mr. armfield – level ii biology 1,2 science department deerfield high school, deerfield il...
TRANSCRIPT
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Transcription Translation ampTranscription Translation ampProtein SynthesisProtein Synthesis
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Do you remember what proteinsDo you remember what proteinsare made of are made of
Hundreds of Amino Acids link together to make one Protein 1048708 There are 20 types of amino acids some we can make and some we canrsquot 1048708 There are infinite combinations of amino acids 1048708 Can be hundreds or thousands
monomersLongThese long chains are called polypeptide
chains
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Protein SynthesisProtein Synthesis
Protein synthesis is the process in which a cell makes protein based on the message contained within its DNA
Howeverndash DNA is only found in the nucleusndash Proteins are only made outside the
nucleus ndash in the cytoplasm Houston we have a problem
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Protein SynthesisProtein Synthesis
How do the many different messages within the DNA molecule get to the many ribosomes outside the nucleus
A molecular cousin of DNA ndash RNA ndash is used to carry these messages
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Ribonucleic Acids (RNA)Ribonucleic Acids (RNA)
The job of RNA (ribonucleic acid) is to carry messages from the DNA (in the nucleus) to the ribosomes (in the cytoplasm)
There are three types of RNA1 mRNA ndash carries a message from the DNA to
the cytoplasm2 tRNA ndash transports amino acids to the mRNA
to make a protein3 rRNA ndash make up ribosomes which make
protein
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Ribonucleic Acids (RNA)Ribonucleic Acids (RNA)
RNA is almost exactly like DNA exceptndash Contains a ribose sugar instead of a
deoxyribose sugar (hence the namehellip)
ndash Contains uracil instead of thyminendash RNA is single-stranded not double-
stranded (usuallyhellip)
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Ribonucleic Acids (RNA)Ribonucleic Acids (RNA)
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Protein SynthesisProtein Synthesis
Occurs in TWO steps1Transcription ndash the genetic
information from a strand of DNA is copied into a strand of mRNA
2Translation ndash the mRNA with the help of the ribosome forms a chain of amino acids (eventually forming a protein) based on the information contained on the mRNA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Central DogmaThe Central Dogma
This order of events is called the central dogma of molecular biology
DNA RNA P RO T E
IN
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step One Step One TranscriptionTranscription
1 DNA unzips enzymes split apart base pairs and unwind the DNA double helix
2 Bases pair up Free nucleotides in the cell find their complementary bases along the new strands with the help of RNA polymerase What will be different
3 New backbone formed The sugar-phosphate backbone is assembled to complete the RNA strand and separates from the DNA strand
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step One Step One TranscriptionTranscription
Watch this simplified animationhttpwwwstolafedupeoplegianniniflashanimatmolgeneticstranscriptionswf
Watch the more complex animation
httpwww-classunledubiochemgp2m_biologyanimationgenegene_a2html
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step One Step One TranscriptionTranscription
Try it What RNA strand will be made from the following DNA sequence
TACGCATGACTAGCAAGTCTAACT
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step One Step One TranscriptionTranscription
Try it What RNA strand will be made from the following DNA sequence
TACGCATGACTAGCAAGTCTAACTAUGCGUACUGAUCGUUCAGAUUGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step 1frac12 Step 1frac12 RNA EditingRNA Editing
An mRNA molecule has to be ldquoeditedrdquo in order to be useful Therersquos a lot of unnecessary information that needs to be removed
An mRNA sequence that does NOT code for protein is called an interoninteron A sequence that is useful in making a protein is called an exonexon
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step 1frac12 Step 1frac12 RNA EditingRNA Editing
DNA
exon 1 interon exon 2 interon exon 3
pre-RNA (in nucleus)
exon 1 exon 2 exon 3
RNA (in cytoplasm)
transcription
interon
interon
RNA editing
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two Translation ldquoTranslation ldquoto decode ordecipher the meaning ofrdquo
Now that our mRNA molecule has been made itrsquos time for its message to be made into a protein sequence
How does the mRNA sequence translate into an amino acid sequence
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
Problem ndash There are 20 different amino acidsndash There are 4 RNA bases
phe ile val pro ala his asn asp cys argleu met ser thr tyr gln lys glu trp gly
A T C G
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
Watch this simplified animationhttpwwwstolafedupeoplegianniniflashanimatmolgeneticstranslationswf
Watch the more complex animation
httpwww-classunledubiochemgp2m_biologyanimationgenegene_a3html
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
1 So how do you exactly go about determining what protein your cells are going to make
2 FIRST Divide the mRNA sequence into codons As you just saw and heard codons are three-base sections of mRNA
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
asp arg thr asp arg ser
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
asp STOPmet thr asp arg ser
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
RECAPRECAP
1 DNA is transcribed into mRNA in the nucleus
2 The mRNA leaves the nucleus and enters the cytoplasm
3 The protein is translated from the mRNA sequence using tRNA and amino acids
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Do you remember what proteinsDo you remember what proteinsare made of are made of
Hundreds of Amino Acids link together to make one Protein 1048708 There are 20 types of amino acids some we can make and some we canrsquot 1048708 There are infinite combinations of amino acids 1048708 Can be hundreds or thousands
monomersLongThese long chains are called polypeptide
chains
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Protein SynthesisProtein Synthesis
Protein synthesis is the process in which a cell makes protein based on the message contained within its DNA
Howeverndash DNA is only found in the nucleusndash Proteins are only made outside the
nucleus ndash in the cytoplasm Houston we have a problem
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Protein SynthesisProtein Synthesis
How do the many different messages within the DNA molecule get to the many ribosomes outside the nucleus
A molecular cousin of DNA ndash RNA ndash is used to carry these messages
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Ribonucleic Acids (RNA)Ribonucleic Acids (RNA)
The job of RNA (ribonucleic acid) is to carry messages from the DNA (in the nucleus) to the ribosomes (in the cytoplasm)
There are three types of RNA1 mRNA ndash carries a message from the DNA to
the cytoplasm2 tRNA ndash transports amino acids to the mRNA
to make a protein3 rRNA ndash make up ribosomes which make
protein
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Ribonucleic Acids (RNA)Ribonucleic Acids (RNA)
RNA is almost exactly like DNA exceptndash Contains a ribose sugar instead of a
deoxyribose sugar (hence the namehellip)
ndash Contains uracil instead of thyminendash RNA is single-stranded not double-
stranded (usuallyhellip)
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Ribonucleic Acids (RNA)Ribonucleic Acids (RNA)
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Protein SynthesisProtein Synthesis
Occurs in TWO steps1Transcription ndash the genetic
information from a strand of DNA is copied into a strand of mRNA
2Translation ndash the mRNA with the help of the ribosome forms a chain of amino acids (eventually forming a protein) based on the information contained on the mRNA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Central DogmaThe Central Dogma
This order of events is called the central dogma of molecular biology
DNA RNA P RO T E
IN
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step One Step One TranscriptionTranscription
1 DNA unzips enzymes split apart base pairs and unwind the DNA double helix
2 Bases pair up Free nucleotides in the cell find their complementary bases along the new strands with the help of RNA polymerase What will be different
3 New backbone formed The sugar-phosphate backbone is assembled to complete the RNA strand and separates from the DNA strand
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step One Step One TranscriptionTranscription
Watch this simplified animationhttpwwwstolafedupeoplegianniniflashanimatmolgeneticstranscriptionswf
Watch the more complex animation
httpwww-classunledubiochemgp2m_biologyanimationgenegene_a2html
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step One Step One TranscriptionTranscription
Try it What RNA strand will be made from the following DNA sequence
TACGCATGACTAGCAAGTCTAACT
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step One Step One TranscriptionTranscription
Try it What RNA strand will be made from the following DNA sequence
TACGCATGACTAGCAAGTCTAACTAUGCGUACUGAUCGUUCAGAUUGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step 1frac12 Step 1frac12 RNA EditingRNA Editing
An mRNA molecule has to be ldquoeditedrdquo in order to be useful Therersquos a lot of unnecessary information that needs to be removed
An mRNA sequence that does NOT code for protein is called an interoninteron A sequence that is useful in making a protein is called an exonexon
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step 1frac12 Step 1frac12 RNA EditingRNA Editing
DNA
exon 1 interon exon 2 interon exon 3
pre-RNA (in nucleus)
exon 1 exon 2 exon 3
RNA (in cytoplasm)
transcription
interon
interon
RNA editing
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two Translation ldquoTranslation ldquoto decode ordecipher the meaning ofrdquo
Now that our mRNA molecule has been made itrsquos time for its message to be made into a protein sequence
How does the mRNA sequence translate into an amino acid sequence
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
Problem ndash There are 20 different amino acidsndash There are 4 RNA bases
phe ile val pro ala his asn asp cys argleu met ser thr tyr gln lys glu trp gly
A T C G
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
Watch this simplified animationhttpwwwstolafedupeoplegianniniflashanimatmolgeneticstranslationswf
Watch the more complex animation
httpwww-classunledubiochemgp2m_biologyanimationgenegene_a3html
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
1 So how do you exactly go about determining what protein your cells are going to make
2 FIRST Divide the mRNA sequence into codons As you just saw and heard codons are three-base sections of mRNA
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
asp arg thr asp arg ser
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
asp STOPmet thr asp arg ser
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
RECAPRECAP
1 DNA is transcribed into mRNA in the nucleus
2 The mRNA leaves the nucleus and enters the cytoplasm
3 The protein is translated from the mRNA sequence using tRNA and amino acids
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Protein SynthesisProtein Synthesis
Protein synthesis is the process in which a cell makes protein based on the message contained within its DNA
Howeverndash DNA is only found in the nucleusndash Proteins are only made outside the
nucleus ndash in the cytoplasm Houston we have a problem
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Protein SynthesisProtein Synthesis
How do the many different messages within the DNA molecule get to the many ribosomes outside the nucleus
A molecular cousin of DNA ndash RNA ndash is used to carry these messages
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Ribonucleic Acids (RNA)Ribonucleic Acids (RNA)
The job of RNA (ribonucleic acid) is to carry messages from the DNA (in the nucleus) to the ribosomes (in the cytoplasm)
There are three types of RNA1 mRNA ndash carries a message from the DNA to
the cytoplasm2 tRNA ndash transports amino acids to the mRNA
to make a protein3 rRNA ndash make up ribosomes which make
protein
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Ribonucleic Acids (RNA)Ribonucleic Acids (RNA)
RNA is almost exactly like DNA exceptndash Contains a ribose sugar instead of a
deoxyribose sugar (hence the namehellip)
ndash Contains uracil instead of thyminendash RNA is single-stranded not double-
stranded (usuallyhellip)
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Ribonucleic Acids (RNA)Ribonucleic Acids (RNA)
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Protein SynthesisProtein Synthesis
Occurs in TWO steps1Transcription ndash the genetic
information from a strand of DNA is copied into a strand of mRNA
2Translation ndash the mRNA with the help of the ribosome forms a chain of amino acids (eventually forming a protein) based on the information contained on the mRNA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Central DogmaThe Central Dogma
This order of events is called the central dogma of molecular biology
DNA RNA P RO T E
IN
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step One Step One TranscriptionTranscription
1 DNA unzips enzymes split apart base pairs and unwind the DNA double helix
2 Bases pair up Free nucleotides in the cell find their complementary bases along the new strands with the help of RNA polymerase What will be different
3 New backbone formed The sugar-phosphate backbone is assembled to complete the RNA strand and separates from the DNA strand
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step One Step One TranscriptionTranscription
Watch this simplified animationhttpwwwstolafedupeoplegianniniflashanimatmolgeneticstranscriptionswf
Watch the more complex animation
httpwww-classunledubiochemgp2m_biologyanimationgenegene_a2html
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step One Step One TranscriptionTranscription
Try it What RNA strand will be made from the following DNA sequence
TACGCATGACTAGCAAGTCTAACT
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step One Step One TranscriptionTranscription
Try it What RNA strand will be made from the following DNA sequence
TACGCATGACTAGCAAGTCTAACTAUGCGUACUGAUCGUUCAGAUUGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step 1frac12 Step 1frac12 RNA EditingRNA Editing
An mRNA molecule has to be ldquoeditedrdquo in order to be useful Therersquos a lot of unnecessary information that needs to be removed
An mRNA sequence that does NOT code for protein is called an interoninteron A sequence that is useful in making a protein is called an exonexon
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step 1frac12 Step 1frac12 RNA EditingRNA Editing
DNA
exon 1 interon exon 2 interon exon 3
pre-RNA (in nucleus)
exon 1 exon 2 exon 3
RNA (in cytoplasm)
transcription
interon
interon
RNA editing
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two Translation ldquoTranslation ldquoto decode ordecipher the meaning ofrdquo
Now that our mRNA molecule has been made itrsquos time for its message to be made into a protein sequence
How does the mRNA sequence translate into an amino acid sequence
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
Problem ndash There are 20 different amino acidsndash There are 4 RNA bases
phe ile val pro ala his asn asp cys argleu met ser thr tyr gln lys glu trp gly
A T C G
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
Watch this simplified animationhttpwwwstolafedupeoplegianniniflashanimatmolgeneticstranslationswf
Watch the more complex animation
httpwww-classunledubiochemgp2m_biologyanimationgenegene_a3html
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
1 So how do you exactly go about determining what protein your cells are going to make
2 FIRST Divide the mRNA sequence into codons As you just saw and heard codons are three-base sections of mRNA
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
asp arg thr asp arg ser
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
asp STOPmet thr asp arg ser
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
RECAPRECAP
1 DNA is transcribed into mRNA in the nucleus
2 The mRNA leaves the nucleus and enters the cytoplasm
3 The protein is translated from the mRNA sequence using tRNA and amino acids
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Protein SynthesisProtein Synthesis
How do the many different messages within the DNA molecule get to the many ribosomes outside the nucleus
A molecular cousin of DNA ndash RNA ndash is used to carry these messages
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Ribonucleic Acids (RNA)Ribonucleic Acids (RNA)
The job of RNA (ribonucleic acid) is to carry messages from the DNA (in the nucleus) to the ribosomes (in the cytoplasm)
There are three types of RNA1 mRNA ndash carries a message from the DNA to
the cytoplasm2 tRNA ndash transports amino acids to the mRNA
to make a protein3 rRNA ndash make up ribosomes which make
protein
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Ribonucleic Acids (RNA)Ribonucleic Acids (RNA)
RNA is almost exactly like DNA exceptndash Contains a ribose sugar instead of a
deoxyribose sugar (hence the namehellip)
ndash Contains uracil instead of thyminendash RNA is single-stranded not double-
stranded (usuallyhellip)
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Ribonucleic Acids (RNA)Ribonucleic Acids (RNA)
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Protein SynthesisProtein Synthesis
Occurs in TWO steps1Transcription ndash the genetic
information from a strand of DNA is copied into a strand of mRNA
2Translation ndash the mRNA with the help of the ribosome forms a chain of amino acids (eventually forming a protein) based on the information contained on the mRNA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Central DogmaThe Central Dogma
This order of events is called the central dogma of molecular biology
DNA RNA P RO T E
IN
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step One Step One TranscriptionTranscription
1 DNA unzips enzymes split apart base pairs and unwind the DNA double helix
2 Bases pair up Free nucleotides in the cell find their complementary bases along the new strands with the help of RNA polymerase What will be different
3 New backbone formed The sugar-phosphate backbone is assembled to complete the RNA strand and separates from the DNA strand
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step One Step One TranscriptionTranscription
Watch this simplified animationhttpwwwstolafedupeoplegianniniflashanimatmolgeneticstranscriptionswf
Watch the more complex animation
httpwww-classunledubiochemgp2m_biologyanimationgenegene_a2html
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step One Step One TranscriptionTranscription
Try it What RNA strand will be made from the following DNA sequence
TACGCATGACTAGCAAGTCTAACT
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step One Step One TranscriptionTranscription
Try it What RNA strand will be made from the following DNA sequence
TACGCATGACTAGCAAGTCTAACTAUGCGUACUGAUCGUUCAGAUUGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step 1frac12 Step 1frac12 RNA EditingRNA Editing
An mRNA molecule has to be ldquoeditedrdquo in order to be useful Therersquos a lot of unnecessary information that needs to be removed
An mRNA sequence that does NOT code for protein is called an interoninteron A sequence that is useful in making a protein is called an exonexon
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step 1frac12 Step 1frac12 RNA EditingRNA Editing
DNA
exon 1 interon exon 2 interon exon 3
pre-RNA (in nucleus)
exon 1 exon 2 exon 3
RNA (in cytoplasm)
transcription
interon
interon
RNA editing
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two Translation ldquoTranslation ldquoto decode ordecipher the meaning ofrdquo
Now that our mRNA molecule has been made itrsquos time for its message to be made into a protein sequence
How does the mRNA sequence translate into an amino acid sequence
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
Problem ndash There are 20 different amino acidsndash There are 4 RNA bases
phe ile val pro ala his asn asp cys argleu met ser thr tyr gln lys glu trp gly
A T C G
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
Watch this simplified animationhttpwwwstolafedupeoplegianniniflashanimatmolgeneticstranslationswf
Watch the more complex animation
httpwww-classunledubiochemgp2m_biologyanimationgenegene_a3html
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
1 So how do you exactly go about determining what protein your cells are going to make
2 FIRST Divide the mRNA sequence into codons As you just saw and heard codons are three-base sections of mRNA
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
asp arg thr asp arg ser
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
asp STOPmet thr asp arg ser
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
RECAPRECAP
1 DNA is transcribed into mRNA in the nucleus
2 The mRNA leaves the nucleus and enters the cytoplasm
3 The protein is translated from the mRNA sequence using tRNA and amino acids
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Ribonucleic Acids (RNA)Ribonucleic Acids (RNA)
The job of RNA (ribonucleic acid) is to carry messages from the DNA (in the nucleus) to the ribosomes (in the cytoplasm)
There are three types of RNA1 mRNA ndash carries a message from the DNA to
the cytoplasm2 tRNA ndash transports amino acids to the mRNA
to make a protein3 rRNA ndash make up ribosomes which make
protein
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Ribonucleic Acids (RNA)Ribonucleic Acids (RNA)
RNA is almost exactly like DNA exceptndash Contains a ribose sugar instead of a
deoxyribose sugar (hence the namehellip)
ndash Contains uracil instead of thyminendash RNA is single-stranded not double-
stranded (usuallyhellip)
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Ribonucleic Acids (RNA)Ribonucleic Acids (RNA)
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Protein SynthesisProtein Synthesis
Occurs in TWO steps1Transcription ndash the genetic
information from a strand of DNA is copied into a strand of mRNA
2Translation ndash the mRNA with the help of the ribosome forms a chain of amino acids (eventually forming a protein) based on the information contained on the mRNA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Central DogmaThe Central Dogma
This order of events is called the central dogma of molecular biology
DNA RNA P RO T E
IN
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step One Step One TranscriptionTranscription
1 DNA unzips enzymes split apart base pairs and unwind the DNA double helix
2 Bases pair up Free nucleotides in the cell find their complementary bases along the new strands with the help of RNA polymerase What will be different
3 New backbone formed The sugar-phosphate backbone is assembled to complete the RNA strand and separates from the DNA strand
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step One Step One TranscriptionTranscription
Watch this simplified animationhttpwwwstolafedupeoplegianniniflashanimatmolgeneticstranscriptionswf
Watch the more complex animation
httpwww-classunledubiochemgp2m_biologyanimationgenegene_a2html
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step One Step One TranscriptionTranscription
Try it What RNA strand will be made from the following DNA sequence
TACGCATGACTAGCAAGTCTAACT
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step One Step One TranscriptionTranscription
Try it What RNA strand will be made from the following DNA sequence
TACGCATGACTAGCAAGTCTAACTAUGCGUACUGAUCGUUCAGAUUGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step 1frac12 Step 1frac12 RNA EditingRNA Editing
An mRNA molecule has to be ldquoeditedrdquo in order to be useful Therersquos a lot of unnecessary information that needs to be removed
An mRNA sequence that does NOT code for protein is called an interoninteron A sequence that is useful in making a protein is called an exonexon
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step 1frac12 Step 1frac12 RNA EditingRNA Editing
DNA
exon 1 interon exon 2 interon exon 3
pre-RNA (in nucleus)
exon 1 exon 2 exon 3
RNA (in cytoplasm)
transcription
interon
interon
RNA editing
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two Translation ldquoTranslation ldquoto decode ordecipher the meaning ofrdquo
Now that our mRNA molecule has been made itrsquos time for its message to be made into a protein sequence
How does the mRNA sequence translate into an amino acid sequence
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
Problem ndash There are 20 different amino acidsndash There are 4 RNA bases
phe ile val pro ala his asn asp cys argleu met ser thr tyr gln lys glu trp gly
A T C G
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
Watch this simplified animationhttpwwwstolafedupeoplegianniniflashanimatmolgeneticstranslationswf
Watch the more complex animation
httpwww-classunledubiochemgp2m_biologyanimationgenegene_a3html
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
1 So how do you exactly go about determining what protein your cells are going to make
2 FIRST Divide the mRNA sequence into codons As you just saw and heard codons are three-base sections of mRNA
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
asp arg thr asp arg ser
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
asp STOPmet thr asp arg ser
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
RECAPRECAP
1 DNA is transcribed into mRNA in the nucleus
2 The mRNA leaves the nucleus and enters the cytoplasm
3 The protein is translated from the mRNA sequence using tRNA and amino acids
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Ribonucleic Acids (RNA)Ribonucleic Acids (RNA)
RNA is almost exactly like DNA exceptndash Contains a ribose sugar instead of a
deoxyribose sugar (hence the namehellip)
ndash Contains uracil instead of thyminendash RNA is single-stranded not double-
stranded (usuallyhellip)
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Ribonucleic Acids (RNA)Ribonucleic Acids (RNA)
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Protein SynthesisProtein Synthesis
Occurs in TWO steps1Transcription ndash the genetic
information from a strand of DNA is copied into a strand of mRNA
2Translation ndash the mRNA with the help of the ribosome forms a chain of amino acids (eventually forming a protein) based on the information contained on the mRNA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Central DogmaThe Central Dogma
This order of events is called the central dogma of molecular biology
DNA RNA P RO T E
IN
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step One Step One TranscriptionTranscription
1 DNA unzips enzymes split apart base pairs and unwind the DNA double helix
2 Bases pair up Free nucleotides in the cell find their complementary bases along the new strands with the help of RNA polymerase What will be different
3 New backbone formed The sugar-phosphate backbone is assembled to complete the RNA strand and separates from the DNA strand
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step One Step One TranscriptionTranscription
Watch this simplified animationhttpwwwstolafedupeoplegianniniflashanimatmolgeneticstranscriptionswf
Watch the more complex animation
httpwww-classunledubiochemgp2m_biologyanimationgenegene_a2html
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step One Step One TranscriptionTranscription
Try it What RNA strand will be made from the following DNA sequence
TACGCATGACTAGCAAGTCTAACT
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step One Step One TranscriptionTranscription
Try it What RNA strand will be made from the following DNA sequence
TACGCATGACTAGCAAGTCTAACTAUGCGUACUGAUCGUUCAGAUUGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step 1frac12 Step 1frac12 RNA EditingRNA Editing
An mRNA molecule has to be ldquoeditedrdquo in order to be useful Therersquos a lot of unnecessary information that needs to be removed
An mRNA sequence that does NOT code for protein is called an interoninteron A sequence that is useful in making a protein is called an exonexon
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step 1frac12 Step 1frac12 RNA EditingRNA Editing
DNA
exon 1 interon exon 2 interon exon 3
pre-RNA (in nucleus)
exon 1 exon 2 exon 3
RNA (in cytoplasm)
transcription
interon
interon
RNA editing
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two Translation ldquoTranslation ldquoto decode ordecipher the meaning ofrdquo
Now that our mRNA molecule has been made itrsquos time for its message to be made into a protein sequence
How does the mRNA sequence translate into an amino acid sequence
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
Problem ndash There are 20 different amino acidsndash There are 4 RNA bases
phe ile val pro ala his asn asp cys argleu met ser thr tyr gln lys glu trp gly
A T C G
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
Watch this simplified animationhttpwwwstolafedupeoplegianniniflashanimatmolgeneticstranslationswf
Watch the more complex animation
httpwww-classunledubiochemgp2m_biologyanimationgenegene_a3html
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
1 So how do you exactly go about determining what protein your cells are going to make
2 FIRST Divide the mRNA sequence into codons As you just saw and heard codons are three-base sections of mRNA
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
asp arg thr asp arg ser
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
asp STOPmet thr asp arg ser
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
RECAPRECAP
1 DNA is transcribed into mRNA in the nucleus
2 The mRNA leaves the nucleus and enters the cytoplasm
3 The protein is translated from the mRNA sequence using tRNA and amino acids
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Ribonucleic Acids (RNA)Ribonucleic Acids (RNA)
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Protein SynthesisProtein Synthesis
Occurs in TWO steps1Transcription ndash the genetic
information from a strand of DNA is copied into a strand of mRNA
2Translation ndash the mRNA with the help of the ribosome forms a chain of amino acids (eventually forming a protein) based on the information contained on the mRNA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Central DogmaThe Central Dogma
This order of events is called the central dogma of molecular biology
DNA RNA P RO T E
IN
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step One Step One TranscriptionTranscription
1 DNA unzips enzymes split apart base pairs and unwind the DNA double helix
2 Bases pair up Free nucleotides in the cell find their complementary bases along the new strands with the help of RNA polymerase What will be different
3 New backbone formed The sugar-phosphate backbone is assembled to complete the RNA strand and separates from the DNA strand
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step One Step One TranscriptionTranscription
Watch this simplified animationhttpwwwstolafedupeoplegianniniflashanimatmolgeneticstranscriptionswf
Watch the more complex animation
httpwww-classunledubiochemgp2m_biologyanimationgenegene_a2html
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step One Step One TranscriptionTranscription
Try it What RNA strand will be made from the following DNA sequence
TACGCATGACTAGCAAGTCTAACT
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step One Step One TranscriptionTranscription
Try it What RNA strand will be made from the following DNA sequence
TACGCATGACTAGCAAGTCTAACTAUGCGUACUGAUCGUUCAGAUUGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step 1frac12 Step 1frac12 RNA EditingRNA Editing
An mRNA molecule has to be ldquoeditedrdquo in order to be useful Therersquos a lot of unnecessary information that needs to be removed
An mRNA sequence that does NOT code for protein is called an interoninteron A sequence that is useful in making a protein is called an exonexon
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step 1frac12 Step 1frac12 RNA EditingRNA Editing
DNA
exon 1 interon exon 2 interon exon 3
pre-RNA (in nucleus)
exon 1 exon 2 exon 3
RNA (in cytoplasm)
transcription
interon
interon
RNA editing
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two Translation ldquoTranslation ldquoto decode ordecipher the meaning ofrdquo
Now that our mRNA molecule has been made itrsquos time for its message to be made into a protein sequence
How does the mRNA sequence translate into an amino acid sequence
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
Problem ndash There are 20 different amino acidsndash There are 4 RNA bases
phe ile val pro ala his asn asp cys argleu met ser thr tyr gln lys glu trp gly
A T C G
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
Watch this simplified animationhttpwwwstolafedupeoplegianniniflashanimatmolgeneticstranslationswf
Watch the more complex animation
httpwww-classunledubiochemgp2m_biologyanimationgenegene_a3html
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
1 So how do you exactly go about determining what protein your cells are going to make
2 FIRST Divide the mRNA sequence into codons As you just saw and heard codons are three-base sections of mRNA
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
asp arg thr asp arg ser
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
asp STOPmet thr asp arg ser
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
RECAPRECAP
1 DNA is transcribed into mRNA in the nucleus
2 The mRNA leaves the nucleus and enters the cytoplasm
3 The protein is translated from the mRNA sequence using tRNA and amino acids
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Protein SynthesisProtein Synthesis
Occurs in TWO steps1Transcription ndash the genetic
information from a strand of DNA is copied into a strand of mRNA
2Translation ndash the mRNA with the help of the ribosome forms a chain of amino acids (eventually forming a protein) based on the information contained on the mRNA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Central DogmaThe Central Dogma
This order of events is called the central dogma of molecular biology
DNA RNA P RO T E
IN
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step One Step One TranscriptionTranscription
1 DNA unzips enzymes split apart base pairs and unwind the DNA double helix
2 Bases pair up Free nucleotides in the cell find their complementary bases along the new strands with the help of RNA polymerase What will be different
3 New backbone formed The sugar-phosphate backbone is assembled to complete the RNA strand and separates from the DNA strand
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step One Step One TranscriptionTranscription
Watch this simplified animationhttpwwwstolafedupeoplegianniniflashanimatmolgeneticstranscriptionswf
Watch the more complex animation
httpwww-classunledubiochemgp2m_biologyanimationgenegene_a2html
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step One Step One TranscriptionTranscription
Try it What RNA strand will be made from the following DNA sequence
TACGCATGACTAGCAAGTCTAACT
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step One Step One TranscriptionTranscription
Try it What RNA strand will be made from the following DNA sequence
TACGCATGACTAGCAAGTCTAACTAUGCGUACUGAUCGUUCAGAUUGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step 1frac12 Step 1frac12 RNA EditingRNA Editing
An mRNA molecule has to be ldquoeditedrdquo in order to be useful Therersquos a lot of unnecessary information that needs to be removed
An mRNA sequence that does NOT code for protein is called an interoninteron A sequence that is useful in making a protein is called an exonexon
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step 1frac12 Step 1frac12 RNA EditingRNA Editing
DNA
exon 1 interon exon 2 interon exon 3
pre-RNA (in nucleus)
exon 1 exon 2 exon 3
RNA (in cytoplasm)
transcription
interon
interon
RNA editing
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two Translation ldquoTranslation ldquoto decode ordecipher the meaning ofrdquo
Now that our mRNA molecule has been made itrsquos time for its message to be made into a protein sequence
How does the mRNA sequence translate into an amino acid sequence
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
Problem ndash There are 20 different amino acidsndash There are 4 RNA bases
phe ile val pro ala his asn asp cys argleu met ser thr tyr gln lys glu trp gly
A T C G
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
Watch this simplified animationhttpwwwstolafedupeoplegianniniflashanimatmolgeneticstranslationswf
Watch the more complex animation
httpwww-classunledubiochemgp2m_biologyanimationgenegene_a3html
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
1 So how do you exactly go about determining what protein your cells are going to make
2 FIRST Divide the mRNA sequence into codons As you just saw and heard codons are three-base sections of mRNA
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
asp arg thr asp arg ser
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
asp STOPmet thr asp arg ser
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
RECAPRECAP
1 DNA is transcribed into mRNA in the nucleus
2 The mRNA leaves the nucleus and enters the cytoplasm
3 The protein is translated from the mRNA sequence using tRNA and amino acids
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Central DogmaThe Central Dogma
This order of events is called the central dogma of molecular biology
DNA RNA P RO T E
IN
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step One Step One TranscriptionTranscription
1 DNA unzips enzymes split apart base pairs and unwind the DNA double helix
2 Bases pair up Free nucleotides in the cell find their complementary bases along the new strands with the help of RNA polymerase What will be different
3 New backbone formed The sugar-phosphate backbone is assembled to complete the RNA strand and separates from the DNA strand
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step One Step One TranscriptionTranscription
Watch this simplified animationhttpwwwstolafedupeoplegianniniflashanimatmolgeneticstranscriptionswf
Watch the more complex animation
httpwww-classunledubiochemgp2m_biologyanimationgenegene_a2html
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step One Step One TranscriptionTranscription
Try it What RNA strand will be made from the following DNA sequence
TACGCATGACTAGCAAGTCTAACT
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step One Step One TranscriptionTranscription
Try it What RNA strand will be made from the following DNA sequence
TACGCATGACTAGCAAGTCTAACTAUGCGUACUGAUCGUUCAGAUUGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step 1frac12 Step 1frac12 RNA EditingRNA Editing
An mRNA molecule has to be ldquoeditedrdquo in order to be useful Therersquos a lot of unnecessary information that needs to be removed
An mRNA sequence that does NOT code for protein is called an interoninteron A sequence that is useful in making a protein is called an exonexon
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step 1frac12 Step 1frac12 RNA EditingRNA Editing
DNA
exon 1 interon exon 2 interon exon 3
pre-RNA (in nucleus)
exon 1 exon 2 exon 3
RNA (in cytoplasm)
transcription
interon
interon
RNA editing
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two Translation ldquoTranslation ldquoto decode ordecipher the meaning ofrdquo
Now that our mRNA molecule has been made itrsquos time for its message to be made into a protein sequence
How does the mRNA sequence translate into an amino acid sequence
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
Problem ndash There are 20 different amino acidsndash There are 4 RNA bases
phe ile val pro ala his asn asp cys argleu met ser thr tyr gln lys glu trp gly
A T C G
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
Watch this simplified animationhttpwwwstolafedupeoplegianniniflashanimatmolgeneticstranslationswf
Watch the more complex animation
httpwww-classunledubiochemgp2m_biologyanimationgenegene_a3html
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
1 So how do you exactly go about determining what protein your cells are going to make
2 FIRST Divide the mRNA sequence into codons As you just saw and heard codons are three-base sections of mRNA
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
asp arg thr asp arg ser
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
asp STOPmet thr asp arg ser
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
RECAPRECAP
1 DNA is transcribed into mRNA in the nucleus
2 The mRNA leaves the nucleus and enters the cytoplasm
3 The protein is translated from the mRNA sequence using tRNA and amino acids
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step One Step One TranscriptionTranscription
1 DNA unzips enzymes split apart base pairs and unwind the DNA double helix
2 Bases pair up Free nucleotides in the cell find their complementary bases along the new strands with the help of RNA polymerase What will be different
3 New backbone formed The sugar-phosphate backbone is assembled to complete the RNA strand and separates from the DNA strand
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step One Step One TranscriptionTranscription
Watch this simplified animationhttpwwwstolafedupeoplegianniniflashanimatmolgeneticstranscriptionswf
Watch the more complex animation
httpwww-classunledubiochemgp2m_biologyanimationgenegene_a2html
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step One Step One TranscriptionTranscription
Try it What RNA strand will be made from the following DNA sequence
TACGCATGACTAGCAAGTCTAACT
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step One Step One TranscriptionTranscription
Try it What RNA strand will be made from the following DNA sequence
TACGCATGACTAGCAAGTCTAACTAUGCGUACUGAUCGUUCAGAUUGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step 1frac12 Step 1frac12 RNA EditingRNA Editing
An mRNA molecule has to be ldquoeditedrdquo in order to be useful Therersquos a lot of unnecessary information that needs to be removed
An mRNA sequence that does NOT code for protein is called an interoninteron A sequence that is useful in making a protein is called an exonexon
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step 1frac12 Step 1frac12 RNA EditingRNA Editing
DNA
exon 1 interon exon 2 interon exon 3
pre-RNA (in nucleus)
exon 1 exon 2 exon 3
RNA (in cytoplasm)
transcription
interon
interon
RNA editing
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two Translation ldquoTranslation ldquoto decode ordecipher the meaning ofrdquo
Now that our mRNA molecule has been made itrsquos time for its message to be made into a protein sequence
How does the mRNA sequence translate into an amino acid sequence
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
Problem ndash There are 20 different amino acidsndash There are 4 RNA bases
phe ile val pro ala his asn asp cys argleu met ser thr tyr gln lys glu trp gly
A T C G
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
Watch this simplified animationhttpwwwstolafedupeoplegianniniflashanimatmolgeneticstranslationswf
Watch the more complex animation
httpwww-classunledubiochemgp2m_biologyanimationgenegene_a3html
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
1 So how do you exactly go about determining what protein your cells are going to make
2 FIRST Divide the mRNA sequence into codons As you just saw and heard codons are three-base sections of mRNA
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
asp arg thr asp arg ser
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
asp STOPmet thr asp arg ser
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
RECAPRECAP
1 DNA is transcribed into mRNA in the nucleus
2 The mRNA leaves the nucleus and enters the cytoplasm
3 The protein is translated from the mRNA sequence using tRNA and amino acids
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step One Step One TranscriptionTranscription
Watch this simplified animationhttpwwwstolafedupeoplegianniniflashanimatmolgeneticstranscriptionswf
Watch the more complex animation
httpwww-classunledubiochemgp2m_biologyanimationgenegene_a2html
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step One Step One TranscriptionTranscription
Try it What RNA strand will be made from the following DNA sequence
TACGCATGACTAGCAAGTCTAACT
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step One Step One TranscriptionTranscription
Try it What RNA strand will be made from the following DNA sequence
TACGCATGACTAGCAAGTCTAACTAUGCGUACUGAUCGUUCAGAUUGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step 1frac12 Step 1frac12 RNA EditingRNA Editing
An mRNA molecule has to be ldquoeditedrdquo in order to be useful Therersquos a lot of unnecessary information that needs to be removed
An mRNA sequence that does NOT code for protein is called an interoninteron A sequence that is useful in making a protein is called an exonexon
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step 1frac12 Step 1frac12 RNA EditingRNA Editing
DNA
exon 1 interon exon 2 interon exon 3
pre-RNA (in nucleus)
exon 1 exon 2 exon 3
RNA (in cytoplasm)
transcription
interon
interon
RNA editing
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two Translation ldquoTranslation ldquoto decode ordecipher the meaning ofrdquo
Now that our mRNA molecule has been made itrsquos time for its message to be made into a protein sequence
How does the mRNA sequence translate into an amino acid sequence
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
Problem ndash There are 20 different amino acidsndash There are 4 RNA bases
phe ile val pro ala his asn asp cys argleu met ser thr tyr gln lys glu trp gly
A T C G
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
Watch this simplified animationhttpwwwstolafedupeoplegianniniflashanimatmolgeneticstranslationswf
Watch the more complex animation
httpwww-classunledubiochemgp2m_biologyanimationgenegene_a3html
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
1 So how do you exactly go about determining what protein your cells are going to make
2 FIRST Divide the mRNA sequence into codons As you just saw and heard codons are three-base sections of mRNA
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
asp arg thr asp arg ser
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
asp STOPmet thr asp arg ser
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
RECAPRECAP
1 DNA is transcribed into mRNA in the nucleus
2 The mRNA leaves the nucleus and enters the cytoplasm
3 The protein is translated from the mRNA sequence using tRNA and amino acids
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step One Step One TranscriptionTranscription
Try it What RNA strand will be made from the following DNA sequence
TACGCATGACTAGCAAGTCTAACT
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step One Step One TranscriptionTranscription
Try it What RNA strand will be made from the following DNA sequence
TACGCATGACTAGCAAGTCTAACTAUGCGUACUGAUCGUUCAGAUUGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step 1frac12 Step 1frac12 RNA EditingRNA Editing
An mRNA molecule has to be ldquoeditedrdquo in order to be useful Therersquos a lot of unnecessary information that needs to be removed
An mRNA sequence that does NOT code for protein is called an interoninteron A sequence that is useful in making a protein is called an exonexon
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step 1frac12 Step 1frac12 RNA EditingRNA Editing
DNA
exon 1 interon exon 2 interon exon 3
pre-RNA (in nucleus)
exon 1 exon 2 exon 3
RNA (in cytoplasm)
transcription
interon
interon
RNA editing
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two Translation ldquoTranslation ldquoto decode ordecipher the meaning ofrdquo
Now that our mRNA molecule has been made itrsquos time for its message to be made into a protein sequence
How does the mRNA sequence translate into an amino acid sequence
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
Problem ndash There are 20 different amino acidsndash There are 4 RNA bases
phe ile val pro ala his asn asp cys argleu met ser thr tyr gln lys glu trp gly
A T C G
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
Watch this simplified animationhttpwwwstolafedupeoplegianniniflashanimatmolgeneticstranslationswf
Watch the more complex animation
httpwww-classunledubiochemgp2m_biologyanimationgenegene_a3html
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
1 So how do you exactly go about determining what protein your cells are going to make
2 FIRST Divide the mRNA sequence into codons As you just saw and heard codons are three-base sections of mRNA
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
asp arg thr asp arg ser
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
asp STOPmet thr asp arg ser
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
RECAPRECAP
1 DNA is transcribed into mRNA in the nucleus
2 The mRNA leaves the nucleus and enters the cytoplasm
3 The protein is translated from the mRNA sequence using tRNA and amino acids
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step One Step One TranscriptionTranscription
Try it What RNA strand will be made from the following DNA sequence
TACGCATGACTAGCAAGTCTAACTAUGCGUACUGAUCGUUCAGAUUGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step 1frac12 Step 1frac12 RNA EditingRNA Editing
An mRNA molecule has to be ldquoeditedrdquo in order to be useful Therersquos a lot of unnecessary information that needs to be removed
An mRNA sequence that does NOT code for protein is called an interoninteron A sequence that is useful in making a protein is called an exonexon
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step 1frac12 Step 1frac12 RNA EditingRNA Editing
DNA
exon 1 interon exon 2 interon exon 3
pre-RNA (in nucleus)
exon 1 exon 2 exon 3
RNA (in cytoplasm)
transcription
interon
interon
RNA editing
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two Translation ldquoTranslation ldquoto decode ordecipher the meaning ofrdquo
Now that our mRNA molecule has been made itrsquos time for its message to be made into a protein sequence
How does the mRNA sequence translate into an amino acid sequence
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
Problem ndash There are 20 different amino acidsndash There are 4 RNA bases
phe ile val pro ala his asn asp cys argleu met ser thr tyr gln lys glu trp gly
A T C G
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
Watch this simplified animationhttpwwwstolafedupeoplegianniniflashanimatmolgeneticstranslationswf
Watch the more complex animation
httpwww-classunledubiochemgp2m_biologyanimationgenegene_a3html
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
1 So how do you exactly go about determining what protein your cells are going to make
2 FIRST Divide the mRNA sequence into codons As you just saw and heard codons are three-base sections of mRNA
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
asp arg thr asp arg ser
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
asp STOPmet thr asp arg ser
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
RECAPRECAP
1 DNA is transcribed into mRNA in the nucleus
2 The mRNA leaves the nucleus and enters the cytoplasm
3 The protein is translated from the mRNA sequence using tRNA and amino acids
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step 1frac12 Step 1frac12 RNA EditingRNA Editing
An mRNA molecule has to be ldquoeditedrdquo in order to be useful Therersquos a lot of unnecessary information that needs to be removed
An mRNA sequence that does NOT code for protein is called an interoninteron A sequence that is useful in making a protein is called an exonexon
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step 1frac12 Step 1frac12 RNA EditingRNA Editing
DNA
exon 1 interon exon 2 interon exon 3
pre-RNA (in nucleus)
exon 1 exon 2 exon 3
RNA (in cytoplasm)
transcription
interon
interon
RNA editing
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two Translation ldquoTranslation ldquoto decode ordecipher the meaning ofrdquo
Now that our mRNA molecule has been made itrsquos time for its message to be made into a protein sequence
How does the mRNA sequence translate into an amino acid sequence
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
Problem ndash There are 20 different amino acidsndash There are 4 RNA bases
phe ile val pro ala his asn asp cys argleu met ser thr tyr gln lys glu trp gly
A T C G
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
Watch this simplified animationhttpwwwstolafedupeoplegianniniflashanimatmolgeneticstranslationswf
Watch the more complex animation
httpwww-classunledubiochemgp2m_biologyanimationgenegene_a3html
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
1 So how do you exactly go about determining what protein your cells are going to make
2 FIRST Divide the mRNA sequence into codons As you just saw and heard codons are three-base sections of mRNA
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
asp arg thr asp arg ser
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
asp STOPmet thr asp arg ser
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
RECAPRECAP
1 DNA is transcribed into mRNA in the nucleus
2 The mRNA leaves the nucleus and enters the cytoplasm
3 The protein is translated from the mRNA sequence using tRNA and amino acids
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step 1frac12 Step 1frac12 RNA EditingRNA Editing
DNA
exon 1 interon exon 2 interon exon 3
pre-RNA (in nucleus)
exon 1 exon 2 exon 3
RNA (in cytoplasm)
transcription
interon
interon
RNA editing
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two Translation ldquoTranslation ldquoto decode ordecipher the meaning ofrdquo
Now that our mRNA molecule has been made itrsquos time for its message to be made into a protein sequence
How does the mRNA sequence translate into an amino acid sequence
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
Problem ndash There are 20 different amino acidsndash There are 4 RNA bases
phe ile val pro ala his asn asp cys argleu met ser thr tyr gln lys glu trp gly
A T C G
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
Watch this simplified animationhttpwwwstolafedupeoplegianniniflashanimatmolgeneticstranslationswf
Watch the more complex animation
httpwww-classunledubiochemgp2m_biologyanimationgenegene_a3html
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
1 So how do you exactly go about determining what protein your cells are going to make
2 FIRST Divide the mRNA sequence into codons As you just saw and heard codons are three-base sections of mRNA
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
asp arg thr asp arg ser
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
asp STOPmet thr asp arg ser
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
RECAPRECAP
1 DNA is transcribed into mRNA in the nucleus
2 The mRNA leaves the nucleus and enters the cytoplasm
3 The protein is translated from the mRNA sequence using tRNA and amino acids
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two Translation ldquoTranslation ldquoto decode ordecipher the meaning ofrdquo
Now that our mRNA molecule has been made itrsquos time for its message to be made into a protein sequence
How does the mRNA sequence translate into an amino acid sequence
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
Problem ndash There are 20 different amino acidsndash There are 4 RNA bases
phe ile val pro ala his asn asp cys argleu met ser thr tyr gln lys glu trp gly
A T C G
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
Watch this simplified animationhttpwwwstolafedupeoplegianniniflashanimatmolgeneticstranslationswf
Watch the more complex animation
httpwww-classunledubiochemgp2m_biologyanimationgenegene_a3html
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
1 So how do you exactly go about determining what protein your cells are going to make
2 FIRST Divide the mRNA sequence into codons As you just saw and heard codons are three-base sections of mRNA
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
asp arg thr asp arg ser
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
asp STOPmet thr asp arg ser
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
RECAPRECAP
1 DNA is transcribed into mRNA in the nucleus
2 The mRNA leaves the nucleus and enters the cytoplasm
3 The protein is translated from the mRNA sequence using tRNA and amino acids
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
Problem ndash There are 20 different amino acidsndash There are 4 RNA bases
phe ile val pro ala his asn asp cys argleu met ser thr tyr gln lys glu trp gly
A T C G
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
Watch this simplified animationhttpwwwstolafedupeoplegianniniflashanimatmolgeneticstranslationswf
Watch the more complex animation
httpwww-classunledubiochemgp2m_biologyanimationgenegene_a3html
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
1 So how do you exactly go about determining what protein your cells are going to make
2 FIRST Divide the mRNA sequence into codons As you just saw and heard codons are three-base sections of mRNA
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
asp arg thr asp arg ser
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
asp STOPmet thr asp arg ser
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
RECAPRECAP
1 DNA is transcribed into mRNA in the nucleus
2 The mRNA leaves the nucleus and enters the cytoplasm
3 The protein is translated from the mRNA sequence using tRNA and amino acids
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
Watch this simplified animationhttpwwwstolafedupeoplegianniniflashanimatmolgeneticstranslationswf
Watch the more complex animation
httpwww-classunledubiochemgp2m_biologyanimationgenegene_a3html
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
1 So how do you exactly go about determining what protein your cells are going to make
2 FIRST Divide the mRNA sequence into codons As you just saw and heard codons are three-base sections of mRNA
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
asp arg thr asp arg ser
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
asp STOPmet thr asp arg ser
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
RECAPRECAP
1 DNA is transcribed into mRNA in the nucleus
2 The mRNA leaves the nucleus and enters the cytoplasm
3 The protein is translated from the mRNA sequence using tRNA and amino acids
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
1 So how do you exactly go about determining what protein your cells are going to make
2 FIRST Divide the mRNA sequence into codons As you just saw and heard codons are three-base sections of mRNA
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
asp arg thr asp arg ser
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
asp STOPmet thr asp arg ser
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
RECAPRECAP
1 DNA is transcribed into mRNA in the nucleus
2 The mRNA leaves the nucleus and enters the cytoplasm
3 The protein is translated from the mRNA sequence using tRNA and amino acids
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
asp arg thr asp arg ser
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
asp STOPmet thr asp arg ser
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
RECAPRECAP
1 DNA is transcribed into mRNA in the nucleus
2 The mRNA leaves the nucleus and enters the cytoplasm
3 The protein is translated from the mRNA sequence using tRNA and amino acids
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
asp arg thr asp arg ser
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
asp STOPmet thr asp arg ser
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
RECAPRECAP
1 DNA is transcribed into mRNA in the nucleus
2 The mRNA leaves the nucleus and enters the cytoplasm
3 The protein is translated from the mRNA sequence using tRNA and amino acids
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
asp arg thr asp arg ser
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
asp STOPmet thr asp arg ser
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
RECAPRECAP
1 DNA is transcribed into mRNA in the nucleus
2 The mRNA leaves the nucleus and enters the cytoplasm
3 The protein is translated from the mRNA sequence using tRNA and amino acids
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
asp arg thr asp arg ser
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
asp STOPmet thr asp arg ser
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
RECAPRECAP
1 DNA is transcribed into mRNA in the nucleus
2 The mRNA leaves the nucleus and enters the cytoplasm
3 The protein is translated from the mRNA sequence using tRNA and amino acids
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
asp arg thr asp arg ser
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
asp STOPmet thr asp arg ser
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
RECAPRECAP
1 DNA is transcribed into mRNA in the nucleus
2 The mRNA leaves the nucleus and enters the cytoplasm
3 The protein is translated from the mRNA sequence using tRNA and amino acids
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
The Genetic CodeThe Genetic Code
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
asp STOPmet thr asp arg ser
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
RECAPRECAP
1 DNA is transcribed into mRNA in the nucleus
2 The mRNA leaves the nucleus and enters the cytoplasm
3 The protein is translated from the mRNA sequence using tRNA and amino acids
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
Step Two Step Two TranslationTranslation
2 Since each 3-letter combination ldquocodesrdquo for an amino acid you need to figure out what amino acid matches up with each codon
met
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
asp STOPmet thr asp arg ser
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
RECAPRECAP
1 DNA is transcribed into mRNA in the nucleus
2 The mRNA leaves the nucleus and enters the cytoplasm
3 The protein is translated from the mRNA sequence using tRNA and amino acids
Mr Armfield ndash Level II Biology 12Mr Armfield ndash Level II Biology 12Science DepartmentScience DepartmentDeerfield High School Deerfield ILDeerfield High School Deerfield IL
RECAPRECAP
1 DNA is transcribed into mRNA in the nucleus
2 The mRNA leaves the nucleus and enters the cytoplasm
3 The protein is translated from the mRNA sequence using tRNA and amino acids