JOURNAL OF BACTERIOLOGY, Dec. 1991, p. 7834-7840 Vol. 173, No. 240021-9193/91/247834-07$02.00/0Copyright 1991, American Society for Microbiology

Molecular Analysis of Bacillus subtilis ada Mutants Deficient in theAdaptive Response to Simple Alkylating AgentsFUMIKO MOROHOSHI,1* KENSHI HAYASHI,2 AND NOBUO MUNAKATA1

Radiobiology Division1 and Oncogene Division,2 National Cancer Center Research Institute,Tsukiji, 5-1-1, Chuo-ku, Tokyo 104, Japan

Received 6 May 1991/Accepted 10 October 1991

Previously, we isolated and characterized six Bacillus subtilis ada mutants that were hypersensitive tomethylnitroso compounds and deficient in the adaptive response to alkylation. Cloning of the DNAcomplementing the defects revealed the presence of an ada operon consisting of two tandem and partiallyoverlapping genes, adaA and adaB. The two genes encoded proteins with methylphosphotriester-DNAmethyltransferase and 06-methylguanine-DNA methyltransferase activities, respectively. To locate the sixmutations, the ada operon was divided into five overlapping regions of about 350 bp. The fragments of eachregion were amplified by polymerase chain reaction and analyzed by gel electrophoresis to detect single-strandconformation polymorphism. Nucleotide sequences of the fragments exhibiting mobility shifts were deter-mined. Three of the mutants carried sequence alterations in the adaA gene: the adaAl and adaA2 mutants hada one-base deletion and insertion, respectively, and the adaA5 mutant had a substitution of two consecutivebases causing changes of two amino acid residues next to the presumptive alkyl-accepting Cys-85 residue. Threemutants carried sequence alterations in the adaB gene: the adaB3 mutant contained a rearrangement, theadaB6 mutant contained a base substitution causing a change of the presumptive alkyl-accepting Cys-141 toTyr, and the adaB4 mutant contained a base substitution changing Leu-167 to Pro. The adaB mutants producedada transcripts upon treatment with low doses of alkylating agents, whereas the adaA mutant did not. Weconclude that the AdaA protein functions as the transcriptional activator of this operon, while the AdaB proteinspecializes in repair of alkylated residues in DNA.

Some bacterial species, such as Escherichia coli andBacillus subtilis, exhibit an adaptive response to alkylation:when the cells are grown in the presence of methylating orethylating agents, they acquire resistance to subsequentchallenge with these agents (13, 20, 29). The ada mutantsthat are deficient in this response have helped to reveal theunderlying mechanisms of this response (9, 21).Genes complementing the ada mutations have been

cloned from E. coli (3, 12, 15, 24, 30) and B. subtilis (19).Comparisons of the gene organizations and sequences of theencoded proteins revealed intriguing similarities and differ-ences. In E. coli, the ada gene encodes a 39-kDa Ada proteinwith two cysteine residues: Cys-69 accepts an alkyl groupfrom alkylphosphotriesters and Cys-321 accepts one from06-alkylguanine and 04-thymine residues in DNA (3, 16, 32).In B. subtilis, two tandem and overlapping genes, termedadaA and adaB, encode 24-kDa AdaA and 20-kDa AdaBproteins. The AdaA and AdaB proteins accept an alkylgroup from alkylphosphotriesters and from 06-alkylgua-nines, respectively (23). The ada gene in E. coli forms anoperon with an alkB gene (11), while the adaA and adaBgenes in B. subtilis constitute an operon by themselves. Theexpressions of both operons are inducible by adaptive treat-ment (i.e., cultivation in the presence of low concentrationsof N-methyl-N'-nitro-N-nitrosoguanidine [MNNG] ormethyl methanesulfonate) (12, 19, 25, 36).

Six ada mutants of B. subtilis isolated were hypersensitiveto MNNG, and none of them produced the AdaB proteinupon adaptive treatment (21, 22). Three mutants (ada-3, -4,and -6) were proficient in synthesis of the AdaA protein,while the rest (ada-I, -2, and -5) were not (23). Thus, the

* Corresponding author.

former three mutants were thought to carry mutations in theadaB gene. As complementation experiments with thecloned adaA gene showed that the adaB gene was intact inthe latter three mutants (19), they were suspected of havingdefects in the adaA gene. This then suggested that the AdaAprotein was responsible for transcriptional activation of theoperon. To prove this hypothesis and to clarify the functionsof the two genes, we thought it was necessary to character-ize the molecular bases of the ada mutations.We found that one mutant (ada-3) carried a DNA rear-

rangement in the adaB coding region. The other five mutantsseemed not to carry gross sequence changes. To locate thesites of sequence alterations, we analyzed conformationalpolymorphisms of single-stranded DNA fragments amplifiedby the polymerase chain reaction (PCR-SSCP analysis) (26,33). We detected polymorphic fragments in the five mutantsand determined the sequences of the fragments. Threemutants (ada-i, -2, and -5) carried sequence alterations inthe coding region of the adaA gene, while the others (ada-3,-4, and -6) had alterations in the coding region of the adaBgene. Upon adaptive treatment, ada transcripts were pro-duced in the latter three mutants but not in the former ones.These results indicated that the adaA gene product is acrucial regulatory protein of the adaptive response.

MATERIALS AND METHODS

Bacterial strains. B. subtilis strains used in this work arelisted in Table 1. Six ada mutants were isolated previouslyfrom the spores of strains TKJ7501, TKJ7512, and TKJ1922irradiated with 1.4 Mrad of accelerated electrons (ada-i, -2,and -3) (21) or with 60Co gamma rays (ada-4, -5, and -6) (22).The mutations were all mapped by PBS1-mediated transduc-tion between attSPO2 and lin (22).

7834

on June 23, 2018 by guesthttp://jb.asm

.org/D

ownloaded from

SEQUENCE CHANGES OF B. SUBTILIS ada MUTATIONS 7835

TABLE 1. Bacterial strains

Designation Genotype Reference

TKJ7501 thyA thyB hisH101 metB101 21leuA8 uvrA10 ssp-1

TKJ7512 thyA thyB hisH01 metBi01 21lys-21 uvrAJ0 ssp-l

TKJ1922 thyA thyB hisH01 metB01 22leuA8 lys-21

1012 leuA8 metB5 hsrMl 7TKJ0922 As TKJ1922, but adaAl 22TKJO902 As TKJ7501, but adaA2 21TKJO903 As TKJ7501, but adaB3 21TKJ2924 As TKJ1922, but adaB4 22TKJ2925 As TKJ1922, but adaA5 22TKJ2906 As TKJ1922, but adaB6 22TKJ4906 As 1012, but leu+ adaB6 (1012 x This study

TKJ2906)

Southern and Northern blotting. Southern and Northern(RNA) blotting were performed by the standard methods ofManiatis et al. (14) with the modifications previously de-scribed (18). Restriction enzymes were purchased fromToyobo (Osaka, Japan).PCR-SSCP. The ada operon, consisting of the adaA (633

bp) and adaB (537 bp) genes with an overlap of 11 bp, wasdivided into seven regions (I to VII) (see Fig. 1). The 20-meroligonucleotides used as the primers of PCR were synthe-sized with a DNA synthesizer (model 380B; Applied Biosys-tems) and purified with oligonucleotide purification car-tridges (Applied Biosystems). Nucleotide sequences of leftand right primers of regions I to VII are shown in Table 2.DNA fragments of each region were amplified in a thermalcycler (Cetus) by using a Gene Amp Kit (Cetus). Thereaction mixture (20 p.1) contained 0.1 p.g of DNA extractedfrom ada+ or ada mutant cells, 1 p.l of [a-32P]dCTP (3,000Ci/mmol, 10 mCi/mi; Amersham), and the synthetic primers.The mixture was subjected to 20 cycles of heat treatment at94, 55, and 72°C for 0.5, 0.5, and 1 min, respectively. Afterthe reaction, an equal volume of 2x loading buffer I (40 mMEDTA, 0.2% sodium dodecyl sulfate [SDS], 0.1% bro-mophenol blue, 0.1% xylene cyanol) was added to themixture. The solution was diluted 25 to 100 times, dependingon the yield, with either loading buffer I or buffer II (95%formamide, 20 mM EDTA, 0.05% bromophenol blue, 0.05%xylene cyanol).The mixture diluted with loading buffer I was used to

detect polymorphism as double-stranded forms. It was ap-plied to 5% nondenaturing polyacrylamide gel containingbisacrylamide (1:50, wt/wt) and separated by electrophoresisat 30 W for 3 h under cooling with a fan. The mixture dilutedwith loading buffer II was used to detect polymorphism as

single-stranded forms. It was heated at 80°C for 2 min andthen applied to 5% nondenaturing polyacrylamide gel with or

without the addition of 5% glycerol. Electrophoresis was

carried out under cooling with a fan at 30 W for 3.5 to 4 h at4°C for the gels without glycerol or at 35 W for 4.5 h at roomtemperature for the gels with glycerol (26).

Sequencing of amplified DNA fragments. The double-stranded PCR product was separated by electrophoresis in5% nondenaturing polyacrylamide gel. After electrophore-sis, the gel was dried on filter paper (Whatmann 3MM) in a

gel drier. A small portion of the filter carrying radioactivitywas immersed in 50 ,ul of distilled water, and the solutionwas vortexed and allowed to stand for 1 h at room temper-ature. A 5-gl volume of the solution was used as a templatefor asymmetric PCR (34). The reaction mixture (100 ,ul) forPCR containing 5 and 0.5 pmol of each side primer, respec-

tively, and the template DNA was subjected to 50 cycles ofheat treatment as described above (4). Amplified DNA was

extracted once with phenol-chloroform and twice with chlo-roform and passed through Centricon 30 (Amicon). TheDNA sequence was determined with a 7-deaza SequenaseKit (U.S. Biochemicals) by using 1 pmol of 20-mer oligonu-cleotide, the 5'-end of which had been labeled with[y-32PJATP (7,000 Ci/mM; ICN Pharmaceuticals).

Inverse PCR. To determine the sequence around the site ofDNA rearrangement in the ada-3 mutant, inverse PCR wascarried out as described by Triglia et al. (37). DNA extractedfrom ada-3 mutant cells was digested with EcoRI and selfligated at a concentration of 3 ,ug/ml. The DNA sequenceinvolving the rearrangement site was amplified by using theligated DNA (15 ng) as a template and the left 20-mer ofregion I and the right 20-mer of region IV as primers. Themixture was subjected to 25 cycles of heat treatment at 94,55, and 72°C for 0.5, 0.5, and 2 min, respectively. Theamplified product was digested with HindIII and insertedinto the HindIll site of Bluescript SK M13+. The sequencewas determined by using a 7-deaza Sequenase Kit (USB).

RESULTS

Southern blot analysis of ada mutations. To detect possiblegross changes ofDNA sequence in ada mutants, we digestedDNAs with several restriction enzymes and subjected theproducts to Southern blotting. A 0.59-kb EcoT221-PvuIIfragment located within the coding regions of the adaA andadaB genes was used as a probe (Fig. 1). The DNAs from thewild type (ada+) and all ada mutants except the ada-3mutant produced identical patterns upon digestion withBglII, PvuII, or EcoRI (Fig. 2). DNA from ada-3 mutantcells produced an 8.9-kb fragment (instead of a 10.0-kb one)upon BglII digestion and a 2.5-kb fragment (instead of a15-kb one) upon EcoRI digestion. Its PvuII fragment was the

TABLE 2. Primers used to amplify region I to VII fragments

Region (nucleotide no.)a Left primer Right primer

I (-183 to 141 of adaA) TTATCTTGCTATTACATTCT AACAGCGTAGAAAAATTGATII (103 to 454 of adaA) AATGATGCAGCGTACAATAA ATTCTTGTTGTATATACTCAIII (415 of adaA to 142 of adaB ATTAAAGGCATTACGCTGGT TCCTAGCCCATTCGAACAATIV (102 to 482 of adaB) CAGAACAAACCAATCGAGGA TCATTTCAAATCCGCCCCGAV (442 to 781 of adaB and downstream region) ATGGCTCATTAACTGGCTAT AAATAAATCGACTCATGTTCVI (155 to 511 of adaA) TATTCTGTAAACCATCCTGT CGATATCTCCAATCGCTTTAVII (-132 to 124 of adaA) ATAGTGTAGTTATCAACAAT GATTATTGTACGGTGCATCA

a Nucleotides were numbered from the translation initiation sites of adaA and adaB.

VOL. 173, 1991

on June 23, 2018 by guesthttp://jb.asm

.org/D

ownloaded from

7836 MOROHOSHI ET AL.

FIG. 1. Restriction map of the ada operon showing locations of the fragments (I to VII) subjected to PCR-SSCP analysis.

same size (2.6 kb) as those of the other strains. These resultsshowed that, in the ada-3 mutant, DNA was rearrangedwithin the ada operon.PCR-SSCP analysis of ada mutations. The adaA and adaB

loci were divided into five overlapping regions (regions I toV) of about 350 bp as shown in Fig. 1. Each sequencebracketed by two synthetic primers was amplified in thepresence of [a-32P]dCTP. To detect possible size differ-ences, the amplified fragments were separated by electro-phoresis as double-stranded forms in nondenaturing poly-acrylamide gel. As shown in Fig. 3, the region I fragmentfrom the ada-2 mutant and the region II fragment from theada-i mutant moved slightly behind the others. The frag-mernts of regions III and V of all of the mutants migrated thesame distances. In region IV, a radioactive band was missingin the PCR product of ada-3 mutant DNA. These resultssuggested that the ada-1 and ada-2 mutations could be due tominor size changes in region II and I, respectively, and thatthe ada-3 mutation could be due to DNA rearrangement inregion IV.

Next, we analyzed single-stranded forms to detect possi-ble sites of base changes. The amplified fragments wereheated and subjected to electrophoresis in nondenaturing gel

with or without glycerol. Figure 4 shows the results ofPCR-SSCP analysis. The two major bands in each lane of thegel, which we call upper and lower bands for convenience,represent separated strands. In region I, both bands of theamplified products from the ada-2 mutant were slightlyretarded. In region II, both bands from the ada-i mutantmoved slightly ahead and the upper band of the ada-5 mutantmoved slightly slower than the others. In region III, allfragments moved equally. In region IV, both bands weremissing in the ada-3 mutant, and the lower band of the ada-6mutant was considerably retarded. In region V, the upperband of the ada-4 mutant was retarded. Thus, each mutantcontained a fragment of one region that exhibited a mobilitydifference: ada-1, -2, -3, -4, -5, and -6 mutants in regions II,I, IV, V, II, and IV, respectively.Base sequences of ada mutations. The base sequences of

the DNA fragments exhibiting mobility differences weredetermined by using the products of asymmetrical amplifi-cation. Since the direct sequencings of region I and IIfragments were unsatisfactory, different primers coveringregions VI and VII were used (Fig. 1). The region VIIfragment from the ada-2 mutant and the region VI fragments

*~m - - ___

FIG. 2. Southern blot analysis of DNAs from ada+ and ada mutant strains. DNAs were digested with BglII (I), PvuII (II), or EcoRI (III).The digests were subjected to electrophoresis in 0.4% (I and III) or 0.8% (II) agarose gel, transferred to a nylon membrane, and hybridizedwith a 0.59-kb EcoT221-PvuII fragment. Source of DNA: lane 1, TKJ1922 (ada+); lane 2, TKJ0922 (ada-i mutant); lane 3, TKJO902 (ada-2mutant); lane 4, TKJO903 (ada-3 mutant); lane 5, TKJ2924 (ada-4 mutant); lane 6, TKJ2925 (ada-S mutant); lane 7, TKJ4906 (ada-6 mutant).

J. BACTERIOL.

on June 23, 2018 by guesthttp://jb.asm

.org/D

ownloaded from

SEQUENCE CHANGES OF B. SUBTILIS ada MUTATIONS 7837

1 2 3 4 5 6 7

I m s .p,~ ...... ...... . ...

1 2 3 4 5 6 7

I

_m ~i. n

a s

..7,rw>;~~~~~~~~~~~~~~~~~~~~~~~~~~~~. ......

III o

IVd- _-

Iv

-..:C*.. ~~.*1..I. I, 1.. .,.,A-

V_ _

FIG. 3. Polymorphism of double-stranded DNA amplified fromada+ and ada mutant cells. Fragments of regions I to V are shownin panels I to V, respectively. Source of DNA: lane 1, ada+ cells;lane 2, ada-i mutant; lane 3, ada-2 mutant; lane 4, ada-3 mutant;lane 5, ada-4 mutant; lane 6, ada-5 mutant; lane 7, ada-6 mutant.

of the ada-i and ada-S mutants showed mobility differenceson PCR-SSCP analysis (data not shown).The results of sequence determinations are summarized in

Table 3 and Fig. 5. The five ada mutants carried sequencechanges in the region expected from mobility shifts on gelelectrophoresis. Three (ada-i, ada-2, and ada-S) mutationswere in the coding sequence of the adaA gene. The ada-imutant carried a one-base (C) deletion at nucleotide 336 ofthe adaA gene. This deletion causes a frame shift from aminoacid 112 and would produce a truncated AdaA protein of 115amino acids. The ada-2 mutant carried a one-base (A)insertion in a stretch of four A's from nucleotide 80 in the

FIG. 4. Polymorphism of single-stranded DNA amplified fromada+ and ada mutant cells. Assignments of the panels and lanes areidentical to those of Fig. 3.

adaA gene, causing a frame shift from amino acid 29, andwould produce a truncated AdaA protein of 34 amino acids.The ada-S mutant contained substitutions of two consecu-tive bases (AC to TT) at nucleotides 258 and 259 of the adaAgene, which would lead to changes of two consecutive aminoacid residues (Lys-Arg to Asn-Cys) at residues 86 and 87.

TABLE 3. DNA sequence changes in ada mutants

Wild-type sequence Mutation Mutant sequence

334TTCACAGAAAAATTA adaAl (1-base deletion) TTACAGAAAAATTAA112PheThrGluLysLeu LeuGlnLvsAsnEnd79GAAAAGTGGCAAGCA adaA2 (1-base insertion) GAAAAAGTGGCAAGC27GluLysTrpGlnAla GluLysValAlaSer253TGTAAACGTTGCAAG adaA5 (2-base change) TGTAATTGTTGCAAG85CysLysArgCysLys CysAsnCvsCysLys388ATTGGGGCTAATCCG adaB3 (rearrangement) ATTGGTTGCTCCGAT130IleGlyAlaAsnPro IleGlyCysSerAsp496GATCTGGAAAAGCGA adaB4 (1-base change) GATCCGGAAAAGCGA166AspLeuGluLysArg AspProGluLysArg418CCGTGCCATCGTGTA adaB6 (1-base change) CCGTACCATCGTGTA140ProCysHisArgVal ProTvrHisArgVal

V

anamm&L.. -blddmmm~

bond&~-,

VOL. 173, 1991

m dh.dd&W-,W --~~

on June 23, 2018 by guesthttp://jb.asm

.org/D

ownloaded from

7838 MOROHOSHI ET AL.

-4*_l _ _-

_ .m -

-. _ -~

FIG. 5. Nucleotide sequence changes in ada mutants. The lefthalf of each panel shows wild-type sequences. Arrowheads indicatethe mutated nucleotides. Source of sequence: panel I, ada-i mutant;panel II, ada-2 mutant; panel Ill, ada-4 mutant; panel IV, ada-Smutant; panel V, ada-6 mutant.

The other three mutations were in the adaB coding se-quence. The ada-4 mutant carried a base substitution atnucleotide 500 (T to C) that would result in substitution ofPro for Leu-167. The ada-6 mutant carried a base substitu-tion at nucleotide 422 (G to A) that would cause a change ofCys-141 to Tyr.

Southern blotting and SSCP analyses of the ada-3 mutantDNA indicated that the 3'-side sequence of the PvuII site inthe region IV was rearranged. The break point should bewithin the 2.5-kb EcoRI fragment that is unique in thismutant. On inverse PCR with the right primer of region I andthe left primer of region IV, a fragment of about 2 kbincluding the 3' portion of the adaB gene was amplified. Theproduct of the reaction contained EcoRI and HindIII sites atexpected positions. A 1.2-kb HindIII fragment presumablycontaining the break point was cloned with Bluescript SKM13' and sequenced. The sequence alterations were foundfrom the third G in a stretch of four G's from nucleotide 391of the adaB gene. This would cause amino acid sequencechanges from Ala-132 of the AdaA protein.Thus, all six ada mutations were in the coding sequences

of the adaA or adaB gene. From these results, we renamedthe six mutations adaAl, adaA2, adaA5, adaB3, adaB4, andadaB6.

Transcription of ada operon in ada mutants. Previously, weshowed that the major transcript of the ada operon started121 bp upstream of the initiation codon of AdaA and that thetranscript was about 1.6 kb. This transcript and two smallerones were detected in the adapted cells of the wild-typestrains (19). To determine the roles of the adaA and adaBgene products in the transcription of the ada operon, weanalyzed the mRNAs from the cells of the ada mutants byNorthern blotting, by using the 0.59-kb EcoT221-PvuII frag-ment (Fig. 1) as a probe. As shown in Fig. 6. three bands atpositions corresponding to sizes of 1.6, 1.2, and 0.9 kb weredetected in the RNAs from MNNG-treated cells of the ada',adaB4, and adaB6 strains. The intensities of radioactivity ofthese bands in three strains were not appreciably different.In MNNG-treated ada-3 mutant cells, larger transcri'pts

FIG. 6. Northern blot of mRNAs from ada+ and ada mutantcells. RNAs extracted from control (-) and MNNG-treated (+) cellswere subjected to electrophoresis in 1.2% agarose-formamide gel,transferred to a nylon membrane, and hybridized with a 0.59-kbEcoT221-PvuII fragment. Source of RNA: lanes 1 and 2, strainTKJ1922 (ada+); lanes 3 and 4, TKJ0922 (ada-i mutant); lanes 5 and6, TKJO902 (ada-2 mutant); lanes 7 and 8, TKJO903 (ada-3 mutant);lanes 9 and 10, TKJ2924 (ada-4 mutant); lanes 11 and 12, TKJ2925(ada-S mutant); lanes 13 and 14, TKJ4906 (ada-6 mutant).

were observed. On the other hand, no detectable band waspresent in blots of the RNAs from MNNG-treated adaAl,adaA2, and adaA5 mutant cells. These results show that allthree adaA mutants were totally deficient in transcriptionalactivation of the ada operon, whereas in all three adaBmutants activation was apparently normal.

DISCUSSION

We have determined the DNA sequence alterations in sixada mutants. This study was greatly facilitated by use of thePCR-SSCP analysis technique, by which DNA fragments ofabout 100 to 400 bp with minor sequence changes includingsingle-base substitutions can be identified (26, 33). More-over, by this technique, the DNA fragments analyzed can beobtained by direct amplification of chromosomal DNA with-out cloning. In this work, we started from phenotypicallycharacterized mutants and tried to map the mutations in oneof five fragments of about 350 bp. Our success in locating allsix ada mutations suggests that the rate of successful detec-tion is very high. This gives firmer credence to this methodfor detecting and locating various types of mutations.

Diverse molecular changes were identified in these adamutants. Two mutations were transitions (T/A to C/G inadaB4 and G/C to A/T in adaB6), one was an insertion ofA/T (adaA2), one was a deletion of G/C (adaAl ), one was a2-bp change (adaBS), and one was a gross rearrangement(adaB3). This diversity may have been due to the nature of

FIG. 7. Locations of three adaB mutations. The C-terminal 70amino acid residues of the AdaA protein from residue 110 areshown. Five conserved amino acids are boxed.

J. BACTERIOL.

on June 23, 2018 by guesthttp://jb.asm

.org/D

ownloaded from

VOL. 173, 1991 SEQUENCE CHANGES OF B. SUBTILIS ada MUTATIONS 7839

adaA adaAlno ...DKNlqyn

AdaA 76 91PlDI lCQVNXIatCVGAda 60 &AI ICR~ rldkithaerlltp 5 m

AraC 155 llwll n sl _ actysDhladsSdla8vh l WsrlshrqqlGl lswz lIt1t=p atvgVGXylS 188 4askll gswrot£ sZ vfle kr-l*lriL lawrsly: atTpkYrrlelsra drrslt-adyG

| Helix-Tum-Helix |

FIG. 8. Locations of two adaA mutations in the alignments of AdaA (B. subtilis), Ada (E. coli), AraC (E. coli), and XylS (P. putidaplasmid) proteins. The residues identical to those in AdaA are shown by uppercase letters. Residues from 76 to 175 of the AdaA protein areshown. The adaA2 mutation is in the N-terminal region and is not shown.

the mutagenic treatment employed, i.e., the high-dose irra-diation of spores with ionizing radiation.As shown previously, the adaA and adaB genes encode

methylphosphotriester-DNA methyltransferase (AdaA pro-tein) and 06-methylguanine-DNA methyltransferase (AdaBprotein), respectively (19). The three ada mutants that aresolely defective in synthesis of the AdaB protein carryalterations in the adaB coding sequence. These adaB mutantcells produced ada transcripts when they were grown in thepresence of MNNG, indicating that the AdaB protein wasnot involved in the transcriptional activation of the operon.To date, five genes (or cDNAs) coding for 06-methylgua-

nine-DNA methyltransferase have been sequenced (3, 5, 10,18, 19, 24, 28, 35). Deduced C-terminal amino acid se-quences were highly conserved. In particular, a stretch offive amino acid residues (Pro-Cys-His-Arg-Val) seems in-variant. This stretch includes the Cys residue that accepts analkyl group from 06-alkylguanine residues in DNA in the E.coli Ada protein (3). In the adaB6 mutant, the Cys residue inthis stretch is changed to Tyr, resulting in total loss of theactivity. This fact concurs with the assumption that this isthe alkyl-accepting residue in the AdaB protein. It alsodemonstrates that the sulfhydryl group is indispensable andcannot be replaced by a hydroxyl group.

Secondary-structure prediction according to the algorithmof Chou and Fasman (1) suggests that the active center ofthis alkyltransferase is in a P-strand, which is flanked bya-helices (Fig. 7). A similar arrangement is observed in theother 06-methylguanine-DNA methyltransferases, althoughthe sequence similarity between AdaB and the proteins isbarely recognizable in the C-terminal a-helix. The adaB4mutant carries a base change in the codon for Leu-167 to Proin the putative C-terminal a-helix. Our previous observationalso suggested the necessity of the C-terminal portion for theactivity; the initially cloned fragment lacking the C-terminal13 amino acid residues could not complement the MNNGhypersensitivity of adaB4 mutant cells (19).The three ada mutants that are deficient in the transcrip-

tion of the ada operon and the syntheses of both the AdaAand AdaB protein carry mutations in the adaA codingsequence. The adaAl and adaA2 mutations cause frameshifts, leading to truncations of the AdaA protein. TheadaAS mutation results in substitution of two consecutiveamino acid residues, Asn-Cys, for Lys-86-Arg-87. The lysineresidue is adjacent to Cys-85, which is considered to be thealkyl-accepting residue from alkylphosphotriesters. Se-quence comparisons show that a stretch of seven amino acidresidues (Phe-Arg-Pro-Cys-Lys-Arg-Cys) is identical in E.coli Ada and B. subtilis AdaA (3, 19, 24). All species ofDNAalkyltransferases so far identified contain the sequence offour amino acid residues (Pro-Cys-Lys or His-Arg) in their

presumed alkyl-accepting site (3, 5, 10, 18, 19, 24, 28, 35).The effect of the adaA5 mutation supports the conjecturethat two basic amino acids located on the C-terminal side ofthe alkyl-accepting cysteine residue are important for thisactivity.

Search of the NBRF protein data base revealed that aportion of the AdaA sequence is similar to those in the AraCproteins of E. coli and Salmonella typhimurium (2, 17) and tothose in the XylS protein of Pseudomonas putida TOLplasmid (8). These regulatory proteins carry a helix-turn-helix motif implicated in DNA binding (27). The AdaAprotein also contains this motif in the region exhibitingsequence similarity (Fig. 8). Thus, upon accepting an alkylgroup, the AdaA protein may bind to the promoter of the adaoperon through this motif. No adaA mutant carrying asequence change in this motif has been found, but thepresumed product in the adaAl mutant should be truncatedbetween the alkyl-accepting cysteine and the helix-turn-helixsequence (Fig. 8).Another interesting region is located several residues from

the C terminus of the helix-turn-helix motif. Several alleleshave been identified in the mutant strains of E. coli that werehyperresistant to MNNG and synthesized Ada protein con-stitutively (31). This constitutive phenotype seems to becaused by a change from Met-126 to Ile in the Ada protein(6). However, the corresponding position is occupied by Ilein the wild-type B. subtilis AdaA. We have been unsuccess-ful in isolating similar constitutive mutants of B. subtilis.For a full understanding of the mechanism of the adaptive

response, more mutants are required, especially those of theadaA gene. Our current efforts include the induction andcharacterization of additional adaA mutants and attempts todefine the promoter sequence to which the AdaA proteinbinds.

ACKNOWLEDGMENTSWe thank Reiko Makino (Oncogene Division) for instructions on

oligonucleotide synthesis and to Hiroshi Tanooka (RadiobiologyDivision) for encouragement.

This work was supported in part by grants-in-aid from theMinistry of Education, Science and Culture of Japan and from theScience and Technology Agency of Japan.

REFERENCES1. Chou, P. Y., and G. D. Fasman. 1974. Conformational parame-

ters for amino acids in helical, beta-sheet, and random coilregions calculated from proteins. Biochemistry 13:211-222.

2. Clake, P., H.-C. Lin, and G. Wilcox. 1982. The nucleotidesequence of the araC regulatory gene in Salmonella typhimu-rium LT12. Gene 18:157-163.

3. Demple, B., B. Sedgwick, P. Robins, N. Totty, M. D. Waterfield,and T. Lindahl. 1985. Active site and complete sequence of the

on June 23, 2018 by guesthttp://jb.asm

.org/D

ownloaded from

7840 MOROHOSHI ET AL. J. BACTERIOL.

suicidal methyltransferase that counters alkylation mutagenesis.Proc. Natl. Acad. Sci. USA 82:2688-2692.

4. Gyllensten, U. B., and H. A. Erlich. 1988. Generation of single-stranded DNA by the polymerase chain reaction and its appli-cation to direct sequencing of the HLA-DQA locus. Proc. Natl.Acad. Sci. USA 85:7652-7656.

5. Hayakawa, H., J. Koike, and M. Sekiguchi. 1990. Expressionand cloning of complementary DNA for a human enzyme thatrepairs O6-methylguanine in DNA. J. Mol. Biol. 213:739-747.

6. Hughes, S. J., and B. Sedgwick. 1989. The adaptive response toalkylation. J. Biol. Chem. 15:21369-21375.

7. Ikawa, S., T. Shibata, K. Matsumoto, T. Ijima, H. Saito, and T.Ando. 1981. Chromosomal loci of genes controlling site-specificrestriction endonucleases of Bacillus subtilis. Mol. Gen. Genet.183:1-6.

8. Inoue, S., A. Nakazawa, and T. Nakazawa. 1986. Nucleotidesequence of the regulatory gene xylS on the Pseudomonasputida TOL plasmid and identification of the protein product.Gene 44:235-242.

9. Jeggo, P. 1979. Isolation and characterization of Escherichiacoli K-12 mutants unable to induce the adaptive response tosimple alkylating agents. J. Bacteriol. 139:783-791.

10. Kodama, K., Y. Nakabeppu, and M. Sekiguchi. 1989. Cloningand expression of the Bacillus subtilis methyltransferase gene inEscherichia coli ada- cells. Mutat. Res. 218:153-163.

11. Kondo, H., Y. Nakabeppu, H. Kataoka, S. Kuhara, S. Kawa-bata, and M. Sekiguchi. 1986. Structure and expression of thealkB gene of Escherichia coli related to the repair of alkylatedDNA. J. Biol. Chem. 261:15772-15777.

12. LeMotte, P. K., and G. C. Walker. 1985. Induction and auto-regulation of ada, a positively acting element regulating theresponse of Escherichia coli K-12 to methylating agents. J.Bacteriol. 161:888-895.

13. Lindahl, T., B. Sedgwick, M. Sekiguchi, and Y. Nakabeppu.1988. Regulation and expression of the adaptive response toalkylating agents. Annu. Rev. Biochem. 57:133-157.

14. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecularcloning: a laboratory manual. Cold Spring Harbor Laboratory,Cold Spring Harbor, N.Y.

15. Margison, G. P., D. P. Cooper, and J. Brennand. 1985. Cloningof the E. coli 06-methylguanine and methylphosphotriestermethyltransferase gene using a functional DNA repair assay.Nucleic Acids Res. 13:1939-1952.

16. McCarthy, T. V., P. Karran, and T. Lindahl. 1984. Induciblerepair of 0-alkylated DNA pyrimidines in Escherichia coli.EMBO J. 3:545-550.

17. Miyada, C. G., A. H. Horwitz, L. G. Gass, J. Timko, and G.Wilcox. 1980. DNA sequence of the araC regulatory gene fromEscherichia coli B/r. Nucleic Acids Res. 8:5267-5274.

18. Morohoshi, F., K. Hayashi, and N. Munakata. 1989. Bacillussubtilis gene coding for constitutive 06-methylguanine-DNAalkyltransferase. Nucleic Acids Res. 17:6531-6543.

19. Morohoshi, F., K. Hayashi, and N. Munakata. 1990. Bacillussubtilis ada operon encodes two DNA alkyltransferases. Nu-cleic Acids Res. 18:5473-5480.

20. Morohoshi, F., and N. Munakata. 1983. Adaptive response tosimple alkylating agents in Bacillus subtilis cells. Mutat. Res.110:23-37.

21. Morohoshi, F., and N. Munakata. 1985. Bacillus subtilis mutantsdeficient in the adaptive response to simple alkylating agents. J.Bacteriol. 161:825-830.

22. Morohoshi, F., and N. Munakata. 1986. Two classes of Bacillussubtilis mutants deficient in the adaptive response to simplealkylating agents. Mol. Gen. Genet. 202:200-206.

23. Morohoshi, F., and N. Munakata. 1987. Multiple species ofBacillus subtilis DNA alkyltransferase involved in the adaptiveresponse to simple alkylating agents. J. Bacteriol. 169:587-592.

24. Nakabeppu, Y., H. Kondo, S. Kawabata, S. Iwanaga, and M.Sekiguchi. 1985. Purification and structure of the intact Adaregulatory protein of Escherichia coli K12, 06-methylguanine-DNA methyltransferase. J. Biol. Chem. 260:7281-7288.

25. Nakabeppu, Y., and M. Sekiguchi. 1986. Regulatory mecha-nisms for induction of synthesis of repair enzymes in responseto alkylating agents: Ada protein acts as a transcriptionalregulator. Proc. Natl. Acad. Sci. USA 83:6297-6301.

26. Orita, M., Y. Suzuki, T. Sekiya, and K. Hayashi. 1989. Rapidand sensitive detection of point mutations and DNA polymor-phisms using the polymerase chain reaction. Genomics 5:874-879.

27. Pabo, C. 0., and R. T. Sauer. 1984. Protein-DNA recognition.Annu. Rev. Biochem. 53:293-321.

28. Potter, P. M., M. C. Wilkinson, J. Fitton, F. J. Carr, J.Brennand, D. P. Copper, and G. P. Margison. 1987. Character-ization and nucleotide sequence of ogt, the O6-alkylguanine-DNA alkyltransferase gene of E. coli. Nucleic Acids Res.15:9177-9193.

29. Samson, L., and J. Cairns. 1977. A new pathway for DNA repairin Escherichia coli. Nature (London) 267:281-283.

30. Sedgwick, B. 1983. Molecular cloning of a gene which regulatesthe adaptive response to alkylating agents in Escherichia coli.Mol. Gen. Genet. 191:466-472.

31. Sedgwick, B., and P. Robins. 1980. Isolation of mutants ofEscherichia coli with increased resistance to alkylating agents;mutants deficient in thiols and mutants constitutive for theadaptive response. Mol. Gen. Genet. 180:85-90.

32. Sedgwick, B., P. Robins, N. Totty, and T. Lindahl. 1988.Functional domains and methyl acceptor sites of the Esche-richia coli Ada protein. J. Biol. Chem. 263:4430-4433.

33. Suzuki, Y., M. Orita, M. Shiraishi, K. Hayashi, and T. Sekiya.1990. Detection of ras gene mutations in human lung cancers bysingle-strand conformation polymorphism analysis of polymer-ase chain reaction products. Oncogene 5:1037-1043.

34. Suzuki, Y., T. Sekiya, and K. Hayashi. 1991. Allele-specificpolymerase chain reaction: a method for amplification andsequence determination of a single component among a mixtureof sequence variants. Anal. Biochem. 192:82-84.

35. Tano, K., S. Shiota, J. Collier, R. S. Foote, and S. Mitra. 1990.Isolation and structural characterization of a cDNA cloneencoding the human DNA repair protein for 06-alkylguanine.Proc. Natl. Acad. Sci. USA 87:686-690.

36. Teo, I., B. Sedgwick, M. W. Kilpatrick, T. V. McCarthy, and T.Lindahl. 1986. The intracellular signal for induction of resis-tance to alkylating agents in E. coli. Cell 45:315-324.

37. Triglia, T., M. G. Peterson, and D. J. Kemp. 1988. A procedurefor in vitro amplification of DNA segments that lie outside theboundaries of known sequences. Nucleic Acids Res. 16:8186.

on June 23, 2018 by guesthttp://jb.asm

.org/D

ownloaded from