pi is 1198743 x 14633279

8/15/2019 Pi is 1198743 x 14633279

1/7

Linking Pneumocystis jiroveci sulfamethoxazole resistance to the

alleles of the DHPS gene using functional complementation in

Saccharomyces cerevisiae

R. Moukhlis1, J. Boyer 2, P. Lacube1, J. Bolognini1, P. Roux1 and C. Hennequin1

1) Laboratoire de Parasitologie-Mycologie, Faculté de Médecine Pierre et Marie Curie (site Saint Antoine) and 2) Unité de Génétique Moléculaire des

Levures, Université Pierre et Marie Curie, Paris, France

Abstract

Curative and prophylactic therapy for Pneumocystis jiroveci pneumonia relies mainly on cotrimoxazole, an association of trimethoprim

and sulfamethoxazole (SMX). SMX inhibits the folic acid pathway through competition with para-aminobenzoic acid (pABA), one of the

two substrates of the dihydropteroate synthase (DHPS), a key enzyme in de novo folic acid synthesis. The most frequent non-synony-

mous single nucleotide polymorphisms (SNPs) in P. jiroveci DHPS are seen at positions 165 and 171, the combination leading to four

possible different genetic alleles. A number of reports correlate prophylaxis failure and mutation in the P. jiroveci DHPS but, because of

the impossibility of reliably cultivating P. jiroveci, the link between DHPS mutation(s) and SMX susceptibility is not definitively proven. To

circumvent this limitation, the yeast Saccharomyces cerevisiae was used as a model. The introduction of the P. jiroveci DHPS gene, with or

without point mutations, directly amplified from a clinical specimen and cloned in a centromeric plasmid into a DHPS-deleted yeast

strain, allowed a fully effective complementation. However, in the presence of SMX at concentrations >250 mg/L, yeasts complemented

with the double mutated allele showed a lower susceptibility compared with strains complemented with either a single mutated allele

or wild-type alleles. These results confirm the need for prospective study of pneumocystosis, including systematic determination of the

DHPS genotype, to clarify further the impact of mutations on clinical outcome. Additionally, the S. cerevisiae model proves to be useful

for the study of still uninvestigated biological properties of P. jiroveci .

Keywords: Cotrimoxazole, Pneumocystis jiroveci , resistance

Original Submission: 27 October 2008; Revised Submission: 5 January 2009; Accepted: 7 January 2009Editor: E. Roilides

Article published online: 10 August 2009

Clin Microbiol Infect 2010; 16: 501–507

10.1111/j.1469-0691.2009.02833.x

Corresponding author and reprint requests: C. Hennequin,

Laboratoire de Parasitologie-Mycologie, Faculté de Médecine Pierre

et Marie Curie (site Saint Antoine), 27 rue de Chaligny, 75012 Paris,

France

E-mail: [email protected]

Introduction

Pneumocystis pneumonia (PCP) caused by Pneumocystis jiroveci

remains an important opportunistic infection affecting immu-

nocompromised patients such as organ transplant patients,

cancer patients and, especially, human immunodeficiency

virus (HIV)-infected patients [1–3]. Although the incidence of

PCP has declined in HIV patients due to the introduction of

highly active antiretroviral therapy [4], PCP still reveals HIV

infection in >40% of cases in France [5], and remains an

important cause of mortality [6].

The drug of choice for both treatment and prophylaxis of

PCP is cotrimoxazole, a combination of sulfamethoxazole

(SMX) and trimethoprim [7]. Sulfa drugs such as SMX act on

the folic acid synthesis (FAS) pathway and deplete cells of

folates, which are essential for growth. SMX activity occurs

by competing with para-aminobenzoic acid (pABA) in a reac-

tion catalysed by dihydropteroate synthase (DHPS) that leads

to the formation of a precursor of folinic acid [8]. As is thecase in Saccharomyces cerevisiae, the P. jiroveci FAS protein

is a multidomain protein responsible for DHPS activity, in

conjunction with other enzyme activities also involved in the

de novo FAS pathway [9]. Most common non-synonymous

mutations single nucleotide polymorphisms (SNPs) in the

P. jiroveci DHPS gene are located at nucleotide positions 165

(A–G) and 171 (C–T), causing amino acid substitutions at

codon 55 (Thr to Ala) and 57 (Pro to Ser) in a highly

conserved region of one of the putative active sites of the

enzyme [10,11]. Likewise, similar point mutations in equiva-

ª2009 The Authors

Journal Compilation ª2009 European Society of Clinical Microbiology and Infectious Diseases

ORIGINAL ARTICLE MYCOLOGY

8/15/2019 Pi is 1198743 x 14633279

2/7

lent positions have been shown to cause sulfa resistance in

pathogens such as Plasmodium falciparum [12], Toxoplasma

gondii [13], Streptococcus pneumonia [14] and Escherichia coli

[15]. Several studies have demonstrated a significant associa-

tion between sulfa and sulfone prophylaxis and the emer-

gence of DHPS gene mutations in P. jiroveci [16–18].

Because there is still no reliable culture system for P. jiroveci ,

resistance studies based upon in vitro drug susceptibility testing

cannot be performed. In this study, S. cerevisiae was used as a

model to better understand the relationship between DHPS

gene mutations and sulfa drug susceptibility. Although phyloge-

netically distant, both species are members of the phylum Asc-

omycota and contain similar DHPS genes. While similar

studies have been done using site mutagenesis targeting the

S. cerevisiae DHPS gene [19,20], we show here that the P. jiro-

veci DHPS can complement the S. cerevisiae deletion mutant,

and then tested DHPS alleles, with or without point muta-tion(s), collected directly from clinical samples. Using this

strategy, we demonstrate that a decrease in susceptibility to

SMX is associated with the double mutated genotype.

Materials and Methods

Reagents were purchased from Sigma (Lyon, France) excepted

when specified.

Strains and growth

Molecular cloning and plasmid amplification were done in the

E. coli strain DH5a (Gibco, Cergy Pontoise, France). The

growth medium used was Luria-Bertani (LB) broth (1% tryp-

tone, 0.5% yeast extract, 0.5% NaCl). Cells were made com-

petent by calcium chloride treatment, and transformants

were selected in LB supplemented with 100 mg/L of ampicil-

lin (LB-Amp). Saccharomyces cerevisiae yeast strains used in

this study derived from YH1 (mata leu2-3, 112trp1 tup1 ura

3-52) [21]. Yeasts were grown in YEPD medium (1% yeast

extract (Difco), 2% peptone (Difco), 2% glucose). The S. cere-

visiae DHPS-deficient strain EHY1 (mata leu2-3, 112trp1 tup1

ura 3-52 DHPS::LEU2) was grown in YEPD supplementedwith 100 mg/L of folinic acid [22].

Cloning P. jiroveci DHPS gene into the yeast expression

vector pCM189

Bronchoalveolar lavage fluid samples were obtained from

patients with a diagnosis of PCP confirmed by Giemsa staining

and indirect immunofluorescence (MonoFluo kit P. carinii ; Bio-

Rad, Marnes-la-Coquette, France). DNA was extracted with a

QiaGen Mini kit (Qiagen, Courtaboeuf, France) and P. jiroveci

DHPS genotype was determined using a PCR-RFLP method

previously described [23]. The four DHPS genotypes: WW

(wild type in positions 165 and 171), WM (wild type in 165

and mutated in 171), MW (mutated in position 165 and wild

type in 171) and MM (mutated in positions 165 and 171) were

obtained for this study. For cloning, the P. jiroveci DHPS gene

was amplified by a nested PCR protocol using the primers

Pj-DHPS-F1and Pj-DHPS-R1 for the first PCR and hybrid

primers Pj-DHPS-F2 and Pj-DHPS-R2 containing the Bgl II

restriction enzyme site for the second PCR (Table 1). The

sequence of P. carinii f. sp. hominis hydroxymethyl-dihydrop-

terin pyrophosphokinase/dihydropteroate synthase gene

(GenBank accession AF139132) was used to design the prim-

ers. Primers were selected to amplify the complete ORF of

the DHPS domain (48 nt upstream the start codon to 61 nt

downstream the stop codon). Cycles of amplification were as

follows: 94C for 5 min, then five cycles at 94C for 30 s,

55

C for 1 min and 72

C for 1 min followed by 25 cycles at94C for 30 s, 50C for 1 min and 72C for 1 min. For the

second round of PCR, the protocol was ten cycles at 92C for

30 s, 52C for 1 min and 72C for 1 min followed by 25 cycles

at 92C for 30 s, 42C for 1 min and 72C for 1 min. The

resulting product (834 bp) was digested with Bgl II, purified

using a QiaGen Mini kit, and cloned into the yeast centromeric

vector pCM189 [24] previously digested with BamHI.

This plasmid is characterized by the presence of the Ura3

gene and a tet promoter, repressed by doxycycline, behind the

multiple-cloning site. Cloning was done for each of the four

P. jiroveci DHPS genotypes to produce WW-, WM-, MW-,

MM-pCM189-PjDHPS. As a control, the DHPS gene of S. cerevi-

siae was amplified using primers Sc-DHPS-F and Sc-DHPS-R

(Table 1), and then similarly cloned to produce pCM189-

ScDHPS. Vectors were then introduced into E. coli by electro-

poration transformation [25]. The insertion of DHPS into the

plasmid was verified by PCR on colonies selected on LB-Amp

plates using the Seq4 and Seq8 primers (Table 1). Positive

transformants were then grown in LB-Amp broth overnight at

37C. Plasmids were then extracted using a JetSTAR kit

TABLE 1. PCR primers used in this studyName Sequences 5¢ fi 3 ¢ Origin

Ahum GCGCCTACACATATTATGGCCATTTTAAATC [23]Bhum CATAAACATCATGAACCC [23]Pj-DHPS-F1 GGATTACCTATAGTTTCTTATC This stud yPj- DH PS -R 1 GC AAA ATTA CAA TCA ACC AAA G T hi s s tudyPj-DHPS-F2 GAAGATCTTCCCTGGTATTAAACCAGTTTTGC This studyPj-DHPS-R2 GAAGATCTTCCAATTCAATAAACTCCTTTCC This studySc-DHPS-F CGCGGATCCCGTAGTGGTGTGGAGCCT This studySc-DHPS-R CGCGGATCCCACTTGTTTCCTCCCTTGG This studySeq-4 CAGGTTGTCTAACTCCTTCCTTTTCG [24]Seq-8 GAGCTCGGTACCCTATGGCA [24]

Bgl II restriction sites used for cloning are underlined.

502 Clinical Microbiology and Infection, Volume 16 Number 5, May 2010 CMI

ª2009 The Authors

Journal Compilation ª 2009 European Society of Clinical Microbiology and Infectious Diseases, CMI, 16 , 501–507

8/15/2019 Pi is 1198743 x 14633279

3/7

(Qbiogen, Illkirch, France). The product (1834 bp) was gel-

purified using a Qiagen Gel extraction kit (Qiagen) and intro-

duced into the S. cerevisiae EHY1 strain by lithium acetate pro-

tocol transformation [26]. EHY1 transformants were selected

in minimal medium plates (0.65% yeast nitrogen base (YNB)

medium without amino acids, 2% glucose) supplemented with

20 mg/L tryptophan and 100 mg/L thymidine monophosphate.

In order to eliminate the presence of other mutations in the

amplified sequence, alleles used for transformation were

sequenced at this step by direct sequencing of amplicons

obtained by PCR colony using primers Pj-DHPS-F2 and Pj-

DHPS-R2. The role of the plasmid in the change of phenotype

was checked by plating transformants on media with and with-

out doxycycline (100 mg/L).

Sulfa drug resistance assays

As a first experiment, the susceptibility of S. cerevisiae toSMX was checked by plating tenfold serial suspensions of

YH1 strain (102 –105 CFU/mL) onto YNB, added with

increasing SMX (ICN Biomedicals Inc., Warrenale, PA, USA)

concentrations prepared in 70% ethanol from 50 to

1000 mg/L. Complemented yeasts were further tested simi-

larly. The reversion of the phenotype was checked by the

addition of 100 mg/L folinic acid to the medium. The plates

were evaluated after 2 days’ incubation at 30C.

To evaluate further the in vitro susceptibility of con-

structed strains to SMX, a liquid medium assay was also

used. Briefly, 2 · 108 cells, pre-cultured overnight in YNB

medium supplemented with 20 to SMX tryptophan and 100

to SMX thymidine monophosphate, were cultured in this

medium, added with increasing concentrations of SMX, from

0 to 3 mg/mL, in a 96-U-shaped-well microplate. Absorbance

at 595 mm was measured after 48 h of incubation at 30C.

Each experiment was done in triplicate.

Results

Effect of SMX on S. cerevisiae yeast

To establish the validity of our yeast model system, theeffect of SMX on the growth of S. cerevisiae strain YH1,

which has a functional DHPS, was confirmed. As shown in

Fig. 1, YH1 (inoculum £103 cells/mL) was sensitive to SMX,

with an inhibition of growth especially noticeable when the

concentration of SMX reached 250 mg/L and complete inhi-

bition at concentrations of SMX >1000 mg/L. In the presence

of folinic acid, the growth was restored to a level similar to

that observed in the absence of SMX, suggesting an uptake

of folinic acid by the yeasts. The same results were obtained

when pABA at 2 mg/L was added instead of folinic acid. No

growth was observed for S. cerevisiae strain EHY1 in the

absence of exogenous folinic acid.

Cloning of P. jiroveci DHPS in EHY1 and complementation

tests

To test the complementation of the DHPS-deleted EHY1

strain by P. jiroveci DHPS, the yeasts were transformed with

either WW-pCM189-PjDHPS or pCM189-ScDHPS as a con-

trol, and plated in parallel onto YNB, with or without exoge-

nous folinic acid (Fig. 1). Both constructed plasmids allowed

the EHY1 strain to grow normally without the need of exog-

enous folinic acid. Addition of doxycycline induced an inhibi-tion of growth, supporting the fact that normal growth is

restored by the plasmid-borne gene controlled by the tet-off

promoter (Fig. 2). The addition of folinic acid abolished the

growth inhibition afforded by doxycycline and restored a

wild-type phenotype (data not shown).

Double mutation in P. jiroveci DHPS gene influences SMX

susceptibility of S. cerevisiae complemented yeast

Whatever the P. jiroveci DHPS genotype, transformants were

found to be able to grow on minimal medium without addition

CFU/mL A

105

104

103

102

105

104

103

102

SMX (µg/mL) 0

0

0

50

0

0

250

0

0

Folinic acid (µg/mL)

pABA (µg/mL)

SMX (µg/mL) 10000

0

2500

0

250100

2


pABA (µg/mL)

CFU/mL

B C A B C A B C

A B C A B C A B C

FIG. 1. Susceptibility of Saccharomyces cerevisiae strains to sulfameth-

oxazole (SMX) and reversion of the activity by exogenous folinic

acid. Log serial dilutions of yeast cell suspensions. Yeast strains (A)

YH1 [functional dihydropteroate synthase (DHPS)]; (B) EHY1

(DHPS-deficient) transformed with pCM189-wild type Pneumocystis

jiroveci DHPS; (C) EHY1 transformed with pCM189-S. cerevisiae

DHPS. Plates were photographed after 2 days’ incubation at 30 C.

CMI Moukhlis et al. Sulfamethoxazole resistance in Pneumocystis jiroveci 503

ª2009 The Authors

Journal Compilation ª2009 European Society of Clinical Microbiology and Infectious Diseases, CMI, 16 , 501–507

8/15/2019 Pi is 1198743 x 14633279

4/7

of folinic acid or pABA and therefore express a functional

DHPS. In order to examine the effect of P. jiroveci DHPS muta-

tions of SMX resistance, the in vitro susceptibility of EHY1

transformed with pCM189 harbouring one of the four

genotypes of P. jiroveci DHPS was compared. As shown in

Fig. 2, a single mutation at either position 165 or 171 did not

induce any change in susceptibility to SMX, compared with

wild-type DHPS of P. jiroveci or the parent strain YH1 with a

functional DHPS. In contrast, EHY1 expressing the double

mutant P. jiroveci DHPS appeared less susceptible to SMX than

other constructed strains with either a wild-type or single

mutation profile, and grew in the presence of SMX at 250 mg/

L. In a microdilution assay with SMX concentrations of 1.5 mg/

mL, growth of yeast strains complemented with either wild-

type or single mutated P. jiroveci -DHPS was reduced by 72–

75%, whereas double mutation was associated with a growth

reduction of only 10% (Fig. 3). Indeed, SMX concentration as

high as 3 mg/mL had only a marginal effect (11.6% reduction)

on the growth of this strain. In contrast, at concentrations of

SMX between 0.5 and 1 mg/mL, EHY1 complemented with

P. jiroveci DHPS harbouring either one or no mutation was

more sensitive than the YH1 parent strain.

Discussion

Sulfamethoxazole, which targets the DHPS enzyme, remains

a major component of PCP treatment and prophylaxis.

A correlation between mutation(s) in the P. jiroveci DHPS

gene and resistance to SMX has been suggested by several

surveys [16–18]. However, the inability to culture P. jiroveci

in a standardized culture system prevents routine suscepti-

bility testing and detection of drug resistance. To address

this question, an alternative strategy using S. cerevisiae was

thus designed. Indeed , S. cerevisiae is an easy and inexpen-

sive tool, commonly used for in vitro complementation stud-

ies, notably for testing inhibitors of heterologous enzymes

[27,28]. Recently, functional complementation of deleted

CFU/mL A B C D E A B C D E

CFU/mL A B C D E A B C D E

105

104

103

102

0

0

0

0

0

100

250

0

0

250

100

0


Doxycycline (µg/mL)

105

104

103

102

SMX (µg/mL)


Doxycycline (µg/mL)

SMX (µg/mL)

FIG. 2. In vitro susceptibility of transformed Saccharomyces cerevisiae

strains against sulfamethoxazole (SMX) according to the dihydro-

pteroate synthase (DHPS) genotype. (A–D): EHY1 (DHPS-deficient)

transformed by the pcM189 vector harbouring (A) double mutated

(positions 165 and 171) Pneumocystis jiroveci DHPS; (B) position 165

mutated P. jiroveci DHPS; (C) position 171 mutated P. jiroveci ; (D)

wild-type P. jiroveci DHPS; (E) YH1 (functional DHPS). Plates were

photographed after 2 days’ incubation at 30C.

1.40

1.20

1.00

0.80

0.60

0.40

0.20

0.000 250 500 750

YH1EHY1 + WW-PjDHPSEHY1 + WM-PjDHPSEHY1 + MW-PjDHPSEHY1 + MM-PjDHPS

1000 1500 2000 3000

SMX concentration (µg/mL)

O D

a t 5 9 5 n m

FIG. 3. In vitro sulfamethoxazole (SMX) susceptibility assay in YEPD liquid medium. Yeast strains YH1 [functional dihydropteroate synthase

(DHPS)] and EHY1 (DHPS-deficient) transformed with the different genotypes of Pneumocystis jiroveci DHPS WW-PjDHPS: wild-type P. jiroveci

DHPS; WM-PjDHPS: position 171 mutated P. jiroveci DHPS; MW-PjDHPS: position 165 mutated P. jiroveci DHPS; MM-PjDHPS: double mutated

(positions 165 and 171) P. jiroveci DHPS. Growth was measured by optical density at 595 mm 48 h after incubation at 30 C. The error bars

indicate standard deviations of triplicate experiments.


ª2009 The Authors


8/15/2019 Pi is 1198743 x 14633279

5/7

yeasts by Pneumocystis homologue genes has been obtained

for dihydrofolate synthase and brl1 (coding for a nuclear

envelope protein) genes [29,30]. Together with our data,

this supports the development of an S. cerevisiae model to

explore other biological characteristics of P. jiroveci until a

reliable in vitro culture becomes available [31]. In accor-

dance with previous studies showing the efficacy of other

sulfonamide derivatives against yeasts [28], we confirmed

the in vitro susceptibility of S. cerevisiae to SMX. We then

fully complemented a DHPS-deficient yeast strain with the

wild-type P. jiroveci DHPS gene, consistent with the high

level of conservation of this enzyme (73% similarity

between S. cerevisiae and P. jiroveci ). Complementation was

successful for all four P. jiroveci DHPS alleles. However, the

response to SMX was different, according to which P. jiroveci

DHPS allele was expressed. Pneumocystis jiroveci DHPS with

the double mutation was associated with lower suscep-tibility to SMX, an observation supported by assays

performed either on solid medium or in liquid medium. It

is noteworthy that multiple point mutations in the Plasmo-

dium falciparum DHPS gene are required for the induction

of resistance to sulfa drugs [32,33]. This may be due to

critical changes in the structure of the protein leading to an

altered interaction with the substrate, here, the sulfa drug.

Our findings strengthen the results of previous studies

that used either E. coli or S. cerevisiae as models and site-

directed mutagenized DHPS to address the question of

resistance to sulfa drugs [19,34]. Similarly, in E. coli , using a

heterologous DHPS construction consisting of DNA

fragments coding for the first 33 amino acids of the yeast

DHPS fused to the different alleles of P. jiroveci DHPS, double

mutation resulted in MICs threefold higher than wild-type

DHPS [35].

In contrast, complementation by chromosomal integration

of a fragment of the S. cerevisiae FOL1 gene, previously

mutagenized, into a DHPS-knockout yeast strain resulted in

a requirement of pABA for growth, evidence of reduced

susceptibility to sulfa drugs, but in this case associated with

hypersensitivity to SMX [20].

Our study differed from these studies by the use of P. jiro-veci DHPS genes obtained directly from clinical specimens.

Contrary to previous studies, this was not associated with

an auxotrophy for pABA, allowing easier interpretation of

the susceptibility tests that clearly demonstrate a decrease of

SMX susceptibility in the case of double mutation in the

P. jiroveci DHPS. This was not an artefact result due to a

growth defect of the more susceptible strains, since all

constructed strains exhibited a growth rate generally similar

to that of the DHPS-functional parent strain (data not

shown).

The clinical impact of these mutations is still controversial.

In Europe, the prevalence of the double mutated genotype

remains low (

8/15/2019 Pi is 1198743 x 14633279

6/7

3. Miller RF, Allen E, Copas A, Singer M, Edwards SG. Improved survival

for HIV infected patients with severe Pneumocystis jirovecii pneumonia

is independent of highly active antiretroviral therapy. Thorax 2006;

61: 716–721.

4. Wolff AJ, O’Donnell AE. Pulmonary manifestations of HIV infection

in the era of highly active antiretroviral therapy. Chest 2001; 120:

1888–1893.5. Latouche S, Lacube P, Maury E et al. Pneumocystis jirovecii dihydro-

pteroate synthase genotypes in French patients with pneumocystosis:

a 1998–2001 prospective study. Med Mycol 2003; 41: 533–537.

6. Kaplan JE, Sepkowitz K, Masur H, Sirisanthana T, Russo M, Chapman L.

Opportunistic infections in persons with HIV or other immunocom-

promising conditions. Emerg Infect Dis 2001; 7: 541.

7. Walzer PD, Foy J, Steele P et al. Activities of antifolate, antiviral,

and other drugs in an immunosuppressed rat model of Pneumocys-

tis carinii pneumonia. Antimicrob Agents Chemother 1992; 36: 1935–

1942.

8. Skold O. Sulfonamide resistance: mechanisms and trends. Drug Resist

Updat 2000; 3: 155–160.

9. Volpe F, Ballantine SP, Delves CJ. The multifunctional folic acid

synthesis fas gene of Pneumocystis carinii encodes dihydroneopterin

aldolase, hydroxymethyldihydropterin pyrophosphokinase and dihydr-opteroate synthase. Eur J Biochem 1993; 216: 449–458.

10. Lane BR, Ast JC, Hossler PA et al. Dihydropteroate synthase poly-

morphisms in Pneumocystis carinii . J Infect Dis 1997; 175: 482–485.

11. Kazanjian P, Locke AB, Hossler PA et al. Pneumocystis carinii mutations

associated with sulfa and sulfone prophylaxis failures in AIDS patients.

AIDS 1998; 12: 873–878.

12. Brooks DR, Wang P, Read M, Watkins WM, Sims PF, Hyde JE.

Sequence variation of the hydroxymethyldihydropterin pyrophospho-

kinase: dihydropteroate synthase gene in lines of the human malaria

parasite, Plasmodium falciparum, with differing resistance to sulfadox-

ine. Eur J Biochem 1994; 224: 397–405.

13. Allegra CJ, Boarman D, Kovacs JA et al. Interaction of sulfonamide

and sulfone compounds with Toxoplasma gondii dihydropteroate syn-

thase. J Clin Invest 1990; 85: 371–379.

14. Lopez P, Espinosa M, Greenberg B, Lacks SA. Sulfonamide resistancein Streptococcus pneumoniae: DNA sequence of the gene encoding

dihydropteroate synthase and characterization of the enzyme.

J Bacteriol 1987; 169: 4320–4326.

15. Dallas WS, Gowen JE, Ray PH, Cox MJ, Dev IK. Cloning, sequencing,

and enhanced expression of the dihydropteroate synthase gene of

Escherichia coli mc4100. J Bacteriol 1992; 174: 5961–5970.

16. Helweg-Larsen J, Benfield TL, Eugen-Olsen J, Lundgren JD, Lundgren

B. Effects of mutations in Pneumocystis carinii dihydropteroate

synthase gene on outcome of AIDS-associated P. carinii pneumonia.

Lancet 1999; 354: 1347–1351.

17. Ma L, Kovacs JA, Cargnel A, Valerio A, Fantoni G, Atzori C. Muta-

tions in the dihydropteroate synthase gene of human-derived Pneumo-

cystis carinii isolates from Italy are infrequent but correlate with prior

sulfa prophylaxis. J Infect Dis 2002; 185: 1530–1532.

18. Visconti E, Ortona E, Margutti P et al. Identification of dihydroptero-ate (DHPS) gene mutant in Pneumocystis carinii in respiratory samples

of HIV+ patients from 1992 to 1997. J Eukaryot Microbiol 1999; 46:

S132.

19. Iliades P, Meshnick SR, Macreadie IG. Dihydropteroate synthase

mutations in Pneumocystis jiroveci can affect sulfamethoxazole resis-

tance in a Saccharomyces cerevisiae model. Antimicrob Agents Chemother

2004; 48: 2617–2623.

20. Meneau I, Sanglard D, Bille J, Hauser PM. Pneumocystis jiroveci dihydro-

pteroate synthase polymorphisms confer resistance to sulfadoxine

and sulfanilamide in Saccharomyces cerevisiae. Antimicrob Agents Chemo-

ther 2004; 48: 2610–2616.

21. Huang T, Barclay BJ, Kalman TI, von Borstel RC, Hastings PJ. The

phenotype of a dihydrofolate reductase mutant of Saccharomyces cere-

visiae. Gene 1992; 121: 167–171.

22. Bayly AM, Berglez JM, Patel O et al. Folic acid utilisation related to

sulfa drug resistance in Saccharomyces cerevisiae. FEMS Microbiol Lett

2001; 204: 387–390.

23. Santos LD, Lacube P, Latouche S et al. Contribution of dihydroptero-ate synthase gene typing for Pneumocystis carinii f. sp. hominis epidemi-

ology. J Eukaryot Microbiol 1999; 46: S133–S134.

24. Gari E, Piedrafita L, Aldea M, Herrero E. A set of vectors with a

tetracycline-regulatable promoter system for modulated gene expres-

sion in Saccharomyces cerevisiae. Yeast 1997; 13: 837–848.

25. Chung CT, Miller RH. A rapid and convenient method for the prepa-

ration and storage of competent bacterial cells. Nucleic Acids Res

1988; 16: 3580.

26. Gietz RD, Schiestl RH, Willems AR, Woods RA. Studies on the

transformation of intact yeast cells by the liac/ss-DNA/peg proce-

dure. Yeast 1995; 11: 355–360.

27. Brophy VH, Vasquez J, Nelson RG, Forney JR, Rosowsky A, Sibley

CH. Identification of Cryptosporidium parvum dihydrofolate reductase

inhibitors by complementation in Saccharomyces cerevisiae. Antimicrob

Agents Chemother 2000; 44: 1019–1028.28. Castelli LA, Nguyen NP, Macreadie IG. Sulfa drug screening in yeast:

fifteen sulfa drugs compete with p-aminobenzoate in Saccharomyces

cerevisiae. FEMS Microbiol Lett 2001; 199: 181–184.

29. Hauser PM, Macreadie IG. Isolation of the Pneumocystis carinii dihy-

drofolate synthase gene and functional complementation in Saccharo-

myces cerevisiae. FEMS Microbiol Lett 2006; 256: 244–250.

30. Lo Presti L, Cockell M, Cerutti L, Simanis V, Hauser PM. Functional

characterization of Pneumocystis carinii brl1 by transspecies comple-

mentation analysis. Eukary ot Cell 2007; 6: 2448–2452.

31. Hauser PM, Lo Presti L, Cockell M, Cerutti L, Simanis V. Analysis of

Pneumocystis carinii gene function by complementation in yeast

mutants. J Eukaryot Microbiol 2006; 53 (Suppl 1): S149–S150.

32. Olliaro P. Mode of action and mechanisms of resistance for antima-

larial drugs. Pharmacol Ther 2001; 89: 207–219.

33. Triglia T, Wang P, Sims PF, Hyde JE, Cowman AF. Allelic exchange atthe endogenous genomic locus in Plasmodium falciparum proves the

role of dihydropteroate synthase in sulfadoxine-resistant malaria.

EMBO J 1998; 17: 3807–3815.

34. Iliades P, Walker DJ, Castelli L, Satchell J, Meshnick SR, Macreadie

IG. Cloning of the Pneumocystis jirovecii trifunctional fas gene and com-

plementation of its DHPS activity in Escherichia coli . Fungal Genet Biol

2004; 41: 1053–1062.

35. Iliades P, Meshnick SR, Macreadie IG. Mutations in the Pneumocystis

jirovecii DHPS gene confer cross-resistance to sulfa drugs. Antimicrob

Agents Chemother 2005; 49: 741–748.

36. Esteves F, Montes-Cano MA, de la Horra C et al. Pneumocystis jirovecii

multilocus genotyping profiles in patients from Portugal and Spain.

Clin Microbiol Infect 2008; 14: 356–362.

37. Kazanjian PH, Fisk D, Armstrong W et al. Increase in prevalence of

Pneumocystis carinii mutations in patients with AIDS and P. carinii pneumonia, in the United States and China. J Infect Dis 2004; 189:

1684–1687.

38. Magne D, Lacube P, Angoulvant A et al. Pneumocystosis: survey and

DHPS genotype analysis in 14 Parisian hospitals in 2003 and 2004.

J Eukaryot Microbiol 2006; 53 (Suppl 1): S106–S107.

39. Navin TR, Beard CB, Huang L et al. Effect of mutations in Pneumocys-

tis carinii dihydropteroate synthase gene on outcome of P. carinii

pneumonia in patients with HIV-1: a prospective study. Lancet 2001;

358: 545–549.

40. Ma L, Borio L, Masur H, Kovacs JA. Pneumocystis carinii dihydroptero-

ate synthase but not dihydrofolate reductase gene mutations corre-


ª2009 The Authors


8/15/2019 Pi is 1198743 x 14633279

7/7

late with prior trimethoprim-sulfamethoxazole or dapsone use.

J Infect Dis 1999; 180: 1969–1978.

41. Kazanjian P, Armstrong W, Hossler PA et al. Pneumocystis carinii

mutations are associated with duration of sulfa or sulfone prophylaxis

exposure in AIDS patients. J Infect Dis 2000; 182: 551–557.

42. Huang L, Beard CB, Creasman J et al. Sulfa or sulfone prophylaxis

and geographic region predict mutations in the Pneumocystis carinii dihydropteroate synthase gene. J Infect Dis 2000; 182: 1192–1198.

43. Takahashi T, Hosoya N, Endo T et al. Relationship between muta-

tions in dihydropteroate synthase of Pneumocystis carinii f. sp. hominis

isolates in Japan and resistance to sulfonamide therapy. J Clin Microbiol

2000; 38: 3161–3164.

CMI Moukhlis et al. Sulfamethoxazole resistance in Pneumocystis jiroveci 507

ª2009 The Authors

Journal Compilation ª2009 European Society of Clinical Microbiology and Infectious Diseases, CMI, 16 , 501–507

pi is 1198743 x 14633279

Documents