organization of bacterial chromosome prokaryotic dna replicate, transcription & translation by...

Organization of bacterial chromosome Prokaryotic DNA replicate, transcription &

translation

by Angelia Teo (Jan 09) 1

Bacterial chromosome, structure & organizationBacterial chromosome, structure & organization

Prokaryotic DNA replication, transcription, translationProkaryotic DNA replication, transcription, translation

Prokaryotic regulation of gene expressionProkaryotic regulation of gene expression

Mutations and SelectionMutations and Selection

Extra-chromosomal elements.Extra-chromosomal elements. - Bacteriophages- Bacteriophages - Plasmid DNA- Plasmid DNA

the genome of prokaryotes is not in a separate compartment, haploid. Single chromosome: it is located in the cytoplasm (although sometimes confined to a particular region called a “nucleoid”). Prokaryotes contain no membrane-bound organelles; their only membrane is the membrane that separates the cell form the outside world. Nearly all prokaryotes are unicellular.


Eukaryotes are defined as having their genetic material enclosed in a membrane-bound nucleus,

separate from the cytoplasm. In addition, eukaryotes have other membrane-bound organelles such as mitochondria, lysosomes, and endoplasmic reticulum. almost all multicellular organisms are

eukaryotes.

Prokaryotes are haploid, and they contain a single circular chromosome. In addition, prokaryotes often contain small circular DNA molecules called “plasmids”, that confer useful properties such as drug resistance. Only circular DNA molecules in prokaryotes can replicate.


Eukaryotes are often diploid, and eukaryotes have linear chromosomes, usually more than 1.

In prokaryotes, translation is coupled to transcription: translation of the new RNA molecule starts before transcription is finished.


In eukaryotes, transcription of genes in RNA occurs in the nucleus, and translation of that RNA into protein occurs in the cytoplasm. The two processes are separated from each other.

2005-2006

Bacteria review one-celled organisms prokaryotes reproduce by mitosis

▪ binary fission rapid growth

▪ generation every ~20 minutes▪ 108 (100 million) colony overnight!

dominant form of life on Earth incredibly diverse

2005-2006

Single circular chromosome haploid naked DNA

▪ no histone proteins ~4 million base pairs

▪ ~4300 genes▪ 1/1000 DNA in eukaryote

Intro to Bacteria video

2005-2006

No nuclear membrane chromosome in cytoplasm transcription & translation are coupled

together▪ no processing of mRNA

no introns but Central Dogma

still applies▪ use same

genetic code

Molecules of double-stranded DNAUsually circularTend to be shorterContains a few thousand unique

genesMostly structural genesSingle origin of replication

9

The bacterial chromosome is found in region called the nucleoid (not membrane-bounded- so the DNA is in direct contact with the cytoplasm)


The circularity of the bacterial chromosome was elegantly demonstrated by electron microscopy in both Gram negative bacteria (such as Escherichia coli) and Gram positive bacteria (such as Bacillus subtilis).

Bacterial plasmids were also shown to be circular.

Linear chromosomes found in Gram-positive Borrelia & Streptomyces.


Bacterial Genome is haploid, single chromosomeBacterial Genome is haploid, single chromosome

Not all bacteria have a single circular chromosome: some bacteria have multiple circular chromosomes, and many bacteria have linear chromosomes and linear plasmids.

Bacterial chromosomal DNA is usually a circular molecule that is a few million nucleotides in length Escherichia coli 4.6 million base pairs Haemophilus influenzae 1.8 million base pairs

A typical bacterial chromosome contains a few thousand different genes Structural gene sequences (encoding

proteins) account for the majority of bacterial DNA

The nontranscribed DNA between adjacent genes are termed intergenic regions


Chromosomal Map of BacteriaChromosomal Map of Bacteria

Circular genetic map of E coli. Positions of representative genes are indicated on inner circle. Distances between genes are calibrated in minutes, based on times required for transfer during conjugation. Position of threonine (thr) locus is arbitrarily designated as 0 minutes, and other assignments are relative to thr.


The Complete Sequence of Escherichia coli Chromosome

http://www.sciencemag.org/content/vol277/issue5331/images/large/se3275565001.jpeg

Typical bacterial chromosome must be compacted about 1,000-fold

Bacterial DNA is not wound around histone proteins to form nucleosomes

Proteins important in forming loop domains Compacts DNA about 10-fold

DNA supercoiling Topoisomerases twist the DNA and control

degree of supercoiling

17

The length of a typical bacterial operon (usually about 3 genes), is about as long as the entire bacterial cell !


The operon model of prokaryotic gene regulation was proposed by Fancois Jacob and Jacques Monod. Groups of genes coding for related

proteins are arranged in units known as operons. An operon consists of an operator, promoter, regulator, and structural genes. The regulator

gene codes for a repressor protein that binds to the operator, obstructing the promoter (thus, transcription) of the structural genes.

The regulator does not have to be adjacent to other genes in the operon. If the repressor protein is removed, transcription may occur.

The operon model of prokaryotic gene regulation was proposed by Fancois Jacob and Jacques Monod. Groups of genes coding for related

proteins are arranged in units known as operons. An operon consists of an operator, promoter, regulator, and structural genes. The regulator

gene codes for a repressor protein that binds to the operator, obstructing the promoter (thus, transcription) of the structural genes.

The regulator does not have to be adjacent to other genes in the operon. If the repressor protein is removed, transcription may occur.


Operons are either inducible or repressible

according to the control mechanism.

Seventy-five different operons controlling 250

structural genes have been identified

for E. coli. Both repression and induction are examples of

negative control since the repressor

proteins turn off transcription.

Operons are either inducible or repressible

according to the control mechanism.

Seventy-five different operons controlling 250

structural genes have been identified

for E. coli. Both repression and induction are examples of

negative control since the repressor

proteins turn off transcription.

DNA molecules that replicate as discrete genetic units in bacteria are called replicons.

Extrachromosomal replicons: - bacteriophages - plasmids (non-essential replicons)

These determine resistance to antimicrobial agents or production of virulence factors.


Nucleic acids are polynucleotides, consist of repeating nucleotide units Each nucleotide contains one phosphate group, one sugar (pentose or deoxypentose) and one base (purine or pyrimidine). Phosphodiester bonds link the 3'-OH of one nucleotide sugar to the 5'-OH group of the adjacent nucleotide sugar. In DNA the sugar is D-2-deoxyribose; in RNA the sugar is D-ribose. RNA has a hydroxyl group on the 2' carbon of the sugar. In DNA the purine bases are adenine (A) and guanine (G), and the pyrimidine bases are thymine (T) and cytosine (C). In RNA, uracil (U) replaces thymine. Chemically modified purine and pyrimidine bases are found in some bacteria and bacteriophages.

DNA is a double-stranded helix; two strands are anti-parallel.

Double helix is stabilized by H bonds between purine & pyrimidine bases on the opposite strands. A pairs T by 2 H bonds; G pairs C by 3 H bonds.

Two strands in DNA helix are complementary, ie. dsDNA contains equimolar amounts of purines (A + G) and pyrimidines (T + C), with A = T and G = C.

The mole fraction of G + C in DNA varies widely among different bacteria.

DNA is supercoiled and tightly packaged. The extent of sequence homology between DNAs

from different microorganisms determines how closely related they are (eg. 16sRNA sequence)

RNA exists as a single-stranded molecule; forms hairpin loops (secondary structure) due to intra-molecular base-pairing.

DNA Replication in Bacteria

The DNA replicates semiconservatively: - Each strand in dsDNA serves as a template for synthesis of a new complementary strand. - Result: daughter dsDNA molecule - contains one old polynucleotide strand and one newly synthesized strand.

Replication of chromosomal DNA in bacteria starts at a specific chromosomal site called the origin of replication and proceeds bi-directionally until the process is completed.

.

X

Y

Autoradiograph of intact Autoradiograph of intact replicating chromosome replicating chromosome of of E coliE coli. Bacteria were . Bacteria were radioactively labeled radioactively labeled with tritiated thymidinewith tritiated thymidine

DNA Replication in Bacteria

DNA replication is initiated whenever cells divide, so in rapidly growing bacteria a new round of chromosomal replication begins before an earlier round is completed.

The origin regions specifically and transiently associate with the cell membrane after initiation of DNA replication. Membrane attachment directs separation of daughter chromosomes.

Time required for replication of the entire chromosome is about 40 minutes (500 – 1000 nucleotides / sec)

Replicated chromosomes are partitioned into each of the daughter cells.

Central Dogma of Molecular BiologyCentral Dogma of Molecular Biology

How does the sequence of How does the sequence of a strand of DNA correspond a strand of DNA correspond to the amino acid sequence to the amino acid sequence of a protein?of a protein?

• DNA codes for RNA production.• RNA codes for protein production.• Protein does not code protein, RNA or DNA production. The end.

Or in the words of Francis Crick: Once information has passed into protein, it cannot get out again!

Revision of the "Central Dogma"Revision of the "Central Dogma"

CAN go back from RNA to DNA (reverse transcriptase)CAN go back from RNA to DNA (reverse transcriptase) RNA can also make copies of itself (RNA polymerase) RNA can also make copies of itself (RNA polymerase)

Still NOT possible from Proteins back to RNA or DNAStill NOT possible from Proteins back to RNA or DNA

Not known mechanisms for proteins making copies of themselves.Not known mechanisms for proteins making copies of themselves.

Gene ExpressionGene Expression

Expression of genetic determinants in bacteria involves the Expression of genetic determinants in bacteria involves the unidirectional flow of information from DNA to RNA to unidirectional flow of information from DNA to RNA to protein. protein. Two processes involved are transcription and translation.Two processes involved are transcription and translation.

Transcription & TranslationTranscription & Translation Prokaryotic vs Eukaryotic cellsProkaryotic vs Eukaryotic cells

In a prokaryotic cell, which does not contain a nucleus, this In a prokaryotic cell, which does not contain a nucleus, this process happens at the same time. process happens at the same time. In Eukaryotic cells, occur at different In Eukaryotic cells, occur at different cell compartments.cell compartments.

Prokaryotic cellProkaryotic cell Eukaryotic cellEukaryotic cell

TranscriptionTranscription The DNA-directed synthesis of RNA is called transcription. The DNA-directed synthesis of RNA is called transcription. Transcription produces RNA molecules that are complimentary Transcription produces RNA molecules that are complimentary copies of one strand of DNA. copies of one strand of DNA. Only one of the dsDNA strands can serve as template for Only one of the dsDNA strands can serve as template for synthesis of a specific mRNA molecule.synthesis of a specific mRNA molecule. mRNAs transmit information from DNA, and each mRNA in mRNAs transmit information from DNA, and each mRNA in bacteria function as a template for synthesis of one or more bacteria function as a template for synthesis of one or more specific proteins.specific proteins.

TranslationTranslation

The process by which the nucleotide sequence of an mRNA molecule The process by which the nucleotide sequence of an mRNA molecule determines the primary amino acid sequence of a protein. determines the primary amino acid sequence of a protein. Ribosomes Ribosomes are complexes of ribosomal RNAs (rRNAs) and several are complexes of ribosomal RNAs (rRNAs) and several ribosomal proteins. ribosomal proteins. Ribosomes with the aid ofRibosomes with the aid of transfer RNAstransfer RNAs (tRNAs),(tRNAs), amino-acyl tRNA amino-acyl tRNA synthesasessynthesases, , initiation factorsinitiation factors and and elongation factorselongation factors are all involved in are all involved in translation of each mRNA into corresponding polypeptide (protein).translation of each mRNA into corresponding polypeptide (protein).

Translation Translation

Initiated at an AUG codon for methionine.Initiated at an AUG codon for methionine. Codons are translated sequentially in mRNA from 5' to 3'. Codons are translated sequentially in mRNA from 5' to 3'. The corresponding polypeptide chain / protein is assembled The corresponding polypeptide chain / protein is assembled from the amino terminus to carboxy terminus. from the amino terminus to carboxy terminus. The sequence of amino acids in the polypeptide is, therefore, The sequence of amino acids in the polypeptide is, therefore, co-linear with the sequence of nucleotides in the mRNA and the co-linear with the sequence of nucleotides in the mRNA and the corresponding gene. corresponding gene.

The Genetic codeThe Genetic codeThe "universal" genetic code employed by most organisms is a triplet code and it The "universal" genetic code employed by most organisms is a triplet code and it determines how the nucleotides in mRNA specify the amino acids in the determines how the nucleotides in mRNA specify the amino acids in the polypeptide. polypeptide.

• 61 of 64 possible trinucleotides 61 of 64 possible trinucleotides (codons) encode specific amino (codons) encode specific amino acids.acids.

• 3 remaining codons (UAG, UAA or 3 remaining codons (UAG, UAA or UGA) code for termination of UGA) code for termination of translation (nonsense codons = do translation (nonsense codons = do not specify any amino acids) not specify any amino acids)

Exceptions:Exceptions:1)1) UGA as a tryptophan codon in some UGA as a tryptophan codon in some

species of Mycoplasma and in species of Mycoplasma and in mitochondrial DNA.mitochondrial DNA.

2)2) Few codon differences in Few codon differences in mitochondrial DNAs from yeasts, mitochondrial DNAs from yeasts, Drosophila, and mammals. Drosophila, and mammals.

Gene expression occurs in 2 steps: Gene expression occurs in 2 steps: TranscriptionTranscription of the information encoded in DNA into a molecule of RNA of the information encoded in DNA into a molecule of RNATranslationTranslation of the information encoded in mRNA into a defined sequence of of the information encoded in mRNA into a defined sequence of amino acids in a protein.amino acids in a protein.

The sequence of one strand of DNA is 5’ GGGTAAGCTTATCCCGTA 3’ 3’ CCCATTCGAATAGGGCAT 5’ The sequence of the complementary strand from

5’ to 3’ is

A) CCCATTCGAATAGGGCAT B) TACGGGATAAGCTTACCC C) GGGTAAGCTTATCCCGTA D) ATGCCCTATTCGAATGGG

The following is the sense strand of the DNA sequence. Give the amino acid sequence of the protein generated

after translation.

5’ ATGGGGTACTACCATCCCAATCATCCCAATAGGTACCCC 3’ TRANSCRIPTION

5’ AUGGGGUACUACCAUCCCAAUCAUCCCAAUAGGUACCCC 3’ TRANSLATION

Met Gly Tyr Tyr His Pro Asn His Pro Asn Arg Tyr Pro 5’AUG GGG UAC UAC CAU CCC AAU CAU CCC AAU AGG UAC CCC 3’

Charlebois, R. 1999. Organization of the Prokaryotic Genome. ASM Press, Washington, D.C.

Casjens, S. 1998. The diverse and dynamic structure of bacterial genomes. Ann. Rev. Genet. 32: 339-377.

Casjens, S. 1999. Evolution of the linear DNA replicons of the Borrelia spirochetes. Curr. Opin. Microbiol. 2: 529-534.

Chen, C. 1996. http://www.ym.edu.tw/ig/cwc/end_troubles/End_Troubles.html Jumas-Bilak et al. 1998. Unconventional genomic organization in the alpha

subgroup of the Proteobacteria. J. Bacteriol. 180: 2749-2755. Kobryn K, Chaconas G. 2001. The circle is broken: telomere resolution in linear

replicons. Curr Opin Microbiol. 4(5): 558-564. Suwanto, A., and S. Kaplan. 1989. Physical and genetic mapping of the

Rhodobacter sphaeroides 2.4.1 genome: presence of two unique circular chromosomes. J. Bacteriol. 171: 5850-5859.

Suwanto, A and S. Kaplan. 1992. Chromosome transfer in Rhodobacter sphaeroides: Hfr formation and genetic evidence for two unique circular chromosomes. J. Bacteriol. 174: 1135-1145.

Trucksis et al. 1998. The Vibrio cholerae genome contains two unique circular chromosomes. Proc. Natl. Acad. Sci. USA 95: 14464-14469.

Volff, J.-N., and J. Altenbuchner. 2000. A new beginning with new ends: linearisation of circular chromosomes during bacterial evolution. FEMS Microbiol. Lett. 186: 143-150.

Yang CC, Huang CH, Li CY, Tsay YG, Lee SC, Chen CW. 2002. The terminal proteins of linear Streptomyces chromosomes and plasmids: a novel class of replication priming proteins. Mol Microbiol. 43(2): 297-305.


organization of bacterial chromosome prokaryotic dna replicate, transcription & translation by...

Documents

cytoplasmby angelia

genome of prokaryotes

small circular dna molecules

bacterial genome

bacterial plasmids

membranebound organelles

multiple circular chromosomes

membranebound nucleus