Molecular Phylogenetics and Evolution 103 (2016) 6–18

Contents lists available at ScienceDirect

Molecular Phylogenetics and Evolution

journal homepage: www.elsevier .com/locate /ympev

Out of Africa: Phylogeny and biogeography of the widespread genusAcanthodactylus (Reptilia: Lacertidae)

http://dx.doi.org/10.1016/j.ympev.2016.07.0031055-7903/� 2016 Elsevier Inc. All rights reserved.

⇑ Corresponding author at: Department of Zoology, George S. Wise Faculty of LifeSciences, Tel Aviv University, Tel Aviv 6997801, Israel.

E-mail address: karintmr@gmail.com (K. Tamar).

Karin Tamar a,b,⇑, Salvador Carranza c, Roberto Sindaco d, Jirí Moravec e, Jean-François Trape f, Shai Meiri a,b

aDepartment of Zoology, George S. Wise Faculty of Life Sciences, Tel Aviv University, Tel Aviv 6997801, Israelb The Steinhardt Museum of Natural History, Israel National Center for Biodiversity Studies, Tel Aviv University, Tel Aviv 6997801, Israelc Institut de Biologia Evolutiva (CSIC-Universitat Pompeu Fabra), Passeig Maritím de la Barceloneta, 37-49, 08003 Barcelona, SpaindMuseo Civico de Storia Naturale, via San Francesco di Sales 188, I-10022 Carmagnola, Torino, ItalyeDepartment of Zoology, National Museum, Cirkusová 1740, 19300 Prague 9, Czech Republicf Laboratoire de paludologie et zoologie médicale, Institut de Recherche pour le Développement, UMR MIVEGEC, B.P. 1386, Dakar, Senegal

a r t i c l e i n f o a b s t r a c t

Article history:Received 15 February 2016Revised 1 June 2016Accepted 5 July 2016Available online 6 July 2016

Keywords:ArabiaDiversificationMolecular clockPhylogeographySystematicsTaxonomy

Acanthodactylus lizards are among the most diverse and widespread diurnal reptiles in the arid regionsspanning from North Africa across to western India. Acanthodactylus constitutes the most species-richgenus in the family Lacertidae, with over 40 recognized species inhabiting a wide variety of dry habitats.The genus has seldom undergone taxonomic revisions, and although there are a number of described spe-cies and species-groups, their boundaries, as well as their interspecific relationships, remain largely unre-solved. We constructed a multilocus phylogeny, combining data from two mitochondrial (12S, cytb) andthree nuclear (MC1R, ACM4, c-mos) markers for 302 individuals belonging to 36 known species, providingthe first large-scale time-calibrated molecular phylogeny of the genus. We evaluated phylogenetic rela-tionships between and within species-groups, and assessed Acanthodactylus biogeography across itsknown range. Acanthodactylus cladogenesis is estimated to have originated in Africa due to vicarianceand dispersal events from the Oligocene onwards. Radiation started with the separation into three clades:the Western and scutellatus clades largely distributed in North Africa, and the Eastern clade occurringmostly in south-west Asia. Most Acanthodactylus species diverged during the Miocene, possibly as a resultof regional geological instability and climatic changes. We support most of the current taxonomic classi-fications and phylogenetic relationships, and provide genetic validity for most species. We reveal a newdistinct blanfordii species-group, suggest new phylogenetic positions (A. hardyi, A. masirae), and syn-onymize several species and subspecies (A. lineomaculatus, A. boskianus khattensis and A. b. nigeriensis)with their phylogenetically closely-related species. We recommend a thorough systematic revision oftaxa, such as A. guineensis, A. grandis, A. dumerilii, A. senegalensis and the pardalis and erythrurusspecies-groups, which exhibit high levels of intraspecific variability, and clear evidence of phylogeneticcomplexity.

� 2016 Elsevier Inc. All rights reserved.

1. Introduction

The Old World genus Acanthodactylus Fitzinger, 1834 is themost species-rich genus in the family Lacertidae, comprising over40 currently recognized species (Uetz and Hošek, 2016). Theselizards are commonly known as fringe-fingered lizards due to theirdistinctive lateral finger scalation. Acanthodactylus is a member ofthe Saharo-Eurasian clade within the Eremiadini tribe (Mayer andPavlicev, 2007), and along with its phylogenetically closest

members (i.e., Eremias, Mesalina, Ophisops; Pyron et al., 2013), itinhabits mostly xeric habitats in North Africa and Asia (Sindacoand Jeremcenko, 2008). Acanthodactylus ranges from the IberianPeninsula, across North Africa (including the Sahel) and theArabian Peninsula towards western India, and northward to Cyprusand southern Turkey (Fig. 1; Salvador, 1982; Arnold, 1983; Schleichet al., 1996; Sindaco and Jeremcenko, 2008). Acanthodactylus arediurnal, ground-dwelling, medium-sized lizards, occurring inseveral climatic regions, from the Mediterranean ecoregion to theharsh desert environments of the Sahara and Arabia, occupying awide array of arid ecosystems from open woodland, shrublandand savanna to sand dune deserts (Salvador, 1982; Arnold, 1983;Sindaco and Jeremcenko, 2008).

Fig. 1. Map illustrating the distributional range of Acanthodactylus (modified from Sindaco and Jeremcenko, 2008), including the phylogenetic tree with the three clades andthe localities of each clade member.

K. Tamar et al. /Molecular Phylogenetics and Evolution 103 (2016) 6–18 7

Acanthodactylus is known among herpetologists as one of themost taxonomically complex genera. The genus is morphologicallyhighly conservative, but some species have great intraspecific vari-ability (e.g., A. boskianus; Salvador, 1982; Arnold, 1983). The taxon-omy of this genus is unstable due to complex microevolution, greatintraspecific variation (usually non-clinal; Schleich et al., 1996),and morphological convergence (Tamar et al., 2014). Consequently,the classification of many species remains unresolved and evenambiguous (e.g., A. mechriguensis; Nouira and Blanc, 1999;Fonseca et al., 2008).

The current systematic knowledge of Acanthodactylus is basedon several revisions of its morphology, osteology, and hemipenialfeatures (Boulenger, 1918; Salvador, 1982; Arnold, 1983; Harrisand Arnold, 2000), as well as on phylogenetic studies (Harris andArnold, 2000; Harris et al., 2004; Fonseca et al., 2008, 2009;Carretero et al., 2011; Heidari et al., 2014; Tamar et al., 2014).The first genus-level molecular phylogeny of Acanthodactylus sam-pled 15 species and divided the genus into three clades: Eastern,Western, and scutellatus (Harris and Arnold, 2000). The genus isfurther divided into species-groups based on gross morphologicalsimilarities among species (Salvador, 1982; Arnold, 1983; Harrisand Arnold, 2000). Currently, Acanthodactylus species are dividedinto the following species-groups (hereafter ‘groups’) within thethree clades: the Western clade comprises the tristrami group fromthe Middle East, and the erythrurus and pardalis groups occupyingthe Sub-Saharan region and the coastal areas of North Africa; thescutellatus clade corresponds to the scutellatus group solely, occur-ring mainly in the sandy areas of North Africa; and the Easternclade is composed of the micropholis, grandis, cantoris, opheodurusand boskianus groups, mostly inhabiting south-west Asia. Thegroup division within Acanthodactylus is frequently used today,although the actual number of groups is debated (Salvador,1982; Arnold, 1983; Harris and Arnold, 2000), as is the assignmentof some species to groups (e.g., A. blanfordii and A. masirae withinthe cantoris group; Harris and Arnold, 2000). Furthermore, clear

systematic identifications within the groups are intricate (e.g., A.schreiberi and A. boskianus within the boskianus group; Tamaret al., 2014; A. dumerilii and A. senegalensis within the scutellatusgroup; Schleich et al., 1996; Crochet et al., 2003; Trape et al.,2012). The systematic classification is further obscured by theambiguous boundaries and relationships among species andgroups (Salvador, 1982; Arnold, 1983; Mellado and Olmedo,1990; Harris and Arnold, 2000; Crochet et al., 2003; Harris et al.,2004; Fonseca et al., 2008, 2009; Tamar et al., 2014).

The widely-distributed, relatively species-rich Acanthodactylusgenus provides an excellent model group to test biogeographichypotheses and examine the processes that have resulted in itscurrent diversification. However, an objective assessment of thesehypotheses is complicated as there is no consensus regarding theevolutionary and biogeographical timeframe of the origin anddiversification within the Eremiadini tribe and its Saharo-Eurasian clade, to which Acanthodactylus belongs. Several studiesof the Lacertidae have suggested that the diversification withinEremiadini occurred during the Miocene, 17–19 million years ago(Mya), following the collision of Africa-Arabia and Eurasia, withthe later recolonization of Asia (Arnold, 1989a, 2004; Mayer andBenyr, 1994; Harris et al., 1998; Arnold et al., 2007; Mayer andPavlicev, 2007; Pavlicev and Mayer, 2009). Other authors, such asWiens et al. (2006), Hipsley et al. (2009) and Zheng and Wiens(2016), have suggested much older dates, during the Eocene. Inaddition, several studies have hypothesized that Acanthodactylus,and its closest relatives within the Saharo-Eurasian clade (i.e., Ere-mias, Mesalina, Ophisops), originated in south-west Asia wheremost of their species occur, with multiple later invasions intoAfrica (Arnold, 1989b, 2004; Harris and Arnold, 2000; Mayer andPavlicev, 2007; Hipsley et al., 2009).

A thorough examination of the phylogeny and phylogeographyof Acanthodactylus will help to shed light on the complexsystematics and biogeography of this genus. In this study weproduce the first comprehensive, time-calibrated phylogeny of

8 K. Tamar et al. /Molecular Phylogenetics and Evolution 103 (2016) 6–18

Acanthodactylus, based on multilocus genetic data, in order to elu-cidate the biogeographical and evolutionary history and to clarifyits systematics.

2. Material and methods

2.1. DNA extraction, amplification and sequence analysis

We analysed 302 specimens of Acanthodactylus, representing 36recognizing species, from across its known distribution range(Figs. 1–4; Table S1). To enlarge the number of samples, additionalsequences of eight specieswere retrieved fromGenBank (sequencesfromTamar et al., 2014).Mesalina olivieri andM. guttulatawere usedas outgroups based on previous publications (Harris et al., 1998; Fu,2000; Mayer and Pavlicev, 2007; Kapli et al., 2011; Pyron et al.,2013). Codes, locations and GenBank accession numbers are listedin Table S1. Localities are shown in Figs. 2–4.

Genomic DNA was isolated from ethanol-preserved tissue sam-ples using either the DNeasy Blood & Tissue Kit (Qiagen, Valencia,CA, USA) or the SpeedTools Tissue DNA Extraction kit (Biotools,Madrid, Spain). Individuals were sequenced for both strands oftwo mitochondrial gene fragments, the 12S ribosomal RNA (12S)

Fig. 2. The Western clade within Acanthodactylus, part of a Bayesian Inference tree inferreof Acanthodactylus species were modified from Sindaco and Jeremcenko (2008). Codes ne(sample A227 is not shown). Data on all samples are given in Table S1. Maximum likeposterior probability in the Bayesian analysis is indicated by black dots on the nodes (vnodes and include the mean and, in parentheses, the 95% highest posterior densities (H

and Cytochrome b (cytb), and three nuclear gene fragments:melano-cortin 1 receptor (MC1R), acetylcholinergic receptor M4(ACM4) and oocyte maturation factor MOS (c-mos). Primers, PCRprotocols and source references are listed in Table S2.

Chromatographs were edited using Geneious v.7.1.9 (BiomatterLtd.). For the nuclear loci, MC1R, ACM4 and c-mos, heterozygouspositions were coded according to the IUPAC ambiguity codes.Coding gene fragments (cytb, MC1R, ACM4, c-mos) were translatedinto amino acids and no stop codons were observed, suggestingthat the sequences are all functional and no pseudogenes wereamplified. DNA sequences were aligned for each gene fragmentindependently using the online version of MAFFT v.7 (Katoh andStandley, 2013) with default parameters (Auto strategy, Gap open-ing penalty: 1.53, Offset value: 0.0). For the 12S fragments weapplied the Q-INS-i strategy, in which data on the secondarystructure of the RNA are considered. Poorly aligned positions of12S were eliminated with G-blocks (Castresana, 2000) using lowstringency options (Talavera and Castresana, 2007). Inter andintra-specific uncorrected p-distances with pairwise deletion of12S and cytb, and the number of variable (V) and parsimonyinformative (Pi) sites for the ingroup only, were calculated inMEGA v.5.2 (Tamura et al., 2011).

d from the concatenated dataset (12S, cytb, MC1R, ACM4, c-mos). Distribution rangesxt to each taxon refer to the locality in the distribution maps and country of originlihood bootstrap support values (valuesP 70%) are indicated near the nodes andaluesP 0.95). Age estimates obtained with BEAST are indicated near the relevantPD).

Fig. 3. The scutellatus clade within Acanthodactylus, part of a Bayesian Inference tree inferred from the concatenated dataset (12S, cytb, MC1R, ACM4, c-mos). Distributionranges of Acanthodactylus species were modified from Sindaco and Jeremcenko (2008). Codes next to each taxon refer to the locality in the distribution maps and country oforigin (sample A224 is not shown). Data on all samples are given in Table S1. Maximum likelihood bootstrap support values (valuesP 70%) are indicated near the nodes andposterior probability in the Bayesian analysis is indicated by black dots on the nodes (valuesP 0.95). Age estimates obtained with BEAST are indicated near the relevantnodes and include the mean and, in parentheses, the 95% highest posterior densities (HPD).

K. Tamar et al. /Molecular Phylogenetics and Evolution 103 (2016) 6–18 9

2.2. Phylogenetic analyses

We used PartitionFinder v.1.1.1 (Lanfear et al., 2012) to selectthe best-fit partitioning scheme and models of molecular evolution

for the dataset, with the following parameters: linked branchlength; models available in BEAST; AIC model selection; greedysearch algorithm. Due to the large size of the dataset, to avoidover-parameterization, each of the five markers was set in the

Fig. 4. The Eastern clade within Acanthodactylus, part of a Bayesian Inference tree inferred from the concatenated dataset (12S, cytb, MC1R, ACM4, c-mos). Distribution rangesof Acanthodactylus species were modified from Sindaco and Jeremcenko (2008). Codes next to each taxon refer to the locality in the distribution maps and country of origin(sample A178 is not shown). Data on all samples are given in Table S1. Maximum likelihood bootstrap support values (valuesP 70%) are indicated near the nodes andposterior probability in the Bayesian analysis is indicated by black dots on the nodes (valuesP 0.95). Age estimates obtained with BEAST are indicated near the relevantnodes and include the mean and, in parentheses, the 95% highest posterior densities (HPD).

10 K. Tamar et al. /Molecular Phylogenetics and Evolution 103 (2016) 6–18

K. Tamar et al. /Molecular Phylogenetics and Evolution 103 (2016) 6–18 11

input file as a distinct data block. A summary of DNA partitions andrelevant models as determined by PartitionFinder is given inTable S3.

Phylogenetic analyses were performed using maximum likeli-hood (ML) and Bayesian Inference (BI) methods. Models, priorsand parameter specifications applied are listed in Table S3. MLanalyses were performed with RAxML v.7.4.2 (Stamatakis, 2006)as implemented in raxml GUI v.1.3 (Silvestro and Michalak,2012) with a GTRGAMMA model of sequence evolution. All MLanalyses were performed with 100 random addition replicateswith parameters estimated independently for each partition. Nodalsupport was assessed by bootstrap analysis with 1000 pseudorepli-cations (Felsenstein, 1985). BI analyses were performed withBEAST v.1.8.0 (Drummond et al., 2012). For all analyses imple-mented in BEAST, the .xml file was modified to ‘‘Ambigui-ties = true” for the nuclear partitions to account for variability inthe heterozygote positions, rather than treating them as missingdata. Parameter values both for clock and substitution modelswere unlinked across partitions. All BEAST analyses were carriedout in CIPRES Science Gateway (Miller et al., 2010). Convergencewas assessed by confirming that all parameters had reached sta-tionarity and had sufficient effective sample sizes (> 200) usingTRACER v.1.6 (Rambaut et al., 2014). LogCombiner and TreeAnno-tator (both available in the BEAST package) were used to combinethe runs and produce the ultrametric tree after discarding 10% asburn-in. We treated alignment gaps as missing data, and thenuclear gene sequences were not phased. Nodes were consideredstrongly supported if they received ML bootstrap valuesP 70%and posterior probability (pp) support valuesP 0.95 (Wilcoxet al., 2002; Huelsenbeck and Rannala, 2004).

In order to identify divergent lineageswithinAcanthodactylus,weperformed the independent Generalized Mixed Yule-coalescent(GMYC) analysis (Pons et al., 2006). As this analysis relies on singlelocus data, we used a Bayesian concatenated mitochondrial phylo-genetic tree including haplotypes only, reconstructed with BEASTv.1.8.0. Models, priors and parameters are specified in Table S3.We applied the single threshold algorithm implemented in the R‘‘SPLITS” package (Species Limits by Threshold Statistics; Ezardet al., 2009) and compared to the null model (i.e., all individualsbelong to a single species) using a log-likelihood ratio test.

2.3. Estimation of divergence times

Due to the lack of internal calibration points for Acanthodacty-lus, we used calibration points of other lacertids, Gallotia andPodarcis, as previously used in other lacertid phylogenies (e.g.,Kaliontzopoulou et al., 2011; Carranza and Arnold, 2012; Kapliet al., 2013, 2015; Tamar et al., 2015). Divergence times were esti-mated in BEAST v.1.8.0 using the complete concatenated dataset(nuclear genes unphased). The dataset for this analysis includedone representative of each independent GMYC entity of Acantho-dactylus (in order to account for the deep lineages in the phy-logeny; see Metallinou et al., 2015 for dataset strategycomparisons) and sequences of Gallotia and Podarcis (retrievedfrom GenBank; Table S1). The .xml file was manually modified to‘‘Ambiguities = true” for the nuclear genes (MC1R, ACM4, c-mos).Models, priors and parameters are specified in Table S3.

One calibration coincides with the end of the Messinian SalinityCrisis (Normal distribution, mean 5.32, stdev 0.05) - the separationbetween Podarcis pityusensis and Podarcis lilfordi (endemic to theBalearic Islands; Brown et al., 2008), and between Podarcis cretensisand Podarcis peloponnesiacus (isolation of Crete from the Pelopon-nesus; Poulakakis et al., 2005). The other calibrations were basedon the ages of the Canary Islands and the splits between the spe-cies of the Canary Islands’ endemic genus Gallotia (Cox et al.,2010; Carranza and Arnold, 2012) as follows: (a) the split between

Gallotia and Psammodromus algirus (age of the oldest islandsFuerteventura and Lanzarote; Normal distribution, mean 18, stdev2); (b) the split between G. galloti and G. caesaris (age of La GomeraIsland; Normal distribution, mean 6, stdev 3); (c) the split betweenG. galloti palmae and the ancestor of G. g. galloti and G. g. eisentrauti(age of La Palma Island; Normal distribution, mean 1, stdev 0.5);and (d) the splits between G. gomerana and G. simonyi machadoiand between G. caesaris caesaris and G. c. gomerae (age of El HierroIsland; Normal distribution, mean 0.8, stdev 0.2).

2.4. Ancestral area reconstruction

In order to identify the phylogeographic history and reconstructthe ancestral origin of Acanthodactylus, we used the BayesianStochastic Search Variable Selection (BSSVS; Lemey et al., 2009) ofthe discrete phylogeographic model as implemented in BEASTv.1.8.0.We used the complete concatenated dataset with one repre-sentative of each independent GMYC entity (Table S1; ingroup only;nuclear genes unphased). For a temporal framewe applied the aver-age sequence evolution rates of 12S and cytbmitochondrial regions(as estimated in Carranza and Arnold, 2012) also to cross-check thedivergence time estimations. These rates were extracted from afully calibrated phylogeny of the lacertid genus Gallotia from theCanary Islands and the divergence between Podarcis pityusensisand P. lilfordi from the Balearic Islands (for a full account of thespecific calibration points see Carranza and Arnold, 2012). Theserates had been implemented in other lacertid phylogenies, suchas Tamar et al. (2014) and Bellati et al. (2015).We assigned the phy-logeographic traits according to two discrete geographic regions,corresponding to the main areas from which Acanthodactylus wassuggested to originate (Arnold, 1983, 1989a; Harris and Arnold,2000) – Africa (including the Iberian Peninsula) and south-westAsia (including Cyprus and the Sinai and Arabian Peninsulas). Mod-els, prior settings and parameters are listed in Table S3.

3. Results

3.1. Taxon sampling, genetic data and phylogenetic analyses

Thedataset for the phylogenetic analyses comprised 302 individ-uals of 36 known species (Table S1). The dataset totalling 2404 bpcomprised mitochondrial gene fragments of 12S (�385 bp;V = 176; Pi = 154) and cytb (405 bp; V = 217; Pi = 200), and nucleargene fragments of MC1R (663 bp; V = 100; Pi = 73), ACM4 (429 bp;V = 76; Pi = 44) and c-mos (522 bp; V = 104; Pi = 80). The uncor-rected p-distances of the 12S and cytbmitochondrial gene fragmentsbetween and within each species are summarized in Table S4.

The results of the phylogenetic analyses of the complete andmitochondrial datasets, using ML and BI methods, produced verysimilar topologies, differing primarily at the less supported nodes(Figs. 2–4 and S1–S2). The level of genetic variability within Acan-thodactylus is very high, as reflected in both the genetic distances(Table S4) and the results of the GMYC analysis with the singlethreshold approach (Fig. S3; based on the concatenated mitochon-drial haplotype dataset). The latter analysis recovered three cladesand 111 different entities, probably due to incomplete geographicsampling (Talavera et al., 2013). The result of the likelihood ratiotest was significant (p < 0.0001), indicating that the null model(i.e., single population) could be rejected.

3.2. Phylogenetic relationships and genetic diversity withinAcanthodactylus

The phylogenetic results reveal three clearly distinct cladeswithin Acanthodactylus. Within them, ten groups are defined,

12 K. Tamar et al. /Molecular Phylogenetics and Evolution 103 (2016) 6–18

though not all relationships among groups or species are equallysupported (Figs. 1–4 and S1–S3). The three clades in our study cor-respond to the clades shown in Harris and Arnold (2000), we thusretain the names they coined: Western, scutellatus and Eastern. Thephylogenetic results reveal that the Western clade is sister to aclade composed of the scutellatus and Eastern clades (ML supportonly for the mitochondrial tree; Figs. S1–S2).

The Western clade (Fig. 2 and S1–S2) incorporated one well-defined lineage representing A. guineensis, and three groups, tris-trami, erythrurus, and pardalis, though the phylogenetic relation-ships within the clade are not well supported. Acanthodactylusguineensis, a Sub-Saharan member, is represented by mitochon-drial gene fragments only (the nuclear gene fragments failed toamplify properly). This species is recovered as sister to the remain-ing species of the clade, genetically very distant from the other spe-cies of the group, clade, and genus (p-distance 12S: 11.7–17.6%;cytb: 17.4–25.1%). The phylogenetic position of A. guineensiswithinthe genus is not stable. According to the phylogenetic analyses ofthe complete and mitochondrial datasets, it is situated within theWestern clade (Figs. 2 and S1–S3), whereas in the BI dating analy-sis it is sister to the entire genus (Fig. S4). The tristrami group, rep-resented by A. orientalis and A. tristrami, is monophyletic. Theerythrurus group is paraphyletic. The phylogenetic positions of A.savignyi from Algeria and the Sub-Saharan A. boueti are not wellsupported and they are highly genetically distant from the remain-ing members of the group (Table S4). The remaining species of theerythrurus group form a well-supported clade, in which A. blanciand A. lineomaculatus are nested within A. erythrurus, making thelatter paraphyletic (A. blanci is not nested in the ML analysis;Fig. S1). The relationships within the pardalis group are very com-plex. Two species of this group, A. beershebensis and A. pardalis, aremonophyletic, whereas A. bedriagai and A. maculatus are para-phyletic and exhibit high genetic diversity (Table S4). Acantho-dactylus busacki is paraphyletic in the ML analyses of thecomplete and mitochondrial datasets (Figs. S1–S2) with no supportfor monophyly in the BI analysis (Fig. 2).

The scutellatus clade (Figs. 3 and S1–S2) is composed solely ofthe scutellatus group, represented by seven species. Acanthodacty-lus taghitensis A. aureus, A. longipes and A. aegyptius are mono-phyletic. Both A. aegyptius and A. longipes form a distinct,strongly supported, lineage. Although monophyly of the nominatespecies A. scutellatus is recovered, the bootstrap and pp supportvalues are low. This species is divided into two reciprocally mono-phyletic lineages corresponding to its two subspecies, A. s. scutella-tus and A. s. audouini. Both A. dumerilii and A. senegalensis areparaphyletic in respect to one another and form a monophyleticlineage. Within this lineage they form two geographic clusters, anorthern cluster from Algeria and Morocco and a southern clusterfrom Western Sahara southwards.

The Eastern clade (Figs. 4 and S1–S2) comprises 16 species rep-resenting six well-supported monophyletic groups. Themicropholisgroup (A. micropholis) is sister to the grandis group. Acanthodactylusgrandis is paraphyletic with respect to A. harranensis and is highlydiverse genetically (p-distance 12S: 6.1%; cytb: 14.6%). A distinctlineage is composed of the sister species A. blanfordii and A.schmidti. The phylogenetic position of A. hardyi is not supportedin either the ML or the BI analyses, but it forms a well-supportedmonophyletic lineage. The cantoris group is composed of six spe-cies: A. cantoris, A. masirae, A. haasi, A. gongrorhynchatus, A. tilburyi,and A. arabicus, though the phylogenetic relationships among thespecies are mostly not supported. Acanthodactylus cantoris and A.masirae are sister species, while the remaining species form a dis-tinct clade. The opheodurus and boskianus are sister groups. Thetwo species representing the opheodurus group, A. opheodurusand A. felicis, are reciprocally monophyletic. Although the mono-phyly of the opheodurus group is recovered, in the ML analyses

the bootstrap support values are low (Figs. S1–S2). The two mem-bers of the boskianus group, A. schreiberi and A. boskianus, are bothparaphyletic as the former species is nested entirely within the lat-ter. The two Sahelian subspecies of A. boskianus, A. b. nigeriensis andA. b. khattensis, are also nested within the third widespread sub-species, A. b. asper.

3.3. Estimation of divergence times

The divergence time estimations (Fig. S4) are presented inFigs. 2–4 at the relevant nodes. Acanthodactylus guineensis is recov-ered as a sister taxon to Acanthodactylus in the BI dating analysis(Fig. S4), contradictory to its position within the Western cladebased on the phylogenetic analyses of the complete and mitochon-drial datasets (Figs. 2 and S1–S2). Our results indicate that diversi-fication within Acanthodactylus originated during the Oligocenearound 30–33 Mya (95% highest posterior density, HPD: 22.2–45.3 Mya). The Eastern and scutellatus clades separated approxi-mately 27 Mya (95% HPD: 20–35.8 Mya). Further radiation withinthe genus occurred from the Miocene onwards.

3.4. Ancestral area reconstruction

The results of the discrete phylogeographic analyses using theBSSVS model, within a temporal framework of evolutionary rates,are presented in Fig. 5. The two dating approaches (i.e., geologicalcalibration points and evolution rates) resulted in almost identicaldates (Figs. 2–5). Acanthodactylus most likely originated in Africa(83% probability). The origin of both the Western and scutellatusclades is probably also African (91% and 99% probability, respec-tively), whereas the Eastern clade colonized south-west Asia fromAfrica (82% probability at the split between the scutellatus and theEastern clades) and radiated there extensively. Subsequent splitswithin the genus imply dispersal from Africa to Arabia and viceversa.

4. Discussion

4.1. Systematics of the genus Acanthodactylus

Our study constitutes the first large-scale time-calibrated phy-logenetic study of Acanthodactylus. Our results are mostly congru-ent with the current taxonomic classifications, with somesystematic discrepancies. The molecular results confirm that Acan-thodactylus is composed of three well-supported clades: the Wes-tern, scutellatus, and Eastern clades (Harris and Arnold, 2000;Figs. 1 and S1–S2).

4.1.1. The Western cladeThis clade comprises one deeply-separated lineage represented

by A. guineensis and three defined groups, containing mostly NorthAfrican species (Figs. 2 and S1–S2). Acanthodactylus guineensis wasoriginally described within the genus Eremias (Boulenger, 1887)and was later assigned to Acanthodactylus, within the erythrurusgroup (Salvador, 1982; Arnold, 1983). Its phylogenetic positionwithin the genus, however, is not resolved. Salvador (1982) notedthat A. guineensis diversification from the erythrurus group musthave taken place before the separation of the morphologically sim-ilar Sub-Saharan species A. boueti. This, however, is in contrast totheir phylogenetic affinity hypothesized by Fonseca et al. (2009).Our results, based solely on mitochondrial data of A. guineensis,accord with Salvador (1982), but also bring into question its phy-logenetic position within the genus as well as within the group.The extremely high genetic distance from the other species sug-

Fig. 5. BEAST consensus tree using the BSSVS method of ancestral area reconstruction with a temporal framework based on evolutionary rates (see Section 2). Branch colourindicates inferred ancestral range (ranges visualized in the lower left map), with posterior probabilities of ancestral range above the nodes (valuesP 0.95). A pie chartdepicting the probability of each inferred area is presented near the major nodes.

K. Tamar et al. /Molecular Phylogenetics and Evolution 103 (2016) 6–18 13

14 K. Tamar et al. /Molecular Phylogenetics and Evolution 103 (2016) 6–18

gests a very old divergence, but further sampling is required todetermine its status.

The Middle Eastern monophyletic tristrami group is phylogenet-ically closely-related to the north-west African erythrurus group, afinding congruent with their morphology (Arnold, 1983; Harris andArnold, 2000). Despite the geographic gap, the systematic affinityof these two groups suggests a shared ancestral origin betweenNorth Africa and the Middle East.

The erythrurus group is paraphyletic. The phylogenetic positionof the Sub-Saharan species, A. boueti, is not well supported in eitherphylogenetic analysis. It clearly differs from A. erythrurus, thusrejecting its derivation from it (Boulenger, 1921). Its high geneticdistance from A. guineensis (Table S4) and its phylogenetic positionmay indicate that the two lineages evolved independently withinthe Sub-Saharan region. Acanthodactylus savignyi is sister to therest of the erythrurus group members, a notable finding, as it wasexpected to be phylogenetically closely-related either to A. blancidue to similar morphology and sandy habitat preference; or, alter-natively, to A. erythrurus belli, as they both co-occur in northernAlgeria (Arnold, 1983; Schleich et al., 1996). The nominate species,A. erythrurus, is paraphyletic, with both A. blanci and A. lineomacu-latus nested within it (as in Harris et al., 2004; Fonseca et al., 2009).Our results support the phylogenetic affinities of A. blanci with A.erythrurus rather than with A. savignyi (Salvador, 1982). However,the phylogenetic position of A. blanci has not been determinedeither in morphological or molecular revisions, including this study(Boulenger, 1921; Mertens, 1929; Salvador, 1982; Arnold, 1983;Harris et al., 2004; Fonseca et al., 2009), leaving its current specificstatus unclear. Acanthodactylus lineomaculatus was classified as asubspecies of A. erythrurus (Salvador, 1982; Arnold, 1983;Schleich et al., 1996), and later elevated to specific status (Bonsand Geniez, 1995; Harris and Arnold, 2000). However, the phyloge-netic studies of Harris et al. (2004), Fonseca et al. (2009) and thisstudy, show no genetic support for the separation of this speciesfrom A. erythrurus. We agree with Fonseca et al. (2009) and suggestthat A. lineomaculatus is an ecotype reflecting local morphologicaladaptation, and should thus be treated as a junior synonym of A.erythrurus.

The pardalis group is monophyletic. The sister taxa relationshipwith its phylogenetically closely-related erythrurus group is notsupported (agreeing with Fonseca et al., 2009). Although ourresults support the specific status of A. beershebensis and A. parda-lis, we cannot account for their phylogenetic position. The complexphylogenetic structures and relationships among A. busacki, A.bedriagai and A. maculatus remain unresolved (as in Fonsecaet al., 2008). The geographic clustering of these species indicatesthat environmental conditions have strongly influenced their dis-tribution, which in turn may be responsible for their current sys-tematic complexity (Fonseca et al., 2008). These complexphylogenetic relationships highlight the potential flaws in currenttaxonomic classifications based on morphological identifications. Itis thus necessary to examine and revise the identification of dis-tinctive phenotypic features of each population, especially fromcontact zones.

4.1.2. The scutellatus cladeOur results show that seven species belong to the psam-

mophilous scutellatus clade/group, in contrast to the eight speciesas was traditionally believed (A. hardyi is phylogenetically differ-ent, being included instead in the Eastern clade; Salvador, 1982;Arnold, 1983; Figs. 3 and 4 and S1–S2). The scutellatus clade beganradiating within north-west Africa with the split of two clearlygenetically-distinct species, A. aureus and A. taghitensis; thoughthe phylogenetic position of the latter species is less significant.Acanthodactylus longipes and A. aegyptius are reciprocally mono-phyletic sister species and comprise a separate lineage, coinciding

with their known taxonomy (Baha El Din, 2007). The remainingspecies, A. scutellatus, A. dumerilii and A. senegalensis, exhibitunsupported phylogenetic relationships and the two latter speciescluster together. A distinct lineage of A. scutellatus from northernEgypt, the Sinai Peninsula and Israel corresponds to the subspeciesA. scutellatus scutellatus (Bons and Girot, 1964; Crochet et al., 2003).We thus support the validity of the subspecies as discrete. Anothermonophyletic lineage includes the subspecies A. scutellatusaudouini from Egypt eastwards, although both bootstrap and ppsupport values are low. Acanthodactylus senegalensis and A. dumer-ilii, sampled from their type localities, are not clearly defined (thelatter’s type locality is not in Senegal according to the revision byCrochet et al. (2003), but no other locality was given). Since itsdescription, A. senegalensis has been assigned by several authorsas a subspecies/variant/synonym of A. scutellatus or A. dumerilii(Boulenger, 1921; Bons and Girot, 1964; Salvador, 1982; Arnold,1983; Crochet et al., 2003). In addition to the morphological diffi-culties in establishing taxonomic identification between thesetwo species, our results reveal that they cluster together into twophylogenetic, geographic inner-groups. A further comprehensiveand meticulous revision is necessary in order to evaluate the statusof the populations assigned to the two species, and to establish thetrue specific boundaries and their geographical distribution.

4.1.3. The Eastern cladeThis clade is comprised of six monophyletic groups (Figs. 4 and

S1–S2). The micropholis and grandis are sister groups (see alsoHeidari et al., 2014). This phylogenetic relationship conflicts withprevious hypotheses regarding the closely-related systematic allo-cation of themicropholiswith cantoris or the grandis with boskianusgroups (Arnold, 1983; Harris and Arnold, 2000). These results areinteresting due to the allopatric distribution of the two groups,and the habitats occupied, as A. micropholis occupies sandy habitats(Minton, 1966; Khan, 2006) whereas A. grandis prefers semi-desertto desert hamada soils (Disi et al., 2001), although digit pectinationindicates that it may occur on a variety of soil types (Arnold, 1983).These two groups may represent an invasion eastwards from theMiddle East into Asia, as the separation zone between them is insouthern Iran. Within the grandis group, the results support thephylogenetically-close affinities between the morphologically-similar A. grandis and A. harranensis (Baran et al., 2005). The para-phyly and the high genetic diversity of A. grandis indicate it is aspecies complex, as was also suggested by Salvador (1982) andArnold (1983).

The same pattern of contact zone and dispersal eastwards isalso evident in the monophyletic lineage formed by A. blanfordiiand its sister species A. schmidti. Our results suggest that theyare not members of the cantoris group (Boulenger, 1918; Haas,1957; Salvador, 1982; Arnold, 1983; Harris and Arnold, 2000),but form a distinct independent group, which we name the blan-fordii group. Taxonomically, A. hardyi is considered a member ofthe scutellatus group (previously a subspecies of A. scutellatus;Salvador, 1982; Arnold, 1983; Harris and Arnold, 2000; Crochetet al., 2003). The present known differences between A. hardyiand A. scutellatus include morphology, a distributional gap(Salvador, 1982; Arnold, 1983, 1986), and preferred substrates(Rifai et al., 2003). We retain the specific status of A. hardyi, butphylogenetically allocate it to within the Eastern clade (Fig. 4),though its phylogenetic position there is not well defined.

We support the five species taxonomically recognized withinthe cantoris group: A. arabicus, A. cantoris, A. gongrorhynchatus, A.haasi, and A. tilburyi. Although A. masirae is taxonomically regardedas a member of the opheodurus group (Salvador, 1982; Arnold,1983), it is phylogenetically sister to A. cantoris (also in Harrisand Arnold, 2000). Our results thus conflict with the knowntaxonomy, as only a few morphological similarities and shared

K. Tamar et al. /Molecular Phylogenetics and Evolution 103 (2016) 6–18 15

characters are known between A. masirae and A. cantoris (Salvador,1982; Arnold, 1983). Local adaptation of A. masirae to differenthabitats may have accelerated its evolutionary morphologicaldivergence, thus accounting for its morphological disparity fromthe phylogenetically closely-related A. cantoris. This hypothesismay also explain the classification of A. cantoris with mostly Ara-bian species, and the different habitat preferences (Salvador,1982; Arnold, 1983; Khan, 2006; Sindaco and Jeremcenko, 2008).We thus suggest the systematic relocation of A. masirae into thecantoris group.

The opheodurus and boskianus are sister groups, congruent withtheir morphology (Salvador, 1982; Arnold, 1980, 1983). Our resultsagree with the assignment of A. felicis and A. opheodurus within theopheodurus group. The boskianus group is represented by two para-phyletic species, A. boskianus and A. schreiberi (see Tamar et al.,2014 for relevant discussion and systematic accounts). We suggestthat the two subspecies, A. boskianus khattensis (from Mauritania)and A. b. nigeriensis (from Niger), are synonyms of the widespreadA. b. asper, possibly representing phenotypic variations, as they arenested within the latter subspecies with other geographically-adjacent specimens. Acanthodactylus boskianus is known to be anextremely morphologically variable species (Salvador, 1982;Arnold, 1980, 1983; Harris and Arnold, 2000), phylogeneticallyexhibiting geographical groupings (Tamar et al., 2014). The rela-tively similar morphology of A. boskianus and the close phyloge-netic relationships between North African and Arabianpopulations suggest recent migration (Salvador, 1982; Arnold,1983; Tamar et al., 2014), probably from south-west Asia (Fig. 5).Acanthodactylus boskianus inhabits a wide range of dry habitatsand displays the largest distribution within the genus. The highdegree of genetic diversity within A. boskianus (Table S4) mayresult from a non-uniform geographic sampling of this species inour dataset.

4.2. Biogeography of Acanthodactylus - Origin and diversification

Several authors have suggested that lacertids and the ancestorof the Eremiadini tribe, to which Acanthodactylus belongs, dis-persed to Africa during the Miocene around 17–19 Mya after thetectonic collision between Africa-Arabia and Eurasia (Arnold,1989a, 2004; Mayer and Benyr, 1994; Harris et al., 1998; Harrisand Arnold, 2000; Arnold et al., 2007; Mayer and Pavlicev, 2007;Pavlicev and Mayer, 2009). Arnold (2004) suggested that theancestor of the Saharo-Eurasian clade within the Eremiadini, towhich Acanthodactylus belongs, recolonized Asia through a landbridge between the Horn of Africa and Arabia (�10–5 Mya;Bosworth et al., 2005), with later recolonizations of North Africa.Mayer and Pavlicev (2007) discussed another plausible scenario,in which the Eremiadini diversified in the Near East and membersinvaded Africa on several occasions. Following this line, the biogeo-graphical assessment by Harris and Arnold (2000) suggested thatAcanthodactylus originated in south-west Asia and later invadedAfrica, probably during the mid-late Miocene (Arnold, 1989a).Others, however, have hypothesized that the Eremiadini originatedmuch earlier, during the Eocene (Wiens et al., 2006; Hipsley et al.,2009; Zheng and Wiens, 2016), and the radiation of the Saharo-Eurasian members occurred approximately 40 Mya (Hipsleyet al., 2009). All these studies suggest that the xerophilous mem-bers of the Saharo-Eurasian clade within Eremiadini (i.e., Acantho-dactylus, Eremias, Mesalina, Ophisops) most likely originated inEurasia, specifically in south-west Asia.

Our phylogenetic and biogeographical reconstructions predatethe often suggested Miocene radiation onset and rapid dispersalfrom a south-west Asian origin, as noted above. Our results supporta deeper ancestral diversification of Acanthodactylus probably froman African origin (Fig. 5). We show that diversification originated

during the Oligocene with the separation of the three clades (33–27 Mya). Radiation within the three clades and groups mostlyoccurred during the Miocene (Figs. 2–5).

The suggested timeframe in our study is congruent with that ofprevious studies on the diversification of North-African and Ara-bian herpetofauna during the Oligocene (e.g., Pook et al., 2009;Šmíd et al., 2013; Metallinou et al., 2012, 2015; Portik andPapenfuss, 2012, 2015). Divergence time estimations in those stud-ies, and ours, suggest that the Oligocene and Miocene radiationsmay correlate with two major environmental changes that affectedthe western Palearctic realm at the time. The first event is the sep-aration of the Arabian and African plates, and their later collisionwith the Eurasian landmass. These tectonic movements resultedin continuous regional geological instability, which subsequentlyled to the opening of the Red Sea, periodic sea-level fluctuation,the Messinian Salinity Crisis, and the uplift of high mountain ridgessuch as the Atlas in Morocco, the Zagros in Iran, and the coastalmountains of Arabia (Bohannon et al., 1989; Rögl, 1999; Popovet al., 2004; Bosworth et al., 2005; Edgell, 2006; Jolivet et al.,2006; Mouthereau, 2011). These major tectonic events mayexplain the split between the three clades, and the ancestral rela-tives of the Middle Eastern tristrami group separating from theoriginal North-African populations of the erythrurus and pardalisgroups within the Western clade. The second major environmentalevent was the global climate change during the Miocene. Climaticfluctuations and aridification during this period led to the forma-tion, and episodic expansion and contraction, of the Sahara andArabian deserts, which in turn strongly affected species divergenceand distributions within the area (Ruddiman et al., 1989; Flowerand Kennett, 1994; Le Houérou, 1992, 1997; Zachos et al., 2001;Griffin, 2002; Kroepelin, 2006; Schuster et al., 2006; Swezey,2006, 2009). As Acanthodactylus is an arid-adapted genus, the arid-ification process most likely promoted diversification and facili-tated dispersal in most lineages.

There are three Acanthodactylus groups (erythrurus, pardalis andscutellatus) inhabiting North Africa, with the erythrurus and pardalisgroups typically inhabiting areas of solid ground in the northernand western coastal areas (Fig. 2), while the psammophilous scutel-latus group inhabits sandy areas, principally across the Saharadesert (Fig. 3). The expansion/contraction of sands and the rise ofthe Atlas Mountains during the mid-late Miocene created biogeo-graphical barriers and probably triggered diversification, as hasbeen suggested for other reptile taxa (e.g., Brown et al., 2002;Amer and Kumazawa, 2005; Fritz et al., 2005; Carranza et al.,2008; Gonçalves et al., 2012; Kapli et al., 2015; Metallinou et al.,2012, 2015; Tamar et al., 2016). The Sahara sands constitute asouthern barrier for the erythrurus and pardalis groups, which radi-ated from the late-Miocene, restricting them to the western andnorthern coastal areas, characterized by a less arid climate. Thesegroups were influenced both by the shifting Saharan sand area,as well as by sea levels of the Atlantic Ocean and the Mediter-ranean Sea. The fluctuating climate, sea-level and desert areas(Sarnthein, 1978; Douady et al., 2003; Schuster et al., 2006), arelikely to have enhanced diversification and created complex phylo-genetic structures within the North-African Acanthodactylus groups(e.g., Douady et al., 2003; Fonseca et al., 2008, 2009; Metallinouet al., 2015). The Sahara sands are also likely to have facilitateddiversification and dispersal within the scutellatus group, similarto other psammophilous North-African reptile taxa (e.g., Carranzaet al., 2008; Metallinou et al., 2012). The two evidently separateevents in the Sub-Saharan region, the dispersal of A. guineensisand the vicariance of A. boueti, were probably enabled throughthe western edges of North Africa, restricted since the Mioceneby the Sahara sands.

The members of the Eastern clade (Fig. 4), distributed mostly inArabia to western India, began radiating during the mid-Miocene.

16 K. Tamar et al. /Molecular Phylogenetics and Evolution 103 (2016) 6–18

The dispersal of Acanthodactylus eastwards from Arabia furtherinto Asia is estimated to have occurred after the uplift of the ZagrosMountains in Iran during the mid-Miocene, 12.4–10 Mya(Sborshchikov et al., 1981; Agard et al., 2011; Mouthereau, 2011).This accords with the biogeographic patterns observed in otherlizard taxa from the region (e.g., Macey et al., 1998; Šmíd andFrynta, 2012). We suggest that the Zagros Mountains acted as aphysical barrier, restricting dispersal of Acanthodactylus north-wards to potential habitats in the Iranian plateau, thus constrain-ing their dispersal eastward along the southern coast (e.g.,Heidari et al., 2014). Another possibility is that the Iranian plateauhad already been colonized by another lacertid, Eremias, with anal-ogous ecological adaptations to Acanthodactylus. A more recent dis-persal eastwards from Arabia is unlikely considering the profoundlevel of differentiation, indicating a prolonged presence within theregion. The biogeographical history of Acanthodactylus assemblagein the Arabian Peninsula is harder to interpret, since the area lacksboth comprehensive sampling and adequate geological and cli-matic data. During the Miocene, the peninsula interior, character-ized by the existence of a river system and basins, was highlyinfluenced by the changing climate, which led to the formationor migration of desert sands. Local geological events such as peri-odic volcanism, earthquakes and mountain ridges uplifting alsotook place during this period (Bosworth et al., 2005; Edgell,2006). The changing landscapes and habitats within the ArabianPeninsula during the mid-late Miocene are likely to have causedeither contact or fragmentation of ancestral Acanthodactylus popu-lations, and thus been responsible for the diversification within theEastern clade.

Acknowledgments

We are grateful to the following people for providing samplesfor this study: S.M. Baha El Din, D. Donaire, J. Padial, S. Pelts, J.M.Pleguezuelos, J. Šmíd, S. Trape, E. Wade. We also wish to thankthe following for their help with the shipment of tissue samples:J. Vindum from the California Academy of Sciences, USA; C. Spencerfrom the Museum of Vertebrate Zoology, University of California,Berkeley, USA; U. Bott from the Zoologisches ForschungsmuseumAlexander Koenig, Bonn, Germany; P.A. Crochet and P. Geniez, fromthe Centre d’Ecologie Fonctionnelle et Evolutive, Montpellier,France; B. Shacham from the Zoological Museum, Hebrew Univer-sity of Jerusalem, Israel; E. Maza from the Steinhardt Museum ofNatural History in Tel Aviv University, Israel. We thank J.C. Brito,P.A. Crochet and P. Geniez for fruitful discussions. Israeli specimenswere obtained under collecting permits (No. 38074, 38451, 38489,38540) and collecting and exporting permits from Oman wereissued to S.C. by the Nature Conservation Department of the Min-istry of Environment and Climate, Sultanate of Oman (Refs:08/2005; 16/2008; 38/2010; 12/2011; 13/2013; 21/2013). Thework of J.M. was financially supported by the Ministry of Cultureof the Czech Republic (DKRVO 2013/15, 2014/14, NationalMuseum, 00023272). This study was funded by Israel TaxonomicInitiative grant to S.M. and by grant CGL2012-36970 from the Min-isterio de Economía y Competitividad, Spain (co-funded by FEDER-EU) to S.C. K.T. was supported by an Israel Taxonomic Initiativescholarship. We thank two anonymous reviewers for helpful com-ments on an earlier version of the manuscript.

Appendix A. Supplementary material

Supplementary data associated with this article can be found, inthe online version, at http://dx.doi.org/10.1016/j.ympev.2016.07.003.

References

Agard, P., Omrani, J., Jolivet, L., Whitechurch, H., Vrielynck, B., Spakman, W., Monié,P., Meyer, B., Wortel, R., 2011. Zagros orogeny: a subduction-dominatedprocess. Geol. Mag. 148, 692–725. http://dx.doi.org/10.1017/S001675681100046X.

Amer, S.A.M., Kumazawa, Y., 2005. Mitochondrial DNA sequences of the Afro-Arabian spiny-tailed lizards (genus Uromastyx; family Agamidae): phylogeneticanalyses and evolution of gene arrangements. Biol. J. Linn. Soc. 85, 247–260.http://dx.doi.org/10.1111/j.1095-8312.2005.00485.x.

Arnold, E.N., 1980. The scientific results of the Oman flora and fauna survey 1977(Dhofar). The reptiles and amphibians of Dhofar, southern Arabia. J. Oman Stud.Special Report 2, 273–332.

Arnold, E.N., 1983. Osteology, genitalia and the relationships of Acanthodactylus(Reptilia: Lacertidae). Bull. British Mus. (Natural History) Zool. London 44, 291–339.

Arnold, E.N., 1986. A key and annotated check list to the lizards and amphisbaenasof Arabia. Fauna Saudi Arabia 8, 385–435.

Arnold, E.N., 1989a. Towards a phylogeny and biogeography of the Lacertidae:relationships within an Old-World family of lizards derived from morphology.Bull. British Mus. (Natural History) Zool. London 55, 209–257.

Arnold, E.N., 1989b. Systematics and adaptive radiation of equatorial African lizardsassigned to the genera Adolfus, Bedriagaia, Gastropholis, Holaspis and Lacerta(Reptilia: Lacertidae). J. Nat. Hist. 23, 525–555.

Arnold, E.N., 2004. Overview of morphological evolution and radiation in theLacertidae. In: Pérez-Mellado, V., Riera, N., Perera, A. (Eds.), The Biology ofLacertid Lizards. Evolutionary and Ecological Perspectives. Institut Menorquíd’Estudis, Recerca, 8. Maó, Menorca, pp. 11–36.

Arnold, E.N., Arribas, Ó., Carranza, S., 2007. Systematics of the Palaearctic andOriental lizard tribe Lacertini (Squamata: Lacertidae: Lacertinae), withdescriptions of eight new genera. Zootaxa 1430, 1–86.

Baha El Din, S.M., 2007. A new lizard of the Acanthodactylus scutellatus group(Squamata: Lacertidae) from Egypt. Zool. Middle East 40, 21–32.

Baran, I., Kumlutas�, Y., Lanza, B., Sindaco, R., Ilgaz, Ç., Avci, A., Crucitti, P., 2005.Acanthodactylus harranensis, a new species of lizard from southeastern Turkey(Reptilia: Sauria: Lacertidae). Boll. Mus. Reg. Sci. Nat. Torino 23, 323–341.

Bellati, A., Carranza, S., Garcia-Porta, J., Fasola, M., Sindaco, R., 2015. Crypticdiversity within the Anatololacerta species complex (Squamata: Lacertidae) inthe Anatolian Peninsula: evidence from a multi-locus approach. Mol.Phylogenet. Evol. 82, 219–233. http://dx.doi.org/10.1016/j.ympev.2014.10.003.

Bohannon, R.G., Naeser, C.W., Schmidt, D.L., Zimmermann, R.A., 1989. The timing ofuplift, volcanism, and rifting peripheral to the Red Sea: a case for passiverifting? J. Geophys. Res.: Sol. Ea. (1978–2012) 94, 1683–1701. http://dx.doi.org/10.1029/JB094iB02p01683.

Bons, J., Geniez, P., 1995. Contribution to the systematics of the lizardAcanthodactylus erythrurus (Sauria, Lacertidae) in Morocco. Herpetol. J. 5, 271.

Bons, J., Girot, B., 1964. Révision de l’espèce Acanthodactylus scutellatus (Lacertidé-saurien). Bull. Soc. Sci. nat. phys. Maroc 42, 311–336.

Bosworth, W., Huchon, P., McClay, K., 2005. The Red Sea and Gulf of Aden basins. J.Afr. Earth Sci. 43, 334–378. http://dx.doi.org/10.1016/j.jafrearsci.2005.07.020.

Boulenger, G.A., 1887. Catalogue of the lizards in the British Museum (NaturalHistory), . second ed. Lacertidae, Gerrhosauridae, Scincidae, Anelytropidae,Dibamidae, Chamaeleontidae second ed., vol. 3 Trustees of the British Museum(Natural History), London.

Boulenger, G.A., 1918. Sur les lézards du genre Acanthodactylus Wieg. Bull. Soc. Zool.France 43, 143–155.

Boulenger, G.A., 1921. Monograph of the Lacertidae, vol. 2. Trustees of the BritishMuseum (Natural History), London.

Brown, R.P., Suárez, N.M., Pestano, J., 2002. The Atlas Mountains as abiogeographical divide in North-West Africa: evidence from mtDNA evolutionin the Agamid lizard Agama impalearis. Mol. Phylogenet. Evol. 24, 324–332.http://dx.doi.org/10.1016/S1055-7903(02)00218-X.

Brown, R.P., Terrasa, B., Pérez-Mellado, V., Castro, J.A., Hoskisson, P.A., Picornell, A.,Ramon, M.M., 2008. Bayesian estimation of post-Messinian divergence times inBalearic Island lizards. Mol. Phylogenet. Evol. 48, 350–358. http://dx.doi.org/10.1016/j.ympev.2008.04.013.

Carranza, S., Arnold, E.N., 2012. A review of the geckos of the genus Hemidactylus(Squamata: Gekkonidae) from Oman based on morphology, mitochondrial andnuclear data, with descriptions of eight new species. Zootaxa 3378, 1–95.

Carranza, S., Arnold, E.N., Geniez, P., Roca, J., Mateo, J.A., 2008. Radiation, multipledispersal and parallelism in the skinks, Chalcides and Sphenops (Squamata:Scincidae), with comments on Scincus and Scincopus and the age of the SaharaDesert. Mol. Phylogenet. Evol. 46, 1071–1094. http://dx.doi.org/10.1016/j.ympev.2007.11.018.

Carretero, M.A., Fonseca, M.M., Garcia-Munoz, E., Brito, J.C., Harris, D.J., 2011.Adding Acanthodactylus beershebensis to the mtDNA phylogeny of theAcanthodactylus pardalis group. North-West J. Zool. 7, 138–142.

Castresana, J., 2000. Selection of conserved blocks from multiple alignments fortheir use in phylogenetic analysis. Mol. Phylogenet. Evol. 17, 540–552.

Cox, S.C., Carranza, S., Brown, R.P., 2010. Divergence times and colonization of theCanary Islands by Gallotia lizards. Mol. Phylogenet. Evol. 56, 747–757. http://dx.doi.org/10.1016/j.ympev.2010.03.020.

Crochet, P.A., Geniez, P., Ineich, I., 2003. A multivariate analysis of the fringe-toedlizards of the Acanthodactylus scutellatus group (Squamata: Lacertidae):systematic and biogeographical implications. Zool. J. Linn. Soc. 137, 117–155.

K. Tamar et al. /Molecular Phylogenetics and Evolution 103 (2016) 6–18 17

Disi, A., Modry, D., Necas, P., Rifai, L., 2001. Amphibians and Reptiles of theHashemite Kingdom of Jordan: An Atlas and Field Guide. Chimaira, Frankfurtam Main.

Douady, C.J., Catzeflis, F., Raman, J., Springer, M.S., Stanhope, M.J., 2003. The Saharaas a vicariant agent, and the role of Miocene climatic events, in thediversification of the mammalian order Macroscelidea (elephant shrews).Proc. Natl. Acad. Sci. USA 100, 8325–8330. http://dx.doi.org/10.1073/pnas.0832467100.

Drummond, A.J., Suchard, M.A., Xie, D., Rambaut, A., 2012. Bayesian phylogeneticswith BEAUti and the BEAST 1.7. Mol. Biol. Evol. 29, 1969–1973. http://dx.doi.org/10.1093/molbev/mss075.

Edgell, H.S., 2006. Arabian Deserts: Nature, Origin and Evolution. Springer Science &Business Media.

Ezard, T., Fujisawa, T., Barraclough, T.G., 2009. SPLITS: Species Limits by ThresholdStatistics. R package version 1.0-11/r29 <http://R-Forge.R-project.org/projects/splits/>.

Felsenstein, J., 1985. Confidence limits on phylogenies: an approach using thebootstrap. Evolution 39, 783–791.

Fitzinger, L.J.F.J., 1834. Acanthodactylus. In: Wiegman, A.F.A. (Ed.), Herpetologiamexicana, seu Descriptio amphibiorum Novae Hispaniae quae itineribuscomitis De Sack, Ferdinandi Deppe et Chr. Guil. Schiede in Museumzoologicum Berolinense pervenerunt. Pars prima saurorum speciesamplectens, adjecto systematis saurorum prodromo, additisque multis inhunc amphibiorum ordinem observationibus. C.G. Luderitz, Berlin, p. 10.

Flower, B.P., Kennett, J.P., 1994. The middle Miocene climatic transition: eastAntarctic ice sheet development, deep ocean circulation and global carboncycling. Palaeogeogr. Palaeoclimatol. Palaeoecol. 108, 537–555.

Fonseca, M.M., Brito, J.C., Paulo, O.S., Carretero, M.A., Harris, D.J., 2009. Systematicand phylogeographical assessment of the Acanthodactylus erythrurus group(Reptilia: Lacertidae) based on phylogenetic analyses of mitochondrial andnuclear DNA. Mol. Phylogenet. Evol. 51, 131–142. http://dx.doi.org/10.1016/j.ympev.2008.11.021.

Fonseca, M.M., Brito, J.C., Rebelo, H., Kalboussi, M., Larbes, S., Carretero, M.A., Harris,D.J., 2008. Genetic variation among spiny-footed lizards in the Acanthodactyluspardalis group from North Africa. Afr. Zool. 43, 8–15.

Fritz, U., Fritzsch, G., Lehr, E., Ducotterd, J.M., Müller, A., 2005. The Atlas Mountains,not the Strait of Gibraltar, as a biogeographic barrier for Mauremys leprosa(Reptilia: Testudines). Salamandra 41, 97–106.

Fu, J., 2000. Toward the phylogeny of the family Lacertidae-Why 4708 base pairs ofmtDNA sequences cannot draw the picture. Biol. J. Linn. Soc. 71, 203–217.

Gonçalves, D.V., Brito, J.C., Crochet, P.A., Geniez, P., Padial, J.M., Harris, D.J., 2012.Phylogeny of North African Agama lizards (Reptilia: Agamidae) and the role ofthe Sahara desert in vertebrate speciation. Mol. Phylogenet. Evol. 64, 582–591.http://dx.doi.org/10.1016/j.ympev.2012.05.007.

Griffin, D.L., 2002. Aridity and humidity: two aspects of the late Miocene climate ofNorth Africa and the Mediterranean. Palaeogeogr. Palaeoclimatol. Palaeoecol.182, 65–91. http://dx.doi.org/10.1016/S0031-0182(01)00453-9.

Haas, G., 1957. Some amphibians and reptiles from Arabia. Proc. Calif. Acad. Sci. 29,47–86.

Harris, D.J., Arnold, E.N., 2000. Elucidation of the relationships of spiny footedlizards, Acanthodactylus spp. (Reptilia: Lacertidae) using mitochondrial DNAsequence, with comments on their biogeography and evolution. J. Zool. 252,351–362.

Harris, D.J., Arnold, E.N., Thomas, R.H., 1998. Relationships of lacertid lizards(Reptilia: Lacertidae) estimated from mitochondrial DNA sequences andmorphology. Proc. R. Soc. Lond. B. Bio. Sci. 265, 1939–1948.

Harris, D.J., Batista, V., Carretero, M., 2004. Assessment of genetic diversity withinAcanthodactylus erythrurus (Reptilia: Lacertidae) in Morocco and the IberianPeninsula using mitochondrial DNA sequence data. Amphibia-Reptilia 25, 227.

Heidari, N., Rastegar-Pouyani, E., Rastegar-Pouyani, N., Faizi, H., 2014. Molecularphylogeny and biogeography of the genus Acanthodactylus Fitzinger, 1834(Reptilia: Lacertidae) in Iran, inferred from mtDNA Sequences. Zootaxa 3860,379–395.

Hipsley, C.A., Himmelmann, L., Metzler, D., Müller, J., 2009. Integration of Bayesianmolecular clock methods and fossil-based soft bounds reveals early Cenozoicorigin of African lacertid lizards. BMC Evol. Biol. 9, 151. http://dx.doi.org/10.1186/1471-2148-9-151.

Huelsenbeck, J.P., Rannala, B., 2004. Frequentist properties of Bayesian posteriorprobabilities of phylogenetic trees under simple and complex substitutionmodels. Syst. Biol. 53, 904–913. http://dx.doi.org/10.1080/10635150490522629.

Jolivet, L., Augier, R., Robin, C., Suc, J.P., Rouchy, J.M., 2006. Lithospheric-scalegeodynamic context of the Messinian salinity crisis. Sediment. Geol. 188, 9–33.http://dx.doi.org/10.1016/j.sedgeo.2006.02.004.

Kaliontzopoulou, A., Pinho, C., Harris, D.J., Carretero, M.A., 2011. When crypticdiversity blurs the picture: a cautionary tale from Iberian and North AfricanPodarcis wall lizards. Biol. J. Linn. Soc. 103, 779–800. http://dx.doi.org/10.1111/j.1095-8312.2011.01703.x.

Kapli, P., Botoni, D., Ilgaz, Ç., Kumlutas�, Y., Avcı, A., Rastegar-Pouyani, N., Fathinia, B.,Lymberakis, P., Ahmadzadeh, F., Poulakakis, N., 2013. Molecular phylogeny andhistorical biogeography of the Anatolian lizard Apathya (Squamata, Lacertidae).Mol. Phylogenet. Evol. 66, 992–1001. http://dx.doi.org/10.1016/j.ympev.2012.12.002.

Kapli, P., Lymberakis, P., Crochet, P.A., Geniez, P., Brito, J.C., Almutairi, M.,Ahmadzadeh, F., Schmitz, A., Wilms, T., Poulakakis, N., 2015. Historical

biogeography of the lacertid lizard Mesalina in North Africa and the MiddleEast. J. Biogeogr. 42, 267–279. http://dx.doi.org/10.1111/jbi.12420.

Kapli, P., Poulakakis, N., Lymberakis, P., Mylonas, M., 2011. A re-analysis of themolecular phylogeny of Lacertidae with currently available data. Basic Appl.Herpetol. 25, 97–104.

Katoh, K., Standley, D.M., 2013. MAFFT multiple sequence alignment softwareversion 7: improvements in performance and usability. Mol. Biol. Evol. 30, 772–780. http://dx.doi.org/10.1093/molbev/mst010.

Khan, M.S., 2006. Amphibians and Reptiles of Pakistan. Krieger PublishingCompany.

Kroepelin, S., 2006. Revisiting the age of the Sahara Desert. Science 312 (5777),1138–1139.

Lanfear, R., Calcott, B., Ho, S.Y., Guindon, S., 2012. PartitionFinder: combined selectionof partitioning schemes and substitution models for phylogenetic analyses. Mol.Biol. Evol. 29, 1695–1701. http://dx.doi.org/10.1093/molbev/mss020.

Le Houérou, H.N., 1992. Outline of the biological history of the Sahara. J. AridEnviron. 22, 3–30.

Le Houérou, H.N., 1997. Climate, flora and fauna changes in the Sahara over the past500 million years. J. Arid Environ. 37, 619–647. http://dx.doi.org/10.1006/jare.1997.0315.

Lemey, P., Rambaut, A., Drummond, A., Suchard, M., 2009. Bayesian phylogeographyfinds its roots. PLoS Comput. Biol. 5, e1000520. http://dx.doi.org/10.1371/journal.pcbi.1000520.

Macey, J.R., Schulte, J.A., Ananjeva, N.B., Larson, A., Rastegar-Pouyani, N.,Shammakov, S.M., Papenfuss, T.J., 1998. Phylogenetic relationships amongAgamid Lizards of the Laudakia caucasia species group: testing hypotheses ofbiogeographic fragmentation and an Area Cladogram for the Iranian Plateau.Mol. Phylogenet. Evol. 10, 118–131.

Mayer, W., Benyr, G., 1994. Albumin-Evolution und Phylogenese in der FamilieLacertidae (Reptilia: Sauria). Ann. Naturhist. Mus. Wien 96, 621–648.

Mayer, W., Pavlicev, M., 2007. The phylogeny of the family Lacertidae (Reptilia)based on nuclear DNA sequences: convergent adaptations to arid habitatswithin the subfamily Eremiainae. Mol. Phylogenet. Evol. 44, 1155–1163. http://dx.doi.org/10.1016/j.ympev.2007.05.015.

Mellado, J., Olmedo, G., 1990. El género Acanthodactylus en Marruecos: problemasde identificación en los grupos de especies A. pardalis y A. scutellatus. Amphibia-Reptilia 11, 131–146.

Mertens, R., 1929. Beitraege zur Herpetologie Tunesiens. Senckenbergiana 11, 291–310.

Metallinou, M., Arnold, E.N., Crochet, P.A., Geniez, P., Brito, J.C., Lymberakis, P., BahaEl Din, S., Sindaco, R., Robinson, M., Carranza, S., 2012. Conquering the Saharaand Arabian deserts: systematics and biogeography of Stenodactylus geckos(Reptilia: Gekkonidae). BMC Evol. Biol. 12 (1), 258. http://dx.doi.org/10.1186/1471-2148-12-258.

Metallinou, M., Cervenka, J., Crochet, P.A., Kratochvíl, L., Wilms, T., Geniez, P.,Shobrak, M.Y., Brito, J.C., Carranza, S., 2015. Species on the rocks: Systematicsand biogeography of the rock-dwelling Ptyodactylus geckos (Squamata:Phyllodactylidae) in North Africa and Arabia. Mol. Phylogenet. Evol. 85, 208–220. http://dx.doi.org/10.1016/j.ympev.2015.02.010.

Miller, M., Pfeiffer, W., Schwartz, T., 2010. Creating the CIPRES Science Gateway forinference of large phylogenetic trees. In: Proceedings of the GatewayComputing Environments Workshop (GCE). IEEE, L.A, pp. 1–8. http://dx.doi.org/10.1109/GCE.2010.5676129.

Minton, S.A., 1966. A contribution to the herpetology of West Pakistan. Bull. Am.Mus. Nat. His. 134, 27–184.

Mouthereau, F., 2011. Timing of uplift in the Zagros belt/Iranian plateau andaccommodation of late Cenozoic Arabia-Eurasia convergence. Geol. Mag. 148,726–738. http://dx.doi.org/10.1017/S0016756811000306.

Nouira, S., Blanc, C., 1999. Description d’une nouvelle espèce d’acanthodactylede Tunisie: Acanthodactylus mechriguensis n. sp. (Sauria, Reptilia). Siciliana 5,101–108.

Pavlicev, M., Mayer, W., 2009. Fast radiation of the subfamily Lacertinae (Reptilia:Lacertidae): history or methodical artefact? Mol. Phylogenet. Evol. 52, 727–734.http://dx.doi.org/10.1016/j.ympev.2009.04.020.

Pons, J., Barraclough, T.G., Gomez-Zurita, J., Cardoso, A., Duran, D.P., Hazell, S.,Kamoun, S., Sumlin, W.D., Vogler, A.P., 2006. Sequence-based speciesdelimitation for the DNA taxonomy of undescribed insects. Syst. Biol. 55,595–609. http://dx.doi.org/10.1080/10635150600852011.

Pook, C.E., Joger, U., Stümpel, N., Wüster, W., 2009. When continents collide:phylogeny, historical biogeography and systematics of the medically importantviper genus Echis (Squamata: Serpentes: Viperidae). Mol. Phylogenet. Evol. 53,792–807. http://dx.doi.org/10.1016/j.ympev.2009.08.002.

Popov, S.V., Rögl, F., Rozanov, A.Y., Steininger, F.F., Shcherba, I.G., Kovac, M., 2004.Lithological-paleogeographic maps of Paratethys 10 maps Late Eocene toPliocene. Cour. Forsch. Inst. Senckenb 250, 1–46.

Portik, D.M., Papenfuss, T.J., 2012. Monitors cross the Red Sea: the biogeographichistory of Varanus yemenensis. Mol. Phylogenet. Evol. 62, 561–565. http://dx.doi.org/10.1016/j.ympev.2011.09.024.

Portik, D.M., Papenfuss, T.J., 2015. Historical biogeography resolves the origins ofendemic Arabian toad lineages (Anura: Bufonidae): evidence for ancientvicariance and dispersal events with the Horn of Africa and South Asia. BMCEvol. Biol. 15, 152. http://dx.doi.org/10.1186/s12862-015-0417-y.

Poulakakis, N., Lymberakis, P., Valakos, E., Pafilis, P., Zouros, E., Mylonas, M., 2005.Phylogeography of Balkan wall lizard (Podarcis taurica) and its relatives inferredfrom mitochondrial DNA sequences. Mol. Ecol. 14, 2433–2443.

18 K. Tamar et al. /Molecular Phylogenetics and Evolution 103 (2016) 6–18

Pyron, R.A., Burbrink, F.T., Wiens, J.J., 2013. A phylogeny and revised classification ofSquamata, including 4161 species of lizards and snakes. BMC Evol. Biol. 13, 93.http://dx.doi.org/10.1186/1471-2148-13-93.

Rambaut, A., Suchard, M.A., Xie, D., Drummond, A.J., 2014. Tracer v1.6. Availablefrom <http://beast.bio.ed.ac.uk/Tracer>.

Rifai, L., Modry, D., Necas, P., Amr, Z.S., 2003. The occurrence of Acanthodactylushardyi Haas, 1957 in the Hashemite Kingdom of Jordan and notes on its ecology.Zool. Middle East 28, 33–38.

Rögl, F., 1999. Mediterranean and Paratethys. Facts and hypotheses of an Oligoceneto Miocene paleogeography (short overview). Geol. Carpath. 50, 339–349.

Ruddiman, W.F., Raymo, M., Martinson, D.G., Clement, B.M., Backman, J., 1989.Pleistocene evolution: northern hemisphere ice sheets and North AtlanticOcean. Paleoceanography 4, 353–412.

Salvador, A., 1982. A revision of the lizards of the genus Acanthodactylus (Sauria:Lacertidae). Bonner Zoologische Monographien. ZoologischesForschungsinstitut und Museum Alexander Koenig, Bonn (16).

Sarnthein, M., 1978. Sand deserts during glacial maximum and climatic optimum.Nature 272, 43–46.

Schleich, H.H., Kästle, W., Kabisch, K., 1996. Amphibians and Reptiles of NorthAfrica. Koeltz, Koenigstein.

Sborshchikov, I.M., Savostin, L.A., Zonenshain, L.P., 1981. Present plate tectonicsbetween Turkey and Tibet. Tectonophysics 79, 45–73.

Schuster, M., Duringer, P., Ghienne, J.-F., Vignaud, P., Mackaye, H.T., Likius, A.,Brunet, M., 2006. The age of the Sahara desert. Science 311, 821.

Silvestro, D., Michalak, I., 2012. RaxmlGUI: a graphical front-end for RAxML. Org.Divers. Evol. 12, 335–337. http://dx.doi.org/10.1007/s13127-011-0056-0.

Sindaco, R., Jeremcenko, V.K., 2008. The reptiles of the Western Palearctic. 1.Annotated checklist and distributional atlas of the turtles, crocodiles,amphisbaenians and lizards of Europe, North Africa, Middle East and CentralAsia. Monografie della Societas Herpetologica Italica, Edizioni Belvedere, Latina.

Šmíd, J., Carranza, S., Kratochvíl, L., Gvozdík, V., Nasher, A.K., Moravec, J., 2013. Outof Arabia: a complex biogeographic history of multiple vicariance and dispersalevents in the gecko genus Hemidactylus (Reptilia: Gekkonidae). PLoS ONE 8,e64018. http://dx.doi.org/10.1371/journal.pone.0064018.

Šmíd, J., Frynta, D., 2012. Genetic variability of Mesalina watsonana (Reptilia:Lacertidae) on the Iranian plateau and its phylogenetic and biogeographicaffinities as inferred from mtDNA sequences. Acta Herpetol. 7, 139–153.

Stamatakis, A., 2006. RAxML-VI-HPC: maximum likelihood-based phylogeneticanalyses with thousands of taxa and mixed models. Bioinformatics 22, 2688–2690. http://dx.doi.org/10.1093/bioinformatics/btl446.

Swezey, C.S., 2006. Revisiting the age of the Sahara Desert. Science 312, 1138–1139.http://dx.doi.org/10.1126/science.312.5777.1138b.

Swezey, C.S., 2009. Cenozoic stratigraphy of the Sahara, northern Africa. J. Afr. EarthSci. 53, 89–121. http://dx.doi.org/10.1016/j.jafrearsci.2008.08.001.

Talavera, G., Castresana, J., 2007. Improvement of phylogenies after removingdivergent and ambiguously aligned blocks from protein sequence alignments.Syst. Biol. 56, 564–577. http://dx.doi.org/10.1080/10635150701472164.

Talavera, G., Dinca, V., Vila, R., 2013. Factors affecting species delimitations with theGMYC model: insights from a butterfly survey. Methods Ecol. Evol. 4, 1101–1110. http://dx.doi.org/10.1111/2041-210X.12107.

Tamar, K., Carranza, S., Sindaco, R., Moravec, J., Meiri, S., 2014. Systematics andphylogeography of Acanthodactylus schreiberi and its relationships withAcanthodactylus boskianus (Reptilia: Squamata: Lacertidae). Zool. J. Linn. Soc.172, 720–739. http://dx.doi.org/10.1111/zoj.12170.

Tamar, K., Carranza, S., in den Bosch, H., Sindaco, R., Moravec, J., Meiri, S., 2015.Hidden relationships and genetic diversity: molecular phylogeny andphylogeography of the Levantine lizards of the genus Phoenicolacerta(Squamata: Lacertidae). Mol. Phylogenet. Evol. 91, 86–97. http://dx.doi.org/10.1016/j.ympev.2015.05.002.

Tamar, K., Scholz, S., Crochet, P.A., Geniez, P., Meiri, S., Schmitz, A., Wilms, A.,Carranza, S., 2016. Evolution around the Red Sea: systematics and biogeographyof the agamid genus Pseudotrapelus (Squamata: Agamidae) from North Africaand Arabia. Mol. Phylogenet. Evol. 97, 55–68. http://dx.doi.org/10.1016/j.ympev.2015.12.021.

Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5:molecular evolutionary genetics analysis using maximum likelihood,evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28,2731–2739. http://dx.doi.org/10.1093/molbev/msr121.

Trape, J.F., Trape, S., Chirio, L., 2012. Lézards, Crocodiles Et Tortues d’AfriqueOccidentale Et Du Sahara. IRD Éditions, Marseille.

Uetz, P., Hošek, J., 2016. The Reptile Database. Available at <http://www.reptile-database.org>. (April 2016).

Wiens, J.J., Brandley, M.C., Reeder, T.W., 2006. Why does a trait evolve multipletimes within a clade? Repeated evolution of snakeline body form in squamatereptiles. Evolution 60, 123–141.

Wilcox, T.P., Zwickl, D.J., Heath, T.A., Hillis, D.M., 2002. Phylogenetic relationships ofthe dwarf boas and a comparison of Bayesian and bootstrap measures ofphylogenetic support. Mol. Phylogenet. Evol. 25, 361–371. http://dx.doi.org/10.1016/S1055-7903(02)00244-0.

Zachos, J., Pagani, M., Sloan, L., Thomas, E., Billups, K., 2001. Trends, rhythms, andaberrations in global climate 65 Ma to present. Science 292, 686–693. http://dx.doi.org/10.1126/science.1059412.

Zheng, Y., Wiens, J.J., 2016. Combining phylogenomic and supermatrix approaches,and a time-calibrated phylogeny for squamate reptiles (lizards and snakes)based on 52 genes and 4162 species. Mol. Phylogenet. Evol. 94, 537–547. http://dx.doi.org/10.1016/j.ympev.2015.10.009.

0.04

A. guineensis - A275 - Niger

A. savignyi - A265 - AlgeriaA. savignyi - A264 - Algeria

A. orientalis - A244 - SyriaA. orientalis - A246 - Syria

A. orientalis - A245 - SyriaA. tristrami - A196 - Jordan

A. tristrami - A252 - SyriaA. tristrami - A254 - SyriaA. tristrami - A253 - Syria

A. erythrurus erythrurus - A126 - SpainA. erythrurus erythrurus - A125 - Spain

A. erythrurus atlanticus - A60 - MoroccoA. erythrurus belli - A56 - Morocco

A. erythrurus belli - A61 - MoroccoA. erythrurus belli - A146 - Morocco

A. erythrurus belli - A124 - MoroccoA. blanci - A85 - TunisiaA. blanci - A86 - Tunisia

A. lineomaculatus - A130 - MoroccoA. lineomaculatus - A129 - Morocco

A. boueti - A276 - Benin

A. busacki - A263 - Morocco

A. busacki - A271 - MoroccoA. busacki - A272 - MoroccoA. busacki - A87 - MoroccoA. busacki - A88 - MoroccoA. busacki - A89 - Morocco

A. busacki - A269 - MoroccoA. busacki - A268 - Western SaharaA. busacki - A270 - MoroccoA. maculatus - A58 - MoroccoA. maculatus - A262 - Morocco

A. beershebensis - A74 - IsraelA. beershebensis - A280 - Israel

A. beershebensis - A2 - Israel

A. beershebensis - A47 - IsraelA. beershebensis - A284 - IsraelA. beershebensis - A53 - Israel

A. beershebensis - A17 - Israel

A. beershebensis - A40 - Israel

A. beershebensis - A283 - IsraelA. beershebensis - A75 - IsraelA. beershebensis - A278 - Israel

A. maculatus - A142 - AlgeriaA. pardalis - A54 - EgyptA. pardalis - A41 - EgyptA. pardalis - A55 - Egypt

A. pardalis - A227 - EgyptA. maculatus - A141 - AlgeriaA. maculatus - A91 - Libya

A. maculatus - A145 - TunisiaA. bedriagai - A189 - TunisiaA. maculatus - A144 - TunisiaA. maculatus - A81 - MoroccoA. maculatus - A82 - Morocco

A. maculatus - A49 - MoroccoA. maculatus - A52 - Morocco

A. maculatus - A259 - AlgeriaA. bedriagai - A258 - Algeria

A. maculatus - A143 - MoroccoA. maculatus - A90 - Morocco

Mesalina guttulata - M18 - IsraelMesalina guttulata - M17 - Israel

A. aureus - A188 - MoroccoA. aureus - A43 - Morocco

A. aureus - A71 - Western SaharaA. aureus - A184 - MauritaniaA. aureus - A166 - Mauritania

A. aureus - A39 - MoroccoA. aureus - A45 - Morocco

A. aureus - A22 - Western Sahara

A. taghitensis - A266 - AlgeriaA. taghitensis - A267 - Algeria

A. aegyptius - A36 - IsraelA. aegyptius - A10 - IsraelA. aegyptius - A37 - Israel

A. aegyptius - A277 - Israel

A. aegyptius - A132 - Egypt

A. aegyptius - A134 - EgyptA. aegyptius - A133 - Egypt

A. aegyptius - A135 - EgyptA. aegyptius - A136 - Egypt

A. aegyptius - A7 - IsraelA. aegyptius - A23 - Israel

A. longipes - A185 - MauritaniaA. longipes - A180 - MauritaniaA. longipes - A179 - Mauritania

A. longipes - A137 - MauritaniaA. longipes - A139 - MauritaniaA. longipes - A131 - Algeria

A. longipes - A127 - Mauritania

A. dumerilii - A46 - Morocco

A. dumerilii - A3 - AlgeriaA. dumerilii - A248 - Morocco

A. dumerilii - A301 - SenegalA. dumerilii - A300 - Senegal

A. dumerilii - A183 - Mauritania

A. dumerilii - A182 - MauritaniaA. dumerilii - A181 - Mauritania

A. dumerilii - A140 - Western Sahara

A. senegalensis - A187 - Mauritania

A. senegalensis - A186 - Mauritania

A. senegalensis - A202 - Western Sahara

A. senegalensis - A1 - MauritaniaA. senegalensis - A19 - SenegalA. senegalensis - A306 - SenegalA. senegalensis - A307 - SenegalA. senegalensis - A305 - Senegal

A. senegalensis - A155 - Western Sahara

A. dumerilii - A138 - Mauritania

A. senegalensis - A201 - Mauritania

A. scutellatus audouini - A210 - Algeria

A. scutellatus audouini - A103 - TunisiaA. scutellatus audouini - A104 - TunisiaA. scutellatus audouini - A94 - Tunisia

A. scutellatus audouini - A101 - LibyaA. scutellatus audouini - A304 - LibyaA. scutellatus audouini - A93 - TunisiaA. scutellatus audouini - A96 - TunisiaA. scutellatus audouini - A83 - TunisiaA. scutellatus audouini - A95 - TunisiaA. scutellatus audouini - A97 - TunisiaA. scutellatus audouini - A92 - Libya

A. scutellatus audouini - A102 - LibyaA. scutellatus audouini - A100 - LibyaA. scutellatus audouini - A99 - Libya

A. scutellatus audouini - A119 - EgyptA. scutellatus audouini - A222 - MauritaniaA. scutellatus audouini - A223 - MauritaniaA. scutellatus audouini - A211 - EgyptA. scutellatus audouini - A29 - Egypt

A. scutellatus audouini - A27 - EgyptA. scutellatus audouini - A224 - MoroccoA. scutellatus audouini - A225 - Morocco

A. dumerilii - A249 - Morocco

A. scutellatus scutellatus - A215 - Egypt

A. scutellatus scutellatus - A217 - EgyptA. scutellatus scutellatus - A26 - EgyptA. scutellatus scutellatus - A226 - EgyptA. scutellatus scutellatus - A213 - EgyptA. scutellatus scutellatus - A24 - Egypt

A. scutellatus scutellatus - A221 - Egypt

A. scutellatus scutellatus - A214 - Egypt

A. scutellatus scutellatus - A212 - Egypt

A. scutellatus scutellatus - A216 - EgyptA. scutellatus scutellatus - A220 - Egypt

A. scutellatus scutellatus - A20 - Israel

A. scutellatus scutellatus - A14 - IsraelA. scutellatus scutellatus - A65 - IsraelA. scutellatus scutellatus - A44 - IsraelA. scutellatus scutellatus - A11 - IsraelA. scutellatus scutellatus - A42 - Israel

A. scutellatus scutellatus - A9 - IsraelA. scutellatus scutellatus - A8 - Israel

A. scutellatus scutellatus - A68 - IsraelA. scutellatus scutellatus - A13 - Israel

A. scutellatus scutellatus - A6 - Israel

A. scutellatus scutellatus - A218 - EgyptA. scutellatus scutellatus - A219 - Egypt

A. blanfordii - A59 - OmanA. blanfordii - A290 - Oman

A. blanfordii - A291 - UAEA. blanfordii - A208 - IranA. blanfordii - A207 - Iran

A. schmidti - A195 - JordanA. schmidti - A51 - OmanA. schmidti - A228 - UAE

A. grandis - A241 - SyriaA. harranensis - A151 - Turkey

A. micropholis - A67 - PakistanA. micropholis - A150 - Iran

A. grandis - A243 - SyriaA. grandis - A242 - SyriaA. grandis - A192 - Jordan

A. hardyi - A247 - JordanA. hardyi - A122 - Jordan

A. hardyi - A273 - Kuwait

A. hardyi - A123 - Jordan

A. masirae - A63 - OmanA. masirae - A50 - OmanA. masirae - A48 - OmanA. cantoris - A287 - PakistanA. cantoris - A178 - PakistanA. cantoris - A286 - Pakistan

A. haasi - A302 - OmanA. tilburyi - A250 - JordanA. tilburyi - A251 - Jordan

A. felicis - A34 - OmanA. felicis - A30 - OmanA. felicis - A32 - OmanA. felicis - A164 - OmanA. felicis - A165 - OmanA. felicis - A163 - OmanA. felicis - A31 - OmanA. felicis - A197 - OmanA. felicis - A162 - Oman

A. opheodurus - A33 - IsraelA. opheodurus - A25 - IsraelA. opheodurus - A79 - JordanA. opheodurus - A193 - JordanA. opheodurus - A194 - Jordan

A. opheodurus - A38 - OmanA. opheodurus - A35 - Oman

A. opheodurus - A209 - UAEA. opheodurus - A303 - Oman

A. opheodurus - A69 - IsraelA. opheodurus - A288 - Israel

A. boskianus asper - A257 - SyriaA. boskianus asper - A256 - Syria

A. boskianus asper - A240 - SyriaA. boskianus asper - A239 - Syria

A. boskianus asper - A255 - Syria

A. schreiberi schreiberi - A229 - CyprusA. schreiberi schreiberi - A70 - CyprusA. schreiberi schreiberi - A289 - CyprusA. schreiberi schreiberi - A230 - CyprusA. schreiberi ataturi - A198 - TurkeyA. schreiberi ataturi - A199 - TurkeyA. schreiberi schreiberi - A118 - Cyprus

A. boskianus asper - A231 - Oman

A. boskianus asper - A115 - OmanA. boskianus asper - A149 - OmanA. boskianus asper - A293 - Oman

A. boskianus asper - A294 - UAEA. boskianus asper - A191 - Jordan

A. boskianus asper - A168 - EgyptA. boskianus asper - A285 - NigerA. boskianus nigeriensis - A299 - NigerA. boskianus nigeriensis - A298 - NigerA. boskianus asper - A172 - EgyptA. boskianus asper - A120 - EgyptA. boskianus asper - A148 - Sudan

A. boskianus asper - A158 - Morocco

A. boskianus asper - A109 - AlgeriaA. boskianus asper - A175 - Morocco

A. boskianus asper - A160 - MoroccoA. boskianus asper - A147 - MoroccoA. boskianus asper - A161 - Morocco

A. boskianus asper - A110 - TunisiaA. boskianus asper - A157 - TunisiaA. boskianus asper - A176 - Tunisia

A. boskianus asper - A154 - TunisiaA. boskianus khattensis - A296 - MauritaniaA. boskianus khattensis - A297 - MauritaniaA. boskianus khattensis - A295 - Mauritania

A. boskianus asper - A236 - Western SaharaA. boskianus asper - A174 - MauritaniaA. boskianus asper - A173 - Mauritania

A. boskianus asper - A108 - LibyaA. boskianus asper - A235 - MoroccoA. boskianus asper - A234 - Morocco

A. boskianus asper - A156 - YemenA. boskianus asper - A106 - Yemen

A. boskianus asper - A117 - OmanA. boskianus asper - A159 - OmanA. boskianus asper - A116 - OmanA. boskianus asper - A232 - Oman

A. boskianus asper - A169 - Egypt

A. boskianus asper - A114 - Jordan

A. boskianus asper - A167 - EgyptA. boskianus asper - A292 - Egypt

A. schreiberi syriacus - A57 - IsraelA. schreiberi syriacus - A121 - Israel

A. schreiberi syriacus - A15 - IsraelA. schreiberi syriacus - A274 - IsraelA. schreiberi syriacus - A152 - LebanonA. schreiberi syriacus - A153 - Lebanon

A. schreiberi syriacus - A62 - IsraelA. schreiberi syriacus - A21 - Israel

A. schreiberi syriacus - A205 - IsraelA. schreiberi syriacus - A4 - IsraelA. schreiberi syriacus - A204 - IsraelA. schreiberi syriacus - A5 - Israel

A. boskianus asper - A107 - Yemen

A. boskianus asper - A177 - EgyptA. boskianus asper - A170 - EgyptA. boskianus asper - A112 - EgyptA. boskianus asper - A279 - IsraelA. boskianus asper - A66 - Israel

A. boskianus asper - A190 - EgyptA. boskianus asper - A28 - Israel

A. boskianus asper - A282 - IsraelA. boskianus asper - A113 - Jordan

A. boskianus asper - A281 - Israel

A. boskianus asper - A18 - IsraelA. boskianus asper - A206 - Israel

A. boskianus asper - A233 - JordanA. boskianus asper - A171 - Egypt

A. boskianus asper - A12 - IsraelA. boskianus asper - A80 - Israel

A. boskianus asper - A237 - JordanA. boskianus asper - A78 - Israel

A. boskianus asper - A73 - Israel

A. boskianus asper - A203 - Israel

A. boskianus asper - A238 - Jordan

A. boskianus asper - A64 - IsraelA. boskianus asper - A76 - Israel

A. boskianus asper - A105 - EgyptA. boskianus asper - A111 - Egypt

tristramigroup

100

100

100

100

71

87

86

90

10095

98

100

100

100

97

100

100

100

100

100

100

10077

100

100

100

96

100

100

94

94

100

100

99

86

99

100

98

99

86

73

100

10099

100

100 Mesalina olivieri - M19 - IsraelMesalina olivieri - M20 - Israel

Mesalina olivieri - M21 - Israel

75100

99

100

100

9594

94

71100

100

99

97

87

erythrurusgroup

100

100

100

100

99

7796

71

99

100

100

100

100

100

pardalisgroup

100

100

71

97

73

9199

100

A. arabicus - A84 - YemenA. arabicus - A72 - Yemen

A. arabicus - A77 - YemenA. gongrorhynchatus - A128 - UAE

9996

99

98

98

86100

100

100

99

100

89

71

87

94

100

100

9399

100

blanfordigroup

grandis group

micropholis group

opheodurusgroup

boskianusgroup

cantorisgroup

scutellatusgroup

Eastern

clade

scutellatus

clade

Western

clade

98

77

86

79

87

82

78

82

97

99

84

94

948197

84

100

93

82

88

84

100

99

92

71

72

98

95

95

92

90

98

73

96

85

0.06

A. guineensis - A275 - Niger

A. savignyi - A265 - AlgeriaA. savignyi - A264 - Algeria

A. orientalis - A244 - Syria

A. orientalis - A246 - SyriaA. orientalis - A245 - Syria

A. tristrami - A196 - Jordan

A. tristrami - A252 - SyriaA. tristrami - A254 - SyriaA. tristrami - A253 - Syria

A. erythrurus - A126 - SpainA. erythrurus - A125 - Spain

A. erythrurus - A60 - Morocco

A. erythrurus - A56 - Morocco

A. erythrurus - A61 - MoroccoA. erythrurus - A146 - Morocco

A. erythrurus - A124 - Morocco

A. blanci - A85 - TunisiaA. blanci - A86 - Tunisia

A. lineomaculatus - A130 - MoroccoA. lineomaculatus - A129 - Morocco

A. boueti - A276 - Benin A. busacki - A263 - Morocco

A. busacki - A271 - MoroccoA. busacki - A272 - MoroccoA. busacki - A87 - Morocco

A. busacki - A88 - MoroccoA. busacki - A89 - Morocco

A. busacki - A269 - Morocco

A. busacki - A268 - Western SaharaA. busacki - A270 - Morocco

A. maculatus - A58 - MoroccoA. maculatus - A262 - Morocco

A. beershebensis - A74 - IsraelA. beershebensis - A280 - Israel

A. beershebensis - A2 - Israel

A. beershebensis - A47 - IsraelA. beershebensis - A284 - Israel

A. beershebensis - A53 - Israel

A. beershebensis - A17 - IsraelA. beershebensis - A40 - Israel

A. beershebensis - A283 - Israel

A. beershebensis - A75 - Israel

A. beershebensis - A278 - Israel

A. maculatus - A142 - AlgeriaA. pardalis - A54 - Egypt

A. pardalis - A41 - EgyptA. pardalis - A55 - Egypt

A. pardalis - A227 - Egypt

A. maculatus - A141 - Algeria

A. maculatus - A91 - Libya

A. maculatus - A145 - Tunisia

A. bedriagai - A189 - TunisiaA. maculatus - A144 - Tunisia

A. maculatus - A81 - MoroccoA. maculatus - A82 - Morocco

A. maculatus - A49 - MoroccoA. maculatus - A52 - Morocco

A. maculatus - A259 - AlgeriaA. bedriagai - A258 - Algeria

A. maculatus - A143 - MoroccoA. maculatus - A90 - Morocco

Mesalina guttulata - M18 - IsraelMesalina guttulata - M17 - Israel

Mesalina olivieri - M19 - IsraelMesalina olivieri - M20 - Israel

Mesalina olivieri - M21 - Israel

A. aureus - A188 - Morocco

A. aureus - A43 - Morocco

A. aureus - A71 - Western Sahara

A. aureus - A184 - MauritaniaA. aureus - A166 - Mauritania

A. aureus - A39 - Morocco

A. aureus - A45 - Morocco

A. aureus - A22 - Western Sahara

A. taghitensis - A266 - AlgeriaA. taghitensis - A267 - Algeria

A. aegyptius - A36 - IsraelA. aegyptius - A10 - Israel

A. aegyptius - A37 - Israel

A. aegyptius - A277 - Israel

A. aegyptius - A132 - Egypt

A. aegyptius - A134 - Egypt

A. aegyptius - A133 - Egypt

A. aegyptius - A135 - Egypt

A. aegyptius - A136 - Egypt

A. aegyptius - A7 - Israel

A. aegyptius - A23 - Israel

A. longipes - A185 - Mauritania

A. longipes - A180 - Mauritania

A. longipes - A179 - Mauritania

A. longipes - A137 - Mauritania

A. longipes - A139 - MauritaniaA. longipes - A131 - Algeria

A. longipes - A127 - Mauritania

A. dumerilii - A46 - MoroccoA. dumerilii - A3 - Algeria

A. dumerilii - A248 - Morocco

A. dumerilii - A301 - Senegal

A. dumerilii - A300 - SenegalA. dumerilii - A183 - Mauritania

A. dumerilii - A182 - Mauritania

A. dumerilii - A181 - Mauritania

A. dumerilii - A140 - Western Sahara

A. senegalensis - A187 - Mauritania

A. senegalensis - A186 - Mauritania

A. senegalensis - A202 - Western Sahara

A. senegalensis - A1 - Mauritania

A. senegalensis - A19 - Senegal

A. senegalensis - A306 - SenegalA. senegalensis - A307 - Senegal

A. senegalensis - A305 - Senegal

A. senegalensis - A155 - Western Sahara

A. dumerilii - A138 - Mauritania

A. senegalensis - A201 - Mauritania

A. scutellatus audouini - A210 - AlgeriaA. scutellatus audouini - A103 - Tunisia

A. scutellatus audouini - A104 - TunisiaA. scutellatus audouini - A94 - Tunisia

A. scutellatus audouini - A101 - LibyaA. scutellatus audouini - A304 - LibyaA. scutellatus audouini - A93 - TunisiaA. scutellatus audouini - A96 - TunisiaA. scutellatus audouini - A83 - Tunisia

A. scutellatus audouini - A95 - TunisiaA. scutellatus audouini - A97 - Tunisia

A. scutellatus audouini - A92 - Libya

A. scutellatus audouini - A102 - LibyaA. scutellatus audouini - A100 - Libya

A. scutellatus audouini - A99 - Libya

A. scutellatus audouini - A119 - Egypt

A. scutellatus audouini - A222 - MauritaniaA. scutellatus audouini - A223 - Mauritania

A. scutellatus audouini - A211 - Egypt

A. scutellatus audouini - A29 - EgyptA. scutellatus audouini - A27 - Egypt

A. scutellatus audouini - A224 - MoroccoA. scutellatus audouini - A225 - MoroccoA. dumerilii - A249 - Morocco

A. scutellatus scutellatus - A215 - Egypt

A. scutellatus scutellatus - A217 - Egypt

A. scutellatus scutellatus - A26 - Egypt

A. scutellatus scutellatus - A226 - EgyptA. scutellatus scutellatus - A213 - EgyptA. scutellatus scutellatus - A24 - Egypt

A. scutellatus scutellatus - A221 - Egypt

A. scutellatus scutellatus - A214 - Egypt

A. scutellatus scutellatus - A212 - Egypt

A. scutellatus scutellatus - A216 - Egypt

A. scutellatus scutellatus - A220 - Egypt

A. scutellatus scutellatus - A20 - Israel

A. scutellatus scutellatus - A14 - Israel

A. scutellatus scutellatus - A65 - IsraelA. scutellatus scutellatus - A44 - Israel

A. scutellatus scutellatus - A11 - IsraelA. scutellatus scutellatus - A42 - Israel

A. scutellatus scutellatus - A9 - IsraelA. scutellatus scutellatus - A8 - Israel

A. scutellatus scutellatus - A68 - Israel

A. scutellatus scutellatus - A13 - Israel

A. scutellatus scutellatus - A6 - Israel

A. scutellatus scutellatus - A218 - Egypt

A. scutellatus scutellatus - A219 - Egypt

A. blanfordii - A59 - OmanA. blanfordii - A290 - Oman

A. blanfordii - A291 - UAE

A. blanfordii - A208 - IranA. blanfordii - A207 - Iran

A. schmidti - A195 - Jordan

A. schmidti - A51 - OmanA. schmidti - A228 - UAE

A. grandis - A241 - SyriaA. harranensis - A151 - Turkey

A. micropholis - A67 - PakistanA. micropholis - A150 - Iran

A. grandis - A243 - Syria

A. grandis - A242 - SyriaA. grandis - A192 - Jordan

A. hardyi - A247 - JordanA. hardyi - A122 - Jordan

A. hardyi - A273 - Kuwait

A. hardyi - A123 - Jordan

A. masirae - A63 - Oman

A. masirae - A50 - OmanA. masirae - A48 - Oman

A. cantoris - A287 - PakistanA. cantoris - A178 - Pakistan

A. cantoris - A286 - Pakistan

A. arabicus - A84 - YemenA. arabicus - A72 - Yemen

A. arabicus - A77 - YemenA. gongrorhynchatus - A128 - UAE

A. haasi - A302 - Oman

A. tilburyi - A250 - JordanA. tilburyi - A251 - Jordan

A. felicis - A34 - OmanA. felicis - A30 - Oman

A. felicis - A32 - Oman

A. felicis - A164 - OmanA. felicis - A165 - Oman

A. felicis - A163 - Oman

A. felicis - A31 - OmanA. felicis - A197 - Oman

A. felicis - A162 - Oman

A. opheodurus - A33 - IsraelA. opheodurus - A25 - Israel

A. opheodurus - A79 - JordanA. opheodurus - A193 - JordanA. opheodurus - A194 - Jordan

A. opheodurus - A38 - OmanA. opheodurus - A35 - Oman

A. opheodurus - A209 - UAEA. opheodurus - A303 - Oman

A. opheodurus - A69 - IsraelA. opheodurus - A288 - Israel

A. boskianus asper - A257 - Syria

A. boskianus asper - A256 - SyriaA. boskianus asper - A240 - Syria

A. boskianus asper - A239 - SyriaA. boskianus asper - A255 - Syria

A. schreiberi schreiberi - A229 - CyprusA. schreiberi schreiberi - A70 - CyprusA. schreiberi schreiberi - A289 - Cyprus

A. schreiberi schreiberi - A230 - Cyprus

A. schreiberi ataturi - A198 - TurkeyA. schreiberi ataturi - A199 - Turkey

A. schreiberi schreiberi - A118 - Cyprus

A. boskianus asper - A231 - Oman

A. boskianus asper - A115 - OmanA. boskianus asper - A149 - OmanA. boskianus asper - A293 - Oman

A. boskianus asper - A294 - UAEA. boskianus asper - A191 - Jordan

A. boskianus asper - A168 - Egypt

A. boskianus asper - A285 - Niger

A. boskianus nigeriensis - A299 - NigerA. boskianus nigeriensis - A298 - Niger

A. boskianus asper - A172 - EgyptA. boskianus asper - A120 - EgyptA. boskianus asper - A148 - Sudan

A. boskianus asper - A158 - MoroccoA. boskianus asper - A109 - Algeria

A. boskianus asper - A175 - MoroccoA. boskianus asper - A160 - MoroccoA. boskianus asper - A147 - MoroccoA. boskianus asper - A161 - Morocco

A. boskianus asper - A110 - TunisiaA. boskianus asper - A157 - Tunisia

A. boskianus asper - A176 - Tunisia

A. boskianus asper - A154 - TunisiaA. boskianus khattensis - A296 - MauritaniaA. boskianus khattensis - A297 - MauritaniaA. boskianus khattensis - A295 - Mauritania

A. boskianus asper - A236 - Western SaharaA. boskianus asper - A174 - MauritaniaA. boskianus asper - A173 - Mauritania

A. boskianus asper - A108 - Libya

A. boskianus asper - A235 - MoroccoA. boskianus asper - A234 - Morocco

A. boskianus asper - A156 - YemenA. boskianus asper - A106 - Yemen

A. boskianus asper - A117 - OmanA. boskianus asper - A159 - OmanA. boskianus asper - A116 - Oman

A. boskianus asper - A232 - Oman

A. boskianus asper - A169 - Egypt

A. boskianus asper - A114 - Jordan

A. boskianus asper - A167 - EgyptA. boskianus asper - A292 - Egypt

A. schreiberi syriacus - A57 - Israel

A. schreiberi syriacus - A121 - Israel

A. schreiberi syriacus - A15 - IsraelA. schreiberi syriacus - A274 - Israel

A. schreiberi syriacus - A152 - LebanonA. schreiberi syriacus - A153 - Lebanon

A. schreiberi syriacus - A62 - Israel

A. schreiberi syriacus - A21 - Israel

A. schreiberi syriacus - A205 - IsraelA. schreiberi syriacus - A4 - Israel

A. schreiberi syriacus - A204 - IsraelA. schreiberi syriacus - A5 - Israel

A. boskianus asper - A107 - Yemen

A. boskianus asper - A177 - EgyptA. boskianus asper - A170 - Egypt

A. boskianus asper - A112 - Egypt

A. boskianus asper - A279 - IsraelA. boskianus asper - A66 - Israel

A. boskianus asper - A190 - Egypt

A. boskianus asper - A28 - Israel

A. boskianus asper - A282 - Israel

A. boskianus asper - A113 - Jordan

A. boskianus asper - A281 - Israel

A. boskianus asper - A18 - Israel

A. boskianus asper - A206 - Israel

A. boskianus asper - A233 - Jordan

A. boskianus asper - A171 - Egypt

A. boskianus asper - A12 - IsraelA. boskianus asper - A80 - Israel

A. boskianus asper - A237 - Jordan

A. boskianus asper - A78 - IsraelA. boskianus asper - A73 - Israel

A. boskianus asper - A203 - Israel

A. boskianus asper - A238 - Jordan

A. boskianus asper - A64 - Israel

A. boskianus asper - A76 - Israel

A. boskianus asper - A105 - Egypt

A. boskianus asper - A111 - Egypt

scutellatus group

tristramigroup

erythrurusgroup

blanfordigroup

grandis groupmicropholis group

cantorisgroup

opheodurusgroup

boskianus group

pardalis group

Eastern

clade

scutellatus

clade

Western

clade

100

72

91

100

97

85

100

93

8190

100

100

99 100

100

100

100

10085

78

100

72

99

100

100

99

99

89

100

97

74

100

74

87

75

98

94

89

7474

99

74100

97

93

100

100

10077

70

70

100

100

100

100

100

100

100

100

98

100

100

100

99

77

100

100

72

100

91

100

84

100

100

100100

100

96

99

72

100

9199

99

97

100

100

95

88

99

74

100

93

99

71

95

100

100

99

100

9688

98

80

83

76

89

94

75

99

92

76

99

93

97

93

84

100

84

89

75

100

100

95

97

79

96

91

75

93

95

97

99

100

97

A. guineensis - A275 - NigerA. boueti - A276 - Benin

A. beershebensis - A17 - Israel

A. pardalis - A41 - EgyptA. pardalis - A54 - EgyptA. pardalis - A55 - EgyptA. pardalis - A227 - Egypt

A. busacki - A263 - Morocco

A. busacki - A269 - MoroccoA. busacki - A268 - Western SaharaA. busacki - A270 - Morocco

A. savignyi - A265 - AlgeriaA. savignyi - A264 - Algeria

A. tristrami - A252 - SyriaA. tristrami - A196 - Jordan

A. orientalis - A244 - SyriaA. orientalis - A246 - SyriaA. orientalis - A245 - Syria

A. bedriagai - A258 - Algeria

A. bedriagai - A189 - Tunisia

A. blanci - A85 - TunisiaA. blanci - A86 - Tunisia

A. busacki - A87 - Morocco

A. busacki - A88 - MoroccoA. busacki - A89 - Morocco

A. erythrurus belli - A124 - MoroccoA. erythrurus belli - A56 - Morocco

A. erythrurus atlanticus - A60 - MoroccoA. erythrurus erythrurus - A126 - SpainA. erythrurus erythrurus - A125 - SpainA. erythrurus belli - A61 - MoroccoA. erythrurus belli - A146 - Morocco

A. lineomaculatus - A129 - Morocco

A. maculatus - A58 - MoroccoA. maculatus - A262 - MoroccoA. maculatus - A91 - Libya

A. maculatus - A90 - MoroccoA. maculatus - A143 - Morocco

A. maculatus - A259 - AlgeriaA. maculatus - A49 - MoroccoA. maculatus - A52 - MoroccoA. maculatus - A144 - Tunisia

A. maculatus - A81 - Morocco

A. maculatus - A142 - AlgeriaA. beershebensis - A283 - IsraelA. beershebensis - A74 - Israel

A. beershebensis - A278 - Israel

A. aureus - A39 - MoroccoA. aureus - A45 - MoroccoA. aureus - A43 - Morocco

A. aureus - A188 - MoroccoA. aureus - A22 - Western SaharaA. aureus - A71 - Western SaharaA. aureus - A166 - MauritaniaA. aureus - A184 - MauritaniaA. taghitensis - A267 - Algeria

A. aegyptius - A7 - Israel

A. aegyptius - A23 - IsraelA. aegyptius - A10 - IsraelA. aegyptius - A36 - IsraelA. aegyptius - A37 - Israel

A. aegyptius - A277 - IsraelA. aegyptius - A132 - EgyptA. aegyptius - A134 - EgyptA. aegyptius - A133 - Egypt

A. longipes - A127 - Mauritania

A. longipes - A131 - AlgeriaA. longipes - A139 - MauritaniaA. longipes - A179 - Mauritania

A. scutellatus scutellatus - A65 - IsraelA. scutellatus scutellatus - A6 - IsraelA. scutellatus scutellatus - A13 - IsraelA. scutellatus scutellatus - A8 - IsraelA. scutellatus scutellatus - A13 - Israel

A. scutellatus scutellatus - A14 - Israel

A. scutellatus scutellatus - A215 - EgyptA. scutellatus scutellatus - A214 - Egypt

A. scutellatus scutellatus - A216 - EgyptA. scutellatus scutellatus - A226 - EgyptA. scutellatus scutellatus - A26 - EgyptA. scutellatus scutellatus - A212 - EgyptA. scutellatus scutellatus - A214 - Egypt

A. scutellatus audouini - A27 - EgyptA. scutellatus audouini - A211 - EgyptA. scutellatus audouini - A29 - EgyptA. scutellatus audouini - A119 - EgyptA. scutellatus audouini - A223 - MauritaniaA. scutellatus audouini - A222 - MauritaniaA. scutellatus audouini - A224 - MoroccoA. scutellatus audouini - A99 - LibyaA. scutellatus audouini - A102 - LibyaA. scutellatus audouini - A92 - Libya

A. scutellatus audouini - A210 - AlgeriaA. scutellatus audouini - A103 - TunisiaA. scutellatus audouini - A104 - TunisiaA. scutellatus audouini - A94 - TunisiaA. scutellatus audouini - A101 - LibyaA. scutellatus audouini - A93 - TunisiaA. scutellatus audouini - A96 - TunisiaA. scutellatus audouini - A83 - TunisiaA. scutellatus audouini - A95 - TunisiaA. scutellatus audouini - A97 - Tunisia

A. senegalensis - A305 - SenegalA. senegalensis - A307 - SenegalA. senegalensis - A19 - Senegal

A. senegalensis - A201 - Mauritania

A. senegalensis - A1 - Mauritania

A. senegalensis - A155 - Western SaharaA. dumerilii - A301 - Senegal

A. dumerilii - A300 - Senegal

A. dumerilii - A46 - MoroccoA. dumerilii - A249 - MoroccoA. dumerilii - A3 - AlgeriaA. dumerilii - A248 - MoroccoA. senegalensis - A187 - Mauritania

A. senegalensis - A186 - MauritaniaA. dumerilii - A138 - MauritaniaA. dumerilii - A183 - Mauritania

A. dumerilii - A140 - Western SaharaA. dumerilii - A181 - Mauritania

A. dumerilii - A182 - Mauritania

A. tilburyi - A250 - JordanA. tilburyi - A251 - JordanA. haasi - A302 - Oman

A. gongrorhynchatus - A128 - UAEA. arabicus - A84 - YemenA. arabicus - A72 - YemenA. arabicus - A77 - Yemen

A. masirae - A63 - Oman

A. masirae - A50 - OmanA. masirae - A48 - Oman

A. cantoris - A287 - PakistanA. cantoris - A178 - PakistanA. cantoris - A286 - Pakistan

A. grandis - A241 - SyriaA. harranensis - A151 - TurkeyA. micropholis - A67 - PakistanA. micropholis - A150 - Iran

A. grandis - A243 - SyriaA. grandis - A242 - SyriaA. grandis - A192 - Jordan

A. blanfordii - A59 - OmanA. blanfordii - A290 - OmanA. blanfordii - A291 - UAE

A. blanfordii - A208 - IranA. blanfordii - A207 - Iran

A. schmidti - A195 - JordanA. schmidti - A51 - OmanA. schmidti - A228 - UAE

A. hardyi - A247 - JordanA. hardyi - A273 - KuwaitA. hardyi - A122 - JordanA. hardyi - A123 - Jordan

A. felicis - A34 - Oman

A. felicis - A30 - OmanA. felicis - A164 - Oman

A. felicis - A165 - OmanA. felicis - A163 - Oman

A. felicis - A31 - OmanA. felicis - A197 - OmanA. felicis - A162 - Oman

A. opheodurus - A25 - Israel

A. opheodurus - A79 - JordanA. opheodurus - A193 - JordanA. opheodurus - A194 - Jordan

A. opheodurus - A38 - OmanA. opheodurus - A35 - OmanA. opheodurus - A209 - UAEA. opheodurus - A303 - Oman

A. opheodurus - A288 - Israel

A. boskianus asper - A257 - SyriaA. boskianus asper - A256 - SyriaA. schreiberi schreiberi - A229 - CyprusA. schreiberi schreiberi - A289 - CyprusA. schreiberi schreiberi - A118 - CyprusA. schreiberi ataturi - A198 - TurkeyA. schreiberi schreiberi - A230 - Cyprus

A. boskianus asper - A28 - IsraelA. boskianus asper - A78 - Israel

A. schreiberi syriacus - A21 - Israel

A. schreiberi syriacus - A57 - IsraelA. schreiberi syriacus - A62 - Israel

A. schreiberi syriacus - A121 - Israel

A. schreiberi syriacus - A152 - LebanonA. schreiberi syriacus - A15 - IsraelA. boskianus asper - A167 - EgyptA. boskianus asper - A292 - Egypt

A. boskianus asper - A206 - Israel

A. boskianus asper - A233 - JordanA. boskianus asper - A279 - IsraelA. boskianus asper - A203 - IsraelA. boskianus asper - A190 - EgyptA. boskianus asper - A170 - EgyptA. boskianus asper - A112 - EgyptA. boskianus asper - A105 - Egypt

A. boskianus asper - A114 - JordanA. boskianus asper - A238 - JordanA. schreiberi syriacus - A5 - IsraelA. schreiberi syriacus - A4 - IsraelA. boskianus asper - A177 - EgyptA. boskianus asper - A107 - Yemen

A. boskianus asper - A169 - Egypt

A. boskianus asper - A231 - OmanA. boskianus asper - A191 - JordanA. boskianus asper - A115 - OmanA. boskianus asper - A294 - UAEA. boskianus asper - A293 - OmanA. boskianus asper - A149 - Oman

A. boskianus asper - A158 - MoroccoA. boskianus asper - A109 - AlgeriaA. boskianus asper - A175 - MoroccoA. boskianus asper - A161 - MoroccoA. boskianus asper - A160 - MoroccoA. boskianus asper - A168 - EgyptA. boskianus asper - A285 - NigerA. boskianus nigeriensis - A299 - NigerA. boskianus asper - A148 - SudanA. boskianus asper - A172 - EgyptA. boskianus asper - A120 - EgyptA. boskianus asper - A110 - TunisiaA. boskianus asper - A176 - TunisiaA. boskianus asper - A108 - LibyaA. boskianus asper - A154 - Tunisia

A. boskianus khattensis - A295 - MauritaniaA. boskianus khattensis - A296 - Mauritania

A. boskianus asper - A232 - OmanA. boskianus asper - A159 - OmanA. boskianus asper - A156 - YemenA. boskianus asper - A106 - Yemen

A. boskianus asper - A236 - Western SaharaA. boskianus asper - A235 - MoroccoA. boskianus asper - A234 - Morocco

A. boskianus asper - A174 - MauritaniaA. boskianus asper - A173 - MauritaniaA. boskianus asper - A114 - Jordan

−0.30 −0.25 −0.20 −0.15 −0.10 −0.05 0.00

12

510

2050

100

200

TimeN

scutellatus group

pardalisgroup

erythrurusgroup

tristramigroup

micropholisgroupgrandisgroup

cantorisgroup

blanfordiigroup

opheodurusgroup

boskianusgroup

−0.30 −0.25 −0.20 −0.15 −0.10 −0.05 0.00

1715

1720

1725

1730

1735

1740

1745

1750

Time

likel

ihoo

d

(a)

(c)

(b)

Eastern

clade

scutellatus

clade

Western

clade

*

*

*

*

*

*

*

*

*

*

*

**

*

*

*

*

**

*

*

*

*

*

*

*

*

*

*

**

*

***

*

*

*

*

*

*

*

*

**

*

*

*

*

**

* *

*

*

*

*

*

*

*

*

*

*

*

*

*

*

*

*

*

*

*

*

*

*

*

**

*

*

*

*

**

*

*

*

*

*

*

*

*

*

*

*

*

*

*

*

*

*

**

*

*

*

*

*

*

*

*

5.0

50 40 30 20 1060 0

Pssamodromus algirusPssamodromus algirus

Gallotia atlantica mahorataeGallotia atlantica atlanticaGallotia intermedia

Gallotia stehlini

Gallotia gomeranaGallotia simonyi machadoiGallotia caesaris gomeraeGallotia caesaris caesarisGallotia galloti palmaeGallotia galloti gallotiGallotia galloti eisentrauti

Podarcis lilfordiPodarcis lilfordi

Podarcis pityusensisPodarcis pityusensis

Podarcis cretensisPodarcis cretensisPodarcis peloponnesiacusPodarcis peloponnesiacus

A. guineensis - A275 - Niger

A. boueti - A276 - Benin

A. tristrami - A252 - SyriaA. tristrami - A196 - JordanA. orientalis - A244 - SyriaA. orientalis - A246 - SyriaA. orientalis - A245 - SyriaA. savignyi - A264 - Algeria

A. erythrurus - A126 - SpainA. erythrurus - A125 - SpainA. erythrurus - A61 - Morocco

A. erythrurus - A60 - MoroccoA. erythrurus - A56 - MoroccoA. blanci - A85 - TunisiaA. erythrurus - A124 - Morocco

A. lineomaculatus - A129 - Morocco

A. erythrurus - A146 - Morocco

A. busacki - A263 - MoroccoA. busacki - A270 - MoroccoA. busacki - A89 - MoroccoA. beershebensis - A283 - IsraelA. maculatus - A262 - MoroccoA. pardalis - A41 - EgyptA. maculatus - A142 - AlgeriaA. maculatus - A58 - Morocco

A. maculatus - A91 - LibyaA. bedriagai - A189 - TunisiaA. maculatus - A49 - MoroccoA. maculatus - A259 - AlgeriaA. maculatus - A143 - Morocco

A. aegyptius - A10 - IsraelA. longipes - A131 - AlgeriaA. longipes - A179 - Mauritania

A. taghitensis - A267 - Algeria

A. aureus - A71 - Western SaharaA. aureus - A39 - MoroccoA. aureus - A45 - MoroccoA. aureus - A22 - Western Sahara

A. scutellatus scutellatus - A6 - IsraelA. scutellatus audouini - A93 - TunisiaA. scutellatus audouini - A94 - Tunisia

A. scutellatus audouini - A95 - TunisiaA. scutellatus audouini - A101 - Libya

A. scutellatus audouini - A210 - Algeria

A. scutellatus audouini - A92 - LibyaA. scutellatus audouini - A99 - Libya

A. scutellatus audouini - A119 - EgyptA. scutellatus audouini - A223 - MauritaniaA. scutellatus audouini - A211 - EgyptA. scutellatus audouini - A224 - MoroccoA. dumerilii - A248 - MoroccoA. dumerilii - A249 - Morocco

A. dumerilii - A300 - SenegalA. senegalensis - A305 - Senegal

A. dumerilii - A46 - Morocco

A. dumerilii - A3 - Algeria

A. senegalensis - A187 - Mauritania

A. micropholis - A67 - PakistanA. micropholis - A150 - Iran

A. grandis - A241 - SyriaA. grandis - A242 - SyriaA. grandis - A243 - SyriaA. harranensis - A151 - Turkey

A. hardyi - A247 - JordanA. hardyi - A273 - KuwaitA. hardyi - A123 - JordanA. blanfordii - A291 - UAEA. blanfordii - A208 - IranA. schmidti - A51 - OmanA. schmidti - A195 - JordanA. schmidti - A228 - UAE

A. masirae - A50 - OmanA. cantoris - A286 - PakistanA. tilburyi - A251 - JordanA. haasi - A302 - OmanA. gongrorhynchatus - A128 - UAE

A. arabicus - A77 - YemenA. arabicus - A84 - Yemen

A. opheodurus - A25 - Israel

A. opheodurus - A303 - OmanA. opheodurus - A288 - IsraelA. opheodurus - A38 - Oman

A. felicis - A30 - OmanA. felicis - A162 - Oman

A. schreiberi schreiberi - A289 - CyprusA. schreiberi ataturi - A198 - TurkeyA. boskianus asper - A257 - Syria

A. boskianus asper - A28 - IsraelA. schreiberi syriacus - A57 - IsraelA. boskianus asper - A292 - Egypt

A. boskianus asper - A174 - MauritaniaA. boskianus asper - A235 - MoroccoA. boskianus asper - A108 - LibyaA. boskianus khattensis - A295 - MauritaniaA. boskianus asper - A154 - TunisiaA. boskianus asper - A110 - TunisiaA. boskianus asper - A109 - AlgeriaA. boskianus asper - A158 - MoroccoA. boskianus asper - A161 - MoroccoA. boskianus asper - A285 - NigerA. boskianus asper - A148 - SudanA. boskianus asper - A168 - Egypt

A. boskianus asper - A169 - Egypt

A. schreiberi syriacus - A5 - Israel

A. boskianus asper - A107 - YemenA. boskianus asper - A156 - YemenA. boskianus asper - A159 - OmanA. boskianus asper - A114 - Jordan

A. boskianus asper - A191 - JordanA. boskianus asper - A149 - OmanA. boskianus asper - A231 - Oman

Mya

tristramigroup

erythrurusgroup

pardalisgroup

scutellatus group

micropholisgroup

grandisgroup

cantorisgroup

blanfordiigroup

opheodurusgroup

boskianusgroup

Eastern

clade

scutellatus

clade

Western

clade

0.92

2.6

1.93

3.13.4

3.5

3.91.3

2.9

1.5

2.6

4.81.7

2.6

4.5

3

1.73.76.2

7.1

0.7

0.8

1.5

14

9.1

10.8

4

7.7

2.4

1.9

4.3

9.9

2.4

1.48.9

3.21.7

3.5

15.3

9.9

7.414.4

3.410.2

1

6

4.8

312.63.6

2.3

3.25.8

3.2

4.5

0.9

12.6

3.33.9

4.3

1.9

0.8

0.7

3.33.8

1.9

4.8

1.4

3.51

2.9

2.4

3.42.210.2

1.62

2.1

4.7

6.2

9.8

7.5

14.6

12.1

1.5

1.7

3.6

0.8

4.5

7.9

16.3

6

14.8

0.75.3

1.9

0.55.3

17.8

46.2

6.8

4.7

3.2

3.7

8.2

4.31.6

4.1

19.4

13.10.4

0.7

0.3

1.1

0.7

41.5

47.7

1.1

18.7

7.3

9.8

1.48.1

3.4

29.9

33.3

26.9

Table S1. Data on the specimens sampled and related GenBank accession numbers used in this study. Codes correspond to localities presented

in Figs. 2-4; (a) haplotypes (n=235); (b) GMYC representatives (n=111).

Code Species Voucher1 Country Locality 12S cytb MC1R ACM4 c-mos

A132 a A. aegyptius Egypt 5.5 km NW. to Bir Qatia, Sinai KX296855 KX297105 KX297244 KX297530 KX297713

A133 a A. aegyptius Egypt 17 km NW. to Bir Qatia, Sinai KX296856 KX297109 KX297247 KX297531 KX297714

A134 a A. aegyptius Egypt Zaraniq, Sinai KX296857 KX297106 KX297248 KX297532 KX297715

A135 A. aegyptius Egypt Zaraniq, Sinai KX296858 KX297107 KX297251 KX297533 KX297716

A136 A. aegyptius Egypt Zaraniq, Sinai KX296859 KX297108 KX297252 KX297534 KX297717

A10 a b A. aegyptius Israel Bir Mashash sands KX296863 KX297112 KX297249 KX297536 KX297718

A23 a A. aegyptius TAU.R16365 Israel Bir Mashash sands KX296861 KX297113 KX297253 KX297539 KX297719

A36 a A. aegyptius TAU.R16400 Israel Bir Mashash sands KX296864 KX297114 KX297254 KX297537 KX297720

A37 a A. aegyptius Israel Ashelim KX296865 KX297115 KX297250 KX297538 KX297721

A7 a A. aegyptius TAU.R16331 Israel Ashelim KX296862 KX297111 KX297246 KX297535 KX297722

A277 a A. aegyptius TAU.R16161 Israel Shivta junction KX296860 KX297110 - - -

A72 a A. arabicus MVZ:Herp236580 Yemen Lahij, Bir Nasr Farm, 3 km SW. (by air) of Sabir KX296920 KX297031 - - -

A77 a b A. arabicus MCCI-R819 Yemen Bir Ali KX296922 KX297033 - - -

A84 a b A. arabicus MCCI-R820(1) Yemen Tor Albaha KX296921 KX297032 - - -

A166 a A. aureus Mauritania Nouadhibou - KX297116 KX297261 KX297521 KX297728

A184 a A. aureus Mauritania Between Nouadhibou and Bou Lanouar KX296866 KX297117 KX297263 KX297525 KX297729

A188 a A. aureus Morocco Sidi Rbat (near Agadir) KX296868 KX297119 KX297264 KX297522 KX297731

A39 a b A. aureus Morocco Plage Blanche KX296870 KX297121 KX297245 KX297523 KX297732

A43 a A. aureus Morocco Tan-Tan beach KX296871 KX297122 KX297266 KX297524 KX297733

Code Species Voucher1 Country Locality 12S cytb MC1R ACM4 c-mos

A45 a b A. aureus IBES1371 Morocco Aglou-Plage KX296869 KX297120 KX297267 KX297526 KX297734

A22 a b A. aureus TR4086 Western Sahara 76 km S. to the turn to Dakhla KX296872 - - - -

A71 a b A. aureus TR4112 Western Sahara 155 km N. of Nouadhibou KX296867 KX297118 KX297262 KX297528 KX297730

A258 a b A. bedriagai Algeria Djelfa KX296941 KX297144 KX297325 KX297447 KX297647

A189 a b A. bedriagai Tunisia Roman Ruins Bou Chebka-Haidra KX296948 KX297153 KX297346 KX297446 KX297628

A283 a b A. beershebensis Israel 3 km S. of Ofakim KX296956 KX297158 KX297327 KX297451 KX297620

A75 A. beershebensis Israel 3 km S. of Ofakim KX296958 KX297159 - - -

A280 A. beershebensis Israel E. to park Arad KX296954 KX297156 - - -

A74 a A. beershebensis Israel E. to park Arad KX296955 KX297157 KX297328 KX297452 KX297621

A40 A. beershebensis HUJ.R19192 Israel Hanegev junction KX296961 KX297164 - KX297449 KX297617

A53 A. beershebensis HUJ.R19261 Israel Hanegev junction KX296963 KX297166 KX297326 KX297450 KX297619

A17 a A. beershebensis TAU.R16012 Israel Nahal Hed KX296960 KX297163 KX297342 KX297453 KX297622

A2 A. beershebensis TAU.R16396 Israel Nahal Hed KX296959 KX297161 KX297329 KX297456 KX297616

A47 A. beershebensis TAU.R16017 Israel Nahal Hed KX296962 KX297165 KX297330 KX297455 KX297618

A278 a A. beershebensis Israel Nahal Tzavoa KX296964 KX297160 - - -

A284 A. beershebensis Israel NW. to road 40 KX296957 KX297162 - - -

A85 a b A. blanci MCCI-R1321(1) Tunisia Jebel Tamesmida KX296930 KX297133 KX297313 KX297415 KX297599

A86 a A. blanci MCCI-R1325(1) Tunisia Jebel Semmama KX296931 KX297134 KX297314 KX297416 KX297600

A207 a A. blanfordii MVZ:Herp234464 Iran 6 km NW. of Bampur, Balluchestan KJ567754 KJ567846 KJ548101 KJ547929 KJ548020

A208 a b A. blanfordii MVZ:Herp246009 Iran Sand Dunes 7 km N. of Bampur, Balluchestan KJ567755 KJ567847 KJ548102 KJ547930 KJ548021

A59 a A. blanfordii Oman Al Azaiba KX296907 KX297018 KX297306 KX297381 KX297577

A290 a A. blanfordii Oman 2 km SW. of Suadi Al Batha KX296906 KX297017 KX297305 KX297380 KX297575

A291 a b A. blanfordii UAE Kalba mangroves KX296905 KX297016 KX297304 KX297379 KX297574

Code Species Voucher1 Country Locality 12S cytb MC1R ACM4 c-mos

A109 a b A. boskianus asper MCCI-R471 Algeria Tassili 'n' Ajjer KJ567694 KJ567812 KJ548037 KJ547885 KJ547987

A292 a b A. boskianus asper ZFMK77460 Egypt Rasheed KX296878 KX296995 KX297273 KX297371 KX297557

A171 A. boskianus asper Egypt El Arish, Sinai KJ567676 KJ567776 KJ548044 KJ547854 KJ548003

A167 a A. boskianus asper Egypt Baluza, Sinai KJ567727 KJ567790 KJ548063 KJ547852 KJ548014

A105 a A. boskianus asper MCCI-R1566 Egypt Between SerAit el Khadim to Gebel RaqAa, Sinai KJ567672 KJ567768 KJ548035 KJ547849 KJ547966

A190 a A. boskianus asper Egypt 14 km SW. of Nuweibaa, Sinai KJ567693 KJ567773 KJ548057 KJ547856 KJ547951

A112 a A. boskianus asper MCCI-R1568 Egypt Gebel Gunna, Sinai KJ567690 KJ567771 KJ548038 KJ547851 KJ547950

A170 a A. boskianus asper Egypt St. Catherine, Sinai KJ567751 KJ567772 KJ548043 KJ547853 KJ547964

A111 A. boskianus asper MCCI-R1567 Egypt Crossroad St. Catherine to Fox camp, Sinai KJ567689 KJ567770 KJ548056 KJ547886 KJ547982

A177 a A. boskianus asper Egypt Sharm el Sheikh, Sinai - KJ567774 KJ548047 KJ547855 KJ547965

A168 a b A. boskianus asper Egypt Matruh KJ567728 KJ567824 KJ548042 KJ547910 -

A169 a b A. boskianus asper Egypt Sidi Brani KJ567729 KJ567813 KJ548068 KJ547872 KJ548015

A172 a A. boskianus asper Egypt Wadi El Natrun KJ567699 KJ567822 KJ548079 KJ547887 KJ547986

A120 a A. boskianus asper Egypt 60 km E. of Idfu KJ567698 - KJ548039 KJ547870 KJ547969

A279 a A. boskianus asper TAU.R16058 Israel Wadi Revivim KJ567673 KJ567767 KJ548051 KJ547911 KJ547952

A66 A. boskianus asper TAU.R16160 Israel Shivta junction KJ567671 KJ567765 KJ548033 KJ547879 KJ547949

A282 A. boskianus asper TAU.R16295 Israel Kmehin KJ567682 KJ567780 KJ548053 KJ547932 KJ547954

A64 A. boskianus asper Israel Rotem plain KJ567670 KJ567764 KJ548078 KJ547875 KJ547945

A203 a A. boskianus asper HUJ.R24055 Israel S. of Wadi Zafit KJ567691 KJ567766 - - -

A76 A. boskianus asper TAU.R16274 Israel Mt. Tzin KJ567674 KJ567775 KJ548034 KJ547880 KJ547946

A73 A. boskianus asper TAU.R16013 Israel Mitzpe Ramon KJ567686 KJ567783 KJ548058 KJ547864 KJ547962

A78 a A. boskianus asper TAU.R16001 Israel Mitzpe Ramon KJ567692 KJ567784 KJ548061 KJ547874 KJ547963

A80 A. boskianus asper TAU.R16002 Israel Mitzpe Ramon KJ567687 KJ567785 KJ548060 KJ547865 KJ547957

Code Species Voucher1 Country Locality 12S cytb MC1R ACM4 c-mos

A281 A. boskianus asper TAU.R16272 Israel Wadi Nekarot KJ567681 KJ567779 KJ548052 KJ547892 KJ547953

A206 a A. boskianus asper HUJ.R19646 Israel Paran KJ567677 KJ567787 - - -

A12 A. boskianus asper Israel Wadi Paran KJ567683 KJ567781 KJ548059 KJ547861 KJ547955

A18 A. boskianus asper Israel Wadi Paran KJ567684 KJ567782 KJ548064 KJ547884 KJ547956

A28 a b A. boskianus asper Israel Wadi Paran KJ567685 KJ567789 KJ548028 KJ547862 KJ547960

A191 a b A. boskianus asper Jordan Tell al Heber KJ567733 KJ567830 KJ548067 KJ547883 KJ547974

A233 a A. boskianus asper Jordan Petra KJ567679 KJ567777 KJ548048 KJ547858 KJ547958

A237 A. boskianus asper NMP6V70481-2 Jordan Petra KJ567680 KJ567778 - KJ547881 KJ547959

A238 a A. boskianus asper NMP6V70481-3 Jordan Petra KJ567688 KJ567788 - KJ547908 KJ547961

A113 a A. boskianus asper MCCI-R618 Jordan Petra KJ567675 KJ567786 - - -

A114 a b A. boskianus asper MCCI-R621 Jordan Wadi Ramm KJ567730 KJ567826 - KJ547876 KJ547988

A108 a b A. boskianus asper MCCI-R1452(1) Libya Wadi Mathkendush KJ567736 KJ567805 KJ548036 KJ547850 KJ547967

A173 a A. boskianus asper Mauritania Between Zouerat to Bir Moghrein KJ567710 KJ567807 KJ548045 KJ547894 KJ547983

A174 a b A. boskianus asper Mauritania Between Zouerat to Bir Moghrein KJ567714 KJ567808 KJ548030 KJ547895 KJ547973

A158 a b A. boskianus asper MCCI-R1088(4) Morocco Between Saidia to Moulouya KJ567735 KJ567825 KJ548041 KJ547878 KJ547984

A160 a A. boskianus asper NMP6V74482 Morocco Between Ait-Khoujman to Kerrandou KJ567716 KJ567819 KJ548062 - KJ548001

A161 a b A. boskianus asper NMP6V74483-1 Morocco Rissani KJ567717 KJ567818 KJ548054 KJ547882 KJ547985

A147 A. boskianus asper NMP6V74483-2 Morocco Rissani KJ567715 KJ567817 - - -

A175 a A. boskianus asper Morocco Ouarzazate KJ567718 KJ567820 KJ548046 KJ547897 KJ548002

A234 a A. boskianus asper Morocco 6.5 km E. of Oum El-Alek KJ567711 KJ567810 KJ548049 KJ547898 KJ547976

A235 a b A. boskianus asper Morocco Akka KJ567713 KJ567811 KJ548069 KJ547899 KJ547977

A285 a b A. boskianus asper MVZ:Herp238925 Niger Tafokin, 13 km NNE. of Agadez KJ567701 KJ567823 KJ548086 KJ547860 KJ548000

A115 a A. boskianus asper Oman 2 km S. of Lizq KJ567731 KJ567827 KJ548087 KJ547912 KJ547968

Code Species Voucher1 Country Locality 12S cytb MC1R ACM4 c-mos

A231 a b A. boskianus asper Oman Nizwa KJ567678 KJ567829 KJ548089 KJ547914 KJ547975

A149 a b A. boskianus asper Oman 10 km SE. of Kubarah KJ567732 KJ567828 KJ548088 KJ547913 KJ547971

A117 A. boskianus asper Oman 16 km S. of Duqm KJ567707 KJ567802 KJ548091 KJ547905 KJ547990

A116 A. boskianus asper MCCI-R1773(1) Oman Wadi Salit KJ567706 KJ567801 KJ548090 KJ547903 KJ547989

A159 a b A. boskianus asper MCCI-R1773(2) Oman Wadi Salit KJ567708 KJ567803 KJ548092 KJ547906 KJ547991

A232 a A. boskianus asper Oman 4 km N. of Rawiyyah KJ567709 KJ567804 KJ548093 KJ547904 KJ547992

A293 a A. boskianus asper IBECN866 Oman Miskin KX296879 - KX297274 KX297372 KX297554

A294 a A. boskianus asper IBECN9004 Oman Near Dubai KX296880 KX296996 KX297275 KX297373 KX297555

A148 a b A. boskianus asper Sudan N. of El-Koin KJ567700 KJ567821 KJ548040 KJ547877 KJ547970

A256 a A. boskianus asper NMP6V70450-2 Syria Ar Raqqah KJ567747 KJ567842 KJ548032 KJ547915 KJ548012

A257 a b A. boskianus asper NMP6V70470-1 Syria Ar Raqqah KJ567748 KJ567841 KJ548080 KJ547889 KJ548013

A239 A. boskianus asper NMP6V72502-1 Syria Qasr al Hayr al Gharbi KJ567744 KJ567838 KJ548031 KJ547890 KJ548009

A240 A. boskianus asper NMP6V72502-2 Syria Qasr al Hayr al Gharbi KJ567745 KJ567839 KJ548055 KJ547888 KJ548010

A255 A. boskianus asper NMP6V70443 Syria Sadad KJ567746 KJ567840 - KJ547891 KJ548011

A110 a b A. boskianus asper MCCI-R1326(1) Tunisia NE. slopes of Jebel Semmama KJ567695 KJ567814 KJ548085 KJ547893 KJ548004

A157 A. boskianus asper MCCI-R1326(2) Tunisia NE. slopes of Jebel Semmama KJ567696 KJ567815 - - -

A176 a A. boskianus asper Tunisia Hammat al-Jarid KJ567697 KJ567816 KJ548070 KJ547909 KJ548005

A154 a b A. boskianus asper MCCI-R1346(2) Tunisia 33 km S. of Tataouine KJ567702 KJ567806 KJ548081 KJ547907 KJ547972

A236 a A. boskianus asper Western Sahara Laayoune KJ567712 KJ567809 KJ548050 KJ547896 KJ547978

A156 a b A. boskianus asper MCCI-R823(3) Yemen Sa'yun oasis KJ567705 KJ567800 KJ548066 KJ547902 KJ547981

A106 a A. boskianus asper MCCI-R823(4) Yemen Sa'yun oasis KJ567703 KJ567799 KJ548065 KJ547900 KJ547980

A107 a b A. boskianus asper MCCI-R824 Yemen Dunes W. of Shibam KJ567704 KJ567769 - KJ547901 KJ547979

A295 a b A. boskianus kattensis TR4287 Mauritania Near Akjoujt KX296875 KX296992 KX297270 KX297369 KX297556

Code Species Voucher1 Country Locality 12S cytb MC1R ACM4 c-mos

A296 a A. boskianus kattensis TR4288 Mauritania Near Akjoujt KX296877 KX296993 KX297271 KX297401 KX297552

A297 A. boskianus kattensis TR4289 Mauritania Near Akjoujt KX296876 KX296994 KX297272 KX297370 KX297553

A298 A. boskianus nigeriensis TR1566 Niger Karosofoua - KX296990 - KX297366 KX297550

A299 a A. boskianus nigeriensis TR1567 Niger Karosofoua - KX296991 - KX297367 KX297551

A276 a b A. boueti TR3244 Benin Guiguisso KX296974 KX297186 - KX297542 KX297614

A263 a b A. busacki Morocco 1 km N. of Bou Soun KX296968 KX297170 KX297348 KX297430 KX297626

A269 a A. busacki BEV.10869 Morocco 39 km S. of El Quatia KX296967 KX297168 KX297339 KX297432 KX297646

A270 a b A. busacki BEV.10829 Morocco Akhfennir KX296966 KX297169 KX297332 KX297433 KX297645

A271 A. busacki BEV.9440 Morocco 3 km S. of Ain Nekhla KX296969 KX297171 - - KX297630

A272 A. busacki BEV.9439 Morocco Park Massa, near Sidi Binzarne KX296970 KX297172 KX297349 KX297434 KX297627

A87 a A. busacki MCCI-R560 Morocco Between Inchaden and Tifnite KX296971 KX297173 KX297336 KX297435 KX297636

A88 a A. busacki MCCI-R561 Morocco Souss valley, Biougra KX296972 KX297174 KX297337 KX297436 KX297629

A89 a b A. busacki MCCI-R562 Morocco Souss valley, Biougra KX296973 KX297175 KX297350 KX297437 KX297624

A268 a A. busacki BEV.10877 Western Sahara 104 km NNW. of Dakhla KX296965 KX297167 KX297338 KX297431 KX297644

A178 a A. cantoris Pakistan KX296908 - KX297302 KX297374 KX297592

A286 a b A. cantoris MVZ:Herp248443 Pakistan 10 km S. of Uthal, Las Bela, Baluchistan KJ567756 KJ567850 KJ548096 KJ547922 KJ548018

A287 a A. cantoris MVZ:Herp248447 Pakistan 45 km NW. of Nagar Parkar, Thar Parkar KJ567757 KJ567851 KJ548097 KJ547923 KJ548019

A3 a b A. dumerilii TR4025 Algeria Near Taghit KX296800 KX297052 KX297219 - KX297691

A138 a A. dumerilii Mauritania 15 km NE. of Oued Choum (Adrar) KX296789 KX297043 KX297202 KX297471 KX297658

A181 a A. dumerilii Mauritania 35 km S. of Bennichchab (Inchiri) KX296792 KX297038 KX297197 KX297474 KX297660

A182 a A. dumerilii Mauritania 60 km S. of Zouerat (Tiris Zemmour) KX296784 KX297039 KX297194 KX297475 KX297659

A183 a A. dumerilii Mauritania 65 km S. of Atar (Adrar) KX296785 KX297040 KX297199 KX297478 KX297661

A248 a b A. dumerilii NMP6V74299-1 Morocco Mhamid KX296796 KX297051 KX297213 KX297482 KX297694

Code Species Voucher1 Country Locality 12S cytb MC1R ACM4 c-mos

A249 a b A. dumerilii NMP6V74299-2 Morocco Mhamid KX296795 - KX297214 KX297483 KX297663

A46 a b A. dumerilii IBES1342 Morocco 15 km N. of Merzouga KX296799 KX297053 KX297215 KX297473 KX297727

A300 a b A. dumerilii TR4282 Senegal Saint Louis KX296782 KX297034 KX297192 KX297460 KX297650

A301 a A. dumerilii TR4283 Senegal Saint Louis KX296783 KX297042 KX297193 - KX297651

A140 a A. dumerilii Western Sahara Tifariti KX296790 KX297035 KX297200 KX297529 KX297656

A60 a b A. erythrurus atlanticus IBES2898 Morocco Azrou KX296932 KX297135 KX297318 KX297411 KX297603

A124 a b A. erythrurus belli Morocco Sidi ifni KX296933 KX297136 KX297320 KX297413 KX297604

A56 a b A. erythrurus belli IBES2947 Morocco 3 km N. of Boulaajoul KX296929 KX297132 KX297301 KX297414 KX297597

A61 a b A. erythrurus belli Morocco Jebel Tazekka KX296924 KX297129 KX297319 KX297412 KX297598

A146 a b A. erythrurus belli Morocco Jebala (close to Chefchaouen) KX296923 KX297126 KX297311 KX297407 KX297594

A125 a b A. erythrurus erythrurus Spain Barbate KX296928 KX297127 KX297312 KX297408 KX297601

A126 a b A. erythrurus erythrurus Spain Darrical, Almeria KX296925 KX297128 KX297315 KX297419 KX297602

A162 a b A. felicis Oman Uyun pools KX296888 KX297012 KX297295 KX297394 KX297564

A31 a A. felicis IBES7898 Oman Uyun pools KX296883 KX297011 KX297294 KX297396 KX297573

A163 a A. felicis Oman Mirbat KX296885 KX297008 KX297296 KX297395 KX297565

A164 a A. felicis IBES7473 Oman Mirbat KX296886 KX297010 KX297300 KX297399 KX297569

A165 a A. felicis Oman Mirbat KX296887 KX297009 KX297297 KX297397 KX297566

A30 a b A. felicis IBES7733 Oman Mirbat KX296881 KX297005 KX297293 KX297391 KX297567

A34 a A. felicis Oman Mirbat KX296882 KX297007 KX297299 KX297393 KX297563

A32 A. felicis Oman Mirbat KX296884 KX297006 KX297298 KX297392 KX297568

A197 a A. felicis CAS227596 Oman 23 km W. of Ajdarawt KJ567734 KJ567845 KJ548100 KJ547928 KJ548008

A128 a b A. gongrorhynchatus UAE Al Ain KX296909 KX297125 KX297310 KX297459 KX297586

A192 a A. grandis Jordan Daheek KX296913 - KX297288 KX297375 KX297589

Code Species Voucher1 Country Locality 12S cytb MC1R ACM4 c-mos

A241 a b A. grandis NMP6V70442-1 Syria Sadad KX296918 KX297022 KX297286 KX297377 KX297582

A242 a b A. grandis NMP6V70498-2 Syria 5 km S. of Palmyra KX296914 KX297024 KX297289 KX297402 KX297590

A243 a b A. grandis NMP6V 70499-2 Syria 5 km SW. of Au Kemal KX296915 - KX297290 KX297368 KX297591

A275 a b A. guineensis TR4143 Niger Near Kollo KX296989 KX297178 - - -

A302 a b A. haasi IBECN7491 Oman 88 km NW. of Haime KX296904 KX297030 KX297283 KX297405 KX297584

A122 a A. hardyi NMP6V 71353-2 Jordan E. of Al Hazim - KX297027 - KX297404 KX297579

A123 a b A. hardyi NMP6V 71353-3 Jordan E. of Al Hazim KX296900 KX297028 KX297291 KX297376 KX297580

A247 a b A. hardyi NMP6V 71352 Jordan Batn Al Ghul KX296902 - - - -

A273 a b A. hardyi BEV.11053 Koweït 35 km SW. of Ratqa KX296901 KX297029 KX297292 KX297541 KX297581

A151 a b A. harranensis MCCI-R1057 Turkey Harran KX296919 KX297023 - - -

A129 a b A. lineomaculatus Morocco Tangier KX296926 KX297130 KX297316 KX297409 KX297595

A130 A. lineomaculatus Morocco Tangier KX296927 KX297131 KX297317 KX297410 KX297596

A131 a b A. longipes Algeria Tinduf KX296854 KX297104 KX297257 KX297462 KX297711

A127 a A. longipes Mauritania Oued Choum (Adrar) KX296848 KX297098 KX297243 KX297461 KX297710

A137 A. longipes Mauritania Oued Choum (Adrar) KX296849 KX297099 KX297255 KX297463 KX297723

A139 a A. longipes Mauritania Oued Choum (Adrar) KX296853 KX297100 KX297256 KX297464 KX297724

A185 A. longipes Mauritania 65 km S. of Atar KX296852 KX297102 KX297260 KX297466 KX297726

A179 a b A. longipes Mauritania 55 km SW. of Tidjikja; 25 km S of Lekhcheb KX296850 KX297103 KX297258 KX297465 KX297725

A180 A. longipes Mauritania 55 km SW. of Tidjikja; 25 km S of Lekhcheb KX296851 KX297101 KX297259 KX297484 KX297712

A141 A. maculatus Algeria El Aricha KX296937 KX297137 KX297323 KX297427 KX297615

A142 a b A. maculatus Algeria El Aricha KX296938 KX297138 KX297324 KX297428 KX297623

A259 a b A. maculatus Algeria 25 km SE. of Elbayadh KX296942 KX297145 KX297351 KX297448 KX297643

A91 a b A. maculatus MCCI-R1456 Libya 5 km E. of Al Jawsh KX296951 KX297142 KX297341 KX297458 KX297625

Code Species Voucher1 Country Locality 12S cytb MC1R ACM4 c-mos

A58 a b A. maculatus IBES2958 Morocco 6 km N. of Erfoud KX296952 KX297149 KX297353 KX297457 KX297634

A143 a b A. maculatus Morocco El Aioun KX296940 KX297143 KX297340 KX297442 KX297649

A262 a b A. maculatus BEV.5510 Morocco North shore of Dayet Srji (near Merzouga) KX296953 KX297150 - - KX297635

A49 a b A. maculatus IBES1340 Morocco 10 km N. of Midelt KX296944 KX297147 KX297352 KX297443 KX297631

A52 a A. maculatus IBES2957 Morocco 3 km N. of Boulojou KX296945 KX297148 KX297343 KX297444 KX297632

A90 a A. maculatus MCCI-R1084 Morocco Tafrata plain KX296943 KX297146 - - KX297633

A144 a A. maculatus Tunisia Close to Kasserine KX296946 KX297151 KX297345 KX297429 KX297640

A145 A. maculatus Tunisia Close to Kasserine KX296947 KX297152 KX297347 KX297445 KX297648

A81 a A. maculatus MCCI-R1318(2) Tunisia Sidi Mechrig KX296949 KX297154 KX297333 KX297438 KX297641

A82 A. maculatus MCCI-R1318(1) Tunisia Sidi Mechrig KX296950 KX297155 KX297334 KX297439 KX297642

A48 a A. masirae IBES1765 Oman 3 km N of Dawwah KX296903 KX297015 KX297284 KX297406 KX297593

A63 a A. masirae IBES7643 Oman 20 km E. of Ras Madrakah KJ567753 KJ567849 KJ548095 KJ547925 KJ548017

A50 a b A. masirae Oman 0.5 km E. of Ras Abu Zabil KJ567752 KJ567848 KJ548094 KJ547931 KJ548016

A150 a b A. micropholis NMP6V74175-1 Iran Gahkom, Hormozgan KX296917 KX297026 KX297287 KX297403 KX297588

A67 a b A. micropholis MVZ:Herp248441 Pakistan 8.5 km W. of Bela, Las Bela District, Baluchistan KX296916 KX297025 KX297285 KX297378 KX297587

A25 a b A. opheodurus HUJ.R19189 Israel Timna valley KJ567750 KJ567844 KJ548099 KJ547927 KJ548007

A33 A. opheodurus HUJ.R19190 Israel Timna valley KX296895 KX297002 - KX297398 KX297572

A288 a b A. opheodurus TAU.R16286 Israel Grufit KX296898 KX296999 KX297282 KX297400 KX297560

A69 A. opheodurus TAU.R16157 Israel Grufit KX296899 KX297000 - - -

A79 a A. opheodurus MCCI-R627 Jordan Diseh KJ567749 KJ567843 KJ548098 KJ547926 KJ548006

A193 a A. opheodurus Jordan Daheek KX296893 KX297001 KX297279 KX297389 KX297570

A194 a A. opheodurus Jordan Wisad KX296894 - KX297280 KX297390 KX297571

A303 a b A. opheodurus IBECN809 Oman 5 km NW. of Tawa KX296891 KX296997 KX297276 KX297385 KX297558

Code Species Voucher1 Country Locality 12S cytb MC1R ACM4 c-mos

A35 a A. opheodurus IBEAO145 Oman Thumrayt KX296896 KX297003 KX297278 KX297387 KX297561

A38 a b A. opheodurus Oman Thumrayt KX296897 KX297004 KX297281 KX297388 KX297562

A209 a A. opheodurus UAE Al Ain KX296892 KX296998 KX297277 KX297386 KX297559

A244 a b A. orientalis NMP6V70441-1 Syria Hawwarin KX296979 KX297183 KX297356 KX297424 KX297606

A245 a b A. orientalis NMP6V70489-2 Syria 28 km N. of Palmyra KX296980 KX297184 KX297358 KX297426 KX297607

A246 a b A. orientalis NMP6V70491-1 Syria 5-10 km SW. of Au Kemal KX296981 KX297185 KX297357 KX297425 KX297611

A227 a A. pardalis Egypt KX296934 - - - -

A41 a b A. pardalis HUJ.R18993 Egypt El Nasr KX296935 KX297139 KX297344 KX297440 KX297637

A54 a A. pardalis HUJ.R18994 Egypt El Nasr KX296936 KX297141 KX297335 KX297454 KX297639

A55 a A. pardalis HUJ.R18995 Egypt El Nasr KX296939 KX297140 KX297331 KX297441 KX297638

A264 a A. savignyi Algeria Sidi Mansour, El Makta KX296982 KX297176 KX297321 KX297417 KX297612

A265 a A. savignyi Algeria 7 km W. of Ain El-Turck KX296983 KX297177 KX297322 KX297418 KX297613

A195 a b A. schmidti Jordan Shahbat al Hazim KX296912 KX297021 KX297309 KX297382 KX297578

A51 a b A. schmidti IBES1893 Oman Al-Areesh Desert Camp KX296911 KX297020 KX297308 KX297384 KX297583

A228 a b A. schmidti UAE Sharjah Airport KX296910 KX297019 KX297307 KX297383 KX297576

A198 a b A. schreiberi ataturi MCCI-R1693(1) Turkey Botas KJ567740 KJ567835 KJ548075 KJ547919 KJ547996

A199 A. schreiberi ataturi MCCI-R1693(1) Turkey Botas KJ567741 KJ567836 KJ548076 KJ547918 KJ547997

A70 A. schreiberi schreiberi TAU.R16151 Cyprus Lara bay, Akamas peninsula KJ567737 KJ567831 KJ548071 KJ547916 KJ547993

A289 a b A. schreiberi schreiberi TAU.R16150 Cyprus Lara bay, Akamas peninsula KJ567738 KJ567832 KJ548074 KJ547924 KJ547994

A118 a A. schreiberi schreiberi NMP6V74532 Cyprus 3 km S. of Mersinlik, Famagusta KJ567739 KJ567834 KJ548072 KJ547917 KJ547995

A229 a A. schreiberi schreiberi Cyprus Episkopi KJ567743 KJ567833 KJ548073 KJ547921 KJ547999

A230 a A. schreiberi schreiberi Cyprus Vrysoulles KJ567742 KJ567837 KJ548077 KJ547920 KJ547998

A15 a A. schreiberi syriacus HUJ.R23653 Israel Caesarea sands KJ567719 KJ567791 KJ548025 KJ547866 KJ547937

Code Species Voucher1 Country Locality 12S cytb MC1R ACM4 c-mos

A274 A. schreiberi syriacus HUJ.R23410 Israel Between Hadera and Binyamina KJ567722 KJ567792 - KJ547859 KJ547947

A121 a A. schreiberi syriacus TAU.R16262 Israel Rishon LeZion sands KJ567723 KJ567795 KJ548026 KJ547867 KJ547938

A21 a A. schreiberi syriacus TAU.R16398 Israel Holon sands KJ567724 KJ567798 KJ548027 KJ547873 KJ547942

A57 a b A. schreiberi syriacus TAU.R16407 Israel Holon sands KJ567726 KJ567796 KJ548084 KJ547863 KJ547943

A62 a A. schreiberi syriacus TAU.R16412 Israel Holon sands KJ567725 KJ567797 KJ548029 KJ547871 KJ547944

A4 a A. schreiberi syriacus HUJ.R23986 Israel Nizzanim reserve KJ567666 KJ567760 KJ548024 KJ547847 KJ547935

A5 a b A. schreiberi syriacus HUJ.R23987 Israel Nizzanim reserve KJ567667 KJ567761 KJ548082 KJ547848 KJ547936

A204 A. schreiberi syriacus HUJ.R23321 Israel Ashqelon KJ567668 KJ567762 - KJ547857 KJ547940

A205 A. schreiberi syriacus HUJ.R23331 Israel Ashqelon KJ567669 KJ567763 KJ548083 - KJ547941

A152 a A. schreiberi syriacus MCCI-R925(1) Lebanon Tyre KJ567720 KJ567793 - KJ547868 KJ547948

A153 A. schreiberi syriacus MCCI-R925(2) Lebanon Tyre KJ567721 KJ567794 - KJ547869 KJ547939

A210 a b A. scutellatus audouini Algeria El Aricha KX296805 KX297054 KX297222 KX297479 KX297690

A119 a b A. scutellatus audouini Egypt El Khattara, Aswan KX296812 KX297058 KX297208 KX297491 KX297705

A211 a b A. scutellatus audouini Egypt Ad el Malek, W. Desert KX296809 KX297055 KX297204 KX297485 KX297695

A27 a A. scutellatus audouini Egypt Sitra Oasis KX296810 KX297056 - KX297488 KX297698

A29 a A. scutellatus audouini Egypt Dakhla Oasis KX296811 KX297057 KX297205 KX297516 KX297699

A212 a A. scutellatus scutellatus Egypt Cairo-Alexandria desert road KX296826 KX297076 KX297223 KX297494 KX297665

A213 A. scutellatus scutellatus Egypt Cairo-Alexandria desert road KX296827 KX297077 KX297224 KX297495 KX297666

A214 a A. scutellatus scutellatus Egypt Sinai, 3.5 km NE. of Bir el-Ad KX296832 KX297082 KX297225 KX297498 KX297668

A215 a A. scutellatus scutellatus Egypt 25 km NE. of Ismalia, E. bank of Nile KX296833 KX297083 KX297265 KX297496 KX297669

A216 a A. scutellatus scutellatus Egypt Sinai, 10 km NE. of Bir Qatia KX296834 KX297088 KX297232 KX297499 KX297670

A217 A. scutellatus scutellatus Egypt El Omayed protected area KX296828 KX297080 KX297233 KX297500 KX297683

A218 A. scutellatus scutellatus Egypt Zaraniq, Sinai KX296835 KX297084 KX297226 KX297501 KX297671

Code Species Voucher1 Country Locality 12S cytb MC1R ACM4 c-mos

A220 A. scutellatus scutellatus Egypt Zaraniq, Sinai KX296837 KX297086 KX297234 KX297503 KX297673

A221 A. scutellatus scutellatus Egypt Zaraniq, Sinai KX296838 KX297087 KX297228 KX297512 KX297685

A219 A. scutellatus scutellatus Egypt Sinai, 55 km W. of Zaraniq KX296836 KX297085 KX297227 KX297502 KX297672

A226 a A. scutellatus scutellatus Egypt El Omayed protected area KX296829 KX297081 KX297235 KX297519 KX297674

A24 a A. scutellatus scutellatus IBES3537 Egypt Al-Natroun Road KX296830 KX297078 KX297241 KX297504 KX297667

A26 a A. scutellatus scutellatus IBES3545 Egypt Al-Natroun Road KX296831 KX297079 KX297236 KX297497 KX297684

A11 A. scutellatus scutellatus TAU.R16389 Israel Bir Mashash sands KJ567758 KJ567852 KJ548103 KJ547933 KJ548022

A13 a A. scutellatus scutellatus TAU.R16391 Israel Revivim KX296841 KX297090 KX297229 KX297509 KX297678

A14 a A. scutellatus scutellatus HUJ.R23946 Israel Nativ Ha-Asara sands KX296847 KX297094 - KX297513 KX297676

A20 A. scutellatus scutellatus TAU.R16397 Israel Bir Mashash sands KX296842 KX297091 KX297230 KX297511 KX297679

A42 A. scutellatus scutellatus HUJ.R23473 Israel Nizzanim sands KX296845 KX297096 KX297238 KX297515 KX297680

A44 A. scutellatus scutellatus Israel Holon sands KJ567759 KJ567853 KJ548104 KJ547934 KJ548023

A6 a b A. scutellatus scutellatus TAU.R16410 Israel Holon sands KX296844 KX297095 KX297237 KX297514 KX297677

A65 a A. scutellatus scutellatus Israel Holon sands KX296846 KX297097 KX297239 KX297510 KX297681

A68 A. scutellatus scutellatus Israel Bir Mashash sands KX296843 KX297092 KX297231 KX297518 KX297682

A8 a A. scutellatus scutellatus TAU.R16156 Israel Shivta junction KX296839 KX297089 - - -

A9 a A. scutellatus scutellatus Israel Shivta junction KX296840 KX297093 KX297240 KX297507 KX297675

A100 A. scutellatus audouini MCCI-R1466 Libya Between Erg Ouan Kasa and Erg Murzuq KX296814 KX297064 - - KX297702

A101 a b A. scutellatus audouini MCCI-R1465 Libya 15 km N. of Dirj KX296820 KX297067 KX297212 KX297490 KX297703

A102 a A. scutellatus audouini MCCI-R1467 Libya Between Erg Ouan Kasa and Erg Murzuq KX296815 KX297065 KX297209 KX297505 KX297704

A92 a b A. scutellatus audouini MCCI-R1463 Libya Akakus, Adadh area KX296818 KX297062 KX297206 KX297520 KX297700

A99 a b A. scutellatus audouini MCCI-R1464 Libya Akakus, Awiss area KX296813 KX297063 KX297207 KX297489 KX297701

A304 A. scutellatus audouini MCCI-R1468(1) Libya 50 km N. of Dirj KX296819 KX297066 - - -

Code Species Voucher1 Country Locality 12S cytb MC1R ACM4 c-mos

A222 a A. scutellatus audouini Mauritania 60 km S. of Zouerat (Tiris Zemmour) KX296816 KX297059 KX297210 KX297486 KX297696

A223 a b A. scutellatus audouini Mauritania 60 km S. of Zouerat (Tiris Zemmour) KX296817 KX297061 KX297211 KX297487 KX297697

A224 a b A. scutellatus audouini Morocco KX296793 KX297060 KX297220 KX297480 KX297692

A225 A. scutellatus audouini Morocco S. of Zagora KX296794 - KX297221 KX297481 KX297693

A103 a A. scutellatus audouini MCCI-R1345 Tunisia 2 km SW. of Béni Kheddache KX296806 KX297073 - KX297506 KX297708

A104 a A. scutellatus audouini MCCI-R1348 Tunisia Between Tataouine and Remada KX296808 KX297074 - - -

A83 a A. scutellatus audouini MCCI-R1338(1) Tunisia 2-3 km W. of Zaafrane KX296821 KX297070 KX297216 KX297493 KX297707

A93 a b A. scutellatus audouini MCCI-R1341 Tunisia 29 km E. of Douz KX296824 KX297068 KX297218 KX297517 KX297686

A94 a b A. scutellatus audouini MCCI-R1347 Tunisia 33 km S. of Tataouine KX296807 KX297075 KX297242 KX297508 KX297689

A95 a b A. scutellatus audouini MCCI-R1334(1) Tunisia Between Hazoua and Matrouha KX296822 KX297071 KX297217 KX297492 KX297709

A96 a A. scutellatus audouini MCCI-R1344(1) Tunisia 2 km W. of Béni Keddache KX296825 KX297069 - KX297467 KX297706

A97 a A. scutellatus audouini MCCI-R1332(1) Tunisia Between Nefta and Hazoua KX296823 KX297072 - - -

A186 a A. senegalensis Mauritania Walatah KX296786 KX297044 KX297198 KX297476 KX297657

A187 a b A. senegalensis Mauritania Walatah KX296797 KX297049 KX297203 KX297472 KX297664

A201 a A. senegalensis TR109 Mauritania 50 km SW. of Atar KX296791 KX297041 - - -

A1 a A. senegalensis TR2287 Mauritania 150 km NNW. of Walatah KX296798 KX297050 - - KX297652

A305 a b A. senegalensis TR4284 Senegal Dakar KX296801 KX297045 KX297196 KX297468 KX297655

A306 A. senegalensis TR4285 Senegal Dakar KX296803 KX297046 KX297195 KX297469 KX297653

A307 a A. senegalensis TR4286 Senegal Dakar KX296804 KX297047 KX297201 KX297470 KX297654

A19 a A. senegalensis TR2881 Senegal Sangalcam near Dakar KX296802 KX297048 - - -

A155 a A. senegalensis TR4138 Western Sahara 80 km SE. of Dakhla KX296788 KX297037 - KX297477 KX297662

A202 A. senegalensis TR4095 Western Sahara 80 km SE. of Dakhla KX296787 KX297036 - KX297540 -

A266 A. taghitensis BEV.11659 Algeria 3 km S. of El-Aiodh Sidi Cheikh KX296873 KX297123 KX297268 - KX297687

Code Species Voucher1 Country Locality 12S cytb MC1R ACM4 c-mos

A267 a b A. taghitensis BEV.11658 Algeria 3 km S. of El-Aiodh Sidi Cheikh KX296874 KX297124 KX297269 KX297527 KX297688

A250 a A. tilburyi NMP6V70599 Jordan Al Muddawara (Husn el Mudawwara) KX296889 KX297013 - KX297543 -

A251 a b A. tilburyi NMP6V70868 Jordan Al Muddawara (Husn el Mudawwara) KX296890 KX297014 KX297303 KX297544 KX297585

A196 a b A. tristrami Jordan Al Harir (Near Tafilah) KX296975 KX297179 KX297354 KX297420 KX297605

A252 a b A. tristrami NMP6V70472 Syria 5 km E. of Rashiedeh KX296976 KX297180 KX297355 KX297423 KX297608

A253 A. tristrami NMP6V70515-1 Syria 2-3km E. of Rdemeh Sh´Sharqyieh KX296977 KX297181 KX297359 KX297421 KX297610

A254 A. tristrami NMP6V70515-2 Syria 2-3km E. of Rdemeh Sh´Sharqyieh KX296978 KX297182 KX297360 KX297422 KX297609

M17 Mesalina guttulata Israel 4 km W. to Arad KX296984 KX297187 KX297361 KX297545 KX297735

M18 Mesalina guttulata Israel Hirbet Nizana KX296985 KX297188 KX297362 KX297546 KX297736

M19 Mesalina olivieri Israel Ramat Hovav KX296986 KX297189 KX297363 KX297547 KX297737

M20 Mesalina olivieri Israel Hirbet Mamshit KX296987 KX297191 KX297364 KX297548 KX297738

M21 Mesalina olivieri Israel Ramat Hovav KX296988 KX297190 KX297365 KX297549 KX297739

Gallotia atlantica atlantica Canary Islands Lanzarote AY151915 AY151836 - - AY151999

Gallotia atlantica mahoratae Canary Islands Fuerteventura AY151916 AY151837 - - AY152000

Gallotia caesaris caesaris Canary Islands El Hierro AY151922 AY151843 - - AY152006

Gallotia caesaris gomerae Canary Islands La Gomera AY151921 AY151842 - - AY152005

Gallotia gomerana Canary Islands La Gomera AJ272395 AJ272396 - - -

Gallotia galloti eisentrauti Canary Islands Tenerife AY151918 AY151839 - - AY152002

Gallotia galloti galloti Canary Islands Tenerife AY151919 AY151840 - - AY152003

Gallotia galloti palmae Canary Islands La Palma AY151920 AY151841 - - AY152004

Gallotia intermedia Canary Islands Tenerife AY151923 AY151844 - - AY152007

Gallotia simonyi machadoi Canary Islands El Hierro AY151924 AF101219 - - AY152008

Gallotia stehlini Canary Islands Gran Canaria AY151917 AY151838 - - AY152001

Code Species Voucher1 Country Locality 12S cytb MC1R ACM4 c-mos

Podarcis cretensis Greece Crete - AF486216 - - KF003242

Podarcis cretensis Greece Crete - AF486218 - - KF003244

Podarcis lilfordi Balearic Islands Gymnesic Islands, Menorca EF694766 EF694810 - - EF679323

Podarcis lilfordi Balearic Islands Gymnesic Islands, Cabrera EF694764 EF694805 - - EF679302

Podarcis peloponnesiacus Greece Peloponnese - AY896121 - - KF003245

Podarcis peloponnesiacus Greece Peloponnese - AY896124 - - KF003246

Podarcis pityusensis Balearic Islands Pityusic Islands, Ibiza EF694768 EF694814 - - EF679324

Podarcis pityusensis Balearic Islands Pityusic Islands, Espardell EF694769 EF694815 - - EF679325

Psammodromus algirus AY151914 AY151835 - - AY151998

Psammodromus algirus Morocco S. of Tizi Chika, High Atlas AF080308 AF080309 - - -

1 Abreviations: [BEV] Centre d’Ecologie Fonctionnelle et Evolutive, Montpellier, France; [CAS] California Academy of Sciences, San

Francisco, USA; [HUJ.R] Zoological Museum, Hebrew University of Jerusalem, Israel; [IBE] Institute of Evolutionary Biology, Barcelona,

Spain; [MCCI-R] Museo Civico di Storia Naturale, Carmagnola, Turin, Italy; [MVZ:Herp] Museum of Vertebrate Zoology, University of

California, Berkeley, USA; [NMP6V] National Museum (Natural History), Prague, Czech Republic; [TAU.R] The Steinhardt Museum of

Natural History, Tel Aviv University, Israel; [TR] Private collection of Jean-François Trape, Dakar, Senegal; [ZFMK] Zoologisches

Forschungsmuseum Alexander Koenig, Bonn, Germany.

 

Table S2. Data on the gene fragments used in this study, including their lengths and the primers used (with their orientation, sequences,

references and PCR conditions).

References

Gamble, T., Bauer, A.M., Greenbaum, E., Jackman, T.R., 2008. Evidence of Gondwanan vicariance in an ancient clade of geckos. J. Biogeogr., 35, 88–104.

Godinho, R., Crespo, E.G., Ferrand, N., Harris, D.J., 2005. Phylogeny and evolution of the green lizards, Lacerta spp. (Squamata: Lacertidae) based on mitochondrial and nuclear DNA sequences. Amph. Rept., 26, 271-285.

Kocher, T.D., Thomas, W.K., Meyer, A., Edwards, S.V., Pääbo, S., Villablanca, F.X., Wilson, A.C., 1989. Dynamics of mitochondrial DNA evolution in animals: amplification and sequencing with conserved primers. P. Natl. Acad. Sci. USA, 86, 6196-6200.

Gene Length (bp) Primer Primer sequence (5’-3’) Primer reference PCR conditions

12S ~385 12Sa F: AAACTGGGATTAGATACCCCACTAT Kocher et al. (1989)

94°C (5’), [94°C (30’’), 56°C (45’’), 72°C (1’)] x35, 72°C (5’) 12Sb R: GAGGGTGACGGGCGGTGTGT Kocher et al. (1989)

cytb 405 GludG F: TGACTTGAARAACCAYCGTTG Palumbi (1996)

94°C (5’), [94°C (30’’), 49°C (45’’), 72°C (90’)] x35, 72°C (5’) Cytb2 R: CCCTCAGAATGATATTTGTCCTCA Kocher et al. (1989)

MC1R 663 MC1RF F: AGGCNGCCATYGTCAAGAACCGGAACC Pinho et al. (2009)

94°C (5’), [94°C (30’’), 56°C (45’’), 72°C (80’)] x35, 72°C (5’) MC1RR R: CTCCGRAAGGCRTAAATGATGGGGTCCAC Pinho et al. (2009)

ACM4 429 Tg-F F: CAAGCCTGAGAGCAARAAGG Gamble et al. (2008)

94°C (5’) [94°C (30’’), 56°C (45’’), 72°C (80’)] x35, 72°C (5’) Tg-R R: ACYTGACTCCTGGCAATGCT Gamble et al. (2008)

c-mos 522 Lsc1(Mos-F) F: CTCTGGKGGCTTTGGKKCTGTSTACAAGG Godinho et al. (2005)

94°C (5’), [94°C (30’’), 57°C (45’’), 72°C (70’)] x35, 72°C (5’) Lsc2(Mos-R) R: GGTGATGGCAAANGAGTAGATGTCTGC Godinho et al. (2005)

Palumbi, S., 1996. Nucleic acids II: the polymerase chain reaction. In: D.M. Hillis, C. Moritz, B.K. Mable (Eds.), Molecular Systematics, Sinauer Associates, Sunderland, MA, pp. 205–247.

Pinho, C., Rocha, S., Carvalho, B.M., Lopes, S., Mourao, S., Vallinoto, M., Brunes, T.O., Haddad, C.F.B., Goncalves, H., Sequeira, F., Ferrand, N., 2009. New primers for the amplification and sequencing of nuclear loci in a taxonomically wide set of reptiles and amphibians. Conserv. Genet. Resour., 2(S1), 181–185.

 

Table S3. Data on the phylogenetic, calibration and range reconstruction analyses, including partitions, models and parameters.

Analysis Dataset Partition Length Model Clock model (unlinked) Rate Tree model (linked) Other Priors/Parameters Run Specifications

Phylogenetic trees Maximum Likelihood

mtDNA 12S 379

GTR+G Replicates x100 Bootstrap x1000

cytb 405

Complete

12S 379 cytb 405 MC1R 663 ACM4 429 c-mos 522

Phylogenetic trees Bayesian Inference

mtDNA 12S 379 GTR+I+G Relaxed Uncorrelated Lognormal

Rate fixed to 1 Coalescence Random starting tree

Alpha Uniform (0, 10); Base substitution Uniform (0, 100)

2 runs; 108 generations; 104

sampling frequency; 10% burn-in cytb 405 TrN+I+G Relaxed Uncorrelated Lognormal

Complete

12S 379 GTR+I+G Relaxed Uncorrelated Lognormal

2 runs; 2x108 generations; 2x104

sampling frequency; 10% burn-in

cytb 405 GTR+I+G Relaxed Uncorrelated Lognormal MC1R 663 GTR+I+G Strict clock ACM4 429 GTR+I+G Strict clock c-mos 522 TrN +G Strict clock

Bayesian Inference

mtDNA Haplotypes

12S 385 GTR+I+G Relaxed Uncorrelated Lognormal Rate fixed to 1 Coalescence

Random starting tree Alpha Uniform (0, 10); Base substitution Uniform (0, 100)

2 runs; 108 generations; 104

sampling frequency; 10% burn-in cytb 405 GTR+I+G Relaxed Uncorrelated Lognormal Estimation of divergence times (Geological calibration points)

Complete (Including Gallotia and Podarcis)

12S 381 GTR+I+G Relaxed Uncorrelated Lognormal

Uniform 1 (0-100) Yule Random starting tree

Alpha Uniform (0, 10); Base substitution Uniform (0, 100)

2 runs; 3x108 generations; 3x104

sampling frequency; 10% burn-in

cytb 405 GTR+I+G Relaxed Uncorrelated Lognormal MC1R 663 GTR+I+G Strict clock ACM4 429 GTR+I+G Strict clock c-mos 522 HKY+I+

G Strict clock

Ancestral area reconstruction + Estimation of divergence times (Evolution rates)

Complete (ingroup only)

12S 384 GTR+I+G Relaxed Uncorrelated Lognormal Normal 0.00553-0.00128

Yule Random starting tree Alpha Uniform (0, 10); Base

substitution Uniform (0, 100) 2 runs; 3x108 generations; 3x104

sampling frequency; 10% burn-in

cytb 405 GTR+I+G Relaxed Uncorrelated Lognormal Normal 0.0164-0.00317 MC1R 663 GTR+I+G Strict clock Uniform 0.0001 (0-0.0164) ACM4 429 GTR+I+G Strict clock Uniform 0.0001 (0-0.0164) c-mos 522 TrN+I+G Strict clock Uniform 0.0001 (0-0.0164) Location Symmetric discrete Strict clock Exponential (mean 1; offset 0)

 

A. aegyptius A. arabicus A. aureus A. bedriagai A. beershebensis A. blanci A. blanfordi A. boskianus A. busacki A. boueti A. cantoris A. dumerilii A. erythrurus A. felicis A. gongrorhynchatus A. grandis A. guineensis A. haasi A. hardyi A. harranensis A. lineomaculatus A. longipes A. maculatus A. masirae A. micropholis A. opheodurus A. orientalis A. pardalis A. savignyi A. schmidti A. schreiberi A. scutellatus A. senegalensis A. taghitensis A. tilburyi A. tristramiA. aegyptius 0/1 26,9 17,1 20,8 20,3 23,3 21,6 21,9 21,4 22,1 23,4 15 22,8 20,8 24 20,8 25,1 23 22 21 25,1 10,7 20,7 23,3 20,3 23,7 22,5 20,7 23,4 22 21,9 14 15 18,2 21,9 21,2A. arabicus 13,7 4/7.7 22,6 23,7 23,4 22,1 19,2 19,7 23,6 24,5 19 23,5 22,3 17,2 19,7 20,9 21,9 19,8 17,9 20,6 21,8 25,3 23,6 18,4 20,1 17,8 23,8 23,6 21 18,9 19,6 22,7 23,3 22,5 16,2 23,1A. aureus 9,5 13,9 1.5/3.6 20,9 20 21 17,8 18,7 20,7 21,6 21,1 15,6 21,5 18,6 22,9 18,3 21,2 20,2 20,2 17 23,1 17,2 20,5 20,2 18,5 19,6 22,8 19,7 19,4 18,6 19,7 15,2 15,6 16,2 20,6 21,2A. bedriagai 15,8 18 17 2.6/10.1 9,7 19,8 23,7 22,3 12,6 21,9 24,1 21,5 19,9 22 24,4 22,4 17,8 22,5 20,9 22,5 20,4 20,6 7,1 21 21,2 21,9 22,3 8,5 19,7 22,3 22,4 21,2 21,4 18,1 22,2 21,8A. beershebensis 16 18,2 15,8 4 0.1/0.4 17,9 23,2 22,4 11,2 20,2 24,5 20,4 18,8 22,4 25,6 21,5 18,2 22,9 21,9 22,4 19 20,6 9,9 19,2 21,5 22,4 22,4 8,3 18,4 21,1 22,4 21,1 20,6 17,3 22,7 20A. blanci 14,5 14 13,3 8,7 8,7 0/0.7 22,3 21,4 20,2 22,2 23,6 22,4 13,9 21 23,3 21,6 19,1 23,8 22,3 21,2 13,5 21,9 19,5 20,7 21,6 20,8 21,1 18,8 16,8 21,2 21,1 22,7 22,2 21,5 22 20,2A. blanfordi 13 9,8 13,9 16,5 17,2 13,1 2.6/7.7 17 21,3 20,4 17,5 19,9 21,1 15,9 20,8 18,1 20,2 18,2 16,7 16,8 22,7 20,2 23,2 17,3 16,2 16,2 21,5 22,6 21,3 13,4 17,5 18,7 20,5 20,7 16,6 22,6A. boskianus 13,4 9,3 13 15,9 16,4 13,5 7,2 3.3/7.8 21,7 21,9 18,9 20,1 21,6 15,3 18,9 17,4 19,5 17,7 16 17,6 22,5 19,7 22,1 15,9 15,8 14,7 22,6 21,5 21,8 16,7 9,4 19,3 20,2 18,9 15,9 22,1A. busacki 14,7 16,8 14,9 4,8 5,8 9,1 15 14,3 2.9/6.6 19,7 23,1 20,5 19,1 20,2 24,1 22,4 18,8 21,1 20,6 21,2 18,9 19,1 12,6 18,9 21,5 20,3 20,6 11,2 17,4 20,3 22,1 19,3 20,4 18,5 21,7 20,4A. boueti 16,9 17,1 16,3 11,1 12,1 9,4 16,7 16,2 11,6 n/c 23,8 22,9 21 21,7 23,7 22 20,2 22,7 23 20,2 22,7 22,9 21,9 23,5 22 22,3 21,4 21,1 19,9 22,3 20,6 21,1 22,8 23 23,2 21,3A. cantoris 11 8,8 12,4 16,6 15,5 12 6 6,3 14,7 16,2 0.7/0.7 21,7 23,6 18,2 20,5 19,4 23,1 19,4 17 18,4 24,6 23,2 24,1 16,3 20,6 19 23,7 23,1 21 18,5 20,6 21,6 22,1 23,6 14,9 22,7A. dumerilii 4,9 13 10,1 16,7 16,6 13,9 14,1 13,5 15,5 16,8 12,3 1.5/4.1 22,3 19 23,1 20,6 22,7 22,2 20 19,9 23 14,8 20,8 20,3 19,5 19,5 24,3 19,3 20,7 19,6 20,2 12,1 4,3 16,5 20,6 20,8A. erythrurus 12,9 14,1 13 9,1 9,2 3,8 13,2 13,2 8,9 10,1 12 13,3 3.6/12.1 20,3 22,2 21,6 18 23,2 21,3 22,2 12,1 21,7 20,1 20,7 20,3 20,4 22,8 19 17,8 20,8 21 21,9 22,5 21,9 20,6 20,5A. felicis 14 10,6 13,8 17,6 17,3 15,4 7,8 5,1 15,9 16,6 7,4 14,6 14,5 0.3/0.9 18,6 18,9 19,5 17,1 15,5 17,1 21,8 19 21,7 16,7 16,6 13,6 21,7 21,5 20,8 16,5 15,3 18,4 19,4 18,8 15,3 21,2A. gongrorhynchatus 14,7 10,8 14,7 18,1 18,6 16,4 9,5 9,2 16,3 18,8 9,5 14,8 15,8 10,4 n/c 19 21,5 18 19,4 18 24,2 22,2 24,6 18,5 19,5 18,3 22,4 25,9 20,5 19,6 19,1 21,6 23,3 23,2 16,8 22,2A. grandis 13,4 12,6 16,8 16,1 16,4 16,4 10,6 10,1 15,2 17,6 9,1 14,9 16,1 10,4 11,2 6.1/14.6 22,8 20,1 18,4 8,5 24,3 19,4 22,2 18,8 15,3 17,1 22,6 22 18,7 16,5 17,6 19 20,7 19,4 17 22,2A. guineensis 11,7 16,8 13,5 13,6 14 13,2 15 15,4 13,8 16,8 14,8 12,6 12,6 16,2 16,5 17,3 n/c 18,3 20,4 22,5 20 23,6 18,1 18,7 20,5 18,4 23,1 17,4 19,9 22,3 18,8 21,7 22,1 20 20,5 20,2A. haasi 12,8 9,7 13,6 16,8 16,8 13,8 8,8 7,3 15,1 16,4 7,6 12,4 13,2 7,7 8,9 10,4 15,3 n/c 17,4 18 23,7 20,5 22,3 16,5 19,9 15,1 23 22 21,9 17,6 18,5 20,6 21,3 20,2 15,8 23,7A. hardyi 11,6 10,7 12,6 16,1 17 12,8 7,1 8,5 14,7 16,3 6,4 11,9 12,1 9 9,5 10,7 14,9 7,8 3.3/4 18,8 21,5 19,9 21,1 16,1 18,2 15,5 22,2 21,1 21,8 15,2 17 19,1 20 17,7 14,8 21,2A. harranensis 12,5 12,2 15,6 15,6 16 15,9 10,3 9,3 15,3 17,2 8,9 14,4 15,8 9,7 10,7 6,6 17,1 9,1 9,7 n/c 25,4 19,9 22,6 18,3 15,7 17,6 21,6 23,2 18,5 16 17,5 18,3 19,7 20,2 17,5 20,9A. lineomaculatus 13,5 14,1 13,8 8,7 9,5 3,4 12,8 13 9,1 8,6 12,3 14,1 3,1 14,6 15,9 16,7 12,6 13,3 12,3 16,7 0/0 22,9 20,5 21,4 22,3 21,3 23 18,3 19,3 21,6 22,3 23,9 23,2 22,5 22 21,2A. longipes 2,4 14,6 10,5 15,9 16,3 15,6 14,2 14,2 15,3 17,6 11,4 5,4 14,3 15,2 15,6 14 13 13,5 11,7 12,8 15,3 0.5/1.3 20,6 22,1 19,8 20,7 21,7 20,6 22,4 20 19,9 13,4 14,9 15,9 22,8 22,8A. maculatus 15,8 17,9 16,3 2,5 4,5 9,2 15,9 15,3 5,1 11,4 16,2 16,3 9,2 16,9 17,6 16 13,6 16,3 15,7 15,4 8,9 15,8 3/7.9 20,5 21 21,6 22,2 7,9 19,6 21,8 22,3 20,7 20,9 17,7 21,8 21,6A. masirae 10,9 9,4 11,9 15,7 15,6 12,9 8 7,8 15 16,8 5,6 12,6 13 9,2 10,3 10,7 12,9 8,5 8,7 10,9 12,7 11,1 15,6 0.2/0.3 17,8 16,4 21,8 18,2 19,7 17,6 17,2 21,3 20,7 20,2 13,1 21,3A. micropholis 12,3 11,4 14 17,2 17,5 16,9 10,1 10 16,3 19,3 9,7 14 16,8 10,6 11,6 9,6 17,6 11,3 9,8 9,9 16,7 12,7 17,1 10,7 3.1/6.4 16,5 24 21,9 19,6 15,4 16 19,5 19,8 20,5 15,6 23,7A. opheodurus 12,9 9,7 13 18,2 17,7 14,7 6,7 5,7 16,1 17,4 5,3 14,4 14,7 5,4 9,9 10 16,6 8,3 7,1 9,2 14,5 13,4 17,6 6,9 9,3 1.6/3.9 23,5 19,5 20,1 15,3 14,9 19,7 19,6 19,7 13,5 21,8A. orientalis 13,9 16,4 15,5 12,9 13,9 10,6 14,3 15 12,5 13 14,6 14,6 11,1 16,4 16,4 16,2 14,1 15,7 13,4 14,8 11,3 14,8 12,6 16,1 15 15,3 3.9/9.2 22,3 20,7 21,6 22,1 22,7 24,1 20,6 21,9 16,2A. pardalis 15,4 18,3 16,6 2,4 4,2 9,3 16,2 15,6 4,4 11,5 16,4 16 9,1 17,4 17,4 15,9 13,4 16,7 16,1 14,8 9,1 15,4 2,6 15,5 17,2 18,1 12 0.1/0.2 19,1 21,8 21,8 20,1 19,9 17,5 20,7 20,3A. savignyi 14,8 16,5 14,5 13,1 14,6 10,9 15,5 13,9 12,3 14 14,5 15,6 10,5 15,1 18,1 17,8 13,3 16,1 14,1 16,9 10,3 14,8 12,8 13,8 15,8 15,2 11,3 12,7 0.3/2.2 20,1 21,5 20,6 20,8 21,4 19,5 19,4A. schmidti 13,2 11,1 13,9 16,3 17,5 14,4 5,8 7,6 15,3 17,1 7,5 14,8 13,8 7,5 10,4 11 16,2 9,7 6,7 10,1 13,6 13,3 15,8 8,7 10,6 6,3 15,2 16,2 14,7 3.2/6.9 16,9 19,5 20,2 16,7 16 21,6A. schreiberi 12,8 9,8 12,9 16,3 16,4 13,2 7,4 3,7 14,7 15,8 5,8 13,7 13 5,3 9,3 10,3 15,1 7,7 8,7 9,6 12,8 13,8 15,6 7,7 10,7 5,8 15,2 15,8 14,7 7,4 2.9/7.5 19,3 20,3 18,9 16,9 22,9A. scutellatus 4,5 13,4 10,3 16,8 16,8 14,4 13,6 13,3 15,8 16,7 11,8 4,4 13,2 13,9 14,6 14,3 12,8 12,7 12,2 13,5 13,6 5,5 16,6 11,7 13,5 13,4 14,4 16,1 15,9 13,9 12,9 2.8/7.4 11,7 16,1 20,6 20,8A. senegalensis 4,7 12,9 9,6 16,5 16,2 13,8 13,9 13,3 15,3 16,5 12,2 1,3 13,1 14,2 14,6 14,8 12,4 12,2 11,8 14,5 13,9 5,5 16 12,5 13,8 14,2 14,4 15,8 15,2 14,8 13,4 4,4 0.7/3.9 16,5 21,3 20,7A. taghitensis 9,7 17,1 9,2 19 17,6 17 16,7 15,2 17,6 19,1 14,9 9,6 16,2 16,4 16,1 16,6 15,2 14,4 13,9 15,7 17 9,4 18,5 14,2 15,9 15,9 16,4 18,5 17,4 16,4 15,1 10,5 9,4 0/0 21,2 19,6A. tilburyi 13,8 8,6 14,5 16,5 17,2 15,3 7,3 5,6 14,6 17,6 6,7 13 14,7 6 8,5 9,4 16,2 6,6 8,7 9 15 14,7 16,1 8,8 9,8 7,1 15,9 16,5 15,4 8 6,5 13,4 12,8 16,1 0.3/0 21,7A. tristrami 13,4 16,7 14,3 13,2 13,9 10,3 15,1 15,9 12,8 13,6 14,1 13,7 10,6 17,2 17,2 17,6 12,7 15,7 13,5 16 10,5 14,8 12,6 15,2 16,4 15,8 5,6 12,5 11,1 15,4 16 14,6 13,3 16,6 17 2.1/3.2

Table S4. Pairwise uncorrected genetic divergence (p-distance) among Acanthodactylus taxa, derived from the mitochondrial genes 12S (below the diagonal) and cytb (above the diagonal), and within the taxa (12S/cytb).