Vol. 56, No. 11

Novel Cloning Vectors for Bacillus thuringiensisJAMES A. BAUM,* DOLORES M. COYLE, M. PEARCE GILBERT, CHRISTINE S. JANY,

AND CYNTHIA GAWRON-BURKEEcogen Inc., 2005 Cabot Boulevard West, Langhorne, Pennsylvania 19047-1810

Received 28 June 1990/Accepted 22 August 1990

Seven replication origins from resident plasmids of Bacillus thuringienis subsp. kurstaki HD263 and HD73were cloned in Escherichia coli. Three of these replication origins, originating from plasmids of 43, 44, and 60MDa, were used to construct a set of compatible shuttle vectors that exhibit structural and segregationalstability in the Cry- strain B. thuringiensis HD73-26. These shuttle vectors, pEG597, pEG853, and pEG854,were designed with rare restriction sites that permit various adaptations, including the construction of smallrecombinant plasmids lacking antibiotic resistance genes. The crylA(c) and cryllA insecticidal crystal proteingenes were inserted into these vectors to demonstrate crystal protein production in B. thuringiensis.Introduction of a cloned crylA(c) gene from strain HD263 into a B. thuringiensis subsp. aizawai strainexhibiting good insecticidal activity against Spodoptera exigua resulted in a recombinant strain with an

improved spectrum of insecticidal activity. Shuttle vectors of this sort should be valuable in future geneticstudies of B. thuringiensis as well as in the development of B. thuringiensis strains for use as microbialpesticides.

The gram-positive soil bacterium Bacillus thuringiensisproduces proteinaceous parasporal crystals that are toxic toa select variety of insect species. Over two dozen varieties ofB. thuringiensis representing different flagellar antigens (5)and insecticidal activities against lepidopteran, dipteran, orcoleopteran larvae have been identified (11). Since its intro-duction as a product in the early 1960s, B. thuringiensis hasbecome the major biological pesticide in use worldwide, withseveral subspecies currently being used as active ingredients(3).The components of the parasporal crystals, often referred

to as delta-endotoxins or insecticidal crystal proteins (ICPs),represent a diverse group of proteins that differ extensivelyin structure and insecticidal activity (11). The composition ofICPs found in B. thuringiensis strains varies considerably;even strains of the same serotype can exhibit substantialdifferences in insecticidal activity. ICPs are encoded bygenes typically found on large plasmids (>30 MDa) (10, 13),some of which can be transferred conjugatively. Conjugaltransfer of ICP-encoding plasmids has been successfullyemployed at the commercial level to construct B. thurin-giensis strains with improved insecticidal activities (3). Al-though it provides a "natural" means of altering the ICPgene composition of B. thuringiensis, the use of conjugationis limited to mobilizable genes and strains that are amenableto conjugation and by plasmid incompatibility. A recombi-nant DNA approach to B. thuringiensis strain constructionoffers a greater degree of flexibility than that afforded byconjugation.Numerous ICP genes have been cloned, and their prod-

ucts have been assessed for insecticidal activity (11). Inaddition, an efficient transformation system for B. thurin-giensis has been developed by employing electroporation(15, 17, 23). Thus, it should be possible to manipulate theproduction, regulation, and activity of ICPs by moleculargenetic techniques and to construct improved B. thuringien-sis strains for use as microbial pesticides. The success of this

* Corresponding author.

approach will depend on the availability of suitable cloningvectors.

In this report, we describe the cloning of seven replicationorigins derived from resident plasmids of B. thuringiensissubsp. kurstaki HD263 and HD73 and the construction ofcloning vectors based on three of these replication origins.These vectors have features that should prove useful in thedevelopment of commercial strains of B. thuringiensis and infuture genetic studies of this important organism.

MATERIALS AND METHODSBacterial strains and plasmids. B. thuringiensis subsp.

kuirstaki HD263 and HD73 were obtained from the collectionof Dulmage (8). Strain HD73-26 is a cured derivative ofHD73 that contains a cryptic 4.9-MDa plasmid (7). StrainHD73-26-10 is an HD73-26 transconjugant strain containinga crylA(c) ICP-encoding 44-MDa plasmid from HD263 aswell as the 4.9-MDa plasmid. Strain HD263-6 is a curedderivative of HD263 lacking the 44-MDa plasmid (2). B.thuringiensis subsp. aizawai EG6346 is a cured derivative ofstrain EG6345 that contains several non-crylA ICP genes.Strain EG6345 contains, in addition to the ICP genes foundin EG6346, a cryIA(b) gene located on a 45-MDa plasmid.Both EG6345 and EG6346 were obtained from the Ecogenstrain collection. Escherichia coli TG1 (Amersham Corp.),XL-1 Blue (Stratagene Corp.), and GM2163 (kindly providedby New England BioLabs Inc.) were used as host strains forsubcloning. Plasmids pTZ18u and pTZ19u (U.S. Biochemi-cal Corp.) were used as cloning vectors. Plasmid pMI1101,which harbors the chloramphenicol acetyltransferase gene

(cat) from pC194 (12), was a gift from Michelle Igo.DNA manipulations. Standard recombinant DNA proce-

dures were performed as described by Maniatis et al. (19).Plasmids from B. thuringiensis HD73-26-10 and HD263-6were isolated as described by Kronstad et al. (13). Plasmidsfrom E. coli were prepared by a small-scale alkaline lysisprocedure (19). For Southern blot analysis, DNAs wereresolved on 1% agarose gels (Tris-phosphate buffer [19]) andtransferred to Zeta-probe membranes (Bio-Rad Corp.) byusing the alkaline blotting procedure recommended by the

3420

APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Nov. 1990, p. 3420-34280099-2240/90/113420-09$02.00/0Copyright © 1990, American Society for Microbiology

on May 22, 2021 by guest

http://aem.asm

.org/D

ownloaded from

NOVEL CLONING VECTORS FOR B. THURINGIENSIS 3421

manufacturer. Hybridization probes were prepared by usingthe random primer method of Feinberg and Vogelstein (9).Transformants of B. thuringiensis HD73-26 harboringrecombinant plasmids were analyzed on 0.8% agarose gelsby using a modified Eckhardt lysis procedure (10). Forrestriction enzyme analysis, B. thuringiensis transformantswere grown for 6 h at 30°C in brain heart infusion (Difco)containing 0.5% glycerol. The cells were pelleted in a

microfuge, frozen on dry ice, and thawed at room tempera-ture. DNA was extracted from the cell pellets by using the E.coli alkaline lysis procedure. DNAs were sequenced accord-ing to the dideoxy chain termination method (22) with[cx-355]dATP and the Sequenase DNA sequencing kit (U.S.Biochemical Corp.). Sequencing templates were preparedfrom double-stranded DNA by procedures outlined in theSequenase manual. Synthetic oligonucleotides were gener-

ated on an Applied Biosystems 380B DNA Synthesizer andpurified by the oligonucleotide purification cartridge methodrecommended by the manufacturer.

Transformation of B. thuringiensis. Transformation was

performed by the electroporation procedure of Mettus andMacaluso (20) with the Bio-Rad Gene Pulser apparatus.Electroporated cells were grown in Luria broth containing0.2 ,ug of chloramphenicol per ml for 1 to 2 h at 37°C beforeplating on NSM plates (23 g of Bacto nutrient agar per liter,1 mM MgCl2, 0.7 mM CaCl2, 0.05 mM MnCl2) containing 5,ug of chloramphenicol per ml.

Cloning of an ICP gene from HD263. A cryIA(c) gene

located on the 44-MDa plasmid of B. thuringiensis HD263was cloned in E. coli by using the bacteriophage cloningvector Lambda-Dash (Stratagene). Plasmid DNA from thetransconjugant strain HD73-26-10, which harbors the 44-MDa plasmid, was partially digested with MboI to yieldDNA fragments in the 15- to 30-kb range. This DNA was

then dephosphorylated with calf intestinal alkaline phos-phatase (Boehringer Mannheim Corp.), ligated to BamHI-digested bacteriophage vector DNA, and packaged intophage particles by using packaging extracts prepared from E.coli BH2688 and BH2690 (19). Strain NM539 (Stratagene)was used as the host strain for phage propagation. Clonesharboring the crylA(c) gene were identified by plaque hy-bridization with a 720-bp EcoRI fragment from the cryIA(a)gene of HD263 as a probe (unpublished data, this laborato-ry). The identity of the cryIA(c) gene was confirmed byrestriction endonuclease mapping.ICP preparation and SDS-PAGE. B. thuringiensis strains

were grown in M55 medium, which contained the following(per liter): 1.5 g of potato dextrose broth, 2.65 g of nutrientbroth, 0.1 g of L-methionine, 330 [lI of 1 M MgCl2, 10 ,ul of0.5 M MnCl2, and 50 ml of 20x M55 salts [176 g of NaCl, 100g of K2HPO4, 100 g of KH2PO4, 13.3 g of (NH4)2SO4, and 4.2g of citric acid per liter, 20 puM CuCI2 2H20, 20 p.MNa2MoO4, 20 puM Zn-sodium citrate)]. Strains were grown

at 30°C for 3 days until fully sporulated and lysed. Spore-crystal preparations were examined by phase-contrast mi-croscopy and sodium dodecyl sulfate-polyacrylamide gelelectrophoresis (SDS-PAGE). Samples (100 ,ul) from thelysed cultures were centrifuged for 5 min in a microfuge, andthe pellets were washed once with 1 ml of 10 mM Trishydrochloride (7.5)-l mM EDTA-1 mM EGTA. The spore-crystal suspensions were centrifuged again, and the resultantpellets were dried and suspended in 100 pul of 2x Laemmlibuffer at 95°C for 5 min (14). Crystal proteins were resolvedon either 7.5 or 10% gels. Crystal protein concentrationswere determined by densitometry with a Molecular Dynam-

500 bp

cat plac ori amp f- ........4.- -~~~~~~~~~~~~..................I- _ ~~~~~pTZ1 8u EE E

S BSmEStKSmBXbSPSpHFIG. 1. Linear restriction map of replicon cloning vector

pEG588. An EcoRI fragment from pMI1101 harboring the chloram-phenicol acetytransferase (cat) gene of pC194 (dark-shaded box)was inserted into the EcoRI site of the E. coli vector pTZ18u(light-shaded box) as shown. Restriction sites: B, BamHI; E, EcoRI;H, Hindlll; K, KpnI; P, PstI; S, Sall; S, SmaI; Sp, SphI; St, SstI;Xb, XbaI. Other abbreviations: f, fl phage replication origin; ori,replication origin of pTZ18u; amp, beta-lactamase gene; cat, chlor-amphenicol acetyltransferase gene.

ics model 300A computing densitometer and purifiedCryIA(c) and CryllA proteins as standards.Western blot analysis. Crystal proteins resolved on 7.5%

SDS-polyacrylamide gels were transferred to nitrocellulosefilters (Millipore HATF, 0.45-,um pore size) by electropho-resis in 12 mM Tris-96 mM glycine-20% (vol/vol) methanol.The filters were blocked by incubation in 5% (wt/vol) nonfatdry milk-10 mM Tris hydrochloride (pH 7.5)-0.9% (wt/vol)NaCl-0.09% (wt/vol) sodium azide for 1 h at room temper-ature. After a 10-min rinse in 0.3% Tween 80, the filters wereincubated with CryIA(c) protein-specific antibodies at a1:200 dilution in TBSN (10 mM Tris hydrochloride, 0.9%NaCl, 0.1% [wt/vol] globulin-free bovine serum albumin,0.09% sodium azide, 0.05% [vol/vol] Triton X-405) for 1 h.After subsequent washes with TBSN, TBSN-0.05% SDS,and TBSN, the filters were incubated for several hours witha second antibody consisting of anti-mouse alkaline phos-phatase-conjugated immunoglobulin G (Sigma ChemicalCo.) at a 1:1,000 dilution in TBSN. After thorough washingwith TBSN and double-distilled water, the alkaline phos-phatase-specific color reaction was developed with 5-bromo-4-chloro-3-indoyl phosphate and Nitro Blue Tetrazolium(Sigma).

Bioassay. Activity against lepidopteran larvae was deter-mined by topically applying 100 p1l of serially diluted spore-crystal preparations to 3 ml of an agar-based artificial diet ina plastic feeding cup (600-mm2 surface). One neonate larvawas placed in each cup and scored for mortality after 7 days.Fifty percent lethal concentrations were determined byprobit analysis as described by Daum (4) by an eight-dosetesting procedure with 30 larvae per dose. The assays wereperformed in duplicate.

RESULTSCloning of B. thuringiensis replication origins. To facilitate

the cloning of B. thuringiensis plasmid replication origins, aplasmid was constructed that requires such sequences toreplicate in B. thuringiensis. Briefly, a 1.5-kb EcoRI frag-ment from pMI1101 containing the cat gene of pC194 (12)was inserted into the EcoRI site of the E. coli cloning vectorpTZ18u to provide a selectable marker that is functional inB. thuringiensis. The resultant construct, pEG588, contain-ing the desired orientation of the cat gene is shown in Fig. 1.This plasmid, as expected, would not replicate in B. thu-ringiensis (data not shown).The resident plasmids of B. thuringiensis HD263 were

VOL. 56, 1990

on May 22, 2021 by guest

http://aem.asm

.org/D

ownloaded from

APPL. ENVIRON. MICROBIOL.

S $ S 07

FIG. 2. Southern blot analysis of resident plasmids in B. thu-ringiensis HD263-6 (A) and HD73-26-10 (B). CsCl gradient-purifiedplasmid DNAs were resolved by agarose gel electrophoresis andtransferred to nylon membranes for hybridization analysis. Thereplication origin clones listed in Table 1, representing seven dif-ferent B. thuringiensis plasmid replication origins, were used as

hybridization probes: 1, pEG851; 2, pEG599; 3, pEG588-14a; 4,pEG588-23a; 5, pEG588-20a; 6, pEG588-4a; 7, pEG588-2. Finalmembrane washes were performed in 0.3x SSC (1x SSC is 0.15 MNaCl plus 0.015 M sodium citrate)-0.1% SDS at 65°C. L, linearDNA fragments; M, linear lambda DNA.

chosen as the source of plasmid replication origins. StrainHD263 contains resident plasmids of 130, 110, 60, 44, 43,7.5, 5.4, 5.2, and 4.9 MDa (2). This strain also containsseveral ICP genes of the cryIA and cryII class, several ofwhich have been cloned and characterized in our laboratory(6, 20; this report). To clone the replication origin from the44-MDa plasmid of HD263, plasmid DNA from HD73-26-10(a transconjugant strain harboring this plasmid and a 4.9-MDa plasmid) was digested with MboI to yield DNA frag-ments in the 2- to 15-kb range. An equimolar concentrationof this DNA was ligated to BamHI-digested pEG588, and theentire ligation reaction was used to transform the Cry- strainB. thuringiensis HD73-26 to chloramphenicol resistance(Cm'). Twenty-one Cmr transformants were recovered andanalyzed on agarose gels for the presence of novel plasmidsby using a modified Eckhardt lysis procedure (10). The novelrecombinant plasmids were designated pEG588-1 throughpEG588-21. The smallest B. thuringiensis replication origininsert among the 21 clones, isolated from plasmid pEG588-8(see Fig. 3), was used as a hybridization probe for Southernblot analysis. Recombinant plasmids from 18 transformantshybridized strongly to the pEG588-8 probe (data not shown).A subclone of the replication origin fragment of pEG588-8,designated pEG851, was subsequently shown to hybridize tothe 44-MDa plasmid in strain HD73-26-10 (Fig. 2). The threeremaining Cmr transformants contained novel plasmids,designated pEG588-2, pEG588-18, and pEG588-21, that hy-bridized strongly on Southern blots to a hybridization probeconsisting of the 4.9-MDa plasmid of strain HD73-26 (datanot shown). These HD73-26 transformants also showed a

reduction in, or absence of, the resident 4.9-MDa plasmid ofstrain HD73-26, suggesting that the novel plasmids exhibitsome degree of incompatibility with the 4.9-MDa plasmid(data not shown). The replication origin fragment inpEG588-2 was subsequently shown to hybridize to the4.9-MDa plasmid of strains HD73-26-10 and HD263-6 (Fig.2).The replication origins of other plasmids derived from

strain HD263 were obtained in similar fashion by using

TABLE 1. B. thuringiensis plasmid replication origin clones

Clone Resident InsertClone plasmid" (MDa) size (kb)

pEG588-2 4.9 6.8pEG588-20a 5.2 6.0pEG588-4a 5.4 6.2pEG588-23a 7.5 5.4pEG599b 43 2.8pEG851' 44 2.25pEG588-14a 60 2.3

a Resident B. thuringiensis plasmid from which the replication origin wasderived. Only representative replication origin clones are listed.

b Subcloned from pEG588-13a (Fig. 3).' Subcloned from pEG588-8 (Fig. 3).

plasmid DNA isolated from strain HD263-6, a cured deriv-ative of HD263 lacking the 44-MDa plasmid. A total of 24replication origin clones (pEG588-la through pEG588-24a)were obtained from HD263-6, and these were compiled intosix distinct homology groups based on Southern blot analy-ses with replication origin inserts from several recombinantplasmids as hybridization probes (data not shown).

Subsequently, the resident B. thuringiensis plasmid fromwhich each homology group was derived was identified bySouthern blot analysis of HD263-6 and HD73-26-10 plasmidsby using the smallest replication origin insert of each homol-ogy group as a hybridization probe (Table 1, Fig. 2). In-cluded in this analysis were the replication origin inserts inpEG851 and pEG588-2, derived from the 44- and 4.9-MDaplasmids, respectively. Interestingly, the replication originfragments from the 4.9-, 7.5-, 43-, 44-, and 60-MDa plasmidsshowed no homology with other B. thuringiensis plasmids.The recombinant plasmid containing the replication originfragment from the 5.4-MDa plasmid (pEG588-4a) showedpartial homology to the 4.9-MDa plasmid but not vice versa.In addition, the recombinant plasmid containing the replica-tion origin fragment from the 5.2-MDa plasmid (pEG588-20a)showed strong homology to the 43-MDa plasmid but not viceversa.

Construction of B. thuringiensis-E. coli shuttle vectors. Thesmallest replication origin inserts obtained from the 43-, 44-,and 60-MDa plasmids of B. thuringiensis HD263 were con-tained on plasmids pEG588-13a, pEG588-8, and pEG588-14a, respectively (Fig. 3). The replication origins from the43- and 44-MDa plasmids were subsequently localized tosmaller restriction fragments by subcloning directly into B.thuringiensis HD73-26. Plasmid pEG599, containing thereplication origin from the 43-MDa plasmid (ori 43), con-sisted of a 2.8-kb XbaI fragment from pEG588-13a insertedinto the XbaI site of pEG588 (Table 1, Fig. 3). PlasmidpEG851, containing the replication origin from the 44-MDaplasmid (ori 44), consisted of the 3.75-kb EcoRI-HindIIIfragment of pEG588-8 inserted into pTZ19u (cleaved at theEcoRI and HindIII sites), thereby replacing the multiplecloning site of pTZ19u with a DNA fragment containing thecat gene and the B. thuringiensis replication origin (Table 1,Fig. 3). Plasmids pEG851, pEG599, and pEG588-14a werefound to replicate stably in B. thuringiensis HD73-26: recom-binants harboring these plasmids yielded 96 to 100% Cmrcolonies after 18 generations in the absence of selection.Because of their apparent stability and the small size of theirinserts, these three plasmids were selected for developmentas a set of compatible shuttle vectors.

Figure 4 illustrates the strategy used to construct a B.

3422 BAUM ET AL.

on May 22, 2021 by guest

http://aem.asm

.org/D

ownloaded from

NOVEL CLONING VECTORS FOR B. THURINGIENSIS 3423

1 kb

H

XbS PSpH

* cat s ori 44 *plac amp f_ 1 ~~~~~~~~~~~~~~~~~~.::...... .....

E sp H pTZ1 9u E

cat s B ori 60 f amp plac

H XbS PSpH pTZI8u

pEG588-1 3a

cat-S P H H Xb

I I I I

plac amp f4 -40

E pTZ18U H Sp PS Xb

ZI. pTZl 8uXb S P Sp H

ori 43 Sp cat_!~~~

E Xb B Sm K St E Sm B'S E

FIG. 3. Linear restriction maps of replication origin clones from the 43-, 44-, and 60-MDa plasmids of strain HD263. For clarity, thereplication origins have been labeled ori 44 (44-MDa plasmid), ori 60 (60-MDa plasmid), and ori 43 (43-MDa plasmid). Light-shaded boxesrepresent pTZ18u or pTZ19u sequences. Dark-shaded boxes represent the cat gene fragment from pMI1101. Open boxes represent replicationorigin fragments from B. thuringiensis. Abbreviations for restriction endonuclease sites are given in the legend to Fig. 1. Plasmids pEG851and pEG599 are subclones derived from plasmids pEG588-8 and pEG588-13a, respectively.

thuringiensis-E. coli shuttle vector based on the replicationorigin of the 44-MDa plasmid (ori 44). An SphI site locateddownstream of the cat gene on pEG851 was removed bydigesting plasmid DNA with SphI, using T4 polymerase toremove the 3' overhangs, and ligating the blunt ends to-gether. Subsequently, the EcoRI site was replaced with an

NotI site by cleaving the plasmid with EcoRI and insertingan NotI linker with EcoRI-compatible ends. Finally, a mul-tiple cloning site (MCS) was inserted at the unique HindIIIsite to yield the shuttle vector pEG597. The sequence andorientation of the MCS were confirmed by DNA sequenceanalysis.The pair of NotI sites in pEG597 allows for subsequent

deletion of the pTZ19u segment from the vector, therebyconverting the shuttle vector into a B. thuringiensis plasmidwith a single antibiotic resistance gene. The pair of Sall sitesenables recovery of a DNA fragment containing the B.thuringiensis replication origin and any gene inserted intothe multiple cloning site. This feature provides a means ofconstructing an ICP-encoding plasmid composed entirely ofB. thuringiensis DNA or, alternatively, a B. thuringiensisplasmid combined with a different selectable or nonselect-able marker gene (see Discussion).The strategy used to construct shuttle vectors based on

the replication origins isolated from the 60-MDa (ori 60) and43-MDa (ori 43) plasmids is illustrated in Fig. 5. The repli-cation origin from the 60-MDa plasmid is contained on a

2.3-kb fragment flanked by SalI sites in plasmid pEG588-14a(Fig. 3). In the process of cloning ori 60, the BamHI sitepresent in pEG588 was restored at one end of the cloned

insert. The 2.3-kb Sall fragment was ligated to the 4.36-kbSalI fragment of pEG597 (Fig. 4), containing the cat gene

and pTZ19u, to yield pEG852 (Fig. 5). An SfiI site was

inserted at the XbaI site by using an SfiI-XbaI linker thatrestores the XbaI site on one side of the inserted linker. Thedesired orientation shown in Fig. 5 was selected by DNAsequence analysis. Subsequently, an MCS was inserted atthe unique BamHI site to yield the shuttle vector pEG853.The orientation of the MCS was selected by restrictionenzyme analysis and confirmed by sequence analysis. Sub-sequently, the 2.8-kb XbaI fragment from pEG599 (Fig. 3)was inserted in place of the 2.3-kb XbaI fragment of pEG853,thus replacing ori 60 with ori 43 to yield the shuttle vectorpEG854 (Fig. 5). Plasmid pEG854 contained all of therestriction site modifications present in pEG853. In additionto the pairs of NotI and Sall sites found in pEG597, plasmidspEG853 and pEG854 also contained a pair of Sfil sitesflanking the B. thuringiensis replication origin fragment andmultiple cloning site. The pair of XbaI sites flanking the B.thuringiensis replication origin segment could be used toconstruct additional shuttle vectors, as illustrated by theconstruction of pEG854 (Fig. 5). The characteristics ofshuttle vectors pEG597, pEG853, and pEG854 are listed inTable 2.

Expression of crystal protein genes in B. thuyingiensis. Todemonstrate the utility of vectors pEG597, pEG853, andpEG854 for expressing ICP genes in B. thuringiensis, twodistinct crystal protein genes were inserted into each of thethree plasmids. The first gene, cryIIA, previously referred toas cryBI (6), encodes the P2 delta-endotoxin or CrylIA ICP

E cat sI, *~.

pEG588-8

Sp

f amp.4- -

pEG851

pEG588-14a

plac

EpTZ18u

EI Isp E

E

E

E

Sp

pEG599

f amp plac

E

I6MEMEEmisw I......................................... 1.

I I I I II

VOL. 56, 1990

I

I

on May 22, 2021 by guest

http://aem.asm

.org/D

ownloaded from

APPL. ENVIRON. MICROBIOL.

1 kb

cat > S orl 44 < Etlac ^ amp f~~~~~~~~~~~~~~~~~~~~.4.- ......

E Sp H pTZ19u E

Sph IT4 POLYMERASE + dNTPsT4 LIGASE

E S H E

I Eco RIINSERT Not I LINKER

N S H N

I Hind IIIINSERT MCS

cat orl 44 plac amp f4- 4 -'

.......................

N S l ZpTZ1 9u

B X P St Sp Sm H E S N

N

FIG. 4. Construction of shuttle vector pEG597. The figure depicts the strategy used to remove the SphI (Sp) site, replace the EcoRI (E)site with a Notl (N) site, and insert an MCS as described in Results. The sequence of the MCS (top strand), starting with the BamHI site,is 5' GGATCCCTCGAGCTGCAGGAGCTCGCATGCCCCGGGAAGCTTGAATTCGTCGACGCGGCCGC 3'. X, XhoI. Abbreviations forthe remaining restriction endonuclease sites are given in the legend to Fig. 1.

that exhibits insecticidal activity against both lepidopteranand dipteran larvae (6, 24). The second gene, cryIA(c),encodes the P1 delta-endotoxin or CryIA(c) ICP, whichexhibits relatively potent insecticidal activity against a vari-ety of lepidopteran insect pests (11).The cryIIA gene, located on a 4.0-kb BamHI-HindIII

fragment in pEG201 (6), was inserted into the BamHI andHindlll sites of pEG597 to generate pEG864 (Table 2). Thesame gene was inserted as a 4.0-kb BamHI-HpaI fragmentinto the BamHI and HpaI sites of pEG853 and pEG854to yield plasmids pEG858 and pEG862, respectively. ThecryIA(c) gene, located on a 5.0-kb SphI-SalI fragment iso-lated from a bacteriophage clone of HD73-26-10 plasmidDNA (see Materials and Methods), was inserted into allthree vectors at the SphI and XhoI sites to yield plasmidspEG863, pEG857, and pEG861. The six constructs are listedin Table 2.The ICP-encoding plasmids (Table 2) were introduced into

the Cry- strain HD73-26 by electroporation, and the trans-

formants were examined for crystal protein production.Transformants were first characterized by restriction en-zyme analysis of plasmid DNAs to confirm the structuralstability of the recombinant plasmids (data not shown).Subsequently, the transformants were grown for 3 days at30°C in M55 medium in the presence or absence of 5 ,ug ofchloramphenicol per ml. Crystals harvested from the lysedcultures were viewed by phase-contrast microscopy andanalyzed by SDS-PAGE (Fig. 6A). HD73-26 recombinantsharboring either pEG858, pEG862, or pEG864 producedlarge rounded or cuboidal crystals, often larger than thespore, that yielded a -70-kDa protein on SDS gels. Thisprotein comigrated with purified CrylIA crystal protein.Similarly, HD73-26 recombinants harboring either pEG857,pEG861, or pEG863 produced bipyramidal crystals typicalof cryIA-type crystal proteins. The crystal protein fromthese recombinant strains comigrated with purified CryIA(c)crystal protein on SDS gels at an apparent molecular mass of-133 kDa (Fig. 6A).

pEG851

pEG597

3424 BAUM ET AL.

on May 22, 2021 by guest

http://aem.asm

.org/D

ownloaded from

NOVEL CLONING VECTORS FOR B. THURINGIENSIS 3425

1 kb

orl 60 B S

cat +plor60 4Wac amp f

~... - l

N SXb H EBSN pTZ19u N

Xba II INSERT Sfi I LINKER~~~~~~~~~~~~..........................................................

N SSfXb H EBSN N

Bam H Ij INSERT MCS

cat orl 60 ptac amp f- 4 ,.,- 4 - -..

S Sf Xb H E pTZ19u N

Xb P KSm AvBX St C Hp Sp Eg Sf SN(MCS)

catpEG854

N

orl 43

Xba IREPLACE ORI 60 FRAGMENT WITH

Xba I FRAGMENT FROM pEG599CONTAINING ORI 43

plac amp f.4- ~- -~

S Sf Xb N

Xb PKSmAvBXStCHpSp Eg SfSNFIG. 5. Construction of shuttle vectors pEG853 and pEG854. The 2.3-kb Sall fragment (ori 60) from pEG588-14a was ligated to the 4.35-kb

SalI fragment (pTZ19u-cat) from pEG597 to give pEG852. An Sfil (Sf) site was inserted at the XbaI (Xb) site, and an MCS was inserted atthe BamHI (B) site as shown to give pEG853. Removal of ori 60 by XbaI digestion and insertion of the 2.8-kb XbaI fragment (ori 43) frompEG599 (Fig. 3) yielded pEG854. The sequence of the multiple cloning site (top strand), starting with the XbaI site, is 5' TCTAGACTGCAGGTACCCGGGCCTAGGATCCCTCGAGCTCATCGATGTTAACGCATGCGGCCGATCGGGCCGATCCGTCGACGCGGCCGC 3'.Av, AvrII; C, Clal; Eg, EagI; Hp, HpaI. Abbreviations for the remaining restriction sites are given in the legend to Fig. 1.

Plasmid pEG863 (Table 2) contained both the replicationorigin and the cryIA(c) gene from the 44-MDa plasmid ofstrain HD263. Strains HD73-26(pEG863) and HD73-26-10(containing the 44-MDa plasmid) were used to compare thelevels of CryIA(c) protein produced by identical genes

located on related native and recombinant plasmids in thesame host background. SDS-PAGE of crystal preparationsfrom strains HD73-26(pEG863) and HD73-26-10 indicatedthat pEG863 and the 44-MDa plasmid yielded similar levelsof CryIA(c) protein (Fig. 6B).

Production of crystal protein in the recombinant strains

was not noticeably affected by the presence or absence ofchloramphenicol, suggesting that the ICP-encoding plasmidsreplicate stably. In subsequent stability tests, HD73-26 re-

combinants containing ICP-encoding plasmids derived frompEG597 yielded 70 to 80% Cmr colonies after 18 generationsin the absence of selection, whereas recombinants contain-ing ICP-encoding plasmids derived from pEG853 or pEG854yielded 97 to 99% Cmr colonies after 18 generations in theabsence of selection.

Introduction of crylA(c) into a complex strain background.An ICP-encoding recombinant plasmid was introduced into a

S Xb

pEG852

pEG853N

........... ......................

VOL. 56, 1990

l

on May 22, 2021 by guest

http://aem.asm

.org/D

ownloaded from

APPL. ENVIRON. MICROBIOL.

TABLE 2. Shuttle vectors and derivatives

Plasmid Size (kb) Relevant characteristics

pEG597 6.6 Contains ori 44pEG853 6.6 Contains ori 60pEG854 7.2 Contains ori 43pEG863 11.6 pEG597 + cryIA(c), ori 44pEG864 10.6 pEG597 + cryIIA, ori 44pEG857 11.6 pEG853 + cryIA(c), ori 60pEG858 10.6 pEG853 + cryIIA, ori 60pEG861 12.2 pEG854 + cryIA(c), ori 43pEG862 11.2 pEG854 + cryIIA, ori 43

B. thuringiensis strain harboring multiple ICP genes toexamine the effect of the cloned ICP gene on insecticidalactivity. Specifically, plasmid pEG863 [containing crylA(c)]was introduced into strain EG6346, a novel B. thuringiensisstrain that exhibits good insecticidal activity againstSpodoptera exigua but lacks cryIA-type genes. For compar-ison, the related strain EG6345 (see Materials and Methods)was also tested in the bioassay. Spore-crystal preparationsof EG6345, EG6346, and the recombinant strain EG6346(pEG863) were prepared from lysed M55 cultures and exam-ined by SDS-PAGE (Fig. 7A) and Western blot analysis (Fig.7B). Western blot analysis with CryIA(c) protein-specificantibodies confirmed that CryIA(c) protein was produced inthe recombinant strain EG6346(pEG863) but not in strainsEG6345 and EG6346 (Fig. 7B). Interestingly, CryIA(c) pro-duction appeared to be higher in the recombinant strainHD73-26(pEG863). The spore-crystal preps were used di-rectly in quantitative bioassays against a variety of insectspecies (Table 3). Introduction of pEG863 into EG6346enhanced the insecticidal activity of the strain against He-liothis zea, Heliothis virescens, Trichoplusia ni, Ostrinia

A

D073-26 RECOMBRIA

-

a 40t4c

FIG. 6. SDS-PAGE analysis of spore-crystal preparations from

HD73-26 recombinant strains harboring crystal protein genes. (A)

Strains harboring cryIA(c)-containing recombinant plasmids pro-

duce a CryIA-type protein, whereas strains harboring cryIIA -con-taining recombinant plasmids produce a CrylIA-type protein.Recombinant strains are designated according to ICP-encodingplasmids as listed in Table 2. Purified P1 [CrylA(c)] and P2 (CryIlA)crystal proteins were included as standards. M55 cultures were

grown in the presence (+) or absence (-) of 5 p.g of chloramphenicol

per ml. (B) Strains HD73-26(pEG863) and HD73-26-10 produce

comparable levels of CryIA(c) toxin. Strain HD73-26-10 is a trans-

conjugant strain of HD73-26 harboring the cryIA(c)-containing 44-

MDa plasmid of strain HD263.

nubilalis, and Plutella xylostella and maintained the activityof the strain against S. exigua. Overall, the insecticidalactivity of the recombinant strain was also significantlybetter than that of the cryIA(b)-containing strain EG6345.

DISCUSSION

In this report we describe the cloning of seven plasmidreplication origins from B. thuringiensis subsp. kurstakiHD263 and HD73 and the construction ofB. thuringiensis-E.coli shuttle vectors pEG597, pEG853, and pEG854, contain-ing replication origins from the resident 44-, 60-, and 43-MDaplasmids of strain HD263, respectively.These shuttle vectors were designed to facilitate the

manipulation of cloned ICP genes and plasmid replicationorigins in B. thuringiensis. For example, restriction sites forNotI, Sall, and Sfil were introduced into the plasmids toallow for the systematic excision of non-B. thuringiensisDNA after the cloning of ICP genes in E. coli and before thetransformation of B. thuringiensis. Restriction sites for NotIand Sfil are well suited for this purpose, since they should beexceptionally rare in the B. thuringiensis genome (30%G+C). Deletion of the pTZ19u portion of the vectors byNotI digestion and self-ligation provides a convenient andreliable means of constructing small B. thuringiensis plas-mids containing a single selectable marker gene, cat. The catgene can be used to monitor or maintain the stability ofICP-encoding recombinant plasmids during fermentation.However, a desirable feature of live recombinant B. thurin-giensis strains destined for use as biopesticides would pre-sumably be the absence of DNA from other biologicalsources, particularly antibiotic resistance genes. To this end,self-ligated Sfil or Sall fragments containing a B. thuringien-sis replication origin and an ICP gene (inserted into themultiple cloning site) could be introduced into B. thuringien-sis by cotransformation with an unstable selectable plasmid,resulting in small ICP-encoding plasmids devoid of foreignDNA. At the very least, DNA fragments containing an ICPgene and a B. thuringiensis replication origin could becombined with alternative marker genes.

Other features of the vectors are worth noting. Thepositions of the XbaI sites in pEG853 and pEG854 permit thesubstitution of B. thuringiensis replication origin fragments,thereby facilitating the construction of additional vectors.The lac promoter from pTZ19u is oriented in such a waythat, with the proper manipulations, cloned ICP genes can beexpressed in E. coli as well as in B. thuringiensis. Thisfeature could be useful for genetic studies of ICP structureand function. Adjacent to the lac promoter is the T7 RNApolymerase promoter, useful for the in vitro synthesis ofRNA. In addition, the fl replication origin can be used in E.coli to generate single-stranded DNA suitable for DNAsequence analysis and site-directed mutagenesis. Finally,since the three replication origins were derived from com-patible plasmids, they could provide the means for con-structing complex B. thuringiensis strains de novo.

Shuttle vectors containing cryIA(c) or cryIIA yieldedsignificant amounts of crystal protein when introduced intothe Cry- strain HD73-26. In the case of the cryIIA-contain-ing plasmids, the amount of CryllA protein produced (0.17to 0.25 ,ug of protein per ,ul of M55 culture lysate) was four-to fivefold higher than that normally obtained with B. thu-ringiensis HD263. Comparable results have been obtainedwith cryIIA-containing recombinant plasmids that employthe replication origin from pBC16 (J. Chambers, A. Jelen,and C. Gawron-Burke, unpublished data). CryIA(c) protein

3426 BAUM ET AL.

on May 22, 2021 by guest

http://aem.asm

.org/D

ownloaded from

NOVEL CLONING VECTORS FOR B. THURINGIENSIS 3427

C,, V0

CI 4D et e

0 co cw 0 0

:C 'A iS|XE:X-.: i t.a.......04 CE) 0oP0 0* 0 0

wB

FIG. 7. SDS-PAGE (A) and Western blot (B) analyses of duplicate spore-crystal preparations from B. thuringiensis EG6345, EG6346, andEG6346(pEG863). (A) Three protein bands are detected in crystal preparations from strain EG6345, and two protein bands are detected incrystal preparations from the related strain EG6346. (B) Western blot analysis using antibodies specific for the CryIA(c) protein demonstratesexpression of the cryIA(c) gene in strain EG6346(pEG863).

production in the HD73-26 recombinant strains was esti-mated to be 0.2 to 0.3 j.ig of protein per p,l of M55 culturelysate, approximately twofold lower than the amount ofCryIA protein produced by strains such as HD1 or HD263,which harbor multiple cryIA-type genes. The comparablelevels of CryIA(c) protein produced by the recombinantplasmid pEG863 and the cryIA(c)-containing 44-MDa plas-mid in strain HD73-26 suggest that ICP-encoding recombi-nant plasmids may, in some instances, behave similarly toICP-encoding native (resident) plasmids in B. thuringiensis.The expression of ICP genes on the shuttle vectors still

appears to be linked to sporulation in B. thuringiensis, sincecrystal protein could only be observed by microscopy insporulating cultures. Mettus and Macaluso (20) have shownthat the expression of cryIA and crylIA genes introducedinto B. thuringiensis on recombinant plasmids is sporulationdependent, provided transcription is directed by the nativeICP gene promoter. Experiments employing translationalfusions between crylIIA or crylA(c) and lacZ suggest thatthe sporulation-linked regulation of these genes is main-tained on shuttle vectors, provided there is no transcriptionfrom vector-borne promoters proceeding through the crygene (Baum and Jelen, unpublished data).Western immunoblot analysis indicates that the produc-

tion of CryIA(c) protein in strain HD73-26(pEG863) isgreater than that in strain EG6346(pEG863). This may be dueto the additional ICP genes contained in EG6346 that pre-

sumably compete with cryIA(c) for transcriptional and/ortranslational factors. It is known, for instance, that thepromoter regions of some crystal protein genes are highlyconserved and appear to require a specific RNA polymerasecontaining a new sigma subunit (1, 11). Although the level ofCryIA(c) production in strain EG6346(pEG863) is lower thanthat observed in strain HD73-26(pEG863), the EG6346recombinant strain exhibits significant improvements in in-secticidal activity over the recipient strain, EG6346.Other shuttle vectors employing plasmid replication ori-

gins from B. thuringiensis have been described in the liter-ature. Small cryptic plasmids from B. thuringiensis havebeen cloned directly into E. coli (16, 18, 21), resulting inbifunctional vectors, but the size of many of these constructslimits their usefulness as shuttle vectors. Lereclus et al. (15)have reported the construction of a shuttle vector for B.thuringiensis by employing a replication origin fragmentfrom the small cryptic plasmid pHT1030 of B. thuringiensissubsp. thuringiensis. Shuttle vectors based on pHT1030(e.g., pHT3101) appear to exhibit segregational stability inBacillus subtilis (16).The shuttle vectors described in this report have features

that should facilitate the development of improved B. thu-ringiensis-based microbial insecticides. The vectors can beused to construct B. thuringiensis strains with novel combi-nations of ICP genes, resulting in improved insecticidalactivities against a broader spectrum of target pests. The

TABLE 3. Insecticidal activity of native and recombinant B. thuringiensis strainsa

LC50, ng of ICP/cm2 (95% confidence interval)Strain

Heliothis zea S. exigua Ostrinia nubilalis Heliothis virescens Trichoplusia ni Plutella xylostella

EG6345 48.0 (39.5-59.7) 9.3 (5.0-15.0) 2.0 (1.4-2.8) >7.6 16.0 (8.3-28.3) >7.6EG6346 54.2 (44.2-68.7) 15.1 (12.1-18.9) 6.1 (4.8-7.9) >6.1 22.3 (8.1-67.6) >6.1EG6346(pEG863) 21.6 (17.6-27.5) 8.9 (7.3-10.9) 1.5 (0.9-3.1) 2.6 (1.8-4.1) 5.2 (4.2-6.3) 1.0 (0.4-1.5)

a Bioassays were performed on spore-crystal preparations from M55 liquid cultures.

VOL. 56, 1990

on May 22, 2021 by guest

http://aem.asm

.org/D

ownloaded from

APPL. ENVIRON. MICROBIOL.

segregational stability of these vectors, and the apparentsporulation-linked regulation of ICP genes contained on suchvectors, will permit detailed studies of ICP gene regulation inthe native host. Last, further investigations of the B. thu-ringiensis plasmid replication origins will shed light on themechanisms of plasmid replication and maintenance in thiscommercially important organism.

ACKNOWLEDGMENTS

We thank R. Gene Groat and James Mattison for supplying uswith CryIA(c)-specific antibodies, Amy Jelen for assistance with theWestern blot analysis, and William Donovan for his critical readingof the manuscript.

LITERATURE CITED1. Brown, K. L., and H. R. Whiteley. 1988. Isolation of a Bacillus

thuringiensis RNA polymerase capable of transcribing crystalprotein genes. Proc. Natl. Acad. Sci. USA 85:4166-4170.

2. Carlton, B. C., and J. M. Gonzalez, Jr. 1985. Plasmids anddelta-endotoxin production in different subspecies of Bacillusthuringiensis, p. 246-252. In J. A. Hoch and P. Setlow (ed.),Molecular biology of microbial differentiation. American Soci-ety for Microbiology, Washington, D.C.

3. Currier, T. C., and C. Gawron-Burke. 1989. Commercial devel-opment of Bacillus thuringiensis bioinsecticide products, p.111-143. In J. P. Nakas and C. Hagedorn (ed.), Biotechnologyof plant-microbe interactions. McGraw-Hill Book Co., NewYork.

4. Daum, R. J. 1970. Revision of two computer programs for probitanalysis. Bull. Entomol. Soc. Am. 16:10-15.

5. de Barjac, H. 1981. Identification of H-serotypes of Bacillusthuringiensis, p. 35-43. In H. D. Burges (ed.), Microbial controlof pests and plant diseases 1970-1980. Academic Press, Inc.,New York.

6. Donovan, W. P., C. C. Dankocsik, M. P. Gilbert, and C.Gawron-Burke. 1988. Amino acid sequence and entomocidalactivity of the P2 crystal protein. J. Biol. Chem. 263:561-567.

7. Donovan, W. P., J. M. Gonzalez, Jr., M. P. Gilbert, and C.Dankocsik. 1988. Isolation and characterization of EG2158, anew strain of Bacillus thuringiensis toxic to coleopteran larvae,and nucleotide sequence of the toxin gene. Mol. Gen. Genet.214:365-372.

8. Dulmage, H. T., C. C. Beegle, H. de Barjac, D. Reich, G.Donaldson, and J. Krywienczyk. 1982. Bacillus thuringiensiscultures available from the U.S. Department of Agriculture.U.S.D.A.-A.R.S. agricultural reviews and manuals, ARM-S-30/Oct. U.S. Department of Agriculture, Agricultural ResearchService, New Orleans.

9. Feinberg, A. P., and B. Vogelstein. 1984. A technique for

radiolabeling DNA restriction endonuclease fragments to highspecific activity. Anal. Biochem. 137:266-267.

10. Gonzalez, J. M., Jr., H. T. Dulmage, and B. C. Carlton. 1981.Correlation between specific plasmids and delta endotoxin pro-duction in Bacillus thuringiensis. Plasmid 5:351-365.

11. Hofte, H., and H. R. Whiteley. 1989. Insecticidal crystal proteinsof Bacillus thuringiensis. Microbiol. Rev. 53:242-255.

12. Horinouchi, S., and B. Weisblum. 1982. Nucleotide sequenceand functional map of pC194, a plasmid that specifies induciblechloramphenicol resistance. J. Bacteriol. 150:815-825.

13. Kronstad, J. W., H. E. Schnepf, and H. R. Whiteley. 1983.Diversity of locations for Bacillus thuringiensis crystal proteingenes. J. Bacteriol. 154:419-428.

14. Laemmli, U. K. 1970. Cleavage of structural proteins during theassembly of the head of T4 bacteriophage. Nature (London)227:680-685.

15. Lereclus, D., 0. Arantes, J. Chaufaux, and M.-M. Lecadet. 1989.Transformation and expression of a cloned endotoxin gene inBacillus thuringiensis. FEMS Microbiol. Lett. 60:211-218.

16. Lereclus, D., S. Guo, V. Sanchis, and M.-M. Lecadet. 1988.Characterization of two Bacillus thuringiensis plasmids whosereplication is thermosensitive in B. subtilis. FEMS Microbiol.Lett. 49:417-422.

17. Mahillon, J., W. Chungjatupornchai, J. Decock, S. Dierickx, F.Michiels, M. Peferoen, and H. Joos. 1989. Transformation ofBacillus thuringiensis by electroporation. FEMS Microbiol.Lett. 60:205-210.

18. Mahillon, J., F. Hespel, A.-M. Pierssens, and J. Delcour. 1988.Cloning and partial characterization of three small crypticplasmids from Bacillus thuringiensis. Plasmid 19:169-173.

19. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecularcloning: a laboratory manual. Cold Spring Harbor Laboratory,Cold Spring Harbor, N.Y.

20. Mettus, A.-M., and A. Macaluso. 1990. Expression of Bacillusthuringiensis 8-endotoxin genes during vegetative growth. Appl.Environ. Microbiol. 56:1128-1134.

21. Miteva, V. I., and R. T. Grigorova. 1988. Construction of abifunctional genetically labelled plasmid for Bacillus thuringien-sis subsp. israelensis. Arch. Microbiol. 150:496-498.

22. Sanger, F., S. Nicklen, and A. Coulson. 1977. DNA sequencingwith chain terminating inhibitors. Proc. Natl. Acad. Sci. USA74:5463-5467.

23. Schurter, W., M. Geiser, and D. Mathe. 1989. Efficient trans-formation of Bacillus thuringiensis and Bacillus cereus viaelectroporation: transformation of acrystalliferous strains with acloned delta-endotoxin gene. Mol. Gen. Genet. 218:177-181.

24. Widner, W. R., and H. R. Whiteley. 1989. Two highly relatedinsecticidal crystal proteins of Bacillus thuringiensis subsp.kurstaki possess different host range specificities. J. Bacteriol.171:965-974.

3428 BAUM ET AL.

on May 22, 2021 by guest

http://aem.asm

.org/D

ownloaded from