Revue Méd. Vét., 2014, 165, 5-6, 167-171

FASCIOLIASIS IN DONKEYS AND PCR-RFLP OF 28S rRNA GENE 167

Introduction

Fascioliasis is one of the most prevalent helminthic infections of ruminants, equines and humans with a global geographical distribution. It is caused by the digenetic trematodes, Fasciola gigantica and Fasciola hepatica [27]. Fasciola gigantica is found in tropical regions of Africa and Asia, while F. hepatica has a cosmopolitan distribution, mainly in temperate regions. Thus, the two fasciolid species overlap in large regions [21].

Fascioliasis in livestock has been recognized as a veterinary problem on a world wide scale. In Egypt, the disease is highly enzootic affecting cattle, sheep, donkeys, goats and buffaloes [2, 8, 10, 24, 25].

Severe negative economic impact has been estimated in ruminants due to significant morbidity, mortality, reduction in host fecundity, decrease in milk and wool production [4, 12]. In addition, human fascioliasis constitutes a significant health problem, as the estimated number of people infected

with fascioliasis in Egypt is 830,000 cases [13], while population at risk is considered to be 27 million [32]. The Nile Delta considered one of the endemic areas in the world for human fascioliasis [6, 28].

Equines still receive more interest in many countries as draft animals, source of leather and other related products. Also, donkeys have a prominent position in the agricultural systems of many developing countries. The epidemiology, pathogenicity and immunology of fascioliasis in equids in general, and in donkeys in particular have not been fully determined. In Egypt, information on equine fasciolosis in donkeys is sparse [11, 12] Traditional methods of identification of Fasciola spp. have relied on morphological features of adults and eggs. The problem has even been increased by the existence of morphologically intermediate forms between the two fasciolid species and genetic hybrids of both in overlapping areas, endemic for animals [15] and humans in Africa [26]. So the molecular approach for accurate identification is more decisive [18, 23]. Thereby, this study aimed to determine occurrence of Fasciola spp.

SUMMARY

Fascioliasis is an important parasitic zoonosis worldwide and has a veterinary problem in herbivourous animals. This study aimed to investigate the occurrence and molecular identification of Fasciola spp. in donkeys in two localities in Egypt (Giza Zoo, Giza Province and Zagazig region, Sharkia Province). One hundred and thirty one fecal samples were collected from donkeys slaughtered at Giza Zoo and also from animals at Zagazig region. Feces were examined by simple sedmententation concentration technique. The overall prevalence rate of fascioliasis was 17.6% (23 out of 131). The infection rate was 32.1% (17 out of 53) in donkeys at Giza Zoo and 7.7% (6 out of 78) at Zagazig region. A postmortem examination was carried out for animals at Giza Zoo. The recovered worms were morphotyped as Fasciola gigantica. As a first molecular typing of fascioliasis of donkeys in Egypt, the 28S rRNA gene of adult worm specimens from infected ten donkeys at Giza Zoo was amplified and digested with the restriction enzyme Ava II using PCR-RFLP. The RFLP patterns of all specimens revealed two fragments of 322 and 269 bp characteristic for F. gigantica. No F. hepatica or intermediate forms could be detected. This study drew an attention for the control of fascioliasis in donkeys to avoid public health hazard.

Keywords: Occurrence, Fasciola gigantica, Donkeys, 28S rRNA gene, PCR-RFLP, Egypt.

RÉSUMÉ

Fasciolose chez les ânes en Egypte  : typage par PCR-RFLP du gène de l’ARNr 28S

La fasciolose est une zoonose parasitaire de prévalence mondiale et un problème de santé animale chez les animaux herbivores. Cette étude vise à déterminer la présence et identifier de manière moléculaire Fasciola spp. chez les ânes dans deux localités en Egypte (Zoo de Giza , dans la province de Gizeh et la région Zagazig, province Sharkia ). Cent trente et un échantillons de matières fécales ont été recueillis sur des ânes abattus au Zoo de Giza et sur des animaux de la région Zagazig. Les matières fécales ont été examinées après concentration par sédimentation simple. Le taux global de prévalence de la fasciolose était de 17,6 % (23 sur 131). Le taux d’infection était de 32,1 % (17 sur 53) chez les ânes de Gizeh et de 7,7% (6 sur 78) dans la région ZagaZig . Un examen post-mortem a été effectué sur les animaux du Zoo de Giza. Les vers ont été récupérés et morphologiquement identifiés comme Fasciola gigantica. Un typage moléculaire a été effectué sur dix spécimens obtenus sur des ânes de Giza après digestion des ARNr 28S par l’enzyme de restriction Ava II et amplification par PCR-RFLP. Les profils RFLP de tous les échantillons ont révélé deux fragments de 322 et 269 pb caractéristique de F. gigantica. Aucun cas de F. hepatica ou formes intermédiaires n’a été détecté. Cette étude montre l’importance du contrôle de la fasciolose chez les ânes afin d’éviter les risques de zoonose.

Mots clefs : épidémiologie, fasciolose, Fasciola gigantica, âne, ARNr 28S, PCR-RFLP, Egypte

Occurrence of zoonotic fascioliasis in donkeys in Egypt with emphasis on PCR-RFLP of 28S rRNA gene

A. BADAWY1, N. ABOUZAID2, A. MERWAD3*

1Department of Parasitology, Faculty of Veterinary Medicine, Zagazig University, Zagazig 44511, Egypt.2Department of Infectious Diseases, Faculty of Veterinary Medicine, Zagazig University, Zagazig 44511, Egypt.3Department of Zoonoses, Faculty of Veterinary Medicine, Zagazig University, Zagazig 44511, Egypt.

*Corresponding author: merwad.abdallah @ yahoo.com

Revue Méd. Vét., 2014, 165, 5-6, 167-171

BADAWY (A.) AND COLLABORATORS168

in donkeys at two localities in Egypt (Giza Zoo and Zagazig region), and also to identify the flukes to the species level using PCR-RFLP of amplified 28S rRNA gene for the first time.

Material and Methods

SAMPLING AND FECAL EXAMINATION

One hundred and thirty one fecal samples (53 from donkeys slaughtered at Giza Zoo and 78 from live animals at Zagazig region) were collected from the rectum in labeled plastic bags during March 2012 to September, 2013; and examined for Fasciola spp. eggs using a simple sedimentation concentration technique [19].

PARASITE COLLECTION

Worms were collected from livers of slaughtered animals at the Abattoir of the Zoo, Giza province. In brief, bile ducts were searched thoroughly for presence of fasciolid worms. Detected flukes were removed and washed extensively in phosphate buffer saline (PBS). Portions of specimens were fixed in formalin 10% and stained with acetic acid alum carmine stain according to the technique of KRUSE and PRITCHARD [17], while other portions were subsequently fixed in 70% ethanol and stored at -20°C until used for molecular characterization.

GENOMIC DNA EXTRACTION The genomic DNA was isolated from apical zones of

liver flukes, obtained from infected ten donkeys slaughtered at Giza Zoo according to Chelex®-based DNA extraction method [5]. Mature worms were mechanically disrupted in 200 µl of Chelex® 5% under liquid nitrogen and then incubated at 56°C for one hour; and at 95°C for 30 minutes in a water bath. Centrifugation of the mixture was done at 13,000 xg for seven minutes. The DNA supernatants were collected and stored at - 20°C.

PCR AMPLIFICATION OF 28S rRNA GENE

To amplify the 28S rRNA gene of the specimens, the oligonucleotide primers 28F1 (5’ACGTGATTACCCGCTGAACT’3) and 28R600 (5’CTGAGAAAGTGCACTGACAAG’3) were designed [20]. The nucleotide sets were synthesized in Metabion international AG, Martinsired, Deutschland. Each PCR reaction mixture

(25 µl) contained 1 µl of template DNA, 12.5 µl of Dream Taq Green PCR Master Mix (2X) (ThermoScientific, Fermentas), 0.25 µl of each primer (25 pmol) and 11 µl of molecular water. The amplification of reaction mixture was performed in a thermal cycler with a minor modification of PCR conditions [20]. Briefly, an initial denaturation of samples was at 94°C for 4 min, followed by 30 cycles as a denaturation at 94°C for 1 min; then annealing at 55°C for 1 min for 30 cycles and extension for 1 min at 72°C for 30 cycles. The final extension step was at 72°C for 10 min. The PCR products (10 µl) were analyzed by electrophoresis on 1.5% agarose gel stained with ethidium bromide. A negative control was included in a PCR reaction. A Gene Ruler 100 bp DNA Marker (Fermentas) was included on the gel for base-pair comparisons.

PCR-RFLP OF 28S rRNA GENE

A specific restriction enzyme Ava II (Jena Bioscience GmbH, Jena, Germany) was selected to digest the amplified 28S rRNA gene of Fasciola spp. to identify the recovered worms to a species level [20]. Ten microliters of PCR products were completely digested with 3 µl Ava II and 2.5 µl buffer at 37°C. Analysis of digested PCR products was carried out by electrophoresis in 3% agarose gel and visualization was achieved via ethidium bromide staining. Undigested PCR product (without addition of Ava II) was used as a control. A GeneRuler 50 bp DNA Marker (Fermentas) was included on the gel. The length of restriction fragments was predicted by Gene Runner software v. 3.05 (Hastings Software Inc, 1994).

Results

As shown in Table I, twenty three donkeys were infected with fascioliasis with an overall prevalence rate of 17.6%. The infection rate was 7.7% (6 out of 78) at Zagazig region, while it was 32.1% (17 out of 53) at the Zoo, Giza Province. Most of infected donkeys suffered from emaciation, had pale mucous membranes and leaf-like flukes were present in grossly enlarged and thickened bile ducts, particularly in the ventral lobe of the liver.

Regarding the morphology, the recovered eggs from feces were oval, golden yellow in color, operculated and measured 105-147 μm in length (aver. 126 μm) and 72- 90 μm in maximum width (aver. 81 μm). The mean egg length/width ratio was 1.6 (Figure 1, A). Morphologically, adult worms showed the characteristics of F. gigantica; where the worms were grayish, dorsoventrally flattened, with narrow shoulders, parallel sides and differed in size from 30-48 mm

Localities No. Examined No. Infected % PositiveGiza ZOO 53 17 32.1

Zagazig region 78 6 7.7Total 131 23 17.6

Table I: Occurrence of fascioliasis in examined donkeys at two localities in Egypt.

Revue Méd. Vét., 2014, 165, 5-6, 167-171

FASCIOLIASIS IN DONKEYS AND PCR-RFLP OF 28S rRNA GENE 169

(aver. 39 mm) in length and 10 mm-17 mm (aver. 13.5 mm) as maximum breadth. The cone length ranged from 4-5 mm (aver. 4.5 mm), maximum cone width was 6-8 mm (aver. 7.0 mm), shoulder width was 9-12 mm (aver. 10.5 mm) and the postacetabular length was 36-44 mm (aver. 40 mm) (Figure 1, B&C).

With respect to PCR-RFLP, the amplified 28S rRNA gene of all speciemens yielded PCR products of 618 bp which was identical for Fasciola spp. (Figure 2). After digestion of amplicons with the restriction enzyme Ava II, the RFLP profile revealed two fragments of 322 and 269 bp characteristic for F. gigantica (Figure 3).

Discussion

The infection with fascioliasis in domestic ruminants, equines and more recently in humans is a well-recognized

problem worldwide. Studies reported by MAS-COMA et al. [22] in Bolivia and by HARIDY et al. [12] in Egypt showed that next to domestic ruminants, donkeys are the second important final reservoirs of F. hepatica and F. gigantica and play a zoonotic significance in human infection [33].

Concerning the overall prevalence of fascioliasis in examined donkeys (17.6%) as shown in Table I, nearly similar percentages of 17.05% in Giza [11] and 14.1% in Kafr El-Sheikh [14]. On the contrary, lower percentages of fascioliasis were cited in different Provinces in Egypt: 0.37% in Assuit [16]; 3.03% in Gharbia [12]; 6.7% in Al-Fayoum [25]; and 3.08% in Giza [1]. However, 44.4% of examined working donkeys in Ethiopia were proved to be positive for fascioliasis [9].The variations in these results may be attributed to the age of the examined donkeys which coincides with the finding of GETACHEW et al. [9], who stated that the infection intensity of fascioliasis was significantly higher in donkeys

Figure 1: Egg and adults of Fasciola gigantica recovered from infected donkeys in Egypt.A. Fasciola spp. egg detected in feces of infected donkeys (Bar = 40 µm).B. Unstained adult worm morphotyped as F. gigantica (Bar = 8 mm).C. Alum carmine stained apical region of adult worm morphotyped as F. gigantica (Bar = 4 mm).

Figure 2: PCR products of 28S rRNA gene of Fasciola spp. recovered from infected ten donkeys at Giza Zoo. Lane M: 100 bp DNA size marker; Lane 1: negative control; lanes 2-11: amplified 28S rRNA of Fasciola spp. (618 bp).

Figure 3: PCR- RFLP patterns of 28S rRNA gene of Fasciola gigantica after digestion with a restriction enzyme AvaII. Lane M: 50 bp DNA size marker; Lane 1: Undigested PCR product of 28S rRNA of Fasciola spp. (618 bp); Lanes 2-11: Digested PCR pro-ducts of 28S rRNA of Fasciola gigantica (322, 269 bp).

Revue Méd. Vét., 2014, 165, 5-6, 167-171

BADAWY (A.) AND COLLABORATORS170

8 years old and above. In addition, the higher prevalence rate of fascioliasis in donkeys in this study may be accounted for grazing of these donkeys in heavily contaminated areas with encysted metacercariae. The infected donkeys shed viable Fasciola eggs and have capability to infect lymnaeid snails, and the produced metacercariae are infective for other definitive hosts. This referred to the greatest role played by donkeys in the epidemiology of both livestock and human fascioliasis [30]. The higher infection rate of fascioliasis was noticed in donkeys slaughtered at Giza Zoo than that in animals at Zagazig region may be attributed to aged donkeys at the Zoo.

Dealing with morphological and morphometric identification of Fasciola spp. detected in the present study by microscopical examination, only F. gigantica was identified from infected animals (Figure 1). Adult worms showed characteristic features resembling that of the early described for this parasite [7, 29]. However, identification of the species depending on morphological and morphometrical criteria is not decisive due to overlap in the values of most measurements [18, 23]. Eggs showed similar characteristics of Fasciola species eggs, although egg measurements were lower than that described for both F. gigantica and F. hepatica recovered from cattle in Egypt [31].

Molecular genetic techniques based on the differences in nucleotides, a PCR-RFLP technique was developed mainly to differentiate between F. hepatica and F. gigantica [20]. In the present study, the amplified 28S rRNA genes of the specimens collected from donkeys at Giza Zoo were digested with the restriction enzyme Ava II. The RFLP patterns of all specimens revealed two fragments of 322 and 269 bp characteristic for F. gigantica (Figure 3). The present result was concordant with the finding of MARCILLA et al. [20], who distinguished between both fasciolid species obtained from South America, Europe and Africa based on a 618-bp-long sequence of the 28S rRNA gene. These results confirmed the morphological findings and support the early studies which found that F. gigantica is the commonest fasciolid fluke affects donkeys in Egypt [3, 14]; and contradict with finding of AHMED et al. [1], who isolated F. hepatica from 3.08% from necropsied donkeys at Moshtohor and Giza Zoo.

Conclusion

Donkeys are considered as important reservoirs for F.  gigantica in Egypt. Thereby, preventive and control measures of fascioliasis in donkeys are crucial to avoid public health hazard. This study clarified that PCR-RFLP assay is a useful alternative tool to distinguish between the two fasciolid worms.

References

1. - AHMED N. E., EL-AKABAWY L. M., RAMADAN M.Y., RADWAN A. M. M.: Studies on helminth parasites in necropsied donkeys in Egypt. Benha Vet. Med. J., 2011, I, 153-162.

2. - AWAD W. S. A., IBRAHIM A. K., EL SAYED M. M.: Comparing coprological examination and indirect enzyme linked immunosorbent assay for studying fasciolosis in Egyptian donkeys. J. Egypt. Vet. Med. Assoc., 2004, 64, 65-72.

3. - AWAD W.S., IBRAHIM A. K., SALIB F. A.: Using indirect ELISA to assess different antigens for the serodiagnosis of Fasciola gigantica infection in cattle, sheep and donkeys. Res. Vet. Sci., 2009, 86, 466-471.

4. - BORAY J. C.: Chemotherapy of infections with fasciolidae. In Boray, JC.ed. Immunology, pathobiology and control of fasciolosis. New Jersy: MSD. Ag. Vet. Rahway, 1997, 83-97.

5. - CARON Y., RIGHI S., LEMPEREUR L., SAEGERMAN C., LOSSON B.: An optimized DNA extraction and multiplex PCR for the detection of Fasciola sp. in lymnaeid snails. Vet. Parasitol., 2011, 178, 93-99.

6. - CURTALE F., HASSANEIN Y. A., BARDUAGNI P., YOUSEF M. M., WAKEEL A. E., HALLAJ Z., MAS-COMA S.: Human fascioliasis infection: gender differences within school-age children from endemic areas of the Nile Delta, Egypt. Trans. R. Soc. Trop. Med. Hyg., 2007, 101,155-160.

7. - EL-RAHIMY H. H., MAHGOUB A. M. A., EL-GEBALY N. S. M., MOUSA, W. M. A., ANTABLY A. S. A.E.: Molecular, biochemical and morphometric characterization of Fasciola species potentially causing zoonotic disease in Egypt. Parasitol. Res., 2012, 111, 1103-1111.

8. - EL-SHAZLY A. M., ABDEL-MAGIED A. A., EL-NAHAS H. A., EL-METWALY M. S., MORSY T. A., ELSHARKAWY E. M., MORSY A. T.A.: On the main reservoir host of Fasciola in Dakahlia Governorate, Egypt. J. Egypt. Soc. Parasitol., 2005, 35, 243-252.

9. - GETACHEW M., INNOCENT G. T., TRAWFORD A. F., REID S. W. J., LOVE S.: Epidemiological features of fascioliasis in working donkeys in Ethiopia.Vet. Parasitol., 2010, 169, 335-339.

10. - HARIDY F. M., EL-SHERBINY G. T., MORSY T. A.: Some parasitic flukes infecting farm animals in Al-Santa Center, Gharbia Governorate, Egypt. J. Egypt. Soc. Parasitol., 2006, 36, 259-264.

11. - HARIDY F. M., MORSY G. H., ABDU N. E., MORSY T. A.: Zoonotic fascioliasis in donkeys: ELISA (Fges) and postmortem examination in the Zoo, Giza, Egypt. J. Egypt. Soc. Parasitol., 2007, 37, 1101-1110.

12. - HARIDY F. M., MORSY T. A., GAWISH N. I., ANTONIOS T. N., ABDEL GAWAD A. G.: The potential reservoir role of donkeys and horses in zoonotic fascioliasis in Gharbia Governorate, Egypt. J. Egypt. Soc. Parasitol., 2002, 32, 561-570.

Revue Méd. Vét., 2014, 165, 5-6, 167-171

FASCIOLIASIS IN DONKEYS AND PCR-RFLP OF 28S rRNA GENE 171

13. - ASEEB A. N., EL-SHAZLY A. M., ARAFA M. A., MORSY A.T.: A review on fascioliasis in Egypt. J. Egypt. Soc. Parasitol., 2002, 32, 317-354.

14. - HASSLINGER M. A., EL-SEIFY M. A.: Paramphistomatid infestation in equids in Egypt. Berl. Munch. Tierarztl. Wochenschr., 1996, 109, 224-226.

15. - ITAGAKI T., KIKAWA M., SAKAGUCHI K., SHIMO J., TERASAKI K., SHIBAHARA T., FUKUDA K.: Genetic characterization of parthenogenetic Fasciola sp. in Japan on the basis of the sequences of ribosomal and mitochondrial DNA. Parasitology, 2005, 131, 679-685.

16. - KHALIFA R., MONIB M. E. M., MANDOUR A. M.: A study on the parasites infecting equines in Assuit Governorate. Assuit Vet. Med. J., 1988, 20, 67-74.

17. - KRUSE G. O., PRITCHARD M. H.: The collection and preservation of animal parasites. Technical Bulletin No.1. The Harold W. Manter Laboratory, University of Nebraska Press, 1982, pp 141.

18. - LOTFY W. M., EL-MORSHEY H. N., ABOU EL-HODA M., EL-TAWILA M. M., OMAR E. A., FARAG H. F.: Identification of the Egyptian species of Fasciola. Vet. Parasitol., 2002, 103, 323-332.

19. - MAFF.: Manual of Veterinary investigation laboratory techniques. Reference book 1984, 390, Vol. 2, London, 162-184.

20. - MARCILLA A., BARGUES M. D., MAS-COMA S.: A PCR-RFLP assay for the distinction between Fasciola hepatica and Fasciola gigantica. Molec. Cell. Prob., 2002, 16,327-333.

21. - MAS-COMA S. BARGUES M. D.: Human liver flukes: a review. Res. Rev. Parasitol., 1997, 57, 145-218.

22. - MAS-COMA S., RODRIGUE Z. A., BARGUES M. D., VALERO M. A., COELLO J. R., ANGLES R.: Secondary reservoir role of domestic animals other than sheep and cattle in fascioliasis transmission in the Northern Bolivian Altiplano. Res. Rev. Parasitol., 1997, 57, 39- 46.

23. - MAS-COMA S., VALERO M. A., BARGUES M. D.: Chapter 2  Fasciola, lymnaeids and human fascioliasis, with a global overview on disease transmission, epidemiology, evolutionary genetics, molecular epidemiology and control. Adv. Parasitol., 2009, 69,141-146.

24. - MAZYAD S. A., EL-NEMR H. I.: The endoparasites of sheep and goats and shepherd in North Sinai Governorate, Egypt. J. Egypt. Soc. Parasitol., 2002, 32, 119-126.

25. - MORSY T. A., SALEM H. S., HARIDY F. M., RIFAAT M. M., ABO-ZENADAH N. Y., ADEL EL-KADI A. M.: Farm animals’ fascioliasis in Ezbet El-Bakly (Tamyia Center) Al-Fayoum Governorate. J. Egypt. Soc. Parasitol., 2005, 35, 825-832.

26. - PERIAGO M.V., VALERO M. A., ELSABED M., ASHRAfi K., ELWAKEEL A, MOHAMED M.Y., DESQUESNES M., CURTALE F., MAS-COMA S.: First phenotypic description of Fasciola hepatica /Fasciola gigantica intermediate forms from the human endemic Area of the Nile Delta, Egypt. Infect. Genet. Evol., 2008, 8, 51-58.

27. - REBLÁNOVÁ M., SPAKULOVÁ M., OROSOVÁ M., KRÁLOVÁ-HROMADOVÁ I., BAZSALOVICSOVÁ E., RAJSK D.: A comparative study of karyotypes and chromosomal location of rDNA genes in important liver flukes Fasciola hepatica and Fascioloides magna (Trematoda: Fasciolidae). Parasitol. Res., 2011, 109, 1021-1028.

28. - SAFAR E., MIKHAIL E., BASSIOUNI G., EL-BASSIOUNI S., EL-KHOLY H.: Human fascioliasis in some areas in Cairo and Giza Governorates, Egypt. J. Egypt. Soc. Parasitol., 2005, 35, 181-192.

29. - SOULSBY E. J. L.: Helminthes, arthropods and protozoa of domestic Animals. 7th Edn, Bailliere Tindall Publishers, Philadphia, London, Toronto, 1986:175-390.

30. - VALERO M. A., MAS-COMA S.: Comparative infectivity of Fasciola hepatica metacercariae from isolates of the main and secondary reservoir animal host species in the Bolivian Altiplano high human endemic region. Folia Parasitol., 2000, 47, 17-22.

31. - VALERO M. A., PEREZ-CRESPO I., PERIAGO M.V., KHOUBBANE M., MAS- COMA S.: Fluke egg characteristics for the diagnosis of human and animal fascioliasis by Fasciola hepatica  and  F. gigantica. Acta Tropica, 2009, 111, 150-159.

32. - WHO. Report of the WHO Informal Meeting on use of triclabendazole in fascioliasis control. WHO/CDS/NTD/PCT/2007.1.

33. - WHO. In report of the WHO meeting on use of triclabendazole in fascioliasis control. WHO Headquarters, Geneva, Switzerland, 17-18 October 2006. Res. Rev. Parasitol., 2006, 57, 39-46.