NGS Bioinformatics Workshop2.1 Tutorial – Next Generation Sequencing

and Sequence Assembly Algorithms

May 3rd, 2012IRMACS 10900

Facilitator: Richard BruskiewichAdjunct Professor, MBB

AgendaData format review (and some associated

tools)Revisit GalaxyRevisit data visualization

FASTQ FASTQ – FASTA “with an attitude” (embedded quality scores). Originally

developed at the Sanger to couple (Phred) quality data with sequence, it is now common to specify raw read output data from NGS machines in this format.

Various flavors: fastq-sanger fastq-illumina fastq-solexa

Differing in the format of the sequence identifier and in the valid range of quality scores. See:

http://en.wikipedia.org/wiki/FASTQ_formathttp://maq.sourceforge.net/fastq.shtml

http://nar.oxfordjournals.org/content/earlyà /2009/12/16/nar.gkp1137.full

“…the Sanger version of the FASTQ format has found the broadest acceptance, supported by many assembly and read mapping tools …Therefore, most users will do this conversion very early in their workflows…”

@EAS54_6_R1_2_1_443_348GTTGCTTCTGGCGTGGGTGGGGGGG+EAS54_6_R1_2_1_443_348*-+*''))**55CCF>>>>>>CCCC

SAM/BAMSAM– a tab-delimited text file that contains a compact

and index-able representation of nucleotide sequence alignments

http://samtools.sourceforge.net/SAM1.pdfhttp://samtools.sourceforge.net/

BAM – binary version of SAM (preferred by IGV) I/O format of several NGS tools, see:

http://samtools.sourceforge.net/swlist.shtmlSee also:Li H.*, Handsaker B.*, Wysoker A., Fennell T., Ruan J., Homer N., Marth G., Abecasis G., Durbin R. and 1000 Genome Project Data Processing Subgroup (2009) The Sequence alignment/map (SAM) format and SAMtools. Bioinformatics, 25, 2078-9.

http://picard.sourceforge.net/command-line-overview.shtml

http://picard.sourceforge.net/

The Picard command-line tools are packaged as executable jar files. They require Java 1.6. They can be invoked as follows:

java jvm-args -jar PicardCommand.jar OPTION1=value1 OPTION2=value2...

Most of the commands are designed to run in 2GB of JVM, so the JVM argument -Xmx2g is recommended.

Getting & Running Picard…Obtain archive using project “Download” linkExtract zip file to sensible locationEnsure that you have Java 6 on your machineRun from command shell as indicated

http://hannonlab.cshl.edu/fastx_toolkit/

Linux, MacOSX or Unix only

Visualization of NGS Data - Standalonehttp://www.broadinstitute.org/igv/

Visualization of NGS Data – Web Site

http://gmod.org/wiki/GBrowse_NGS_Tutorial

GALAXY REVISITED2.1 Next Generation Sequencing and Sequence Assembly Algorithms

Learning about GalaxyExtensive web resources available:

http://wiki.g2.bx.psu.edu/Learn/Getting started: “Galaxy 101”Other screencastsInformation pages about dataset management,

tool usage and data visualizationPublished pages/protocols:

https://main.g2.bx.psu.edu/page/list_published

Logging into Galaxy @ WestGridhttps://joffre.westgrid.ca/galaxy/

Accessing the Westgrid Galaxy instanceUse your Westgrid ID (email name without @part) to

log into Joffre, e.g. if your email is ‘rbruskie@sfu.ca’, your server access id is ‘rbruskie’, and use your WestGrid password

Logging into the Galaxy instanceOnce into Galaxy, you need to register (initially) or log

in (if already registered) using your username (your full email, e.g. ‘rbruskie@sfu.ca’) and (important!) use your WestGrid password as the Galaxy password

Small issue for access through IE?

We will run through “Galaxy 101”

https://main.g2.bx.psu.edu/galaxy101

Try it! Ask questions along the way….

Some sensible steps for processing NGS data

Obtain the data (i.e. upload to Galaxy)Assess quality of read dataConvert reads to convenient form (fastq?)Filter out questionable data: low quality, vectorProcess to integrate

de novo assembly: Allpaths, ABySS, Velvet, SOAPdenovo, etc., or…

Map onto reference: SAM, Bowtie, MAQ, etc.Clean up and visualize