original article ﬁc glucose-induced control of insulin ... · cellular sources. calcineurin...

Specific Glucose-Induced Control of Insulin ReceptorSubstrate-2 Expression Is Mediated via Ca2+-DependentCalcineurin/NFAT Signaling in Primary PancreaticIslet b-CellsDamien Demozay,

1Shin Tsunekawa,

1Isabelle Briaud,

2Ramila Shah,

1and Christopher J. Rhodes

1

OBJECTIVE—Insulin receptor substrate-2 (IRS-2) plays anessential role in pancreatic islet b-cells by promoting growthand survival. IRS-2 turnover is rapid in primary b-cells, but itsexpression is highly regulated at the transcriptional level, espe-cially by glucose. The aim was to investigate the molecular mech-anism on how glucose regulates IRS-2 gene expression in b-cells.

RESEARCH DESIGN AND METHODS—Rat islets were ex-posed to inhibitors or subjected to adenoviral vector–mediated genemanipulations and then to glucose-induced IRS-2 expression ana-lyzed by real-time PCR and immunoblotting. Transcription factornuclear factor of activated T cells (NFAT) interaction with IRS-2promoter was analyzed by chromatin immunoprecipitation assayand glucose-induced NFAT translocation by immunohistochemistry.

RESULTS—Glucose-induced IRS-2 expression occurred in pan-creatic islet b-cells in vivo but not in liver. Modulating rat isletb-cell Ca2+ influx with nifedipine or depolarization demonstratedthat glucose-induced IRS-2 gene expression was dependent ona rise in intracellular calcium concentration derived from extra-cellular sources. Calcineurin inhibitors (FK506, cyclosporin A,and a peptide calcineurin inhibitor [CAIN]) abolished glucose-induced IRS-2 mRNA and protein levels, whereas expression ofa constitutively active calcineurin increased them. Specific inhibi-tion of NFAT with the peptide inhibitor VIVIT prevented a glucose-induced IRS-2 transcription. NFATc1 translocation to the nucleusin response to glucose and association of NFATc1 to conservedNFAT binding sites in the IRS-2 promoter were demonstrated.

CONCLUSIONS—The mechanism behind glucose-induced tran-scriptional control of IRS-2 gene expression specific to the isletb-cell is mediated by the Ca2+/calcineurin/NFAT pathway. Thisinsight into the IRS-2 regulation could provide novel therapeuticmeans in type 2 diabetes to maintain an adequate functionalmass. Diabetes 60:2892–2902, 2011

The pancreatic b-cell plays a pivotal role in con-trol of metabolic glucose homeostasis by se-creting insulin in response to elevated glucoseconcentrations. During insulin-resistant states,

such as in obesity, increased b-cell mass and function are

critical to compensate for decreased insulin sensitivity.Failure of the functional b-cell mass to compensate for in-sulin resistance results in the onset of type 2 diabetes (1).As such, there is interest to better understand molecularmechanisms that regulate specific b-cell growth, regen-eration, and/or survival, which could reveal novel meansto maintain a critical functional b-cell mass and avoid theonset of type 2 diabetes (2,3).

It is established that insulin receptor substrate-2 (IRS-2)is required for maintaining an optimal population offunctional b-cells and necessary for the b-cell mass to in-crease in compensation for peripheral insulin resistance(4–6). IRS-2 is a member of the IRS family of proteins,which are adaptor molecules that are tyrosine phosphor-ylated by plasma membrane associated tyrosine kinases(including insulin and insulin growth factor I receptors)(7). This tyrosine phosphorylation leads to downstreamactivation of the phosphatidylinositol 3-kinase (PI3K)/protein kinase B (also known as Akt) pathway and theRas/Raf-1/mitogen-activated protein kinase pathway (7,8).IRS-2 appears to have a uniquely important role in b-cells,playing a part in the control of b-cell growth and, espe-cially, b-cell survival (5,7). This is illustrated when com-paring the phenotypes of IRS-1 versus IRS-2-null mice(4,5). In IRS-1-null mice, there is marked insulin resistance(since without IRS-1, insulin signaling is impaired), but theb-cell mass compensates so that the animals are onlymildly glucose-intolerant. However, in IRS-2-null mice,where there is a similar degree of insulin resistance, theb-cell mass fails to compensate. Indeed, there is a markedloss of b-cells and decreased insulin production that leadsto a severe diabetes state at 10 weeks of age (4). In con-trast, when IRS-2 expression is specifically increased inb-cells, IRS-2 downstream signaling is enhanced, which inturn promotes b-cell survival and maintains an optimalpopulation of functional b-cells to avoid diabetes in vivo(9). As such, there has been interest in whether a means ofincreasing IRS-2 expression in b-cells may have thera-peutic potential to treat type 2 diabetes. However, themolecular mechanisms that control IRS-2 expression inb-cells are relatively ill defined.

The turnover of IRS-2 in b-cells, at both mRNA and pro-tein levels, appears to be relatively rapid in having a half-life of only ;2 h (10). However, to counteract this, IRS-2expression is dynamically regulated in primary pancreaticislet b-cells by physiologically relevant stimuli, especiallyglucose (10,11). Certain peptide hormones, such as glucagon-like peptide 1 (GLP-1), have also been shown to specifi-cally upregulate IRS-2 expression (12) but are glucosedependent (13). As such, glucose is the major regulator ofIRS-2 expression in b-cells. Intriguingly, glucose has been

From the 1Kovler Diabetes Center, Department of Medicine, Section of Endo-crinology, Diabetes and Metabolism, University of Chicago, Chicago, Illi-nois; and the 2Theriac Pharmaceutical Corporation, Seattle, Washington.

Corresponding author: Christopher J. Rhodes, [email protected] 14 March 2011 and accepted 19 August 2011.DOI: 10.2337/db11-0341This article contains Supplementary Data online at http://diabetes

.diabetesjournals.org/lookup/suppl/doi:10.2337/db11-0341/-/DC1.� 2011 by the American Diabetes Association. Readers may use this article as

long as the work is properly cited, the use is educational and not for profit,and the work is not altered. See http://creativecommons.org/licenses/by-nc-nd/3.0/ for details.

See accompanying original article, p. 2883.

2892 DIABETES, VOL. 60, NOVEMBER 2011 diabetes.diabetesjournals.org

ORIGINAL ARTICLE

suggested to play a prominent role in b-cell compensationfor insulin resistance (14,15). But the molecular mecha-nism as to how glucose might control b-cell growth andsurvival remains illusive and is only partly understood(16). Considering the critical role that IRS-2 plays in in-fluencing b-cell mass, glucose regulation of IRS-2 expres-sion in b-cells could be a major factor in maintaining anoptimal functional mass of b-cells to meet the metabolicdemand. Here, we show that specific glucose-inducedincrease in IRS-2 expression in primary islet b-cells is me-diated by a Ca2+-dependent activation of Ca2+/calmodulin-dependent protein phosphatase-2B (or calcineurin) anddephosphorylation activation of the transcription factornuclear factor of activated T cells (NFAT) to drive IRS-2gene transcription. Considering the role that IRS-2 playsin b-cell mass compensation (7), our findings complementrecent observations that calcineurin inhibitors compromiseboth b-cell proliferation (17) and survival (18).

RESEARCH DESIGN AND METHODS

Materials. Nifedipine, FK506, and cyclosporin A (CsA) were purchased fromSigma-Aldrich (St. Louis, MO). Anti–IRS-2 antibody was provided by Dr. M. White(Children’s Hospital and Harvard Medical School, Boston, MA) or purchasedfrom Upstate Biotechnology (Lake Placid, NY). Antibody to the p85 subunit ofPI3K was also purchased from Upstate Biotechnology. Antibody to NFATc1was purchased from BD Biosciences PharMingen (San Jose, CA) and SantaCruz Biotechnology. Adenovirus construct expressing luciferase was generatedas described previously (19). Adenoviruses expressing CAIN peptide (AdV-CAIN) or a constitutively active form of calcineurin (AdV-CNca) were a giftfrom Dr. J.D. Molkentin (Cincinnati Children’s Hospital Medical Center,Cincinnati, OH). Adenovirus expressing peptide VIVIT (AdV-VIVIT) was a giftfrom Dr. C.M. Norris (Lexington, KY). Adenovirus expressing NFATc1 (AdV-NFATc1) was purchased from Seven Hills Bioreagents (Cincinnati, OH).Animals and pancreatic islet isolation.Male Wistar rats and C57Bl6/6J micewere obtained from Charles River Laboratories (Wilmington, MA). All animalcare, use, and experiment protocols were approved by the Institutional Animaland Use Committee of the University of Chicago. Rodent pancreatic islets wereisolated by collagenase digestion and Histopaque density gradient centrifu-gation as described (20). For the in vivo studies, where efficient tissue har-vesting was an issue, the technique was modified. Preparation and excision ofthe pancreas was conducted first; the liver was then flushed through withbuffer in situ, and the lobes were excised. Islets were isolated from thepancreas by collagenase digestion (20) but with a shorter density gradientcentrifugation (# 10 min) to save time. Islets were then handpicked fromthe density gradient interface as described (20). From the time of death, ittook ~12–15 min to harvest the liver and around 25 min to isolate sufficientpancreatic islets (;100) for subsequent immunoblot analysis of IRS-2 ex-pression. As such, for liver there is ;15-min delay and for islets an ;25–30-mindelay, after the time points on the glucose/saline tolerance test. For in vitrostudies, isolated islets were incubated in RPMI 1640 medium containing3 mmol/L glucose and 0.1% fatty acid–free bovine serum albumin and at 37°C,in 5% CO2, for 16 h before the experiment. For adenovirus infection, dis-persed islet cells were obtained using trypsin and DNase to obtain isletmonolayer.Intraperitoneal glucose tolerance test. The C57Blk6/6J mice were fastedfor 16 h before intraperitoneal glucose injection at a concentration of 2 mgglucose/g body wt. Blood glucose was measured at indicated time points usingan AccuChek Compact Plus glucometer (Roche).Cell culture. The pancreatic b-cell line INS-1 was maintained as previouslydefined (21).Real-time fluorescence-based reverse transcription. Total RNA was iso-lated using an RNeasy Plus Mini Kit from Qiagen (Valencia, CA) and quantifiedusing Spectrophotometer Nanodrop 2000 (Thermo Scientific). RNA (40 ng) wassubmitted to the Power SYBR Green RNA-to-Ct 1 step kit (Applied Biosystems)using a ABI Prism 7700 Sequence Detector System according to the manu-facturer’s instructions. Oligonucleotide primers used are: IRS-2, reverse,

FIG. 1. Specific glucose-induced regulation of IRS-2 expression inpancreatic islets, but not in hepatocytes in vivo. Normal C57Blk6/6Jmice (aged 12 weeks) were fasted overnight and then subjected to anintraperitoneal glucose tolerance test (2 mg/g body wt) or using salineas a control as described (42). Pancreatic islets were isolated, anda liver biopsy was conducted at the 2- and 4-h time point and thensubjected to immunoblot (IB) analysis for IRS-2 protein expressionrelative to PI3K(p85) as a loading control. A: Excursion in circulatingglucose in the mice after a glucose (●) or saline (○) injection.A mean 6 SE is shown (n ‡ 3). B and C: Example IB analyses of IRS-2and PI3K(p85) in islets (B) and liver (C) from saline (S)- or glucose(G)-treated mice at 2 or 4 h are shown from two separate experiments.A quantification of a series of experiments is also depicted, where gray

bars are S- and black bars are G-treated animals. Data are a mean 6 SE(n = 3), where * indicates statistically significant difference (P £ 0.05)from the equivalent saline control.

D. DEMOZAY AND ASSOCIATES

diabetes.diabetesjournals.org DIABETES, VOL. 60, NOVEMBER 2011 2893

FIG. 2. Glucose regulation of IRS-2 expression in b-cells is dependent on increased cytosolic [Ca2+]i flux. Isolated rat pancreatic islets were

cultured overnight at normal 5.6 mmol/L glucose and then incubated at either basal 3 mmol/L (gray bars) or stimulatory 15 mmol/L (black bars)glucose concentration for 6 h in presence or absence of either the voltage-sensitive L-type Ca

2+-channel inhibitor nifedipine (50 mmol/L) (A and B)

or KCl to depolarize b-cells (30 mmol/L) (C and D). A and C: IRS-2 and b-actin (internal reference control) mRNA expression levels weremeasured by real-time fluorescence-based quantitative RT-PCR. The data are shown as a mean 6 SE above basal 3 mmol/L glucose control, where* indicates statistically significant difference (P £ 0.05) at 15 mmol/L glucose in the presence of nifedipine or KCl versus control (n ‡ 4). B andD: IRS-2 and PI3K(p85) (control) protein expression levels were analyzed by immunoblotting. Example immunoblots (IBs) are shown. Quanti-tative measurements are also shown as a mean 6 SE, where * indicates statistically significant increase at 15 mmol/L glucose compared with basal3 mmol/L glucose control, ** indicates statistically significant inhibition in the presence of nifedipine at 15 mmol/L glucose, and *** indicatesstatistically significant potentiation by KCl relative to the equivalent glucose concentration in the absence of KCl (P £ 0.05; n ‡ 4).

Ca/CALCINEURIN/NFAT CONTROL OF IRS-2 EXPRESSION


TTTCCTGAGAGAGACGTTTTCCA, forward, CCCCAGTGTCCCCATCCT; andb-actin, reverse, GGGGTGTTGAAGGTCTCAAA, and forward, TGTCAC-CAACTGGGACGATA. Results are shown relative to b-actin (control) mRNA.Nuclear extracts. Nuclear extracts were prepared as described by Schreiberet al. (22). In brief, islets were lysed in a hypotonic buffer containing proteasesinhibitors and 0.6% (v/v) Nonidet P-40 (NP-40). The lysates were centrifuged,and the pellets were rocked at 4°C in a high salt buffer. After centrifugation,supernatants containing nuclear proteins were collected.Immunoblot analysis. Immunoblots were performed on cell lysates fromisolated rat islets or INS-1 cells as described previously (10).Chromatin immunoprecipitation assay. Chromatin immunoprecipitation(ChIP) assay was performed using the ChIP-IT Express kit (Active Motif,Carlsbad, CA). In brief, INS-1 cells were grown and then infected with variousadenovirus constructs as indicated. Chromatin was fixed in 1% (v/v) formal-dehyde for 10 min before cell lysis. Nuclear pellets were extracted and thensheared by sonication using the Bioruptor UCD-200 from Diagenode Inc.(Sparta, NJ). DNA concentration from each condition was measured, and 75 mgof DNA were immunoprecipitated overnight at 4°C with an antibody toNFATc1 or Mouse IgG as a control, together with protein G-coated magneticbeads. Magnetic beads were washed three times, and DNA-protein complexeswere then eluted and reversed cross-link. Both DNA isolated from ChIP andinput corresponding to DNA aliquot not submitted to immunoprecipitationwere analyzed by PCR using five different primer pairs (Supplementary Table 1).Immunofluorescent analysis. INS-1 pancreatic b-cells were cultured onglass coverslips, and after incubation at 3 mmol/L glucose or 15 mmol/L glu-cose 6 FK506 (10 mmol/L) were washed with ice-cold PBS, fixed in 4% (v/v)paraformaldehyde/PBS for 15 min at 4°C, washed three times in PBS, and thenpermeabilized with 0.3% (v/v) Triton X-100/PBS for 30 min at room tempera-ture. Cells were then incubated with 10% donkey serum/PBS for 1 h at roomtemperature, before incubation with antibodies to NFATc1, or to insulin(Millipore, Billerica, MA) for 16 h at 4°C. Cells were then washed three timesin PBS before incubation with anti-mouse or anti–guinea pig antibodies for 1 hat room temperature. For nuclear staining, cells were mounted with a reagentcontaining DAPI (Invitrogen, Carlsbad, CA). Slides were analyzed using con-focal microscopy.Statistical analysis. Data are presented as means 6 SE. Statistical analysisbetween groups was performed using Student t test, where P # 0.05 wasconsidered statistically significant.

RESULTS

Specific glucose-induced regulation of IRS-2 expressionin pancreatic islets but not in hepatocytes in vivo. It hasbeen shown previously that glucose can specifically increaseIRS-2 expression in islet b-cells in vitro, predominately at thetranscriptional level (10). Here, normal mice were subjectedto an intraperitoneal glucose tolerance test using a dose of2 mg glucose/g body wt or saline as a control whereexcursions in blood glucose were indicated (Fig. 1A). Inislets isolated at 2 h, and more so at 4 h, after the in-troduction of glucose, IRS-2 protein levels were specifi-cally increased compared with saline-injected controls(Fig. 1B), complementary to previous in vitro observations(10,11). However, in parallel experiments, no increase inIRS-2 expression was found in the liver (Fig. 1C), suggestingthat glucose regulation of IRS-2 expression may be uniqueto pancreatic b-cells.Glucose regulation of IRS-2 expression in b-cells isdependent on increased cytosolic [Ca

2+]i flux. It has

been indicated previously that control of glucose-inducedIRS-2 expression in b-cells is likely Ca2+ dependent (10). Itwas investigated whether this Ca2+ dependency was basedon an influx of extracellular Ca2+. Specifically, blockingL-type voltage-dependent Ca2+ channels (L-type VDCCs) inisolated rat islets with the inhibitor nifedipine had littleeffect on basal IRS-2 expression at 3 mmol/L glucose, butprevented a 15 mmol/L glucose-induced specific increasein the expression of IRS-2 mRNA (P # 0.05) (Fig. 2A) andprotein (P # 0.05) (Fig. 2B). The L-type VDCCs in b-cellscan be opened via a depolarization of the plasma mem-brane (23). Depolarization of primary islet b-cells in vitro,by addition of 30 mmol/L KCl, resulted in a significant

increase in IRS-2 mRNA (Fig. 2C) and protein (Fig. 2D) atbasal 3 mmol/L glucose and further increased IRS-2 mRNAand protein expression levels at a stimulatory 15 mmol/Lglucose relative to control islets. Collectively, these dataindicate that a glucose-induced increase in b-cell cytosolicintracellular calcium concentration ([Ca2+]i) flux via de-polarization and subsequent opening of L-type VDCCs isrequired for glucose-induced increases in IRS-2 expressionin b-cells.Glucose regulation of IRS-2 expression in b-cells ismediated by calcineurin. A potential downstream targetthat responds to a rise in cytosolic [Ca2+]i in b-cells is theCa2+/calmodulin-dependent phosphoprotein phosphatase-2B (or calcineurin) (24,25). To assess whether calcineurinwas involved in specific glucose regulation of IRS-2 ex-pression, we used two immunosuppressive drugs, FK506(also named tacrolimus) and CsA that specifically inhibitcalcineurin activity (26). In the presence of FK506, glucose-induced IRS-2 mRNA and protein levels were significantlyinhibited by ;90% in rat islets (P # 0.05) (Fig. 3A and B).Likewise, CsA blocked glucose-induced IRS-2 proteinlevels compared with control rat islets (P # 0.05) (Fig. 2C).It is noteworthy that neither FK506 nor CsA significantlyaffected islet IRS-2 mRNA or protein expression levelsat basal 3 mmol/L glucose (Fig. 3A–C), indicating thatcalcineurin only mediated glucose-induced regulation ofIRS-2 expression in islet b-cells. An alternative, morespecific, inhibition of calcineurin was examined usingrecombinant adenovirus (AdV-CAIN), which expresses anendogenous peptide inhibitor of calcineurin activity (CAIN)(25,27). In AdV-CAIN–infected rat islets, glucose-inducedIRS-2 mRNA and protein expression were significantlyinhibited $90% (P # 0.05) compared with control isletsinfected with a recombinant adenovirus expressing Fireflyluciferase (AdV-FLuc) (Fig. 3D and E). There was no ap-parent effect on IRS-2 mRNA or protein expression byinhibiting calcineurin with AdV-CAIN at basal 3 mmol/Lglucose (Fig. 3D and E). Islets were also infected witha recombinant adenovirus expressing a constitutively acti-vated variant of calcineurin (AdV-CNCa). In AdV-CNca–infected islets there was a significant increase in IRS-2mRNA and protein expression at basal 3 mmol/L glucosethat was further augmented at a stimulatory 15 mmol/Lglucose concentration compared with AdV-FLuc–infectedcontrol islets (Fig. 3F and G). Collectively, these data showthat calcineurin is required to control glucose-induced IRS-2expression in rat islets.Glucose regulation of IRS-2 expression in b-cells ismediated by NFAT. The NFAT family of transcriptionfactors is known to be activated by the Ca2+/calcineurinpathway (28). To assess whether NFAT plays a role in IRS-2expression, AdV-VIVIT, a synthetic peptide preventingNFAT activation by calcineurin without affecting phospha-tase activity of calcineurin, was used (29). In AdV-VIVIT–infected rat islets the specific glucose-induced increase inIRS-2 mRNA levels was significantly decreased by ;75%compared with control AdV-FLuc–infected islets (P # 0.05)(Fig. 4A). Likewise, the glucose-induced increase in IRS-2protein levels was effectively blocked in AdV-VIVIT–infected rat islets compared with AdV-FLuc–infectedcontrol islets (P # 0.05) (Fig. 4B). VIVIT had no effect onIRS-2 mRNA or protein levels at basal 3 mmol/L glucose(Fig. 4A and B), indicating that this was specific for glucose-induced regulation of IRS-2 mRNA/protein expression inislet b-cells. To further investigate NFAT-mediated controlof IRS-2 expression, the effect of increasing ectopic



FIG. 3. Glucose regulation of IRS-2 expression in b-cells is mediated by calcineurin. Isolated rat pancreatic islets were cultured overnight atnormal 5.6 mmol/L glucose and then incubated at either basal 3 mmol/L or stimulatory 15 mmol/L glucose concentration for 6 h in presence orabsence of calcineurin inhibitors FK506 (10 mmol/L) (A and B) or CsA (10 mmol/L) (C). A: IRS-2 and b-actin (internal reference control) mRNAexpression levels were measured by real-time fluorescence-based quantitative RT-PCR. B and C: IRS-2 and PI3K(p85) (control) protein ex-pression levels were analyzed by immunoblotting, where an example immunoblot (IB) is shown. Quantitative measurements are also shown asa mean 6 SE above basal 3 mmol/L glucose control, where * indicates a statistically significant increase at 15 mmol/L glucose and ** indicatesa statistically significant difference at 15 mmol/L glucose in the presence of FK506 or CsA versus control (P £ 0.05; n ‡ 4) (A–C). Isolated ratpancreatic islets were also infected with a recombinant AdV-CAIN (D and E), AdV-CNca (F and G), or AdV-FLuc and cultured overnight at normal



expression of NFATc1 isoform on IRS-2 expression in ratislets using an adenovirus AdV-NFATc1 was examined. InAdV-NFATc1–infected INS-1 cells (Fig. 5A) and rat islets(Fig. 5C), there was an approximate twofold increase inspecific IRS-2 mRNA expression at basal 3 mmol/L glu-cose compared with respective AdV-FLuc–infected controlINS-1 or rat islets (P # 0.05), which was further enhancedat 15 mmol/L glucose (Fig. 5A and C). A complementaryincrease in IRS-2 protein expression was observed at basal3 mmol/L glucose in AdV-NFATc1–infected INS-1 cells (Fig.5B) and rat islets (Fig. 5D) compared relative to AdV-FLuc–infected control rat islets. Taken together, these resultsdemonstrate that NFATc1 is implicated in the regulation ofglucose-induced IRS-2 expression in b-cells.NFATc1 binds to rat IRS-2 gene promoter in b-cells.NFAT transcription factors bind to a consensus sequence(GGAAA) in target genes promoter to transactivate geneexpression. Bioinformatic analysis of the first 3,020 bp ofrat IRS-2 promoter (using a basic local alignment searchtool [BLAST] search) indicated the presence of nine po-tential NFAT binding consensus sequences (Fig. 6A). Totest whether NFATc1 binds to these consensus sequences,we conducted a ChIP assay using chromatin from INS-1b-cells expressing NFATc1 or FLuc as a control, using AdV-NFATc1 and AdV-FLuc, respectively. Oligonucleotide DNAprimers (Supplementary Fig. 1) were used to amplify spe-cific regions containing NFAT binding sites on the IRS-2promoter as indicated: sites A, sites B and C together, site D,site E, or sites F through to I together (Fig. 6A). SignificantNFATc1 binding to sequences containing NFAT bindingsites A, B/C, and D in the IRS-2 promoter was increasedin AdV-NFATc1–infected cells compared with AdV-FLuc–infected control cells (P# 0.05) (Fig. 6B and C). This bindingwas specific for NFATc1, since nothing was detected inrabbit IgG immunoprecipitated controls (Fig. 6B). Theseresults suggest that the four NFAT consensus binding se-quences proximal to the transcriptional start site on theendogenous IRS-2 promoter (sites A–D) are indeed bindingsites for NFATc1 to control IRS-2 expression. The putativeNFAT binding motifs more distal to the transcriptional startsite on the IRS-2 promoter (sites E–I) (Fig. 6A) are notspecifically recognized by NFATc1. Intriguingly, the NFATbinding sites A and D in the IRS-2 promoter are highlyconserved across mammalian species, including human(Supplementary Fig. 1).Glucose induces NFATc1 translocation from cytosolto nucleus in b-cells. NFAT activity is tightly regulatedby calcineurin, which induces its activation by dephos-phorylation, leading to NFAT translocation from the cytosolto the nucleus (30). By contrast, phosphorylated NFAT hasnegligible transcriptional activity and is retained in the cy-tosol. It was found that a 15 mmol/L stimulatory glucoseconcentration caused specific accumulation of NFATc1 tothe nucleus of isolated rat islets and INS-1 cells, and thisglucose-induced translocation of NFATc1 to the nucleus wasprevented in the presence of FK506 (Fig. 7A and B). In com-plementary experiments in INS-1 cells, immunofluorescentstaining of NFATc1 revealed that NFATc1 was mainly

localized in the cytosolic compartment at basal 3 mmol/Lglucose (Fig. 7C). In contrast, NFATc1 was mostly localizedin the nucleus at 15 mmol/L stimulatory glucose concen-tration (Fig. 7C). Moreover, this glucose-induced trans-location of NFATc1 from the cytosol to the nucleus ofINS-1 cells was completely blocked in the presence ofFK506 (Fig. 7C). Collectively, these data indicate that15 mmol/L stimulatory glucose induces the translocationof NFATc1 from the cytosolic compartment to the nucleusof islet b-cell in a calcineurin-dependent manner.

DISCUSSION

Pancreatic b-cells are highly regulated by certain nutrients,peptide hormones, neurotransmitters, and pharmacologi-cal compounds, but the most physiologically relevant ofthese is glucose (31). Glucose metabolism is required togenerate secondary signals that in turn control many of thenormal functions of b-cells including insulin secretion,(pro)insulin production, adaptive b-cell growth, and sur-vival (31). IRS-2 also is key to b-cell survival and com-pensatory growth in response to an increased metabolicload (4,6,7). IRS-2 turns over relatively rapidly in b-cells(10), but this is compensated for by IRS-2 expression beinghighly regulated at the transcriptional level, especially byglucose (10) and a glucose-dependent potentiation byincretins like GLP-1 (12). This glucose-mediated regulationof IRS-2 expression in islet b-cells occurs in vivo and ispossibly unique to b-cells, since it is not found in othernutrient-sensing organs such as the liver (Fig. 1).

Here we show that the mechanism behind specific glucose-induced transcriptional regulation of IRS-2 expression inpancreatic b-cells (10) is predominately mediated by aCa2+/calcineurin/NFAT signaling pathway. It is well estab-lished that an elevation in circulating blood glucose leads toincreased b-cell glucose metabolism, which then raises theATP-to-ADP ratio. This results in closing ATP-sensitiveK+ channels, depolarization of the b-cell plasma membrane,opening of voltage-sensitive L-type Ca2+ channels, and aninflux of Ca2+ into the b-cell that rapidly raises cytosolic[Ca2+]i (32). This is the principal signaling mechanism thatleads to triggering insulin secretion from b-cells in responseto elevated glucose (33,34). However, increased cytosolic[Ca2+]i can also activate other signal transduction pathwaysin b-cells, including the Ca2+/calmodulin-dependent activa-tion of calcineurin (also known as protein phosphatase-2B).There are two isoforms of calcineurin, but only the b-isoformof calcineurin is expressed in pancreatic islet b-cells (25).Once calcineurin-b is activated in b-cells, it can dephos-phorylate NFAT transcription factors, which are thenactivated and translocate from the cytosol to the nucleuswhere they bind to consensus NFAT binding elements(GGAAA) on certain gene promoters to specifically enhancetheir transcription (28). Here, glucose-induced increasesin b-cell IRS-2 mRNA were paralleled by a complementaryincrease in IRS-2 protein levels, reaffirming this regulationwas mediated at the transcriptional level (10). Moreover,our data are consistent with Ca2+/calcineurin/NFAT

5.6 mmol/L glucose. Afterward, the adenovirally infected islets were then incubated at either basal 3 mmol/L or stimulatory 15 mmol/L glucoseconcentration for 6 h. D and F: IRS-2 and b-actin (internal reference control) mRNA expression levels were measured by real-time fluorescence-based quantitative RT-PCR. E and G: IRS-2 and PI3K(p85) (control) protein expression levels were analyzed by immunoblotting, where an ex-ample immunoblot is shown. The data are shown as a mean 6 SE above basal 3 mmol/L glucose control, where * indicates a statistically significantincrease at 15 mmol/L glucose above basal 3 mmol/L glucose, ** indicates a statistically significant inhibition with AdV-CAIN versus AdV-FLuc–infected control islets at 15 mmol/L glucose, and *** indicates a statistically significant increase in AdV-CNca–infected versus AdV-FLuc–infectedcontrol islets at the respective 3 and 15 mmol/L glucose concentrations (P £ 0.05; n ‡ 4) (D–G).



signaling being required for specific glucose-induced in-crease in IRS-2 expression in b-cells. Depolarization of theb-cell enhanced islet b-cell IRS-2 mRNA/protein expres-sion, whereas blocking the rise in b-cell cytosolic [Ca2+]iwith voltage-sensitive L-type Ca2+-channel inhibitors pre-vented the glucose-induced increase in IRS-2 mRNA/pro-tein expression. Calcineurin inhibitors (FK506, CsA, andCAIN) specifically prevented glucose-induced increase inIRS-2 mRNA/protein expression and, in contrast, a consti-tutively activated calcineurin variant increased islet b-cellIRS-2 mRNA/protein expression. Calcineurin inhibitors alsoprevented a glucose-induced translocation of NFAT fromthe b-cell cytosol to the nucleus. Inhibition of NFAT byVIVIT prevented the specific increase in b-cell IRS-2 mRNA/protein expression by glucose, and adenoviral-mediatedincrease in NFATc1 expression enhanced islet b-cell IRS-2 mRNA/protein expression. NFATc1 was also shown tospecifically associate to certain NFAT binding elements inthe b-cell endogenous IRS-2 promoter, proximal to thetranscriptional start site.

Specific inhibition of Ca2+ influx, calcineurin, and/orNFAT activation had minimal effect on IRS-2 mRNA/proteinexpression at basal 3 mmol/L glucose, despite effectivelyblocking glucose-induced IRS-2 expression in islet b-cells.But because a need for b-cell glucose metabolism wasbypassed, such as causing depolarization of the b-cell,expression of activated calcineurin, or forced expressionof NFATc1, an increased expression of IRS-2 mRNA/proteinat basal 3 mmol/L glucose could be observed. However,under normal circumstances glucose does not control basalIRS-2 expression. Indeed, we have also shown that basalIRS-2 expression in b-cells is independent of glucose andmostly controlled by forkhead box class O (FoxO) tran-scription factors (35). The Ca2+/calcineurin/NFAT signalingis only directed at glucose-induced control of IRS-2 ex-pression in b-cells. This has important implications forthe glucose-dependent aspect of GLP-1–mediated tran-scriptional regulation of IRS-2 expression in b-cells via thecAMP-response element binding protein (CREB) (12). TheCREB transcription factor interacts with CREB-regulatedtranscriptional coactivator-1 (CRTC-1), which is also acti-vated by Ca2+/calcineurin–mediated dephosphorylation (36).Thus Ca2+/calcineurin can coordinate CRTC-1/CREB acti-vation, in parallel to that for NFAT, rendering the glucose-dependent aspect for potentiating IRS-2 expression inb-cells by incretins, such as GLP-1 (13).

We have found that NFATc1 can specifically associate toconserved NFAT binding elements in the IRS-2 promoter.However, it should be noted that NFATc1 was used only asa model member of the NFAT family of transcription fac-tors to implicate Ca2+/calcineurin/NFAT signaling in glucose-induced control of IRS-2 expression in b-cells. AlthoughNFATc1 has been implicated in glucose-mediated tran-scriptional control of important b-cell genes, such as Pdx-1,glucokinase, and insulin (17,37), it cannot be ruled out thatother NFAT isoforms are involved in glucose-induced regu-lation of b-cell IRS-2 gene transcription. Moreover, NFAT-mediated control of IRS-2 gene transcription is likely to becomplex and require additional trans-acting factor partnersto help efficiently drive IRS-2 gene transcription, which

FIG. 4. Glucose regulation of IRS-2 expression in b-cells is decreasedwhen NFAT is specifically inhibited. Isolated rat pancreatic islets wereinfected with a recombinant adenovirus expressing a specific peptideinhibitor of NFAT, AdV-VIVIT, or with AdV-FLuc and cultured overnightat normal 5.6 mmol/L glucose. Afterward, the adenovirally infectedislets were then incubated at either basal 3 mmol/L or stimulatory 15mmol/L glucose concentration for 6 h. A: IRS-2 and b-actin (internalreference control) mRNA expression levels were measured by real-timefluorescence-based quantitative RT-PCR. B: IRS-2 and PI3K(p85)(control) protein expression levels were analyzed by immunoblotting,where an example immunoblot (IB) and quantitative measurements areshown. The data are shown as a mean 6 SE above basal 3 mmol/L

glucose control, where * indicates a statistically significant increaseat 15 mmol/L glucose above basal 3 mmol/L glucose and ** indicatesstatistically significant decrease at 15 mmol/L glucose in AdV-VIVIT–infected versus AdV-FLuc–infected control islets (P £ 0.05; n ‡ 4)(A and B).



may include activation protein-1 (AP-1), CCAAT-enhancer–binding protein (C/EBP), myocyte enhancer factor-2 (MEF2),musculoaponeurotic fibrosarcoma oncogene homolog A(MafA), or peroxisome proliferator–activated receptor-g(PPARg) (30). However, very few NFAT transcriptionalpartners have been described in islet b-cells, and addi-tional experimentation will be required to identify whichare the key NFAT coactivators required for glucose-inducedcontrol of IRS-2 expression specific to b-cells.

The Ca2+/calcineurin/NFAT signaling in islet b-cells hasbeen implicated to be important for b-cell survival, atleast in part, via control of IRS-2 expression (18). Here,we show that Ca2+/calcineurin/NFAT activation is requiredfor the glucose-induced increases in IRS-2 expression inb-cells that correlates with previous observations wherenormal physiological fluctuations in glucose have positiveeffects on b-cell survival (38). In addition, Ca2+/calcineurin/NFAT signaling has been implicated as an important

FIG. 5. Glucose regulation of IRS-2 expression in b-cells is enhanced by increased expression of NFATc1. INS-1 b-cells (A and C) or isolated ratpancreatic islets (B and D) were infected with AdV-NFATc1 or with AdV-FLuc and cultured overnight at normal 5.6 mmol/L glucose. Afterward, theadenovirally infected INS-1 b-cells or islets were then incubated at either basal 3 mmol/L or stimulatory 15 mmol/L glucose concentration for 6 h.A and C: IRS-2 and b-actin (internal reference control) mRNA expression levels were measured by real-time fluorescence-based quantitative RT-PCR. The data are shown as a mean 6 SE, where * indicates a statistically significant increase at 15 mmol/L glucose above basal 3 mmol/L glucoseand ** indicates a significant increase in AdV-NFATc1–infected islets versus AdV-FLuc–infected control islets at respective glucose concentrations(P £ 0.05; n ‡ 4). B and D: IRS-2 and PI3K(p85) (control) protein expression levels were analyzed by immunoblotting, where example immunoblots(IBs) are shown. Quantified data are also shown as a mean 6 SE, where * indicates a statistically significant increase at 15 mmol/L glucose abovebasal 3 mmol/L glucose and ** indicates a significant increase in AdV-NFATc1–infected islets versus AdV-FLuc–infected control islets at basal3 mmol/L glucose (P £ 0.05; n ‡ 4).



contributor to the regulation of b-cell proliferation andfunction (17,39). Moreover, Ca2+/calmodulin activationof calcineurin is critical for important b-cell functions, suchas insulin secretory granule transport and the secondphase of glucose-induced insulin secretion (25). It is likelythat Ca2+/calcineurin/NFAT signaling, together with regula-tion of IRS-2 expression in b-cells, makes an importantcontribution for the upregulation of b-cell functional mass tocompensate for insulin resistance and increased metabolicload found in nondiabetes obesity (1). Intriguingly, calci-neurin inhibitors (e.g., tacrolimus/FK506 and CsA) are com-monly used as immunosuppressants in organ transplantation,and a frequent complication of their use is acquired post--transplant diabetes mellitus (PTDM). It is thought that PTDMis symptomatic of the long-term use of calcineurin inhibitorsthat compromises b-cell function, growth, and survival (40).This idea is corroborated by the findings of this study thatshow Ca2+/calcineurin/NFAT signaling is required for gluco-se-induced control of IRS-2 expression specifically in b-cells,and without this regulatory mechanism b-cell survival iscompromised (18). However, it should also be noted thatCa2+/calcineurin/NFAT signaling must be tightly con-trolled in b-cells since uncontrolled chronic activation ofcalcineurin in b-cells can also lead to decreased b-cellmass and hyperglycemia (41).

In summary, we have found the mechanism behindglucose-induced transcriptional control of IRS-2 gene ex-pression in islet b-cells is mediated by the Ca2+/calcineurin/NFAT pathway. Calcineurin/NFAT is an important axis inthe functional adaptation of the b-cell to changes inmetabolic demand. Considering the pivotal role thatcontrol of IRS-2 expression plays b-cell growth and sur-vival (1,7), the identification of this pathway behinda regulation of IRS-2 expression in b-cells may representa new therapeutic means of maintaining a functionalb-cell mass that could avoid the onset of type 2 diabetes.For example, it introduces the concept that calcineurinactivators could be beneficial to b-cells via upregulatingIRS-2 expression and maintaining their survival. How-ever, such hypothetical compounds would have to berelatively short acting in vivo to prevent chronic immuneside effects (40) or overstimulate the b-cell (41). On theother hand, considering that calcineurin inhibitors areparticularly detrimental to b-cell function and survival inPTDM (18,25), and glucose did not increase IRS-2 ex-pression in the liver (Fig. 1), short-acting calcineurinactivators have potential to be relatively selective towardb-cells. However, for the moment, this is speculative, andonly future studies will reveal whether such an approachthat exploits the mechanism of glucose-induced IRS-2

FIG. 6. NFATc1 binds to rat IRS-2 gene promoter in b-cells. A: Predicted NFAT binding site elements on rat IRS-2 gene promoter. Examinationof the rat IRS-2 gene promoter from 23,020 to +1 bp (transcription start point) showed multiple NFATc1 consensus sequences (GGAAA).Black boxes (A–I) represent NFAT consensus binding sites, and arrows indicates the five primer pairs used for the ChIP assay. B and C:Specific binding of NFATc1 to the endogenous rat IRS-2 promoter. INS-1 b-cells were infected with AdV-NFATc1, or AdV-Fluc as control, andthe ChIP assay was performed using anti-NFATc1 antibody or Mouse IgG as a negative control. The input (B) corresponds to cross-linked andsheared chromatin. DNA fragments were then submitted to PCR amplification using primers to amplify five regions in the IRS-2 promotercontaining the NFAT binding sites A, B and C together, D, E, or F through I as indicated above. PCR products were loaded onto an agarose gel,where an example is depicted (B). A series of ChIP assays were conducted (n = 6), and the combined data are shown as a mean6 SD above AdV-FLuccontrol for region A, where * indicates a significant increase (P £ 0.05) in AdV-NFATc1–infected cells versus control AdV-FLuc–infected cells (C).



expression in b-cells emerges and proves to be effectivetherapeutically.

ACKNOWLEDGMENTS

This work was supported by National Institutes of HealthGrant DK-55267 (to C.J.R.) and the Brehm Coalition. D.D.

has been supported in part by a postdoctoral fellowshipfrom the Fondation pour la Recherche Médicale.

No potential conflicts of interest relevant to this articlewere reported.

D.D. researched data, contributed to the experimentaldesign and discussion, and wrote and edited the manuscript.

FIG. 7. Glucose induces NFATc1 translocation from cytosol to nucleus in b-cells. INS-1 b-cells (A and C) or isolated rat islets (B) were culturedovernight at 5.6 mmol/L glucose and then incubated at either basal 3 mmol/L or stimulatory 15 mmol/L glucose concentration for 6 h 6 FK506(10 mmol/L). A and B: Nuclear proteins were extracted and nuclear NFATc1 protein expression levels were analyzed by immunoblotting relative toa Maf-A (A) or RNA polymerase-II (Pol-II) (B) protein expression as loading controls. Example immunoblots (IBs) of three individual experimentsare shown. C: Cellular localization of NFATc1 in INS-1 pancreatic b-cells. NFATc1 (red) localization was analyzed by immunofluorescence andconfocal microscopy relative to insulin immunostaining (green) and nuclei staining by DAPI (blue). Example images of three individual experi-ments are shown. (A high-quality digital representation of this figure is available in the online issue.)



S.T. researched data, contributed to the experimental designand discussion, and edited the manuscript. I.B. researcheddata and contributed to the experimental design. R.S.contributed to the experimental design and researcheddata. C.J.R. contributed to the experimental design anddiscussion and edited and reviewed the manuscript.

The authors thank Dr. C.M. Norris from the University ofKentucky, Lexington, Kentucky, for kindly providing AdV-VIVIT and Dr. J.D. Molkentin from the University ofCincinnati, Cincinnati, Ohio, for providing AdV-CAIN andAdV-CNca.

REFERENCES

1. Rhodes CJ. Type 2 diabetes-a matter of b-cell life and death? Science 2005;307:380–384

2. Chang-Chen KJ, Mullur R, Bernal-Mizrachi E. Beta-cell failure as a com-plication of diabetes. Rev Endocr Metab Disord 2008;9:329–343

3. Butler PC, Meier JJ, Butler AE, Bhushan A. The replication of beta cells innormal physiology, in disease and for therapy. Nat Clin Pract EndocrinolMetab 2007;3:758–768

4. Withers DJ, Gutierrez JS, Towery H, et al. Disruption of IRS-2 causes type 2diabetes in mice. Nature 1998;391:900–904

5. Withers DJ, Burks DJ, Towery HH, Altamuro SL, Flint CL, White MF. Irs-2coordinates Igf-1 receptor-mediated beta-cell development and peripheralinsulin signalling. Nat Genet 1999;23:32–40

6. Terauchi Y, Takamoto I, Kubota N, et al. Glucokinase and IRS-2 are re-quired for compensatory beta cell hyperplasia in response to high-fat diet-induced insulin resistance. J Clin Invest 2007;117:246–257

7. White MF. Regulating insulin signaling and beta-cell function through IRSproteins. Can J Physiol Pharmacol 2006;84:725–737

8. Rhodes CJ, White MF. Molecular insights into insulin action and secretion.Eur J Clin Invest 2002;32(Suppl. 3):3–13

9. Hennige AM, Burks DJ, Ozcan U, et al. Upregulation of insulin receptorsubstrate-2 in pancreatic beta cells prevents diabetes. J Clin Invest 2003;112:1521–1532

10. Lingohr MK, Briaud I, Dickson LM, et al. Specific regulation of IRS-2 ex-pression by glucose in rat primary pancreatic islet beta-cells. J Biol Chem2006;281:15884–15892

11. Amacker-Françoys I, Mohanty S, Niessen M, Spinas GA, Trüb T. The me-tabolisable hexoses D-glucose and D-mannose enhance the expression ofIRS-2 but not of IRS-1 in pancreatic beta-cells. Exp Clin Endocrinol Di-abetes 2005;113:423–429

12. Jhala US, Canettieri G, Screaton RA, et al. cAMP promotes pancreatic beta-cell survival via CREB-mediated induction of IRS2. Genes Dev 2003;17:1575–1580

13. Drucker DJ. The biology of incretin hormones. Cell Metab 2006;3:153–16514. Weir GC, Bonner-Weir S. Five stages of evolving b-cell dysfunction during

progression to diabetes. Diabetes 2004;53(Suppl. 3):S16–S2115. Takamoto I, Terauchi Y, Kubota N, Ohsugi M, Ueki K, Kadowaki T. Crucial

role of insulin receptor substrate-2 in compensatory beta-cell hyperplasiain response to high fat diet-induced insulin resistance. Diabetes ObesMetab 2008;10(Suppl. 4):147–156

16. Alonso LC, Yokoe T, Zhang P, et al. Glucose infusion in mice: a new modelto induce b-cell replication. Diabetes 2007;56:1792–1801

17. Heit JJ, Apelqvist AA, Gu X, et al. Calcineurin/NFAT signalling regulatespancreatic beta-cell growth and function. Nature 2006;443:345–349

18. Soleimanpour SA, Crutchlow MF, Ferrari AM, et al. Calcineurin signalingregulates human islet beta-cell survival. J Biol Chem 2010;285:40050–40059

19. Lingohr MK, Dickson LM, Wrede CE, et al. Decreasing IRS-2 expressionin pancreatic beta-cells (INS-1) promotes apoptosis, which can be

compensated for by introduction of IRS-4 expression. Mol Cell Endo-crinol 2003;209:17–31

20. Alarcón C, Lincoln B, Rhodes CJ. The biosynthesis of the subtilisin-relatedproprotein convertase PC3, but no that of the PC2 convertase, is regulatedby glucose in parallel to proinsulin biosynthesis in rat pancreatic islets.J Biol Chem 1993;268:4276–4280

21. Asfari M, Janjic D, Meda P, Li G, Halban PA, Wollheim CB. Establishmentof 2-mercaptoethanol-dependent differentiated insulin-secreting cell lines.Endocrinology 1992;130:167–178

22. Schreiber E, Matthias P, Müller MM, Schaffner W. Rapid detection of oc-tamer binding proteins with ‘mini-extracts’, prepared from a small numberof cells. Nucleic Acids Res 1989;17:6419

23. Yang SN, Berggren PO. Beta-cell CaV channel regulation in physiology andpathophysiology. Am J Physiol Endocrinol Metab 2005;288:E16–E28

24. Klee CB, Ren H, Wang X. Regulation of the calmodulin-stimulated proteinphosphatase, calcineurin. J Biol Chem 1998;273:13367–13370

25. Donelan M, Julyan R, Kajio H, et al. Ca2+-dependent dephosphorylation ofkinesin heavy chain on beta-granules in pancreatic beta-cells. Implicationsfor regulated beta granule transport and insulin exocytosis. J Biol Chem2002;277:24232–24242

26. Liu J, Farmer JDJ Jr, Lane WS, Friedman J, Weissman I, Schreiber SL.Calcineurin is a common target of cyclophilin-cyclosporin A and FKBP-FK506 complexes. Cell 1991;66:807–815

27. Lai MM, Burnett PE, Wolosker H, Blackshaw S, Snyder SH. Cain, a novelphysiologic protein inhibitor of calcineurin. J Biol Chem 1998;273:18325–18331

28. Hogan PG, Chen L, Nardone J, Rao A. Transcriptional regulation by cal-cium, calcineurin, and NFAT. Genes Dev 2003;17:2205–2232

29. Aramburu J, Yaffe MB, López-Rodríguez C, Cantley LC, Hogan PG, Rao A.Affinity-driven peptide selection of an NFAT inhibitor more selective thancyclosporin A. Science 1999;285:2129–2133

30. Macian F. NFAT proteins: key regulators of T-cell development andfunction. Nat Rev Immunol 2005;5:472–484

31. Rhodes CJ. Processing of the insulin molecule. In Diabetes Mellitus.A Fundamental and Clinical Text. 3rd ed. LeRoith D, Taylor SI, Olefsky JM,Eds. Philadelphia, PA, Lippincott-Raven Publishers, 2004, p. 27–50

32. Deeney JT, Prentki M, Corkey BE. Metabolic control of b-cell function.Semin Cell Dev Biol 2000;11:267–275

33. Easom RA. b-granule transport and exocytosis. Semin Cell Dev Biol 2000;11:253–266

34. Wang Z, Thurmond DC. Mechanisms of biphasic insulin-granule exocytosis—roles of the cytoskeleton, small GTPases and SNARE proteins. J Cell Sci2009;122:893–903

35. Tsunekawa S, Demozay D, Briaud I, McCuaig J, Accili D, Stein R, Rhodes CJ.FoxO feedback control of basal IRS-2 expression in pancreatic b-cells isdistinct from that in hepatocytes. Diabetes 2011;60:2883–2891.

36. Screaton RA, Conkright MD, Katoh Y, et al. The CREB coactivator TORC2functions as a calcium- and cAMP-sensitive coincidence detector. Cell2004;119:61–74

37. Lawrence MC, Bhatt HS, Watterson JM, Easom RA. Regulation of insulingene transcription by a Ca2+-responsive pathway involving calcineurin andnuclear factor of activated T cells. Mol Endocrinol 2001;15:1758–1767

38. Wrede CE, Dickson LM, Lingohr MK, Briaud I, Rhodes CJ. Protein kinaseB/Akt prevents fatty acid-induced apoptosis in pancreatic beta-cells (INS-1).J Biol Chem 2002;277:49676–49684

39. Nir T, Melton DA, Dor Y. Recovery from diabetes in mice by beta cellregeneration. J Clin Invest 2007;117:2553–2561

40. Penfornis A, Kury-Paulin S. Immunosuppressive drug-induced diabetes.Diabetes Metab 2006;32:539–546

41. Bernal-Mizrachi E, Cras-Méneur C, Ye BR, Johnson JD, Permutt MA.Transgenic overexpression of active calcineurin in beta-cells results indecreased beta-cell mass and hyperglycemia. PLoS ONE 2010;5:e11969

42. Yaekura K, Julyan R, Wicksteed BL, et al. Insulin secretory deficiency andglucose intolerance in Rab3A null mice. J Biol Chem 2003;278:9715–9721



original article ﬁc glucose-induced control of insulin ... · cellular sources. calcineurin...

Documents