). Differential Expression 1024 of WOX Genes Mediates Apical-Basal Axis Formation in the Arabidopsis Embryo. Dev. Cell 14: 1025

32

867–876. 1026 Bross, C.D., Howes, T.R., Rad, S.A., Kljakic, O., and Kohalmi, S.E. (2017). Subcellular localization 1027

of Arabidopsis arogenate dehydratases suggests novel and non-enzymatic roles. J. Exp. Bot. 1028 68: 1425–1440. 1029

Candela, H., Pérez-Pérez, J.M., and Micol, J.L. (2011). Uncovering the post-embryonic functions of 1030 gametophytic- and embryonic-lethal genes. Trends Plant Sci. 16: 336–345. 1031

Cheminant, S., Wild, M., Bouvier, F., Pelletier, S., Renou, J.-P., Erhardt, M., Hayes, S., Terry, 1032 M.J., Genschik, P., and Achard, P. (2011). DELLAs Regulate Chlorophyll and Carotenoid 1033 Biosynthesis to Prevent Photooxidative Damage during Seedling Deetiolation in Arabidopsis. 1034 Plant Cell 23: 1849–1860. 1035

Clarke, A.R., Wigley, D.B., Chia, W.N., Barstow, D., Atkinson, T., and Holbrook, J.J. (1986). Site-1036 directed mutagenesis reveals role of mobile arginine residue in lactate dehydrogenase catalysis. 1037 Nature 324: 699–702. 1038

Comparot-Moss, S., Kötting, O., Stettler, M., Edner, C., Graf, A., Weise, S.E., Streb, S., Lue, W.-1039 L., MacLean, D., Mahlow, S., Ritte, G., Steup, M., Chen, J., Zeeman, S.C., and Smith A.M. 1040 (2010). A Putative Phosphatase, LSF1, Is Required for Normal Starch Turnover in Arabidopsis 1041 Leaves. Plant Physiol. 152: 685–697. 1042

Copley, S.D. (2015). An Evolutionary Perspective on Protein Moonlighting. Biochem Soc Trans. 42: 1043 1684–1691. 1044

Copley, S.D. (2003). Enzymes with extra talents: Moonlighting functions and catalytic promiscuity. 1045 Curr. Opin. Chem. Biol. 7: 265–272. 1046

Cvetić, T., Veljović-Jovanović, S., and Vučinić, Ž (2008) Characterization of NAD-dependent 1047 malate dehydrogenases from spinach leaves, Protoplasma 232:247-253. 1048

Demishtein-Zohary, K. and Azem, A. (2017). The TIM23 mitochondrial protein import complex: 1049 function and dysfunction. Cell Tissue Res. 367: 33–41. 1050

Deng, X.W., Caspar, T., and Quail, P.H. (1991). Cop1 : a regulatory locus involved m hght-controlled 1051 development and gene expression in Arabidopsis. Genes Dev. 5: 1172–1182. 1052

Despres, B., Delseny, M., and Devic, M. (2001). Partial complementation of embryo defective 1053 mutations: A general strategy to elucidate gene function. Plant J. 27: 149–159. 1054

Drescher, A., Stephanie, R., Calsa, T., Carrer, H., and Bock, R. (2000). The two largest chloroplast 1055 genome-encoded open reading frames of higher plants are essential genes. Plant J. 22: 97–1056 104. 1057

Engdahl, S., Aronsson, H., Sundqvist, C., Timko, M.P., and Dahlin, C. (2001). Association of the 1058 NADPH:protochlorophyllide oxidoreductase (POR) with isolated etioplast inner membranes from 1059 wheat. Plant J. 27: 297–304. 1060

Emanuelsson, O., Nielsen, H., Brunak, S., and Von Heijne, G. (2000). Predicting subcellular 1061 localization of proteins based on their N-terminal amino acid sequence. J. Mol. Biol. 300: 1005–1062 1016. 1063

Feng, J., Fan, P., Jiang, P., Lv, S., Chen, X., and Li, Y. (2014). Chloroplast-targeted Hsp90 plays 1064 essential roles in plastid development and embryogenesis in Arabidopsis possibly linking with 1065 VIPP1. Physiol. Plant. 150: 292–307. 1066

Ferro, M. et al. (2010). AT_CHLORO, a Comprehensive Chloroplast Proteome Database with 1067 Subplastidial Localization and Curated Information on Envelope Proteins. Mol. Cell. Proteomics 1068 9: 1063–1084. 1069

Franzmann, L.H., Yoon, E.S., and Meinke, D.W. (1995). Saturating the Genetic-Map of Arabidopsis 1070 thaliana with Embryonic Mutations. Plant J. 7: 341–350. 1071

Fujii, S., Kobayashi, K., Nagata, N., Masuda, T., and Wada, H. (2017). 1072 Monogalactosyldiacylglycerol Facilitates Synthesis of Photoactive Protochlorophyllide in 1073 Etioplasts. Plant Physiol. 174: 2183–2198. 1074

Fulton, D.C., Stettler, M., Mettler, T., Vauhjan, C.K., Li, J., Francisco, P., Gil, M., Reinhold, H., 1075 Eicke, S., Messerli, G., Dorken, G., Halliday, K., Smith, A.M., Smith, S.M., and Zeeman, S.C. 1076 (2008). ß-AMYLASE4, a Noncatalytic Protein Required for Starch Breakdown, Acts Upstream of 1077 Three Active ß-Amylases in Arabidopsis Chloroplasts. Plant Cell Online 20: 1040–1058. 1078

Fusari, C.M., Kooke, R., Lauxmann, M.A., Annunziata, M.G., Encke, B., Hoehne, M., Krohn, N., 1079 Becker, F.F.M., Schlereth, A., Sulpice, R., Stitt, M., and Keurentjes, J.J.B. (2017). Genome-1080 wide Association Mapping Reveals that Specific and Pleiotropic Regulatory Mechanisms Fine-1081 tune Central Metabolism and Growth in Arabidopsis. Plant Cell: tpc.00232.2017. 1082

Gómez, L.D., Gilday, A., Feil, R., Lunn, J.E., and Graham, I.A. (2010). AtTPS1-mediated trehalose 1083 6-phosphate synthesis is essential for embryogenic and vegetative growth and responsiveness 1084 to ABA in germinating seeds and stomatal guard cells. Plant J. 64: 1–13. 1085

33

Goward, C.R. and Nicholls, D.J. (1994). Malate dehydrogenase: A model for structure, evolution, 1086 and catalysis. Protein Sci. 3: 1883–1888. 1087

Grau, U.M., Trommer, W.E., and Rossmann, M.G. (1981). Structure of the active ternary complex of 1088 pig heart lactate dehydrogenase with S-lac-NAD at 2.7 Å resolution. J. Mol. Biol. 151: 289–307. 1089

Grefen, C., Donald, N., Hashimoto, K., Kudla, J., Schumacher, K., and Blatt, M.R. (2010). A 1090 ubiquitin-10 promoter-based vector set for fluorescent protein tagging facilitates temporal 1091 stability and native protein distribution in transient and stable expression studies. Plant J. 64: 1092 355–365. 1093

Gujas, B., Cruz, T.M.D., Kastanaki, E., Vermeer, J.E.M., Munnik, T., and Rodriguez-Villalon, A. 1094 (2017). Perturbing phosphoinositide homeostasis oppositely affects vascular differentiation in 1095 Arabidopsis thaliana roots. Development: dev.155788. 1096

Hatch, M.D. and Osmond, C.B. (1976). Compartmentation and Transport in C4 Photosynthesis. In 1097 Stocking CR, Heber U, eds. Transport in plants III, Vol. 3. Berlin:Springer, pp. 144-184. 1098

He, H., Lee, M.-C., Zheng, L.-L., Zheng, L., and Luo, Y. (2013). Integration of the metabolic/redox 1099 state, histone gene switching, DNA replication and S-phase progression by moonlighting 1100 metabolic enzymes. Biosci. Rep. 33: e00018. 1101

Hebbelmann, I., Selinski, J., Wehmeyer, C., Goss, T., Voss, I., Mulo, P., Kangasjärvi, S., Aro, E.-1102 M., Oelze, M.-L., Dietz, K.-J., Nunes-Nesi, A., Do, P.T., Fernie, A.R., Talla, S.K., 1103 Raghavendra, A.S., Linke, V., and Scheibe, R. (2012). Multiple strategies to prevent oxidative 1104 stress in Arabidopsis plants lacking the malate valve enzyme NADP-malate dehydrogenase. J. 1105 Exp. Bot. 63: 1445–1459. 1106

Heber, U. (1974). Metabolite exchange between chloroplasts and cytoplasm. Annu. Rev. Plant 1107 Physiol. 25: 393–421. 1108

Hendriks, W., Mulders, J.W., Bibby, M. a, Slingsby, C., Bloemendal, H., and de Jong, W.W. 1109 (1988). Duck lens epsilon-crystallin and lactate dehydrogenase B4 are identical: a single-copy 1110 gene product with two distinct functions. Proc. Natl. Acad. Sci. U. S. A. 85: 7114–8. 1111

Heyno, E., Innocenti, G., Lemaire, S.D., Issakidis-Bourguet, E., and Krieger-Liszkay, A. (2014). 1112 Putative role of the malate valve enzyme NADP-malate dehydrogenase in H2O2 signalling in 1113 Arabidopsis. Philos. Trans. R. Soc. B Biol. Sci. 369: 20130228–20130228. 1114

Horrer, D., Flütsch, S., Pazmino, D., Matthews, J.S.A., Thalmann, M., Nigro, A., Leonhardt, N., 1115 Lawson, T., and Santelia, D. (2016). Blue light induces a distinct starch degradation pathway in 1116 guard cells for stomatal opening. Curr. Biol. 26: 362–370. 1117

Huberts, D.H.E.W. and van der Klei, I.J. (2010). Moonlighting proteins: An intriguing mode of 1118 multitasking. Biochim. Biophys. Acta - Mol. Cell Res. 1803: 520–525. 1119

Jang, J.C. (1997). Hexokinase as a Sugar Sensor in Higher Plants. Plant Cell Online 9: 5–19. 1120 Jarvis, P., Dormann, P., Peto, C.A., Lutes, J., Benning, C., and Chory, J. (2000). Galactolipid 1121

deficiency and abnormal chloroplast development in the Arabidopsis MGD synthase 1 mutant. 1122 Proc. Natl. Acad. Sci. 97: 8175–8179. 1123

Jeffery, C.J. (1999). Moonlighting proteins. Trends Biochem. Sci. 24: 8–11. 1124 Jeffery, C.J. (2003). Moonlighting proteins: Old proteins learning new tricks. Trends Genet. 19: 415–1125

417. 1126 Journet, E.P., Neuburger, M., and Douce, R. (1981). Role of glutamate-oxaloacetate transaminase 1127

and malate dehydrogenase in the regeneration of NAD for glycine oxidation by spinach leaf 1128 mitochondria. Plant Physiol. 67: 467–469. 1129

Karimi, M., Inze, D., and Depicker, A. (2002). GATEWAY™ vectors for Agrobacterium-mediated 1130 plant transformation. Trends Plant Sci. 7: 193–195. 1131

Kinoshita, H., Nagasaki, J., Yoshikawa, N., Yamamoto, A., Takito, S., Kawasaki, M., Sugiyama, 1132 T., Miyake, H., Weber, A.P.M., and Taniguchi, M. (2011). The chloroplastic 2-1133 oxoglutarate/malate transporter has dual function as the malate valve and in carbon/nitrogen 1134 metabolism. Plant J. 65: 15–26. 1135

Klement, H., Helfrich, M., Oster, U., Schoch, S., and Rüdiger, W. (1999). Pigment-free 1136 NADPH:protochlorophyllide oxidoreductase from Avena sativa L. Purification and substrate 1137 specificity. Eur. J. Biochem. 265: 862–874. 1138

Kobayashi, K., Kondo, M., Fukuda, H., Nishimura, M., and Ohta, H. (2007). Galactolipid synthesis 1139 in chloroplast inner envelope is essential for proper thylakoid biogenesis, photosynthesis, and 1140 embryogenesis. Proc. Natl. Acad. Sci. 104: 17216–17221. 1141

Langklotz, S., Baumann, U., and Narberhaus, F. (2012). Structure and function of the bacterial AAA 1142 protease FtsH. Biochim. Biophys. Acta - Mol. Cell Res. 1823: 40–48. 1143

Lebedev, N., Van Cleve, B., Armstrong, G., and Apel, K. (1995). Chlorophyll Synthesis in a 1144 Deetiolated (det340) Mutant of Arabidopsis without NADPH-Protochlorophyllide (PChlide) 1145

34

Oxidoreductase (POR) A and Photoactive PChlide-F655. Plant Cell 7: 2081–2090. 1146 Lee, C., Schwartz, M.P., Prakash, S., Iwakura, M., and Matouschek, A. (2001). ATP-dependent 1147

proteases degrade their substrates by processively unraveling them from the degradation signal. 1148 Mol. Cell 7: 627–637. 1149

Lee, Y., Rubio, M.C., Alassimone, J., and Geldner, N. (2013). A mechanism for localized lignin 1150 deposition in the endodermis. Cell 153: 402–412. 1151

Lu, X., Zhang, D., Li, S., Su, Y., Liang, Q., Meng, H., Shen, S., Fan, Y., Liu, C., and Zhang, C. 1152 (2014). FtsHi4 is essential for embryogenesis due to its influence on chloroplast development in 1153 Arabidopsis. PLoS One 9. 1154

Majsec, K., Bhuiyan, N.H., Sun, Q., Kumari, S., Kumar, V., Ware, D., and van Wijk, K. (2017). The 1155 Plastid and Mitochondrial Peptidase Network in Arabidopsis: A Foundation for Testing Genetic 1156 Interactions and Functions in Organellar Proteostasis. Plant Cell 29: 2687-2710. 1157

Mansfield, S.G. and Briarty, L.G. (1991). Early Embryogenesis in Arabidopsis thaliana .II. the 1158 Developing Embryo. Can. J. Bot. Can. Bot. 69: 461–476. 1159

Martin, A., Baker, T.A., and Sauer, R.T. (2005). Rebuilt AAA + motors reveal operating principles for 1160 ATP-fuelled machines. Nature 437: 1115–1120. 1161

Mascia, P.N. (1978). Studies of Chloroplast Development in Four Maize Mutants Defective in 1162 Chlorophyll Biosynthesis. Planta. 143: 207–211. 1163

Minárik, P., Tomaásková, N., Kollárová, M., and Antalík, M. (2002). Malate Dehydrogenases - 1164 Structure and function. Gen. Physiol. Biophys. 21: 257–265. 1165

Moore, B. (2003). Role of the Arabidopsis Glucose Sensor HXK1 in Nutrient, Light, and Hormonal 1166 Signaling. Science 300: 332–336. 1167

Moore, B.D. (2004). Bifunctional and moonlighting enzymes: Lighting the way to regulatory control. 1168 Trends Plant Sci. 9: 221–228. 1169

Musrati, R.A., Kollárová, M., Mernik, N., and Mikulášová, D. (1998). Malate Dehydrogenase: 1170 Distribution, Function and Properties. Gen. Physiol. Biophys. 17: 193–210. 1171

Nakai, M. (2018). New perspectives on chloroplast protein import. Plant and Cell Physiology, pcy083, 1172 doi.org/10.1093/pcp/pcy083. 1173

Nicholls, D.J., Miller, J., Scawen, M.D., Clarke, A.R., John Holbrook, J., Atkinson, T., and 1174 Goward, C.R. (1992). The importance of arginine 102 for the substrate specificity of Escherichia 1175 coli malate dehydrogenase. Biochem. Biophys. Res. Commun. 189: 1057–1062. 1176

Nickelsen, J. (2005). The Green Alga Chlamydomonas reinhardtii – A Genetic Model Organism. In 1177 Progress in Botany (Heidelberg, Springer-Verlag Berlin), pp. 68–89. 1178

Nielsen, H. and Engelbrecht, J. (1997). Identification of prokaryotic and eukaryotic signal peptides 1179 and prediction of their cleavage sites Artificial neural networks have been used for many 1180 biological. Protein Eng. 10: 1–6. 1181

Ossowski, S., Schwab, R., and Weigel, D. (2008). Gene silencing in plants using artificial 1182 microRNAs and other small RNAs. Plant J. 53: 674–690. 1183

Park, H., Kreunen, S.S., Cuttriss, A.J., DellaPenna, D., and Pogson, B.J. (2002). Identification of 1184 the Carotenoid Isomerase Provides Insight into Carotenoid Biosynthesis, Prolamellar Body 1185 Formation, and Photomorphogenesis. Plant Cell 14: 321–332. 1186

Patton, D.A., Franzmann, L.H., and Meinke, D.W. (1991). Mapping genes essential for embryo 1187 development in Arabidopsis thaliana. Mol. Gen. Genet. 227: 337–347. 1188

Patton, D.A., Schetter, A.L., Franzmann, L.H., Nelson, K., Ward, E.R., and Meinke, D.W. (1998). 1189 An Embryo-Defective Mutant of Arabidopsis Disrupted in the Final Step of Biotin Synthesis. 1190 Plant Physiol. 116: 935–946. 1191

Pracharoenwattana, I., Cornah, J.E., and Smith, S.M. (2007). Arabidopsis peroxisomal malate 1192 dehydrogenase functions in beta-oxidation but not in the glyoxylate cycle. Plant J. 50: 381–90. 1193

Pracharoenwattana, I., Zhou, W., and Smith, S.M. (2010). Fatty acid beta-oxidation in germinating 1194 Arabidopsis seeds is supported by peroxisomal hydroxypyruvate reductase when malate 1195 dehydrogenase is absent. Plant Mol. Biol. 72: 101–109. 1196

Ruppel, N.J. and Hangarter, R.P. (2007). Mutations in a plastid-localized elongation factor G alter 1197 early stages of plastid development in Arabidopsis thaliana. BMC Plant Biol. 7: 37. 1198

Ryberg, M. and Sundqvist, C. (1982). Characterization of prolamellar bodies and prothylakoids 1199 fractionated from wheat etioplasts. Physiol. Plant. 56: 125–132. 1200

Ryberg, M. and Sundqvist, C. (1988). The regular ultrastructure of isolated prolamellar bodies 1201 depends on the presence of membrane‐bound NADPH‐protochlorophyllide oxidoreductase. 1202 Physiol. Plant. 73: 218–226. 1203

Scheibe, R. (2004). Malate valves to balance cellular energy supply. Physiol. Plant. 120: 21–26. 1204 Scheibe, R. (1987). NADP+‐malate dehydrogenase in C3‐plants: Regulation and role of a light‐1205

35

activated enzyme. Physiol. Plant. 71: 393–400. 1206 Selinski, J., König, N., Wellmeyer, B., Hanke, G.T., Linke, V., Ekkehard Neuhaus, H., and 1207

Scheibe, R. (2014). The plastid-localized NAD-dependent malate dehydrogenase is crucial for 1208 energy homeostasis in developing Arabidopsis thaliana seeds. Mol. Plant 7: 170–186. 1209

Selstam, E., Schelin, J., Brain, T., and Williams, W.P. (2002). The effects of low pH on the 1210 properties of protochlorophyllide oxidoreductase and the organization of prolamellar bodies of 1211 maize (Zea mays). Eur. J. Biochem. 269: 2336–2346. 1212

Seung, D., Thalmann, M., Sparla, F., Abou Hachem, M., Lee, S.K., Issakidis-Bourguet, E., 1213 Svensson, B., Zeeman, S.C., and Santelia, D. (2013). Arabidopsis thaliana AMY3 is a unique 1214 redox-regulated chloroplastic α-amylase. J. Biol. Chem. 288: 33620–33633. 1215

Seung D., Soyk, S., Coiro, M., Maier, B.A., Eicke, S., and Zeeman, S.C. (2015). PROTEIN 1216 TARGETING TO STARCH is required for localising GRANULE-BOUND STARCH SYNTHASE 1217 to starch granules and for normal amylose synthesis in Arabidopsis. PLoS Biol. 13:e1002080. 1218

Sew, Y.S., Ströher, E., Fenske, R., and Millar, A.H. (2016). Loss of Mitochondrial Malate 1219 Dehydrogenase Activity Alters Seed Metabolism Impairing Seed Maturation and Post-1220 Germination Growth in Arabidopsis. Plant Physiol. 171: 849–63. 1221

Silverstein, E. and Sulebele, G. (1969). Catalytic mechanism of pig heart mitochondrial malate 1222 dehydrogenase studied by kinetics at equilibrium. Biochemistry 8: 2543–50. 1223

Sokolenko, A., Pojidaeva, E., Zinchenko, V., Panichkin, V., Glaser, V.M., Herrmann, R.G., and 1224 Shestakov, S. V (2002). The gene complement for proteolysis in the cyanobacterium 1225 Synechocystis sp. PCC 6803 and Arabidopsis thaliana chloroplasts. Curr. Genet. 41: 291–310. 1226

Solymosi, K. and Aronsson, H. (2013). Etioplasts and their significance in chloroplast biogensis 36: 1227 155-167. 1228

Solymosi, K. and Schoefs, B. (2010). Etioplast and etio-chloroplast formation under natural 1229 conditions: The dark side of chlorophyll biosynthesis in angiosperms. Photosynth. Res. 105: 1230 143–166. 1231

Sperling, U., Franck, F., van Cleve, B., Frick, G., Apel, K., and Armstrong, G.A. (1998). Etioplast 1232 differentiation in arabidopsis: both PORA and PORB restore the prolamellar body and 1233 photoactive protochlorophyllide-F655 to the cop1 photomorphogenic mutant. Plant Cell 10: 283–1234 296. 1235

Spicher, L., Almeida, J., Gutbrod, K., Pipitone, R., Dörmann, P., Glauser, G., Rossi, M., and 1236 Kessler, F. (2017). Essential role for phytol kinase and tocopherol in tolerance to combined light 1237 and temperature stress in tomato. J. Exp. Bot. 68: 5845–5856. 1238

Taniguchi, M. and Miyake, H. (2012). Redox-shuttling between chloroplast and cytosol: Integration 1239 of intra-chloroplast and extra-chloroplast metabolism. Curr. Opin. Plant Biol. 15: 252–260. 1240

Tatsuta, T., Augustin, S., Nolden, M., Friedrichs, B., and Langer, T. (2007). m-AAA protease-1241 driven membrane dislocation allows intramembrane cleavage by rhomboid in mitochondria. 1242 EMBO J. 26: 325–335. 1243

Tomaz, T., Bagard, M., Pracharoenwattana, I., Linden, P., Lee, C.P., Carroll, A.J., Stroher, E., 1244 Smith, S.M., Gardestrom, P., and Millar, A.H. (2010). Mitochondrial Malate Dehydrogenase 1245 Lowers Leaf Respiration and Alters Photorespiration and Plant Growth in Arabidopsis. Plant 1246 Physiol. 154: 1143–1157. 1247

Tschopp, M.-A., Iki, T., Brosnan, C.A., Jullien, P.E., and Pumplin, N. (2017). A complex of 1248 Arabidopsis DRB proteins can impair dsRNA processing. RNA 23: 782–797. 1249

Wagner, R., Aigner, H., and Funk, C. (2012). FtsH proteases located in the plant chloroplast. 1250 Physiol. Plant. 145: 203–214. 1251

Wigley, D.B., Gamblin, S.J., Turkenburg, J.P., Dodson, E.J., Piontek, K., Muirhead, H., and 1252 Holbrook, J.J. (1992). Structure of a ternary complex of an allosteric lactate dehydrogenase 1253 from Bacillus stearothermophilus at 2.5 A resolution. J. Mol. Biol. 223: 317–35. 1254

Wistow, G.J., Mulders, J.W., and de Jong, W.W. (1987). The enzyme lactate dehydrogenase as a 1255 structural protein in avian and crocodilian lenses. Nature 326: 622–4. 1256

Yang, S.S. and Zhai, Q.H. (2017). Cytosolic GAPDH: a key mediator in redox signal transduction in 1257 plants. Biol. Plant. 61: 417–426. 1258

Yu, B., Wakao, S., Fan, J., and Benning, C. (2004). Loss of plastidic lysophosphatidic acid 1259 acyltransferase causes embryo-lethality in Arabidopsis. Plant Cell Physiol. 45: 503–510. 1260

Zaffagnini, M., Fermani, S., Costa, A., Lemaire, S.D., and Trost, P. (2013). Plant cytoplasmic 1261 GAPDH: redox post-translational modifications and moonlighting properties. Front. Plant Sci. 4: 1262 1–18. 1263

Zhang, X., Henriques, R., Lin, S.-S., Niu, Q.-W., and Chua, N.-H. (2006). Agrobacterium-mediated 1264 transformation of Arabidopsis thaliana using the floral dip method. Nat. Protoc. 1: 641–6. 1265

36

Zhao, Y., Luo, L., Xu, J., Xin, P., Guo, H., Wu, J., Bai, L., Wang, G., Chu, J., Zuo, J., Hong, Y., 1266 Huang, X., and Li, J. (2018). Malate transported from chloroplast to mitochondrion triggers 1267 production of ROS and PCD in Arabidopsis thaliana. Cell Research 28 (4): 448-461. 1268

1269 1270

FIGURE LEGENDS 1271

Figure 1 Embryo-specific expression of pdNAD-MDH to rescue the embryo lethality 1272

of pdnad-mdh plants. 1273

(A) Schematic diagram of the PABI3:pdNAD-MDH-YFP and PpdNAD-MDH:pdNAD-MDH-1274

YFP constructs. For the former construct, the ABI3 promoter (PABI3) was placed 1275

upstream of the pdNAD-MDH coding sequence fused at its C-terminus to YFP. The 1276

latter construct was described by Beeler et al. (2014). 1277

(B) Opened siliques of pdNAD-MDH+/− plants transformed with the PABI3:pdNAD-1278

MDH-YFP construct. Siliques from the wild type (Ler), untransformed (UT) pdNAD-1279

MDH+/− plants, and pdNAD-MDH+/− transformed with the PpdNAD-MDH:pdNAD-MDH-1280

YFP construct are shown for comparison. White seeds are indicated with an arrow. 1281

Bar = 1 mm. 1282

(C) Expression of the PABI3:pdNAD-MDH-YFP construct in Arabidopsis embryos after 1283

transformation of pdNAD-MDH+/− plants. Expression was detected by fluorescence 1284

microscopy on embryos at three different developmental stages (globular, heart and 1285

torpedo). Bar = 50 µM. 1286

1287

1288

Figure 2 Phenotype of pdnad-mdh mutants rescued by the embryo-specific 1289

expression of pdNAD-MDH. 1290

(A) Photographs of 14-day-old seedlings of pdnad-mdh plants expressing the 1291

PABI3:pdNAD-MDH-YFP construct, grown on ½-strength MS agar plates under a 12-h 1292

light/12-h dark regime. The PABI3:pdNAD-MDH-YFP construct was transformed into 1293

pdNAD-MDH+/− plants, and a T3 population that was segregating for the pdnad-mdh 1294

T-DNA insertion but not for the PABI3:pdNAD-MDH-YFP construct was obtained. Two 1295

examples of pale plants that resembled the constitutive silencing line, miR-mdh-1, 1296

are shown, while the other plants resembled the wild-type Ler, or pdnad-mdh+/−. A 1297

pdnad-mdh −/− plant complemented with the PpdNAD-MDH:pdNAD-MDH-YFP construct 1298

is also shown. Bars = 500 µm. 1299

(B) Photographs of 4-week-old pdnad-mdh−/− seedlings rescued with the 1300

PABI3:pdNAD-MDH-YFP construct. Close-up images of their meristematic zones and 1301

37

their cotyledons are shown. Bars in the left-hand panels = 500 µm, Bars in the 1302

middle and right-hand panels = 100 µm. 1303

(C) Transmission electron micrographs of plastids in pdnad-mdh−/− seedlings 1304

rescued with the PABI3:pdNAD-MDH-YFP construct. Plastids from cotyledons are 1305

shown for the wild type (Ler) and pdnad-mdh −/−, and a plastid in a true leaf of pdnad-1306

mdh −/− is shown on the right. Bars = 500 nm. 1307

1308

Figure 3 Immunoblot and native-PAGE detection of pdNAD-MDH in Ler, miR-mdh-1 1309

and pdnad-mdh−/− seedlings rescued with the PABI3:pdNAD-MDH-YFP construct. 1310

(A) Immunoblots were conducted with the pdNAD-MDH antibody. Equal amounts of 1311

soluble protein (5 µg) were loaded. The migration of molecular weight markers is 1312

indicated (left). 1313

(B) In-gel activity assay of the NAD-MDH. The two bands corresponding to pdNAD-1314

MDH activity are indicated (arrows, right). Equal amounts of protein (15 µg) were 1315

loaded. 1316

1317

Figure 4 β-estradiol-inducible silencing of pdNAD-MDH in mature plant rosettes. 1318

XVE OLEXA:miR-mdh-1 plants photographed before and after a 6 day treatment 1319

with β-estradiol or a mock treatment. 1320

(A) Photographs in the top row were taken before β-estradiol treatment (D0), and 1321

those in the bottom row after 6 days (D6). β-estradiol solution (20 µM) was sprayed 1322

every second day onto the entire rosette. β-estradiol was applied to wild-type (Col) 1323

plants as a control. Mock-treated samples were sprayed with water containing the 1324

same amount of DMSO as the treatment solution (used to dissolve the β-estradiol). 1325

Red arrows indicate examples of white, newly emerging leaves. 1326

(B) Immunoblot detection of pdNAD-MDH in total protein extracts of wild-type and 1327

XVE OLEXA:miR-mdh-1 plants before (D0) and 6 days into β-estradiol treatment 1328

(D6). For the treated XVE OLEXA:miR-mdh-1 plants, proteins were extracted from 1329

the old, green leaves (D6o) and young, white leaves (D6y) separately. Gels were 1330

loaded on an equal leaf area basis. The migration of molecular weight markers is 1331

indicated on the left. pdNAD-MDH and actin (as a loading control) were detected 1332

concurrently on the same membrane using secondary antibodies conjugated to 1333

different infrared fluorescence dyes (800CW for pdNAD-MDH and 680RD for actin). 1334

(C) As for (B), but with old leaves from mock-treated samples. 1335

38

1336

Figure 5 Etiolated growth of miR-mdh-1 and etioplast structure. 1337

(A) Wild-type (Col) and miR-mdh-1 seedlings were grown on ½-strength MS agar 1338

plates in different diel light conditions (24 h dark, 12 h light/12 h dark, 24 h light). Bar 1339

= 1 cm. 1340

(B) Quantification of the hypocotyl length of etiolated wild-type and miR-mdh-1 1341

seedlings. Values represent the mean ± SE of measurements conducted on n=89 1342

and n=86 seedlings for the wild type and miR-mdh-1, respectively. 1343

(C) Etioplast ultrastructure in cotyledons of etiolated wild-type and miR-mdh-1 1344

seedlings observed by transmission electron microscopy. Bars = 500 nm 1345

(D) Proportion of etioplasts showing normal, compromised, or absent prolamellar 1346

body structures in cotyledons of the wild type and miR-mdh-1. The first 139 and 256 1347

etioplasts, observed in wild-type and miR-mdh-1 cotyledons, respectively, were 1348

categorized based on their prolamellar body structure. 1349

1350

Figure 6 Protochlorophylide, galactolipid and β-carotene contents of miR-mdh-1 1351

seedlings. 1352

(A) Protochlorophyllide levels in 5-day-old wild-type (Col) and miR-mdh-1 etiolated 1353

seedlings, measured by fluorescence after excitation at 440 nm. Values are the 1354

means ± SE of three biological replicates, each measured with four technical 1355

replicates. Each biological replicate is a pool of 100-200 individual seedlings. 1356

(B) Immunoblot detection of protochlorophyllide oxidoreductase A (PORA) in total 1357

protein extracts from 6-day-old etiolated wild-type and miR-mdh-1 seedlings (upper 1358

panel). Immunoblots for actin was performed as a loading control (lower panel). Gels 1359

were loaded on an equal fresh weight basis. Three biological replicates are shown. 1360

Each biological replicate is a pool of 50-100 individual seedlings. 1361

(C-F) Lipids and carotenoids were extracted from 6-day-old wild-type and miR-mdh-1 1362

seedlings, either etiolated (e) or light grown (l; grown under a 12-h light/12-h dark 1363

regime). Levels of Diacylglycerol (DAG) (C), MGDG 18:3/16:3 (D) DGDG 18:3/18:3 1364

(E) and β-carotene (F) are shown. For the lipids, only the most common species (in 1365

terms of fatty acid chain composition) is shown; similar trends were seen in other 1366

detected species (Supplemental Table 1). All lipids and carotenoids were quantified 1367

relative to an internal standard, and values were corrected for differences in fresh 1368

weight (see Methods for details). Values are the mean ± SE from four biological 1369

39

replicates. Each biological replicate is a pool of 50-100 individual seedlings. 1370

Significant differences (p < 0.05) within the respective light-grown and etiolated 1371

samples of miR-mdh-1 and the wild type, determined using a two-tailed t-test, are 1372

indicated with an asterisk. 1373

1374

Figure 7 Complementation test with various NAD-MDH isoforms expressed in 1375

pdnad-mdh. 1376

(A) Constructs encoding NAD-MDH isoforms under the control of the pdNAD-MDH 1377

promoter. The plastidial transit peptide from RubisCO small subunit was fused to the 1378

N-terminus of each isoform. The constructs shown are tagged at the C-terminus with 1379

YFP. Similar constructs were cloned with the Flag-HA tag in place of YFP. 1380

(B) Genotyping results of the T2 progeny from T1 plants heterozygous for the pdnad-1381

mdh mutation and expressing the different NAD-MDH isoforms. Numbers above the 1382

bars indicate the number of BASTA-resistant T2 plants that were genotyped. 1383

(C) Chloroplast localization of the NAD-MDH isoforms. Similar constructs to those 1384

shown in A, except with the 35S promoter in place of the native promoter, were 1385

transiently expressed in Nicotiana benthamiana leaves and imaged using confocal 1386

microscopy. Bar = 5 µm. 1387

1388

Figure 8 Enzymatically-inactive pdNAD-MDH proteins can complement the embryo 1389

lethality and growth defects of the pdnad-mdh mutant. 1390

(A) Catalytic centre of the Arabidopsis pdNAD-MDH structure. The pdNAD-MDH 1391

protein sequence (without cTP) was modelled using the human malate- and NADH-1392

bound MMDH2 crystal structure (PDB: 2DFD) as a template. Left panel shows 1393

NADH (red) and malate (yellow), and the relative position of the conserved catalytic 1394

amino acid residues of pdNAD-MDH. A detailed view of the malate-binding site is 1395

shown in the upper right panel. The surface of the catalytic pocket is shown in the 1396

lower right panel. 1397

(B) An in-vitro activity assay was performed using purified recombinant proteins. The 1398

proteins (10 µg) were incubated with an excess of cofactor (NADH) at 22°C. The 1399

reaction was started by the addition of excess substrate (oxaloacetate). The velocity 1400

was determined by measuring the decrease in absorbance at 340 nm resulting from 1401

the conversion of NADH to NAD+. Error bars indicate mean ± SE (n=3). 1402

(C) Genotyping results of T2 progeny from T1 plants heterozygous for pdnad-mdh 1403

40

and expressing the enzymatically-inactive pdNAD-MDH proteins. Numbers above 1404

the bars indicate the number of BASTA-resistant T2 plants that were genotyped. 1405

(D) Photographs showing 3-week-old rosettes of homozygous pdnad-mdh plants 1406

complemented with enzymatically-inactive pdNAD-MDH mutants. For comparison, 1407

wild-type (Ler) plants are shown. Plants were grown under long days (16 h light/8 h 1408

dark). 1409

(E) NAD-MDH activity observed by native-PAGE. Equal amounts of protein (15 µg) 1410

were loaded per lane, and all lanes were run on the same gel. pdNAD-MDH runs in 1411

distinct activity bands (a,b,c). While the fastest migrating band (c) corresponding to 1412

the free dimer is masked by other NAD-MDH activity, the two slower migrating bands 1413

that correspond to NAD-MDH in protein complexes can be easily observed (a, b). 1414

Additional activity bands (a’, b’) are observed for plants heterozygous for the pdnad-1415

mdh T-DNA insertion expressing the catalytic-inactive pdNAD-MDH variants, 1416

possibly due to dimer formation between an inactive pdNAD-MDH with an 1417

endogenous form of pdNAD-MDH protein. 1418

1419

Figure 9 Constitutive and inducible silencing of the FtsH12 protein. 1420

(A) In Arabidopsis, the FtsH12 gene consists of 19 exons and 18 introns. The 1421

sequence and position of the target for artificial microRNA silencing are indicated. 1422

Numbers represent nucleotide positions relative to the translational start site +1. 1423

(B) Constitutive silencing of FtsH12 resulted in plants with varying degrees of 1424

paleness and delayed growth phenotype in the T1 generation. Plants were grown 1425

under a 12-h light/12-h dark regime for 6 weeks. Both amiRNA constructs produced 1426

plants with comparable phenotypes. The identical wild type (Col) plant was used for 1427

both the left and right panels. Bar = 2 cm. 1428

(C) Immunoblot analysis of total protein extracts from the amiRNA FtsH12 lines, 1429

using the FtsH12 antibody (upper panel), pdNAD-MDH antibody (lower panel) and 1430

actin antibody as a loading control (both panels). FtsH12 and actin, as well as 1431

pdNAD-MDH and actin, were detected concurrently on the same membrane using 1432

secondary antibodies conjugated to different infrared fluorescence dyes (800CW for 1433

FtsH12 and pdNAD-MDH, and 680RD for actin). The migration of molecular weight 1434

markers is indicated (left). The gel was loaded on an equal protein (15 µg) basis. 1435

1436

Figure 10 Isothermal titration calorimetry (ITC) thermograms of NADH titrated into 1437

41

the pdNAD-MDH WT and inactive proteins. 1438

(A) ITC profile of NADH injected into a solution of recombinant His-pdNAD-MDH WT 1439

protein at 25°C. The upper panel shows the raw calorimetric data. The plot below 1440

shows the integrated enthalpy as a function of the NADH/pdNAD-MDH molar ratio. 1441

Reactions are exothermic. 1442

(B-D) Experiments were conducted as described for (A) with the His-pdNAD-MDH 1443

R162Q protein (B), the His-pdNAD-MDH R234Q protein (C), and the His-pdNAD-1444

MDH R162Q R234Q protein (D). 1445

1446

Figure 11 A model for the interaction of pdNAD-MDH with the heteromeric FtsH12-1447

FtsHi AAA-ATPase complex at the chloroplast inner envelope membrane, which 1448

plays an essential role in chloroplast development. 1449

1450

42

Accession Number

Identified Proteins (226/242) P35S:MDH-YFP

Etiolated Seedlings Rosette

AT3G47520 pdNAD-MDH 210 102 163

ATCG00860 Chloroplastic Ycf2 65 14 68

AT3G04340 FtsH extracellular protease family, FtsHi 5, Embryo defective2458

55 9 59

AT3G01510 Like SEX4 1 9 11 52

AT1G79560 FtsH protease 12, Embryo defective 1047, Embryo defective 156, Embryo defective 36

38 14 46

AT5G64580 FtsH extracellular protease family, FtsHi 4, Embryo defective 3144

29 8 43

AT3G16290 FtsH extracellular protease family, FtsHi 2, Embryo defective 2083

34 13 41

AT4G23940 FtsH extracellular protease family, ARC1, FtsHi1

21 8 41

AT4G13670 Plastid transcriptionally active 5 5 16 30

AT3G23920 Beta-amylase 1 0 0 12

AT5G53860 Embryo defective 2737 5 3 10

AT2G40300 Ferritin 4 10 3 9

AT1G48460 tRNA-processing ribonuclease BN 5 2 7

AT3G56090 Ferritin 3 5 0 5

AT5G22640 Embryo defective 1211, Tic100 0 0 5

AT5G63040 Transmembrane protein 3 2 4

AT4G17090 Beta-amylase 3 0 0 4

AT4G28210 Embryo defective 1923 2 2 4

AT5G01600 Ferritin 1

8 0 3

AT5G59500 Protein C-terminal S-isoprenylcysteine carboxyl O-methyltransferase

3 2 3

AT3G61780 Embryo defective 1703 0 0 3

AT1G31330 Photosystem I subunit F 0 0 2

ATCG00900 Chloroplast ribosomal protein S7 0 0 2

ATCG00830 Ribosomal protein L2 0 0 2

AT5G14320 Embryo defective 3137 0 0 2

ATCG00190 RNA polymerase subunit beta 2 0 0

AT5G16130 Ribosomal protein S7e family protein 2 0 0

AT3G18420 Slow green 1 3 0 0

Table 1 Proteins identified in anti-YFP immunoprecipitates from plants expressing pdNAD-MDH-YFP. IPs were conducted with anti-YFP beads on extracts of material harvested at three different developmental stages, and the co-eluting proteins were identified using LC-MS/MS. Values represent the total spectrum count of peptides matching each protein. Proteins found in the control samples (IPs from wild-type plant extracts) were assumed to be contaminants and excluded. The full dataset can be found in Supplemental Data Set 1.

43

Accession Number

Identified Proteins (236/247) PUBQ10:FtsH12-YFP

1 2

AT1G79560 FtsH protease 12, Embryo defective 1047, Embryo defective 156, Embryo defective 36

386 371

ATCG00860 Chloroplast Ycf2 181 237

AT3G04340 FtsH extracellular protease family, FtsHi 5, Embryo defective2458

247 179

ATCG01130 Chloroplast Ycf1, TIC214 70 111

AT3G16290 FtsH extracellular protease family, FtsHi 2, Embryo defective 2083

46 86

AT5G64580 FtsH extracellular protease family, FtsHi 4, Embryo defective 3144

66 83

AT4G23940 FtsH extracellular protease family, ARC1, FtsHi1 69 52

AT1G01320 Tetratricopeptide repeat (TPR)-like superfamily protein

6 32

AT4G02510 Translocon at the outer envelope membrane of chloroplasts 159

37 31

AT5G53860 Embryo defective 2737 13 26

ATCG00480 ATP synthase subunit beta 8 23

AT3G47520 pdNAD-MDH 5 22

AT1G07920 GTP binding Elongation factor Tu family protein 15 20

AT1G43170 Ribosomal protein 1 5 20

ATCG00120 ATP synthase subunit alpha 42 19

ATCG00490 Ribulose-bisphosphate carboxylase 48 16

AT5G01590 Histone-lysine N-methyltransferase ATXR3-like protein

14 16

AT2G41840 Ribosomal protein S5 family protein 6 16

Table 2 Proteins identified in anti-YFP immunoprecipitates from two independent lines overexpressing FtsH12-YFP. The IPs were conducted with anti-YFP beads on extracts of material harvested from rosette leaves, and the co-eluting proteins were identified using LC-MS/MS. Values represent the total spectrum count of peptides matching each protein. Proteins found in the control sample (IPs from wild-type plants) were assumed to be contaminants and excluded. The full dataset can be found in Supplemental Data Set 1.

44

Accession Number

Identified Proteins (102/115)

pdnad-mdh+/-

At pdNAD-

MDH

At cyMDH1

Sc mMDH1

At mMDH1

At pMDH1

GFP_AEQVI YFP-tag 108 7 3 66 162

AT3G47520 pdNAD-MDH 142 3 0 18 6

AT1G04410 cyMDH1 0 8 5 0 0

AT1G53240 mMDH1 4 0 0 96 0

AT2G22780 pMDH1 0 2 2 0 312

ATCG00860 Chloroplast Ycf2 193 0 0 4 0

AT3G04340 FtsH extracellular protease family, FtsHi 5, Embryo defective2458

192 0 0 0 0

AT1G79560 FtsH protease 12, Embryo defective 1047, Embryo defective 156, Embryo defective 36

155 0 0 4 0

AT5G64580 FtsH extracellular protease family, FtsHi 4, Embryo defective 3144

102 0 0 0 0

AT3G01510 Like SEX4 1 82 0 0 0 0

AT4G23940 FtsH extracellular protease family, ARC1, FtsHi1

69 0 0 0 0

ATCG01130 Chloroplast Ycf1 protein 59 0 0 0 0

AT3G16290 FtsH extracellular protease family, FtsHi 2, Embryo defective 2083

54 0 0 0 0

AT5G53860 Embryo defective 2737 29 0 0 0 0

AT4G02510 Translocon at the outer envelope membrane of chloroplasts 159

29 0 0 0 0

Table 3 Proteins identified in IPs of YFP-tagged NAD-MDH proteins (AtpdNAD-MDH, AtcyMDH1, ScmMDH1, AtmMDH1 and AtpMDH) expressed in heterozygous pdnad-mdh plants. IPs were conducted with anti-YFP beads on extracts of rosette leaves, and the co-eluting proteins were identified using LC-MS/MS. Values represent the total spectrum count of peptides matching each protein. Proteins also identified in the control sample (Ler) were assumed to be contaminants and excluded. The full dataset can be found in Supplemental Data Set 1.

45

Accession Number

Identified Proteins (917/929)

pdnad-mdh-/-

pdNAD-MDH WT

pdNAD-MDH

R162Q

pdNAD-MDH

R234Q

pdNAD-MDH

R163Q R234Q

AT3G47520 pdNAD-MDH 96 49 31 22

ATCG00860 Chloroplast Ycf2 283 457 332 405

AT3G04340 FtsH extracellular protease family, FtsHi 5, Embryo defective2458

408 330 210 362

AT1G79560 FtsH protease 12, Embryo defective 1047, Embryo defective 156, Embryo defective 36

373 309 212 317

AT5G64580 FtsH extracellular protease family, FtsHi 4, Embryo defective 3144

221 207 164 159

AT3G16290 FtsH extracellular protease family, FtsHi 2, Embryo defective 2083

125 228 158 179

ATCG01130 Chloroplast Ycf1 70 166 174 223

AT4G23940 FtsH extracellular protease family, ARC1, FtsHi1

153 141 153 109

AT4G02510 Translocon at the outer envelope membrane of chloroplasts 159

25 95 113 133

AT3G01510 like SEX4 1 159 58 105 23

AT5G53860 Embryo defective 2737 30 54 55 54

Table 4 Proteins identified in anti-HA immunoprecipitates from homozygous pdnad-mdh plants expressing non-catalytic versions of pdNAD-MDH. The IPs were conducted with anti-HA beads on extracts of rosette leaves, and the co-eluting proteins were identified using LC-MS/MS. Values represent the total spectrum count of peptides matching each protein. Proteins found in the control sample (IPs from wild-type [Ler] plant extracts) were assumed to be contaminants and excluded. The full dataset can be found in Supplemental Data Set 1.

46

1451

Figure 1 Embryo-specific expression of pdNAD-MDH to rescue the embryo lethality of pdnad-mdh plants.

(A) Schematic diagram of the PABI3:pdNAD-MDH-YFP and PpdNAD-MDH:pdNAD-MDH-YFP constructs. For the former construct,

the ABI3 promoter (PABI3) was placed upstream of the pdNAD-MDH coding sequence fused at its C-terminus to YFP. The

latter construct was described by Beeler et al. (2014).

(B) Opened siliques of pdNAD-MDH+/− plants transformed with the PABI3:pdNAD-MDH-YFP construct. Siliques from the wild

type (Ler), untransformed (UT) pdNAD-MDH+/− plants, and pdNAD-MDH+/− transformed with the PpdNAD-MDH:pdNAD-MDH-

YFP construct are shown for comparison. White seeds are indicated with an arrow. Bar = 1 mm.

(C) Expression of the PABI3:pdNAD-MDH-YFP construct in Arabidopsis embryos after transformation of pdNAD-MDH+/−

plants. Expression was detected by fluorescence microscopy on embryos at three different developmental stages (globular,

heart and torpedo). Bar = 50 µM.

A

1000 bp

Scale

C

Ler UT

PABI3:

pdNAD-MDH-

YFP

PpdNAD-MDH:

pdNAD-MDH-

YFP

pdnad-mdh+/- B

YFP pdNAD-MDH PABI3

YFP pdNAD-MDH PpdNAD-MDH

Figure 2 Phenotype of pdnad-mdh mutants rescued by the embryo-specific expression of pdNAD-MDH.

(A) Photographs of 14-day-old seedlings of pdnad-mdh plants expressing the PABI3:pdNAD-MDH-YFP construct, grown on ½-

strength MS agar plates under a 12-h light/12-h dark regime. The PABI3:pdNAD-MDH-YFP construct was transformed into

pdNAD-MDH+/− plants, and a T3 population that was segregating for the pdnad-mdh T-DNA insertion but not for the

PABI3:pdNAD-MDH-YFP construct was obtained. Two examples of pale plants that resembled the constitutive silencing line,

miR-mdh-1, are shown, while the other plants resembled the wild-type Ler, or pdnad-mdh+/−. A pdnad-mdh −/− plant

complemented with the PpdNAD-MDH:pdNAD-MDH-YFP construct is also shown. Bars = 500 µm.

(B) Photographs of 4-week-old pdnad-mdh−/− seedlings rescued with the PABI3:pdNAD-MDH-YFP construct. Close-up images

of their meristematic zones and their cotyledons are shown. Bars in the left-hand panels = 500 µm, Bars in the middle and

right-hand panels = 100 µm.

(C) Transmission electron micrographs of plastids in pdnad-mdh−/− seedlings rescued with the PABI3:pdNAD-MDH-YFP

construct. Plastids from cotyledons are shown for the wild type (Ler) and pdnad-mdh −/−, and a plastid in a true leaf of pdnad-

mdh −/− is shown on the right. Bars = 500 nm.

C

Ler (cotyledon)

pdnad-mdh−/− PABI3:pdNAD-

MDH-YFP #1 (cotyledon)

pdnad-mdh−/− PABI3:pdNAD-

MDH-YFP #1 (true leaf)

Ler pdnad-mdh+/− pdnad-mdh

PABI3:pdNAD-MDH-YFP (T3 gen.)

A miR-mdh-1

pdnad-mdh −/− PpdNAD-MDH:

pdNAD-MDH-

YFP

B pdnad-mdh −/− PABI3:pdNAD-MDH-YFP #1

pdnad-mdh −/− PABI3: pdNAD-MDH-YFP #2

Figure 3 Immunoblot and native-PAGE detection of pdNAD-MDH in Ler, miR-mdh-1 and pdnad-mdh−/− seedlings rescued

with the PABI3:pdNAD-MDH-YFP construct.

(A) Immunoblots were conducted with the pdNAD-MDH antibody. Equal amounts of soluble protein (5 µg) were loaded. The

migration of molecular weight markers is indicated (left).

(B) In-gel activity assay of the NAD-MDH. The two bands corresponding to pdNAD-MDH activity are indicated (arrows, right).

Equal amounts of protein (15 µg) were loaded.

A

Ler

pdnad-mdh−/− PABI3:pdNAD-

MDH-YFP #2

miR-

mdh-1 kDa

35 pdNAD-

MDH

B

55

Figure 4 β-estradiol-inducible silencing of pdNAD-MDH in mature plant rosettes. XVE OLEXA:miR-mdh-1 plants photographed

before and after a 6 day treatment with β-estradiol or a mock treatment.

(A) Photographs in the top row were taken before β-estradiol treatment (D0), and those in the bottom row after 6 days (D6).

β-estradiol solution (20 µM) was sprayed every second day onto the entire rosette. β-estradiol was applied to wild-type (Col)

plants as a control. Mock-treated samples were sprayed with water containing the same amount of DMSO as the treatment

solution (used to dissolve the β-estradiol). Red arrows indicate examples of white, newly emerging leaves.

(B) Immunoblot detection of pdNAD-MDH in total protein extracts of wild-type and XVE OLEXA:miR-mdh-1 plants before (D0)

and 6 days into β-estradiol treatment (D6). For the treated XVE OLEXA:miR-mdh-1 plants, proteins were extracted from the

old, green leaves (D6o) and young, white leaves (D6y) separately. Gels were loaded on an equal leaf area basis. The

migration of molecular weight markers is indicated on the left. pdNAD-MDH and actin (as a loading control) were detected

concurrently on the same membrane using secondary antibodies conjugated to different infrared fluorescence dyes (800CW

for pdNAD-MDH and 680RD for actin).

(C) As for (B), but with old leaves from mock-treated samples.

A

XVE OLEXA:miR-mdh-1

Col #1-2 #2-3

XVE OLEXA:miR-mdh-1

Col #1-2 #2-3

β-estradiol treatment mock treatment

kDa

55

35 pdNAD-MDH

actin

Col

XVE OLEXA:miR-mdh-1

D0 D6

1 2 1 2 1 2 1 2 1 2 1 2

D0 D6 D0

#1-2 #2-3

D6

C

B

pdNAD-

MDH

kDa

55

35

Col

XVE OLEXA:miR-mdh-1

D0 D6

1 2 1 2 1 2 1o 1y 2o 2y 1 2

D0 D6 D0 D6

#1-2

1o 1y 2o 2y

#2-3

actin

miR-mdh-1

miR-mdh-1

miR-mdh-1

Col

Col

miR-mdh-1

Col D

88.5

3.9

1.4

59.8

10.1

36.3

0%

10%

20%

30%

40%

50%

60%

70%

80%

90%

100%

Col miR-mdh-1

normal compromised absent

Prolamellar body (PLB) structure

0

2

4

6

8

10

12

14

16

18

20

Col-0 miR-mdh-1

hypocoty

l le

ngth

[m

m]

Col miR-mdh-1

Figure 5 Etiolated growth of miR-mdh-1 and etioplast structure.

(A) Wild-type (Col) and miR-mdh-1 seedlings were grown on ½-strength MS agar plates in different diel light conditions (24 h

dark, 12 h light/12 h dark, 24 h light). Bar = 1 cm.

(B) Quantification of the hypocotyl length of etiolated wild-type and miR-mdh-1 seedlings. Values represent the mean ± SE of

measurements conducted on n=89 and n=86 seedlings for the wild type and miR-mdh-1, respectively.

(C) Etioplast ultrastructure in cotyledons of etiolated wild-type and miR-mdh-1 seedlings observed by transmission electron

microscopy. Bars = 500 nm

(D) Proportion of etioplasts showing normal, compromised, or absent prolamellar body structures in cotyledons of the wild

type and miR-mdh-1. The first 139 and 256 etioplasts, observed in wild-type and miR-mdh-1 cotyledons respectively, were

categorized based on their prolamellar body structure.

A B

C

Col miR-mdh-1

Col miR-mdh-1

24 h dark

12 h light/12 h dark

24 h light

100

90

80

70

60

50

40

30

20

10

Perc

enta

ge o

f etiopla

sts

[%

]

A B

0

0.5

1

1.5

2

2.5

Col-0 miR-mdh-1

Flu

ore

sce

nce

/mg

FW

Col miR-mdh-1

E F

0

50

100

150

200

250

300

350

Col-0, lightgrown

Col-0, darkgrown

miR-mdh-1,light grown

miR-mdh-1,dark grown

β-carotene

Re

l. q

uantifica

tion

Col miR-mdh-1

e e l l

* *

C

Re

l. q

uantifica

tion

*

α-PORA

Col

miR-

mdh-1 Col

miR-

mdh-1 Col

miR-

mdh-1

α-actin

Protochlorophyllide

Figure 6 Protochlorophylide, galactolipid and β-carotene content of miR-mdh-1 seedlings.

(A) Protochlorophyllide levels in 5-day-old wild-type (Col) and miR-mdh-1 etiolated seedlings, measured by fluorescence after

excitation at 440 nm. Values are the means ± SE of three biological replicates, each measured with four technical replicates.

Each biological replicate is a pool of 50-100 individual seedlings.

(B) Immunoblot detection of protochlorophyllide oxidoreductase A (PORA) in total protein extracts from 6-day-old etiolated

wild-type and miR-mdh-1 seedlings (upper panel). Immunoblots for actin was performed as a loading control (lower panel).

Gels were loaded on an equal fresh weight basis. Three biological replicates are shown. Each biological replicate is a pool of

50-100 individual seedlings.

(C-F) Lipids and carotenoids were extracted from 6-day-old wild-type and miR-mdh-1 seedlings, either etiolated (e) or light

grown (l; grown under a 12-h light/12-h dark regime). Levels of Diacylglycerol (DAG) (C), MGDG 18:3/16:3 (D) DGDG

18:3/18:3 (E) and β-carotene (F) are shown. For the lipids, only the most common species (in terms of fatty acid chain

composition) is shown; similar trends were seen in other detected species (Supplemental Table 1). All lipids and carotenoids

were quantified relative to an internal standard, and values were corrected for differences in fresh weight (see Methods for

details). Values are the mean ± SE from four biological replicates. Each biological replicate is a pool of 50-100 individual

seedlings. Significant differences (p < 0.05) within the respective light-grown and etiolated samples of miR-mdh-1 and the

wild type, determined using a two-tailed t-test, are indicated with an asterisk.

Re

l. q

uantifica

tion

D

Re

l. q

uantifica

tion

0

500

1000

1500

2000

2500

Col-0, lightgrown

Col-0, darkgrown

miR-mdh-1,light grown

miR-mdh-1,dark grown

MGDG-18:3/16:3

0

1000

2000

3000

4000

5000

6000

7000

8000

9000

Col-0, lightgrown

Col-0, darkgrown

miR-mdh-1,light grown

miR-mdh-1,dark grown

DAG-18:0/18:0

e e l l

Col miR-mdh-1

e e l l

*

*

Col miR-mdh-1

0

200

400

600

800

1000

1200

Col-0, lightgrown

Col-0, darkgrown

miR-mdh-1,light grown

miR-mdh-1,dark grown

DGDG-18:3/18:3

Col miR-mdh-1

e e l l

*

*

Figure 7 Complementation test with various NAD-MDH isoforms expressed in pdnad-mdh.

(A) Constructs encoding NAD-MDH isoforms under the control of the pdNAD-MDH promoter. The plastidial transit

peptide from RubisCO small subunit was fused to the N-terminus of each isoform. The constructs shown are tagged at

the C-terminus with YFP. Similar constructs were cloned with the Flag-HA tag in place of YFP.

(B) Genotyping results of the T2 progeny from T1 plants heterozygous for the pdnad-mdh mutation and expressing the

different NAD-MDH isoforms. Numbers above the bars indicate the number of BASTA-resistant T2 plants that were

genotyped.

(C) Chloroplast localization of the NAD-MDH isoforms. Similar constructs to those shown in A, except with the 35S

promoter in place of the native promoter, were transiently expressed in Nicotiana benthamiana leaves and imaged using

confocal microscopy. Bar = 5µm.

1000 bp

Scale

A

PpdNAD-MDH TP

YFP

PpdNAD-MDH TP

PpdNAD-MDH TP

YFP

PpdNAD-MDH AtpMDH1 TP

YFP

YFP

AtmMDH1

ScmMDH1

AtcyMDH1

0%

25%

50%

75%

100%

At

CY

MD

H-Y

FP

Sc M

MD

H-Y

FP

At

MM

DH

-YF

P

At

PM

DH

-YF

P

At

CY

MD

H-F

lag

HA

Sc M

MD

H-F

lag

HA

At

MM

DH

-Fla

gH

A

At

PM

DH

-Fla

gH

A

pdnad-mdh+/-

He Wt Ho

Pe

rcenta

ge o

f T

2 s

eedlin

gs [%

]

+/− +/+ −/− pdnad-mdh genotype:

B

150 149 180 180 149 122 149 150

AtcyMDH

-YFP

ScmMDH

-YFP

AtmMDH

-YFP

AtpMDH

-YFP

YF

P

YF

P +

Ch

l B

F +

Ch

l

C

Figure 8 Enzymatically-inactive pdNAD-MDH proteins can complement the embryo lethality and growth defects of the pdnad-mdh

mutant.

(A) Catalytic centre of the Arabidopsis pdNAD-MDH structure. The pdNAD-MDH protein sequence (without cTP) was modelled

using the human malate- and NADH-bound MMDH2 crystal structure (PDB: 2DFD) as a template. Left panel shows NADH (red)

and malate (yellow), and the relative position of the conserved catalytic amino acid residues of pdNAD-MDH. A detailed view of the

malate-binding site is shown in the upper right panel. The surface of the catalytic pocket is shown in the lower right panel.

(B) An in-vitro activity assay was performed using purified recombinant proteins. The proteins (10 µg) were incubated with an

excess of cofactor (NADH) at 22°C. The reaction was started by the addition of excess substrate (oxaloacetate). The velocity was

determined by measuring the decrease in absorbance at 340 nm resulting from the conversion of NADH to NAD+. Error bars

indicate mean ± SE (n=3).

(C) Genotyping results of T2 progeny from T1 plants heterozygous for pdnad-mdh and expressing the enzymatically-inactive

pdNAD-MDH proteins. Numbers above the bars indicate the number of BASTA-resistant T2 plants that were genotyped.

(D) Photographs showing 3-week-old rosettes of homozygous pdnad-mdh plants complemented with enzymatically-inactive pdNAD-

MDH mutants. For comparison, wild-type (Ler) plants are shown. Plants were grown under long days (16 h light/8 h dark).

(E) NAD-MDH activity observed by native-PAGE. Equal amounts of protein (15 µg) were loaded per lane, and all lanes were run on

the same gel. pdNAD-MDH runs in distinct activity bands (a,b,c). While the fastest migrating band (c) corresponding to the free

dimer is masked by other NAD-MDH activity, the two slower migrating bands that correspond to NAD-MDH in protein complexes

can be easily observed (a,b). Additional activity bands (a’, b’) are observed for plants heterozygous for the pdnad-mdh T-DNA

insertion expressing the catalytic-inactive pdNAD-MDH variants, possibly due to dimer formation between an inactive pdNAD-MDH

with an endogenous form of pdNAD-MDH protein.

H258

D231

R162

R168

R234

D231

R234

H258

R168

R162

D115

0.00

0.02

0.04

0.06

0.08

0.10

0.12

ve

loctiy [m

in-1

]

pdNAD-MDH

WT R162Q R234Q R162Q

R234Q

blank

A

C

E

0%

25%

50%

75%

100%

pdNAD-MDHR162Q

pdNAD-MDHR234Q

pdNAD-MDHR162QR234Q

pdnad-mdh+/-

He Wt Ho

Pe

rcenta

ge o

f T

2 s

eedlin

gs [%

]

R162Q R234Q R162Q

R234Q

pdNAD-MDH

construct:

+/− +/+ −/− pdnad-mdh genotype:

pdnad-mdh background

Le

r

#2

-3-1

#3

-1-1

7

#2

-3-2

1

+/− −/−

R162Q pdNAD-MDH construct:

pdnad-mdh genotype:

#2

-4-1

#2

-4-1

3

#3

-6-2

0

#3

-4-1

#3

-4-3

#4

-5-2

8

+/− −/−

R234Q

+/− −/−

R162Q R234Q

B

D

Ler pdnad-mdh-/-

R162Q R234Q

R162Q

R234Q

pdNAD-MDH construct: 73 69 78

Co

l

miR

-

md

h-1

a

b

c

a’

b’

+3259 +3279

5’UTR 3’UTR

+1 +5333bp

At1G79560

GAGACAAGCTGTGATATTTAT

CCGTGAGTTGACAAGGTATAT

+4777 +4797 amiRNA target A

amiRNA target B

A

B

C

Figure 9 Constitutive and inducible silencing of the FtsH12 protein.

(A) In Arabidopsis, the FtsH12 gene consists of 19 exons and 18 introns. The sequence and position of the target for

artificial microRNA silencing are indicated. Numbers represent nucleotide positions relative to the translational start site

+1.

(B) Constitutive silencing of FtsH12 resulted in plants with varying degrees of paleness and delayed growth phenotype

in the T1 generation. Plants were grown under a 12-h light/12-h dark regime for 6 weeks. Both amiRNA constructs

produced plants with comparable phenotypes. The identical wild type (Col) plant was used for both the left and right

panels. Bar = 2 cm.

(C) Immunoblot analysis of total protein extracts from the amiRNA FtsH12 lines, using the FtsH12 antibody (upper

panel), pdNAD-MDH antibody (lower panel) and actin antibody as a loading control (both panels). The migration of

molecular weight markers is indicated (left). The gel was loaded on an equal protein (15 µg) basis.

miR-mdh-1

amiRNA

FtsH12 A 3-1

amiRNA

FtsH12 B 2-1

Col

Col amiRNA FtsH12 A

14-1 11-1

Col amiRNA FtsH12 B

4-1 1-1

Col amiRNA FtsH12 A

actin

FtsH12

actin

14-1 11-1 3-1 1 2

70

100

130

55

55

35

kDa

pdNAD-MDH

miR-

mdh-1

amiRNA FtsH12 B

4-1 1-1 2-1

Figure 10 Isothermal titration calorimetry (ITC) thermograms of NADH titrated into the pdNAD-MDH WT

and inactive proteins.

(A) ITC profile of NADH injected into a solution of recombinant His-pdNAD-MDH WT protein at 25°C. The

upper panel shows the raw calorimetric data. The plot below shows the integrated enthalpy as a function of

the NADH/pdNAD-MDH molar ratio. Reactions are exothermic.

(B-D) Experiments were conducted as described for (A) with the His-pdNAD-MDH R162Q protein (B), the

His-pdNAD-MDH R234Q protein (C), and the His-pdNAD-MDH R162Q R234Q protein (D).

pdNAD-MDH R234Q pdNAD-MDH R162Q R234Q

A B

C D

pdNAD-MDH WT pdNAD-MDH R162Q

0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5

-6

-4

-2

0

-0.4

-0.3

-0.2

-0.1

0.0

0.10 25 50 75 100 125 150 175 200 225

Time (min)

µca

l/sec

Molar ratio

kcal/m

ole

of in

ject

ant

0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5-6

-4

-2

0

-0.4

-0.3

-0.2

-0.1

0.0

0.10 25 50 75 100 125 150 175 200 225

Time (min)

µca

l/sec

Molar ratio

kcal/m

ole

of in

ject

ant

0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5 4.0-6

-4

-2

0

2

-0.6

-0.5

-0.4

-0.3

-0.2

-0.1

0.0

0.10 25 50 75 100 125 150 175 200 225

Time (min)

µca

l/sec

Molar ratio

kcal/m

ole

of in

ject

ant

0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5 4.0-6

-4

-2

0

-0.7

-0.6

-0.5

-0.4

-0.3

-0.2

-0.1

0.0

0.10 25 50 75 100 125 150 175 200 225

Time (min)

µca

l/sec

Molar ratio

kcal/m

ole

of in

ject

ant

0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5

-6

-4

-2

0

-0.4

-0.3

-0.2

-0.1

0.0

0.10 25 50 75 100 125 150 175 200 225

Time (min)

µca

l/sec

Molar ratio

kcal/m

ole

of in

ject

ant

0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5-6

-4

-2

0

-0.4

-0.3

-0.2

-0.1

0.0

0.10 25 50 75 100 125 150 175 200 225

Time (min)

µca

l/sec

Molar ratio

kcal/m

ole

of in

ject

ant

0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5 4.0-6

-4

-2

0

2

-0.6

-0.5

-0.4

-0.3

-0.2

-0.1

0.0

0.10 25 50 75 100 125 150 175 200 225

Time (min)

µca

l/sec

Molar ratio

kcal/m

ole

of in

ject

ant

0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5 4.0-6

-4

-2

0

-0.7

-0.6

-0.5

-0.4

-0.3

-0.2

-0.1

0.0

0.10 25 50 75 100 125 150 175 200 225

Time (min)

µca

l/sec

Molar ratio

kcal/m

ole

of in

ject

ant

Figure 11 A model for the interaction of pdNAD-MDH with the heteromeric FtsH12-FtsHi AAA-

ATPase complex at the chloroplast inner envelope membrane, which plays an essential role in

chloroplast development.

Ycf2

pdNAD-

MDH

stroma

putative Zinc

binding domain

ATPase

domain

inner chloroplast membrane

outer chloroplast membrane

pdNAD-

MDH

Chloroplast

development

Prolamellar body

formation

FtsH12/FtsHi1/FtsHi2/

FtsHi4/FtsHi5 complex

Parsed CitationsBahl, J., Francke, B., and Monéger, R. (1976). Lipid composition of envelopes, prolamellar bodies and other plastid membranes inetiolated, green and greening wheat leaves. Planta 129: 193–201.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Beeler, S., Liu, H.-C., Stadler, M., Schreier, T., Eicke, S., Lue, W.-L., Truernit, E., Zeeman, S.C., Chen, J., and Kotting, O. (2014).Plastidial NAD-Dependent Malate Dehydrogenase Is Critical for Embryo Development and Heterotrophic Metabolism in Arabidopsis.Plant Physiol. 164: 1175–1190.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Berkemeyer, M., Scheibe, R., and Ocheretina, O. (1998). A novel, non-redox-regulated NAD-dependent malate dehydrogenase fromchloroplasts of Arabidopsis thaliana L. J. Biol. Chem. 273: 27927–27933.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Birktoft, J.J. and Banaszak, L.J. (1983). The presence of a histidine-aspartic acid pair in the active site of 2-hydroxyaciddehydrogenases. X-ray refinement of cytoplasmic malate dehydrogenase. J. Biol. Chem. 258: 472–482.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Bodi, Z., Zhong, S., Mehra, S., Song, J., Graham, N., Li, H., May, S., and Fray, R.G. (2012). Adenosine Methylation in Arabidopsis mRNA isAssociated with the 3′ End and Reduced Levels Cause Developmental Defects. Front. Plant Sci. 3: 1–10.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Botelho Calado, S., Tatsuta, T., Von Heijne, G., and Kim, H. (2013). Dislocation by the m-AAA protease increases the thresholdhydrophobicity for retention of transmembrane helices in the inner membrane of yeast mitochondria. J. Biol. Chem. 288: 4792–4798.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Breuninger, H., Rikirsch, E., Hermann, M., Ueda, M., and Laux, T. (2008). Differential Expression of WOX Genes Mediates Apical-BasalAxis Formation in the Arabidopsis Embryo. Dev. Cell 14: 867–876.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Bross, C.D., Howes, T.R., Rad, S.A., Kljakic, O., and Kohalmi, S.E. (2017). Subcellular localization of Arabidopsis arogenatedehydratases suggests novel and non-enzymatic roles. J. Exp. Bot. 68: 1425–1440.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Candela, H., Pérez-Pérez, J.M., and Micol, J.L. (2011). Uncovering the post-embryonic functions of gametophytic- and embryonic-lethalgenes. Trends Plant Sci. 16: 336–345.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Cheminant, S., Wild, M., Bouvier, F., Pelletier, S., Renou, J.-P., Erhardt, M., Hayes, S., Terry, M.J., Genschik, P., and Achard, P. (2011).DELLAs Regulate Chlorophyll and Carotenoid Biosynthesis to Prevent Photooxidative Damage during Seedling Deetiolation inArabidopsis. Plant Cell 23: 1849–1860.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Clarke, A.R., Wigley, D.B., Chia, W.N., Barstow, D., Atkinson, T., and Holbrook, J.J. (1986). Site-directed mutagenesis reveals role ofmobile arginine residue in lactate dehydrogenase catalysis. Nature 324: 699–702.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Comparot-Moss, S., Kötting, O., Stettler, M., Edner, C., Graf, A., Weise, S.E., Streb, S., Lue, W.-L., MacLean, D., Mahlow, S., Ritte, G.,Steup, M., Chen, J., Zeeman, S.C., and Smith A.M. (2010). A Putative Phosphatase, LSF1, Is Required for Normal Starch Turnover inArabidopsis Leaves. Plant Physiol. 152: 685–697.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Copley, S.D. (2015). An Evolutionary Perspective on Protein Moonlighting. Biochem Soc Trans. 42: 1684–1691.Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Copley, S.D. (2003). Enzymes with extra talents: Moonlighting functions and catalytic promiscuity. Curr. Opin. Chem. Biol. 7: 265–272.Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Cvetić, T., Veljović-Jovanović, S., and Vučinić, Ž (2008) Characterization of NAD-dependent malate dehydrogenases from spinach

leaves, Protoplasma 232:247-253.Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Demishtein-Zohary, K. and Azem, A. (2017). The TIM23 mitochondrial protein import complex: function and dysfunction. Cell TissueRes. 367: 33–41.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Deng, X.W., Caspar, T., and Quail, P.H. (1991). Cop1 : a regulatory locus involved m hght-controlled development and gene expressionin Arabidopsis. Genes Dev. 5: 1172–1182.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Despres, B., Delseny, M., and Devic, M. (2001). Partial complementation of embryo defective mutations: A general strategy to elucidategene function. Plant J. 27: 149–159.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Drescher, A., Stephanie, R., Calsa, T., Carrer, H., and Bock, R. (2000). The two largest chloroplast genome-encoded open readingframes of higher plants are essential genes. Plant J. 22: 97–104.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Engdahl, S., Aronsson, H., Sundqvist, C., Timko, M.P., and Dahlin, C. (2001). Association of the NADPH:protochlorophyllideoxidoreductase (POR) with isolated etioplast inner membranes from wheat. Plant J. 27: 297–304.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Emanuelsson, O., Nielsen, H., Brunak, S., and Von Heijne, G. (2000). Predicting subcellular localization of proteins based on their N-terminal amino acid sequence. J. Mol. Biol. 300: 1005–1016.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Feng, J., Fan, P., Jiang, P., Lv, S., Chen, X., and Li, Y. (2014). Chloroplast-targeted Hsp90 plays essential roles in plastid developmentand embryogenesis in Arabidopsis possibly linking with VIPP1. Physiol. Plant. 150: 292–307.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Ferro, M. et al. (2010). AT_CHLORO, a Comprehensive Chloroplast Proteome Database with Subplastidial Localization and CuratedInformation on Envelope Proteins. Mol. Cell. Proteomics 9: 1063–1084.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Franzmann, L.H., Yoon, E.S., and Meinke, D.W. (1995). Saturating the Genetic-Map of Arabidopsis thaliana with Embryonic Mutations.Plant J. 7: 341–350.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Fujii, S., Kobayashi, K., Nagata, N., Masuda, T., and Wada, H. (2017). Monogalactosyldiacylglycerol Facilitates Synthesis of PhotoactiveProtochlorophyllide in Etioplasts. Plant Physiol. 174: 2183–2198.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Fulton, D.C., Stettler, M., Mettler, T., Vauhjan, C.K., Li, J., Francisco, P., Gil, M., Reinhold, H., Eicke, S., Messerli, G., Dorken, G.,Halliday, K., Smith, A.M., Smith, S.M., and Zeeman, S.C. (2008). ß-AMYLASE4, a Noncatalytic Protein Required for Starch Breakdown,Acts Upstream of Three Active ß-Amylases in Arabidopsis Chloroplasts. Plant Cell Online 20: 1040–1058.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Fusari, C.M., Kooke, R., Lauxmann, M.A., Annunziata, M.G., Encke, B., Hoehne, M., Krohn, N., Becker, F.F.M., Schlereth, A., Sulpice, R.,Stitt, M., and Keurentjes, J.J.B. (2017). Genome-wide Association Mapping Reveals that Specific and Pleiotropic RegulatoryMechanisms Fine-tune Central Metabolism and Growth in Arabidopsis. Plant Cell: tpc.00232.2017.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Gómez, L.D., Gilday, A., Feil, R., Lunn, J.E., and Graham, I.A. (2010). AtTPS1-mediated trehalose 6-phosphate synthesis is essential forembryogenic and vegetative growth and responsiveness to ABA in germinating seeds and stomatal guard cells. Plant J. 64: 1–13.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Goward, C.R. and Nicholls, D.J. (1994). Malate dehydrogenase: A model for structure, evolution, and catalysis. Protein Sci. 3: 1883–1888.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Google Scholar: Author Only Title Only Author and Title

Grau, U.M., Trommer, W.E., and Rossmann, M.G. (1981). Structure of the active ternary complex of pig heart lactate dehydrogenasewith S-lac-NAD at 2.7 Å resolution. J. Mol. Biol. 151: 289–307.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Grefen, C., Donald, N., Hashimoto, K., Kudla, J., Schumacher, K., and Blatt, M.R. (2010). A ubiquitin-10 promoter-based vector set forfluorescent protein tagging facilitates temporal stability and native protein distribution in transient and stable expression studies.Plant J. 64: 355–365.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Gujas, B., Cruz, T.M.D., Kastanaki, E., Vermeer, J.E.M., Munnik, T., and Rodriguez-Villalon, A. (2017). Perturbing phosphoinositidehomeostasis oppositely affects vascular differentiation in Arabidopsis thaliana roots. Development: dev.155788.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Hatch, M.D. and Osmond, C.B. (1976). Compartmentation and Transport in C4 Photosynthesis. In Stocking CR, Heber U, eds. Transportin plants III, Vol. 3. Berlin:Springer, pp. 144-184.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

He, H., Lee, M.-C., Zheng, L.-L., Zheng, L., and Luo, Y. (2013). Integration of the metabolic/redox state, histone gene switching, DNAreplication and S-phase progression by moonlighting metabolic enzymes. Biosci. Rep. 33: e00018.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Hebbelmann, I., Selinski, J., Wehmeyer, C., Goss, T., Voss, I., Mulo, P., Kangasjärvi, S., Aro, E.-M., Oelze, M.-L., Dietz, K.-J., Nunes-Nesi,A., Do, P.T., Fernie, A.R., Talla, S.K., Raghavendra, A.S., Linke, V., and Scheibe, R. (2012). Multiple strategies to prevent oxidativestress in Arabidopsis plants lacking the malate valve enzyme NADP-malate dehydrogenase. J. Exp. Bot. 63: 1445–1459.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Heber, U. (1974). Metabolite exchange between chloroplasts and cytoplasm. Annu. Rev. Plant Physiol. 25: 393–421.Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Hendriks, W., Mulders, J.W., Bibby, M. a, Slingsby, C., Bloemendal, H., and de Jong, W.W. (1988). Duck lens epsilon-crystallin andlactate dehydrogenase B4 are identical: a single-copy gene product with two distinct functions. Proc. Natl. Acad. Sci. U. S. A. 85: 7114–8.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Heyno, E., Innocenti, G., Lemaire, S.D., Issakidis-Bourguet, E., and Krieger-Liszkay, A. (2014). Putative role of the malate valve enzymeNADP-malate dehydrogenase in H2O2 signalling in Arabidopsis. Philos. Trans. R. Soc. B Biol. Sci. 369: 20130228–20130228.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Horrer, D., Flütsch, S., Pazmino, D., Matthews, J.S.A., Thalmann, M., Nigro, A., Leonhardt, N., Lawson, T., and Santelia, D. (2016). Bluelight induces a distinct starch degradation pathway in guard cells for stomatal opening. Curr. Biol. 26: 362–370.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Huberts, D.H.E.W. and van der Klei, I.J. (2010). Moonlighting proteins: An intriguing mode of multitasking. Biochim. Biophys. Acta - Mol.Cell Res. 1803: 520–525.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Jang, J.C. (1997). Hexokinase as a Sugar Sensor in Higher Plants. Plant Cell Online 9: 5–19.Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Jarvis, P., Dormann, P., Peto, C.A., Lutes, J., Benning, C., and Chory, J. (2000). Galactolipid deficiency and abnormal chloroplastdevelopment in the Arabidopsis MGD synthase 1 mutant. Proc. Natl. Acad. Sci. 97: 8175–8179.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Jeffery, C.J. (1999). Moonlighting proteins. Trends Biochem. Sci. 24: 8–11.Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Jeffery, C.J. (2003). Moonlighting proteins: Old proteins learning new tricks. Trends Genet. 19: 415–417.Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Journet, E.P., Neuburger, M., and Douce, R. (1981). Role of glutamate-oxaloacetate transaminase and malate dehydrogenase in theregeneration of NAD for glycine oxidation by spinach leaf mitochondria. Plant Physiol. 67: 467–469.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Karimi, M., Inze, D., and Depicker, A. (2002). GATEWAY™ vectors for Agrobacterium-mediated plant transformation. Trends Plant Sci. 7:193–195.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Kinoshita, H., Nagasaki, J., Yoshikawa, N., Yamamoto, A., Takito, S., Kawasaki, M., Sugiyama, T., Miyake, H., Weber, A.P.M., andTaniguchi, M. (2011). The chloroplastic 2-oxoglutarate/malate transporter has dual function as the malate valve and in carbon/nitrogenmetabolism. Plant J. 65: 15–26.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Klement, H., Helfrich, M., Oster, U., Schoch, S., and Rüdiger, W. (1999). Pigment-free NADPH:protochlorophyllide oxidoreductase fromAvena sativa L. Purification and substrate specificity. Eur. J. Biochem. 265: 862–874.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Kobayashi, K., Kondo, M., Fukuda, H., Nishimura, M., and Ohta, H. (2007). Galactolipid synthesis in chloroplast inner envelope isessential for proper thylakoid biogenesis, photosynthesis, and embryogenesis. Proc. Natl. Acad. Sci. 104: 17216–17221.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Langklotz, S., Baumann, U., and Narberhaus, F. (2012). Structure and function of the bacterial AAA protease FtsH. Biochim. Biophys.Acta - Mol. Cell Res. 1823: 40–48.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Lebedev, N., Van Cleve, B., Armstrong, G., and Apel, K. (1995). Chlorophyll Synthesis in a Deetiolated (det340) Mutant of Arabidopsiswithout NADPH-Protochlorophyllide (PChlide) Oxidoreductase (POR) A and Photoactive PChlide-F655. Plant Cell 7: 2081–2090.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Lee, C., Schwartz, M.P., Prakash, S., Iwakura, M., and Matouschek, A. (2001). ATP-dependent proteases degrade their substrates byprocessively unraveling them from the degradation signal. Mol. Cell 7: 627–637.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Lee, Y., Rubio, M.C., Alassimone, J., and Geldner, N. (2013). A mechanism for localized lignin deposition in the endodermis. Cell 153:402–412.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Lu, X., Zhang, D., Li, S., Su, Y., Liang, Q., Meng, H., Shen, S., Fan, Y., Liu, C., and Zhang, C. (2014). FtsHi4 is essential for embryogenesisdue to its influence on chloroplast development in Arabidopsis. PLoS One 9.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Majsec, K., Bhuiyan, N.H., Sun, Q., Kumari, S., Kumar, V., Ware, D., and van Wijk, K. (2017). The Plastid and Mitochondrial PeptidaseNetwork in Arabidopsis: A Foundation for Testing Genetic Interactions and Functions in Organellar Proteostasis. Plant Cell 29: 2687-2710.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Mansfield, S.G. and Briarty, L.G. (1991). Early Embryogenesis in Arabidopsis thaliana .II. the Developing Embryo. Can. J. Bot. Can. Bot.69: 461–476.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Martin, A., Baker, T.A., and Sauer, R.T. (2005). Rebuilt AAA + motors reveal operating principles for ATP-fuelled machines. Nature 437:1115–1120.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Mascia, P.N. (1978). Studies of Chloroplast Development in Four Maize Mutants Defective in Chlorophyll Biosynthesis. Planta. 143:207–211.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Minárik, P., Tomaásková, N., Kollárová, M., and Antalík, M. (2002). Malate Dehydrogenases - Structure and function. Gen. Physiol.Biophys. 21: 257–265.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Moore, B. (2003). Role of the Arabidopsis Glucose Sensor HXK1 in Nutrient, Light, and Hormonal Signaling. Science 300: 332–336.Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Moore, B.D. (2004). Bifunctional and moonlighting enzymes: Lighting the way to regulatory control. Trends Plant Sci. 9: 221–228.Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Musrati, R.A., Kollárová, M., Mernik, N., and Mikulášová, D. (1998). Malate Dehydrogenase: Distribution, Function and Properties. Gen.Physiol. Biophys. 17: 193–210.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Nakai, M. (2018). New perspectives on chloroplast protein import. Plant and Cell Physiology, pcy083, doi.org/10.1093/pcp/pcy083.Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Nicholls, D.J., Miller, J., Scawen, M.D., Clarke, A.R., John Holbrook, J., Atkinson, T., and Goward, C.R. (1992). The importance ofarginine 102 for the substrate specificity of Escherichia coli malate dehydrogenase. Biochem. Biophys. Res. Commun. 189: 1057–1062.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Nickelsen, J. (2005). The Green Alga Chlamydomonas reinhardtii – A Genetic Model Organism. In Progress in Botany (Heidelberg,Springer-Verlag Berlin), pp. 68–89.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Nielsen, H. and Engelbrecht, J. (1997). Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavagesites Artificial neural networks have been used for many biological. Protein Eng. 10: 1–6.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Ossowski, S., Schwab, R., and Weigel, D. (2008). Gene silencing in plants using artificial microRNAs and other small RNAs. Plant J. 53:674–690.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Park, H., Kreunen, S.S., Cuttriss, A.J., DellaPenna, D., and Pogson, B.J. (2002). Identification of the Carotenoid Isomerase ProvidesInsight into Carotenoid Biosynthesis, Prolamellar Body Formation, and Photomorphogenesis. Plant Cell 14: 321–332.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Patton, D.A., Franzmann, L.H., and Meinke, D.W. (1991). Mapping genes essential for embryo development in Arabidopsis thaliana. Mol.Gen. Genet. 227: 337–347.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Patton, D.A., Schetter, A.L., Franzmann, L.H., Nelson, K., Ward, E.R., and Meinke, D.W. (1998). An Embryo-Defective Mutant ofArabidopsis Disrupted in the Final Step of Biotin Synthesis. Plant Physiol. 116: 935–946.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Pracharoenwattana, I., Cornah, J.E., and Smith, S.M. (2007). Arabidopsis peroxisomal malate dehydrogenase functions in beta-oxidationbut not in the glyoxylate cycle. Plant J. 50: 381–90.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Pracharoenwattana, I., Zhou, W., and Smith, S.M. (2010). Fatty acid beta-oxidation in germinating Arabidopsis seeds is supported byperoxisomal hydroxypyruvate reductase when malate dehydrogenase is absent. Plant Mol. Biol. 72: 101–109.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Ruppel, N.J. and Hangarter, R.P. (2007). Mutations in a plastid-localized elongation factor G alter early stages of plastid development inArabidopsis thaliana. BMC Plant Biol. 7: 37.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Ryberg, M. and Sundqvist, C. (1982). Characterization of prolamellar bodies and prothylakoids fractionated from wheat etioplasts.Physiol. Plant. 56: 125–132.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Ryberg, M. and Sundqvist, C. (1988). The regular ultrastructure of isolated prolamellar bodies depends on the presence of membrane‐bound NADPH‐protochlorophyllide oxidoreductase. Physiol. Plant. 73: 218–226.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Scheibe, R. (2004). Malate valves to balance cellular energy supply. Physiol. Plant. 120: 21–26.Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Scheibe, R. (1987). NADP+‐malate dehydrogenase in C3‐plants: Regulation and role of a light‐activated enzyme. Physiol. Plant. 71: 393–400.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Selinski, J., König, N., Wellmeyer, B., Hanke, G.T., Linke, V., Ekkehard Neuhaus, H., and Scheibe, R. (2014). The plastid-localized NAD-dependent malate dehydrogenase is crucial for energy homeostasis in developing Arabidopsis thaliana seeds. Mol. Plant 7: 170–186.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Selstam, E., Schelin, J., Brain, T., and Williams, W.P. (2002). The effects of low pH on the properties of protochlorophyllideoxidoreductase and the organization of prolamellar bodies of maize (Zea mays). Eur. J. Biochem. 269: 2336–2346.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Seung, D., Thalmann, M., Sparla, F., Abou Hachem, M., Lee, S.K., Issakidis-Bourguet, E., Svensson, B., Zeeman, S.C., and Santelia, D.(2013). Arabidopsis thaliana AMY3 is a unique redox-regulated chloroplastic α-amylase. J. Biol. Chem. 288: 33620–33633.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Seung D., Soyk, S., Coiro, M., Maier, B.A., Eicke, S., and Zeeman, S.C. (2015). PROTEIN TARGETING TO STARCH is required forlocalising GRANULE-BOUND STARCH SYNTHASE to starch granules and for normal amylose synthesis in Arabidopsis. PLoS Biol.13:e1002080.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Sew, Y.S., Ströher, E., Fenske, R., and Millar, A.H. (2016). Loss of Mitochondrial Malate Dehydrogenase Activity Alters Seed MetabolismImpairing Seed Maturation and Post-Germination Growth in Arabidopsis. Plant Physiol. 171: 849–63.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Silverstein, E. and Sulebele, G. (1969). Catalytic mechanism of pig heart mitochondrial malate dehydrogenase studied by kinetics atequilibrium. Biochemistry 8: 2543–50.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Sokolenko, A., Pojidaeva, E., Zinchenko, V., Panichkin, V., Glaser, V.M., Herrmann, R.G., and Shestakov, S. V (2002). The genecomplement for proteolysis in the cyanobacterium Synechocystis sp. PCC 6803 and Arabidopsis thaliana chloroplasts. Curr. Genet. 41:291–310.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Solymosi, K. and Aronsson, H. (2013). Etioplasts and their significance in chloroplast biogensis 36: 155-167.Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Solymosi, K. and Schoefs, B. (2010). Etioplast and etio-chloroplast formation under natural conditions: The dark side of chlorophyllbiosynthesis in angiosperms. Photosynth. Res. 105: 143–166.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Sperling, U., Franck, F., van Cleve, B., Frick, G., Apel, K., and Armstrong, G.A. (1998). Etioplast differentiation in arabidopsis: bothPORA and PORB restore the prolamellar body and photoactive protochlorophyllide-F655 to the cop1 photomorphogenic mutant. PlantCell 10: 283–296.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Spicher, L., Almeida, J., Gutbrod, K., Pipitone, R., Dörmann, P., Glauser, G., Rossi, M., and Kessler, F. (2017). Essential role for phytolkinase and tocopherol in tolerance to combined light and temperature stress in tomato. J. Exp. Bot. 68: 5845–5856.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Taniguchi, M. and Miyake, H. (2012). Redox-shuttling between chloroplast and cytosol: Integration of intra-chloroplast and extra-chloroplast metabolism. Curr. Opin. Plant Biol. 15: 252–260.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Google Scholar: Author Only Title Only Author and Title

Tatsuta, T., Augustin, S., Nolden, M., Friedrichs, B., and Langer, T. (2007). m-AAA protease-driven membrane dislocation allowsintramembrane cleavage by rhomboid in mitochondria. EMBO J. 26: 325–335.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Tomaz, T., Bagard, M., Pracharoenwattana, I., Linden, P., Lee, C.P., Carroll, A.J., Stroher, E., Smith, S.M., Gardestrom, P., and Millar,A.H. (2010). Mitochondrial Malate Dehydrogenase Lowers Leaf Respiration and Alters Photorespiration and Plant Growth inArabidopsis. Plant Physiol. 154: 1143–1157.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Tschopp, M.-A., Iki, T., Brosnan, C.A., Jullien, P.E., and Pumplin, N. (2017). A complex of Arabidopsis DRB proteins can impair dsRNAprocessing. RNA 23: 782–797.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Wagner, R., Aigner, H., and Funk, C. (2012). FtsH proteases located in the plant chloroplast. Physiol. Plant. 145: 203–214.Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Wigley, D.B., Gamblin, S.J., Turkenburg, J.P., Dodson, E.J., Piontek, K., Muirhead, H., and Holbrook, J.J. (1992). Structure of a ternarycomplex of an allosteric lactate dehydrogenase from Bacillus stearothermophilus at 2.5 A resolution. J. Mol. Biol. 223: 317–35.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Wistow, G.J., Mulders, J.W., and de Jong, W.W. (1987). The enzyme lactate dehydrogenase as a structural protein in avian andcrocodilian lenses. Nature 326: 622–4.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Yang, S.S. and Zhai, Q.H. (2017). Cytosolic GAPDH: a key mediator in redox signal transduction in plants. Biol. Plant. 61: 417–426.Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Yu, B., Wakao, S., Fan, J., and Benning, C. (2004). Loss of plastidic lysophosphatidic acid acyltransferase causes embryo-lethality inArabidopsis. Plant Cell Physiol. 45: 503–510.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Zaffagnini, M., Fermani, S., Costa, A., Lemaire, S.D., and Trost, P. (2013). Plant cytoplasmic GAPDH: redox post-translationalmodifications and moonlighting properties. Front. Plant Sci. 4: 1–18.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Zhang, X., Henriques, R., Lin, S.-S., Niu, Q.-W., and Chua, N.-H. (2006). Agrobacterium-mediated transformation of Arabidopsis thalianausing the floral dip method. Nat. Protoc. 1: 641–6.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Zhao, Y., Luo, L., Xu, J., Xin, P., Guo, H., Wu, J., Bai, L., Wang, G., Chu, J., Zuo, J., Hong, Y., Huang, X., and Li, J. (2018). Malatetransported from chloroplast to mitochondrion triggers production of ROS and PCD in Arabidopsis thaliana. Cell Research 28 (4): 448-461.

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

DOI 10.1105/tpc.18.00121; originally published online June 22, 2018;Plant Cell

Oliver KöttingDaniele Albertini, Benjamin A Maier, Felix Kessler, Stefan Hörtensteiner, Samuel C. Zeeman and

Tina B Schreier, Cléry Antoine, Michael Schläfli, Florian Galbier, Martha Stadler, Emilie Demarsy,Chloroplast Development Through its Interaction with an FtsH12-FtsHi Protease Complex

Plastidial NAD-Dependent Malate Dehydrogenase: A Moonlighting Protein Involved in Early

 This information is current as of September 17, 2018

 

Supplemental Data /content/suppl/2018/06/27/tpc.18.00121.DC2.html /content/suppl/2018/06/21/tpc.18.00121.DC1.html

Permissions X

https://www.copyright.com/ccc/openurl.do?sid=pd_hw1532298X&issn=1532298X&WT.mc_id=pd_hw1532298

eTOCs http://www.plantcell.org/cgi/alerts/ctmain

Sign up for eTOCs at:

CiteTrack Alerts http://www.plantcell.org/cgi/alerts/ctmain

Sign up for CiteTrack Alerts at:

Subscription Information http://www.aspb.org/publications/subscriptions.cfm

is available at:Plant Physiology and The Plant CellSubscription Information for

ADVANCING THE SCIENCE OF PLANT BIOLOGY © American Society of Plant Biologists