materials and methods - shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/14175/8/08_chapter...
TRANSCRIPT
![Page 1: MATERIALS AND METHODS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/14175/8/08_chapter 3.pdf · Pea Tic40(40K.Da) psTic40 1:7500 Arabidopsis Tic55(55K.Da) atTic55 1:1500](https://reader034.vdocuments.us/reader034/viewer/2022042209/5eacacc8001ca37f8c6a0ca4/html5/thumbnails/1.jpg)
_MATERIALS AND METHODS
![Page 2: MATERIALS AND METHODS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/14175/8/08_chapter 3.pdf · Pea Tic40(40K.Da) psTic40 1:7500 Arabidopsis Tic55(55K.Da) atTic55 1:1500](https://reader034.vdocuments.us/reader034/viewer/2022042209/5eacacc8001ca37f8c6a0ca4/html5/thumbnails/2.jpg)
MATE.RIALS AND M£THODS
Plant materials and growth conditions
Arabidopsis thaliana ecotype Columbia-0 (Col-O) plants were grown on plastic pots
filled with agropeat soil. The Arabidopsis seeds vernalized at 4°C for 3 days were
resuspended in milli-Q water and 20-30 seeds per pot were uniformly distributed over
the agropeat soil. Plants were allowed to grow photoperiodically (14h LllOh D) at 22°C
in 100 IJ.moles photons m-2 s-1 light intensity.
For plant growth in aseptic medium, seeds (40 mg) of Arabidopsis were surface
sterilized with 20 ml of sterilization solution [2 % sodium hypochlorite) with 1 f.!Vml of
20% Triton X-100] and gently mixed by inversion for 15 min. Washing of seeds with
autoclaved water was repeated several times till the bleach smell disappeared (it
normally takes more than 5 washes). The seeds were finally resuspended in required
volume of sterile water and then plated on GM medium aseptically containing 0.8%
difco bacto agar.
General sterilization procedures
Culture media, glassware and tissue culture tools were sterilized by autoclaving at
121°C and 15.1 p/inch2 pressure for 15 min. Antibiotics and other heat -labile
components used were filter-sterilized using a syringe filtration unit fitted with an
autoclaved cellulose nitrate membrane filter of0.22 f..lm pore size (mdi, India).
Nutrient media
The GM medium (Gamborg et al., 1968) consists of 0.5X MS basal medium (Sigma)
containing the macro- and micronutrients, vitamins, 1% sucrose, inositol and MES as
mentioned in Table- I.
Table- I. Composition of the GM medium (Gamborg et al., 1968)
Constituents Concentration
0.5X MS salt with macro-and micronutrients, Vitamins (Sigma) 2.2 g/L
1% Sucrose 10 g/L
Inositol 100 mg/L
MES 500 mg/L
Adjusted to pH 5.7 with 1M KOH.
The medium was prepared and the pH was adjusted to 5.7 using 1M KOH prior to the
addition of agar (0.7 - 0.8 % Difco Bacto Agar) and then autoclaved. The filter-
56
![Page 3: MATERIALS AND METHODS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/14175/8/08_chapter 3.pdf · Pea Tic40(40K.Da) psTic40 1:7500 Arabidopsis Tic55(55K.Da) atTic55 1:1500](https://reader034.vdocuments.us/reader034/viewer/2022042209/5eacacc8001ca37f8c6a0ca4/html5/thumbnails/3.jpg)
MAT£RIALS AND Mt:THODS
sterilized solution of heat labile antibiotics (Table -2) was added to the autoclaved
medium pre- cooled to 45°C and poured into sterile petridishes in a clean bench. The
petri dishes containing the medium remained open for 1 0-15 min inside the hood under
laminar flow to cool and dry the medium.
Chemicals
Various specific experimental materials, antibiotics and their concentrations, antibodies
with different dilutions used in this study are given in Table (2), (3) and (4)
respectively. The whole set of oligos used are also mentioned in Table (5).
Table-2. Sources of various experimental materials
Material Source
Seeds Arabidopsis thaliana (Col-O) ABRC, Ohio, USA
WT, tic-22 mutant
Plasmids pGEM-T Easy, pCAMBIA Prom ega, CAMBIA,
1304, pET 30a, pHannibal, Novagen
pART27
Bacterial strains Escherichia coli (E.coli) DH5a, Novagen,
BL21 (DE3), Agrobacterium
tumefaciens (GV1301)
Markers lkb ladder, A Hind III Banglore GENEI, MBI
Fermentas
Radioisotopes a 32P dCTP, S35 methionine Amersham, BRIT
Membrane(s) Nylon, Nitrocellulose Amersham, mdi
Restriction enzymes Enzymes in general use Promega, NEB
Secondary antibody anti-rabbit IgG Sigma
General chemicals Sigma, Amersham, Biorad,
Qualigen
57
![Page 4: MATERIALS AND METHODS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/14175/8/08_chapter 3.pdf · Pea Tic40(40K.Da) psTic40 1:7500 Arabidopsis Tic55(55K.Da) atTic55 1:1500](https://reader034.vdocuments.us/reader034/viewer/2022042209/5eacacc8001ca37f8c6a0ca4/html5/thumbnails/4.jpg)
MAT£RIALS AND Mf:THODS
Table-3. Concentration of antibiotics used in this study
Antibiotic Abbreviation Concentration (J..Lg/ml)
Ampicillin (Sodium salt) Amp 100
Kanamycin (kanamycin Km 50
sulfate)
Rifampicin Rf 25
Table-4. Antibodies used in this study
Antibodies Abbreviation Dilution
Pea Toc34 (34K.Da) psToc34 1:7500
Pea Toc75 (75K.Da) psToc75 1:7500
ArabidopsisToc159(160K.Da) atToc159 1:5000
Pea Tic40(40K.Da) psTic40 1:7500
Arabidopsis Tic55(55K.Da) atTic55 1:1500
Arabidopsis Tic62( 60K.Da) atTic62 1:1000
Pea Tic110 (110K.Da) psTicl10 1:5000
Pea Molecular Chaperone heat shock protein 93(93K.Da) psHsp93 1:5000
Arabidopsis Cpn60( a) subunit Cpn60(a) 1:7500
Pea Tic22 (22K.Da) psTic22 1:1000
The psToc34, psTic40, psTic110 and psHsp93 antibodies were a kind gift from Dr.
Keneth Keegstra and atToc159 antibody was a kind gift from Dr. Felix Kessler. The
psTic22 and psToc75 antibodies were gifted to us by Dr. Masato Nakai.
Table-S. Primers used in this study
Name Sequence Tm
Kan F: 5' TCGACCATGGGGATTGAACAAGATGG 3' 61.2
R: 5' ATTCGAGCTCTCAGAAGAACTCGTCAAGAAGGC 3' 64.4
35S Int F: 5' CCC ACT ATC CTT CGC AAG AC 3' 59.4
Oligo dT 5'TTTTTTTTTTTTTTTTTTTTTTTT3' 39.1
a tAct F: 5' ATGGCTGATGGTGAAGACATT 3' 55.8
R: 5' TCAGAAGCACTTCCTGTGAACA 3' 55.8
atTocl59 IntF:5' TGG CAT ATG TGG TCA GAG GAG 3' 58.2
R: 5' TTA GTA CAT GCT GTA CTT GTC 3' 60.0
atToc75 IntF: 5' CTT CAA CCG CCA CCA GTT AAC 3' 54.5
58
![Page 5: MATERIALS AND METHODS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/14175/8/08_chapter 3.pdf · Pea Tic40(40K.Da) psTic40 1:7500 Arabidopsis Tic55(55K.Da) atTic55 1:1500](https://reader034.vdocuments.us/reader034/viewer/2022042209/5eacacc8001ca37f8c6a0ca4/html5/thumbnails/5.jpg)
MAT£RIALS AND M£THODS
R: 5' ITA ATA CCT CTC TCC AAA TCG 3' 55.2
atToc64 F: 5' AGT CTG CTT AGC ATT GCT AGC 3' 60.1
R: 5' TCA CTG GAA TTT TCT CAG TCT 3' 58.2
atToc34 F: 5' ATG ACC TTG ATA GGC AAG TTG 3' 62.2
R: 5' TCA AGA CCT TCG ACT TGC T AA 3' 60.1
atToc33 F: 5' TAG ATA AGC AAG TIG ITA TAG 3' 55.2
R: 5' ITA AAG TGG CTT TCC ACT TGT 3' 58.0
atTicl10 F: 5' CTA GAC GAG TTG CAA AAA CAA 3' 57.8
R: 5' IT A AAA GAC GAA ATT GCC CTC 3' 58.2
atTic62 F: 5'CGG GAT CCG GTA CCA TGG AAG GAA CTT GTT TTC 3' 62.8
R: 5'CGG GAT CCG AAT TCC TAA TGA TIG GTG ACT 3' 64.2
atTic55 F:5' GGG GT A CCT CTC GAA TGG CTG TTC CAT TIC T AA 3' 64.5
R: 5' CGG AAT TCT CAT AGT CTT CTG TGT GTT 3' 66.3
atTic40 F: 5' TGA GGA TGT CTT GCA AAA TGG 3' 56.4
R: 5' TCA ACC CGT CAT TCC TGG GAA 3' 55.9
atTic22 F: 5'GCT CTA GAG GTA CCA TGG AGT CAT CAG TGA AAC 3' 62.3
R: 5'GCG TCG ACG GTA CCT TAC TCT TTG ATC AAA TCC3' 63.4
atTic22ptgs F: 5'- GGGGT ACCCGGGATCCACCGGAGGCAAGTCT ATCGGT -3' 73.4
R: 5'- CCCTCGAGGCTCT AGATTACTCTTTGATCAAATCCTG-3' 72.5
atTic22-III F: 5' ATG AAT TCA AAC ATT TTC CCA 3' 55.4
R: 5' ITA CTC CTG TGT TTG CTC AGT 3' 53.5
atTic20 F: 5' TGC CAC TGC ATG AAA CIT GGA 3' 56.8
R: 5' ITA GTC GTA CGG AAT CTG GAT 3' 58.7
F: 5'CGGGATCCGGTACCATGGCGTCTGCAAACGCTCTC 3' 63.2
at Cpn60(a) R:5'GCGTCGACGGTACCTACACCATGAGACCCTCAGGA3' 66.5
M: 5'CGGGATCCGCTAATGTAAAGGAAATAGCTTTTGAC 3' 60.9
atCpn60(I3) intF: 5' CAT TCT AAC TGG AGC AAC TGT 3' 53.1
R: 5' ITA GTA TCC ATA TCC TGA GTT 3' 46.7
RTatTic22 intF: 5' CGAATCGAAGACACGAAACGAT 3' 61.2
intR:5' AGATGGACTCAACGTCGTCGTC 3' 62.5
RTat Cpn60(a) intF: 5' CGGAGCAGCAACTGAAACTGA 3' 60.6
intR: 5' ATGCACCAAAGCAGCACCA 3' 62.3
atTic22 LP: 5' TCGTGGTAGCTACATTCCCAG 3' 59.0
RP:5' CCTGCATGTGTTGTGCATAAC 3' 59.3
at Cpn60(a) LP:5' ACGCTTCAGAGTTGAAACTGC 3' 60.0
RP:5' TGTACCTGACGGGAAGAACAG 3' 60.4
LBa1 F: 5' TGGTICACGTAGTGGGCCATCG 3' 60.0
59
![Page 6: MATERIALS AND METHODS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/14175/8/08_chapter 3.pdf · Pea Tic40(40K.Da) psTic40 1:7500 Arabidopsis Tic55(55K.Da) atTic55 1:1500](https://reader034.vdocuments.us/reader034/viewer/2022042209/5eacacc8001ca37f8c6a0ca4/html5/thumbnails/6.jpg)
MATERIALS AND METHODS
Recombinant DNA techniques for cloning and DNA analysis
Polymerase chain reaction
Rapid amplification of the eDNA or genomic DNA fragment was carried out using Taq
DNA polymerase and a set of convergent primers. Reaction mixture (50 J..ll) contained
30 - 50 ng DNA template, 30pmoles of each primer, 8 J..ll of 1.25 mM dNTPs, 5 J..ll 1 OX
Taq buffer and 2.5 units ofTaq polymerase. The reaction condition ofPCR consisted of
denaturation (94°C), annealing (varies from gene to gene) and extension (72°C) for 1
min per lkb pair to be amplified. Reaction was continued for 30 cycles to obtain an
amplified product. An aliquot from the mix was electrophoresed on 1 % agarose gel to
check for amplification.
Setting up a restriction digest
Restriction digestion was set according to Promega protocols. To 3 J..ll of lOX
restriction enzyme buffer, 0.2 fll of BSA, 1 flg DNA, 0.5 fll of restriction enzyme
(lOulf.!l of DNA) was added and the final volume was made up to 30 fll with sterile,
deionised water. The reaction mixture was incubated at 37°C for 2 h and then
fractionated on 1% agarose gel.
Purification of DNA fragment from agarose gel
PCR amplified product or restriction enzyme digested plasmid was electrophoresed on
1% agarose gel (Agarose, MB, Pharmacia). The desired fragment was identified using
standard molecular weight marker (1 kb ladder or Lambda DNA digested with Hind
III) and purified as mentioned below. To the excised pieces of agarose gel (not
exceeding 500 mg) containing DNA fragment an aliquot of 500 fll of captured buffer
(GFX gel extraction kit, GE Health care, England) was added and dissolved by heating
to 55°C for 10 min. The mixture was loaded onto GFX spin column and spun briefly in
a microfuge (maximum speed, 30 sec). The flow through was discarded and 500 fll of
wash buffer was added to the spun column. The column was again centrifuged at
maximum speed for 30 sec. Purified DNA fragment was eluted with 50 J..ll of 10 mM
Tris-HCl, pH 8.0.
60
![Page 7: MATERIALS AND METHODS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/14175/8/08_chapter 3.pdf · Pea Tic40(40K.Da) psTic40 1:7500 Arabidopsis Tic55(55K.Da) atTic55 1:1500](https://reader034.vdocuments.us/reader034/viewer/2022042209/5eacacc8001ca37f8c6a0ca4/html5/thumbnails/7.jpg)
MATERIALS AND METHODS
Preparation of competent cells and transformation
DH5a cells were made competent by following the protocol of Hanahan, 1983. A
single colony of DH5a was picked up and inoculated into 5 ml of LB medium (10 g
Nacl, 10 g tryptone, 5 g yeast extract per lL) and grown overnight at 37°C. One ml of
this was inoculated freshly into 100 ml ofLB and grown at 37°C till O.D 600 of0.4- 0.5
was reached (2- 3 hrs). The cells were harvested by centrifugation at 3000 X g for 10
min. The pellet was resuspended in 40 ml of ice cold 100 mM CaClz solution,
incubated on ice for 1 hr, centrifuged and the pellet was resuspended in 4 ml of ice cold
100 mM CaClz containing 15 % glycerol solution. The cell suspension (O.lml) was
ali quoted into autoclaved un-opened eppendorf tubes and stored at -80°C
DNA fragments were ligated to the appropriate vectors by using T4 DNA ligase
(Promega, USA) overnight at 4°C or 16°C. The ligation mixture was added to the
competent cells and mixed by tapping and then incubated for 30 min at 4°C. All steps
were carried out in a laminar hood under sterile conditions. The cells were subjected to
heat shock by incubating at 42°C for 90 sec, allowed to stand for 2 - 5 min on ice
followed by addition of0.9 ml ofLB and then grown at 37°C with gentle shaking (185
rpm) for lh. Different aliquots of these transformed competent cells were plated onto
LB plate (lOg Nacl, lOg tryptone, 5g yeast extract and 15g agar per lL) containing
appropriate antibiotic. The LB medium-containing agar was autoclaved. The filter
sterilized solution of heat labile antibiotics was added to the autoclaved medium pre
cooled to 45°C and poured into sterile petridishes in a clean bench. For blue white
selection, 10 J.lg IPTG and 1 J.lg X- gal per plate were spread prior to plating the cells.
The plates were incubated overnight at 37°C. Transformed cells containing
recombinant plasmid were confirmed by colony PCR and restriction digestion.
Isolation and purification of plasmid DNA
Five milliliters of overnight grown culture of bacterial cells were harvested by
centrifugation at a maximum speed for 1 min in a microfuge. The pellet was re
suspended in 100 f.ll of ice-cold solution I (50 mM Tris-HCl, pH 8.0, 10 mM EDTA,
100 J.lg/ ml RNase A) and vortexed vigorously. Then cells were lysed by adding 200 f.ll
freshly prepared solution II (200 mM NaOH, 1% SDS) and gently mixed by inverting
the tube five times and then kept on ice for 5 min. Following this, 150 f.ll of chilled
solution III (3.0 M potassium acetate, pH 5.5) was added and mixed by inversion. This
61
![Page 8: MATERIALS AND METHODS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/14175/8/08_chapter 3.pdf · Pea Tic40(40K.Da) psTic40 1:7500 Arabidopsis Tic55(55K.Da) atTic55 1:1500](https://reader034.vdocuments.us/reader034/viewer/2022042209/5eacacc8001ca37f8c6a0ca4/html5/thumbnails/8.jpg)
MAT£RIALS AND METHODS
mixture was incubated on ice for 3-5 min and centrifuged at maximum speed in a
microfuge for 5 min at 4°C. The supernatant was extracted with equal volumes of Tris
equilibrated Phenol (pH 8.0): Chloroform: Iso amyl alcohol (25:24:1) at maximum
speed for 2 min at 4°C. The DNA precipitation was carried out by adding 1/10 volume
of 3M sodium acetate (pH 5.2) and two volumes of ethanol (room temperature). The
mixture was incubated at room temperature for 2 min and centrifuged at maximum
speed for 5 min to precipitate DNA. The plasmid DNA was washed with 70% ethanol,
vacuum dried and dissolved in minimal volume of water or TE (1 0 mM Tris, pH 8.0
and 1 mM EDTA) buffer.
Spectrophotometric estimation of nucleic acid
The quantity and quality of the nucleic acid was determined by measunng the
absorbance at 260 nm and 280 nm. The amount was calculated taking 1.0 A 26o = 50
Jlg/ml for DNA and 1.0 A 260 = 40 Jlg for RNA. The purity of the nucleic acid was
determined by calculating the ratio A 260/ A 280 for each sample that yielded a ratio of~
1.8.
PTGS Construct Preparation of atTic22 (At4g33350)
Amplification of atTic22 and its ligation to pGEMT -Easy : For PTGS experiments a
atTic22ptgs eDNA fragment (nt 301 to nt 807), was PCR amplified using eDNA
library of A thaliana. The primers used are forward primer 5'
GGGGTACCCGGGATCCACCGGAGGCAAGTCTATCGGT-3' and reverse primer
5'- CCCTCGAGGCTCTAGATTACTCTTTGATCAAATCCTG-3' (Kpnl and Bamm
restriction sites were introduced at the 5 '-end of the forward primer and Xhol, Xbal
restriction site were engineered at the 5 '-end of the reverse primer), designed based on
the eDNA sequence (Accession no. At4g33350) available in the Gene Bank. PCR was
done in 20 J.!l volume containing 20 ng of template DNA, 15 pmoles of each primer,
200J!M of dNTPs, 4 units of taq polymerase in buffer containing 10 mM Tris-HCl pH
8.3, 50 mM KCl, 15 mM MgCb. PCR amplification was done with a program having
94°C for 2 minutes (initial denaturation) followed by 30 cycles of 94°C (denaturation)
for 30 seconds, 55°C (annealing) for 30 seconds, 72°C (extension) for 1 minute in a
Perkin-Elmer (USA) thermal cycler. The resulting amplification products were gel
purified. The purified fragment was ligated to pGEM T -easy (Promega, USA) vector.
62
![Page 9: MATERIALS AND METHODS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/14175/8/08_chapter 3.pdf · Pea Tic40(40K.Da) psTic40 1:7500 Arabidopsis Tic55(55K.Da) atTic55 1:1500](https://reader034.vdocuments.us/reader034/viewer/2022042209/5eacacc8001ca37f8c6a0ca4/html5/thumbnails/9.jpg)
MATERIALS AND METHODS
The recombinant plasmid (pGEM T-easy-atTic22ptgs) was transformed into competent
E.coli (DH5a.) cells. Plasmid DNA was prepared and the nucleotide sequence of the
atTic22ptgs was confirmed by sequencing using standard procedure.
Cloning of AtTic22ptgs frragment in pHannibal PTGS vector: Clone I - pGEMT
EASY-AtTic22ptgs construct was digested with BamH I and Xba I to release the
atTic22ptgs product and then it was ligated to pHannibal (digested with BamHland
Xbal) in sense orientation, and transformed in E.coli cells. Different colonies were
taken and confirmed by colony PCR. PCR confirmed colonies were inoculated in liquid
LB Broth for plasmid isolation and size was checked by digesting with BamH I and
Xbai to confirm the correct size.
Clone II- pGEMT-EASY- AtTic22ptgs construct was digested with Kpni and Xhoi
enzymes to release the atTic22ptgs product and then it was ligated to pHannibal
(digested with Kpni and Xhoi) in antisense orientation, and transformed in E. coli cells.
To confirm the insert, colonies were inoculated in liquid LB broth for plasmid isolation,
and sizes were checked by digesting with Xbal.
Cloning of atTic22ptgs construct in plant transformation vector: Plasmid of the
pART104 containing the kanamycin (npt) gene was digested by Noti and
dephosphorylated. Dephosphorylation was carried out by using calf intestine alkaline
phosphatase (ClAP). Briefly one micro gram of plasmid was incubated with lOU of
ClAP along with IX buffer and water to make up the volume to 20ul. The reaction
mixture was incubated for 30 min at 37°C. The reaction was stopped by heating at 75°C
for 10 min, load on a 0.8% agarose gel and purified. The atTic22ptgs final construct
with 35S cauliflower mosaic virus (CaMV) promoter and terminator was taken out
from pHannibal-AtTic22ptgs recombinant plasmid (Clone II) by digestion with Not I
enzyme. It was ligated to the above dephosphorylated pART104 vector containing the
kanamycin (npt) gene. After ligation and transformation, plasmids were isolated from
the recombinant colonies and were digested by Not I enzyme to confirm the positive
colony. The positive recombinant clone was transformed in Agrobacterium GV1301.
Transformation of Agrobacterium
Recombinant plasmid constructs (Modified pCAMBIA 1304-atCpn60( a) and
pART104-atTic22ptgs) was transformed into Agrobacterium by freeze thaw method.
For the preparation of competent cells, Agrobacterium tumefaciens (GV1301) was
63
![Page 10: MATERIALS AND METHODS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/14175/8/08_chapter 3.pdf · Pea Tic40(40K.Da) psTic40 1:7500 Arabidopsis Tic55(55K.Da) atTic55 1:1500](https://reader034.vdocuments.us/reader034/viewer/2022042209/5eacacc8001ca37f8c6a0ca4/html5/thumbnails/10.jpg)
MATERIALS AND METHODS
grown in 50 ml YEM medium (0.04% yeast extract, 1% mannitol, 0.01 NaCl, 0.02%
MgS04. 7H20 and 0.05% K2HP04) at 28°C with vigorous shaking (200 rpm) until the
O.D 600 reached 0.5 to 0.6. The culture was chilled on ice and centrifuged at 3000 X g
for 5 min at 4°C. The pellet was resuspended in 1 ml of ice cold CaCh (20 mM).
Aliquots (0.1 ml) were dispensed in pre-chilled eppendorftubes (autoclaved) and stored
at- 80°C.
Transformation of Agrobacterium (GV1301) with pCAMBIA1304-atCpn60(a)
antisense and sense construct I pART104-AtTic22ptgs plasmid construct was carried
out by mixing 100 ng of DNA with competent cells followed by immediate freezing in
liquid nitrogen for 2 min. Subsequently cells were thawed by incubating the eppendorf
tubes at 37°C for 5 min. One ml ofYEM medium was added to the tube and incubated
at 28°C for 3 h. Cells were spread on a YEM agar plate supplemented with 50 J.lg/ml
kanamycin and 25 J.lg/ml rifampicin and incubated at 28°C. Transformed colonies that
appeared after 1-2 days were analyzed either by PCR and the positive colonies were
confirmed by restriction digestion of the purified recombinant plasmids.
Antisense and Sense Construct Preparation of AtCpn60( a)
(At2g28000)
Amplification of atCpn60(a) and its ligation to pGEMT-Easy : For the
amplification of full atCpn60(a) eDNA fragment (1761 bp), eDNA library of A
thaliana was used. atCpn60( a) eDNA fragment was amplified with a pair of primers:
forward primer 5'- CGGGATCCGGTACCATGGCGTCTGCAAACGCTCTC -3' and
reverse primer 5'- GCGTCGACGGTACCTACACCATGAGACCCTCAGGA -3'
(Bam HI, Kpn I restriction sites was introduced at the 5 '-end of the forward primer and
Sal! and Kpnl restriction site was engineered at the 5 '-end of the reverse primer),
designed based on the eDNA sequence (Accession no. At2g28000) available in the
Gene Bank. Cloning in pGEMT-EASY was carried out as described above.
Cloning of AtCpn60( a.) in antisense and sense orientation in modified plant
transformation vector: Plasmid of the modified pCAMBIA 1304 containing the
kanamycin (npt) gene and CaMV 35S omega enhancer cassette was digested by Kpn I.
The atCpn60( a) eDNA was taken out from pGEMT Easy cloned AtCpn60( a) (pGEMT
Easy~AtCpn60(a)) recombinant plasmid. The recombinant plasmids were digested
64
![Page 11: MATERIALS AND METHODS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/14175/8/08_chapter 3.pdf · Pea Tic40(40K.Da) psTic40 1:7500 Arabidopsis Tic55(55K.Da) atTic55 1:1500](https://reader034.vdocuments.us/reader034/viewer/2022042209/5eacacc8001ca37f8c6a0ca4/html5/thumbnails/11.jpg)
MAT£RIALS AND METHODS
with Kpn I enzyme that resulted in the removal of the atCpn60( a) eDNA from pGEMT
easy vector. AtCpn60( a) eDNA was ligated to the above modified pCAMBIA 1304
vector containing the kanamycin (npt) gene and CaMV 35S omega enhancer cassette.
After ligation and transformation, plasmids were isolated from the recombinant
colonies and colony PCR was performed to confirm the positive clone. The antisense
orientation was confirmed by using primer set of 35S promoter and atCpn60(a)
forward. For sense orientation 35S promoter and atCpn60( a) reverse primers were
used. The positive recombinant clone was transformed in Agrobacterium GV1301 as
described above.
Expression of Gene Products
Overexpression of AtCpn60( a) in E. coli
Amplification of mature fragment of atCpn60(a): Nucleotide sequences encoding
the mature (without transit peptide) atCpn60(a) protein (amino acid residues 46-586)
of A. thaliana were amplified by the same PCR method from pGEMT-easy (Promega,
USA) plasmids containing the atCpn60(a) eDNA by using synthetic oligonucleotide
primers specific to the 5' and 3' ends of the coding sequence of the protein. The forward
primer (5'- CGGGATCCGCTAATGTAAAGGAAATAGCTTTTGAC -3') introduced
a BamH I site whereas the reverse primer (5'-ctaatgattggtgactgg-3') included a San
recognition site. PCR was done in 20 Ill volume containing 20 ng of template DNA, 15
pmoles of each primer, 200/lM of dNTPs, 4 units of taq polymerase in buffer
containing 10 mM Tris-HCl pH 8.3, 50 mM KCl, 15 mM MgCh. PCR amplification
was done with a program having 94°C for 2 minutes (initial denaturation) followed by
30 cycles of94°C (denaturation) for 30 seconds, 62°C (annealing) for 30 seconds, 72°C
(extension) for 1 minute 30sec in a Perkin-Elmer (USA) thermal cycler. The resulting
amplification products were gel purified and the purified fragment was ligated to
pGEMT-easy (Promega, USA) vector. The recombinant plasmid was transformed into
competent E.coli (DH5a) cells. Plasmid DNA was prepared and the nucleotide
sequence of the fragment was confirmed by restriction digestion of the recombinant
clone.
Construction of expression vector containing atCpn60(a) : The recombinant
pGEMT-Easy vector containing the atCpn60(a) gene fragment was restriction digested
65
![Page 12: MATERIALS AND METHODS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/14175/8/08_chapter 3.pdf · Pea Tic40(40K.Da) psTic40 1:7500 Arabidopsis Tic55(55K.Da) atTic55 1:1500](https://reader034.vdocuments.us/reader034/viewer/2022042209/5eacacc8001ca37f8c6a0ca4/html5/thumbnails/12.jpg)
MATERIALS AND METHODS
with BamH I and Sall and ligated directionally into the pET 30a (Novagen) expression
vector having hexa-histidine affinity tag resulting in incorporation of an extra 30
aminoacids at theN-terminus of the enzyme. The final construct was confirmed for the
presence of insert by restriction digestion with BamH I and Sali.
Expression of the atCpn60(a.) mature protein: The recombinant plasmid (pET 30a
Cpn60( a)) was transformed into competent E.coli BL 21 (DE3) cells for the purpose of
protein expression. The BL 21 (DE3) competent cells were prepared like DH5a. as
described before. E. coli BL21 (DE3) cells containing the recombinant plasmid (pET
30a- atCpn60(a.)) was grown in 50 ml of LB medium containing 50 Jlg/ml kanamycin
to an A600 of 0.5. Cells were induced with 0.2 mM isopropyl P-D-thiogalactoside
(IPTG) at 30°C for 2 h to express atCpn60(a.). The harvested cells were re-suspended
in a buffer consisting of 100 mM NaH2P04, 10 mM Tris-HCl, 8 M Urea pH adjusted to
8.0 and protease inhibitors like 1 mM PMSF (phenyl-methylsulfonyl fluoride, and
sonicated (thrice, 10 sec each at 2 min intervals) in ice to break the cells. The cell
lysate was centrifuged in 20,000g for 15 min at 4°C to separate the insoluble and
soluble fractions. The protein profile was analyzed on 12.5% SDS-PAGE.
Polyacrylamide gel electrophoresis of proteins (SDS-PAGE)
SDS-PAGE was carried out according to Laemmli, 1970. The chemicals and solutions
used for SDS-PAGE:
Name ofthe Chemical Amount Remarks
Acrylamide 58.4 g Add distilled water to make
Acrylamide volume 200 ml. Stock solution
(30%) Bis-acrylamide 1.6 g
was filtered and stored at 4°C in
amber bottle
Separating gel Tris (1.5 M) 36.3 g Final volume made to 200 ml
buffer (4X) with distilled water and pH
adjusted to 8.8 with HCl. Stored
at 4°C.
Stacking gel Tris (1.0 M) 12 g Final vol made to 100 ml with
buffer (4X) distilled water and pH adjusted
to 6.8 with HCI. Stored at 4°C.
SDS (10%) SDS 10 g Vol made to 100 ml and stored at
66
![Page 13: MATERIALS AND METHODS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/14175/8/08_chapter 3.pdf · Pea Tic40(40K.Da) psTic40 1:7500 Arabidopsis Tic55(55K.Da) atTic55 1:1500](https://reader034.vdocuments.us/reader034/viewer/2022042209/5eacacc8001ca37f8c6a0ca4/html5/thumbnails/13.jpg)
MATERIALS AND METHODS
room temperature.
Tris Cl (0.125 2.5 ml of
M,pH6.8 stacking
gel buffer Distilled water added to make
Sample buffer SDS (4%) 4 ml volume 10 ml.
(4X) of10%SDS
2- 1 ml
mercaptoethanol
(10%)
Glycerol 2 ml
Tris 15.1 g Final volume 1 L with distilled
Tank Buffer (5X) Glycine 94 g water.
SDS 5g
APS (10%) APS 0.1 g Make volume 1 ml always
prepare fresh APS.
TEMED
Reci~es 12.5% Se~arating gel 5% Stacking gel
Monomer stock solution 10.0 ml 1.7 ml
Buffer 6.0 ml (pH 8.8) 2.5 ml (pH 6.8)
SDS (10%) 0.24 ml 1.0 ml
Water 7.6 ml 4.8 ml
TEMED 15 Jll 5 Jll
APS (10%) 400 Jll 150 Jll
Total volume ~24ml -10 ml
SDS-PAGE was carried out in a vertical gel electrophoresis apparatus (regular size)
(ATTO Corp., Japan) according to Laemmli, 1970. Gels were prepared and
electrophoresed under reducing and denaturing conditions in presence of f3-ME and
SDS. Protein samples (50 Jlg) were prepared by mixing with Y2 volumes of 2X sample
buffer (constituents of sample buffer is mentioned above). The samples were boiled for
3 min in a water bath and centrifuged at 13000 rpm for 2 min at room temperature. The
67
![Page 14: MATERIALS AND METHODS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/14175/8/08_chapter 3.pdf · Pea Tic40(40K.Da) psTic40 1:7500 Arabidopsis Tic55(55K.Da) atTic55 1:1500](https://reader034.vdocuments.us/reader034/viewer/2022042209/5eacacc8001ca37f8c6a0ca4/html5/thumbnails/14.jpg)
MATRRIALS AND METHODS
supernatant was loaded on the stacking gel. Gels were run either at a constant voltage
(1 OOV) or a constant current (20 rnA). After electrophoresis, the gels were stained with
Coomassie blueR 250 (CBB R 250) for visualization of the proteins.
Staining with coomassie brilliant blue R 250 (CBB R 250)
Fixing solution:
Staining solution:
40% methanol, 10% acetic acid in double distilled water
CBB (0.05%) in 50% methanol and 5% acetic acid
CBB was dissolved in methanol. Acetic acid was added, followed by Distilled water to
make the volume 1L.
Destaining solution: 5% methanol, 7.5% acetic acid in double distilled water
The gel, after electrophoresis, was incubated in 10 volumes of fixing solution for 20
min on a gyratory shaker. The gel was stained in 5 vol of Staning solution for 2 h on
the shaker. After staining, stain was removed; gel was rinsed with double distilled
water and was then left in 20 vol destaining solution for 2-3 h. The destaining solution
was replaced 2-3 times at 1h interval, until the background was clear. The gel was
preserved in 7% acetic acid in distilled water.
Purification of Recombinant atCpn60(a) protein
The harvested bacterial pellet was resuspended in ice cold lysis buffer containing 100
mM NaH2P04, 10 mM Tris-HCl, 8 M Urea pH adjusted to 8.0 and protease inhibitor 1
mM PMSF (phenyl-methylsulfonyl fluoride). The cell suspension was sonicated in cold
six times for 10 seconds each followed by centrifugation at 12,000 rpm for 20 min at
4°C using SS34 rotor. Concomitantly 1.5 ml Ni2+-NTA-Agarose beads were
equilibrated with lysis buffer for 5 min. The Ni2+-NTA-Agarose beads were centrifuged
at 3000rpm for 5 min in a SS34 rotor and the lysis buffer was discarded. Since the
atCpn60(a) protein was expressed in soluble form, the lysis-buffer-equilibrated Ne+_
NTA-Agarose beads were added to the supernatant fraction containing the
overexpressed protein in a 50 ml Falcon tube and incubated on a rotary shaker at 4°C
for 2 h. The resin was washed thrice with wash buffer (100 mM NaH2P04, 10 mM
Tris-HCl, 8 M Urea, 1 mM PMSF, pH adjusted to 6.3) on a rotary shaker at 4°C for
15min each. The recombinant protein was eluted twice by resuspending resin in elution
buffer (100 mM NaH2P04, 10 mM Tris-HCl, 8 M Urea, 1 mM PMSF, pH adjusted to
4.5) on a rotary shaker at 4°C for 1 h. The purity of the recombinant protein (Histidine-
68
![Page 15: MATERIALS AND METHODS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/14175/8/08_chapter 3.pdf · Pea Tic40(40K.Da) psTic40 1:7500 Arabidopsis Tic55(55K.Da) atTic55 1:1500](https://reader034.vdocuments.us/reader034/viewer/2022042209/5eacacc8001ca37f8c6a0ca4/html5/thumbnails/15.jpg)
MATERIALS AND METHODS
tagged Cpn60(a) protein) was checked by running SDS-PAGE from different fractions.
The residual beads were washed for 30 min with 0.5M NaOH and then stored in 30%
ethanol to inhibit microbial growth.
Western blot
Western blot analysis was done according to_Towbin et al., 1979. The chemicals and
solutions used for western analysis:
N arne of the Chemical Amount Remarks
Tris (25 mM) 0.03 g Adjust pH to 7.4 and make up
TBS NaCl (136 mM) 7.95 g the volume to 1 L
KCl 0.2 g
TBSTbuffer TBS+0.05% Tween
20
Blocking Solution TBST+4%BSA
Tris (0.1M) 6.05 g Adjust pH to 8.1-8.5 and make
Transfer Buffer 1X Glycine (0.192M) 7.2 g up volume to 500 ml
5% Methanol (v/v) 25 ml
Ponceau S Ponceau S 0.1%
Alkaline Tris HCl (100 mM) 1.211g Adjust pH to 9.5 and make up
phosphatase (AP) NaCl (100 mM) 0.5844 g volume to 1 OOml
buffer MgCh (5 mM) 0.10165g
AP color AP buffer 10ml NBT and BCIP are dissolved
development NBT sol 66Jll inN N Dimethyl formamide
BCIP 33Jll
Transfer of proteins from polyacrylamide gels to nitrocellulose membranes was carried
out in a semi-dry Transblot apparatus (ATTO Corp., Japan), as per the manufacturer's
instructions. Protein (20 Jlg) loaded on SDS-P AGE was run in a ATTO gel
electrophoresis apparatus as described above. After the run, gel was first equilibrated
in transfer buffer for 15 min. Nitrocellulose membrane and Whatman papers (3 mM)
were also soaked in the transfer buffer. For transfer, 4-6 pieces of 3 mM Whatman
paper were placed on the platform of the apparatus, on the top of which membrane was
placed followed by gel and 4-6 layers of Whatman paper. Air bubbles trapped were
69
![Page 16: MATERIALS AND METHODS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/14175/8/08_chapter 3.pdf · Pea Tic40(40K.Da) psTic40 1:7500 Arabidopsis Tic55(55K.Da) atTic55 1:1500](https://reader034.vdocuments.us/reader034/viewer/2022042209/5eacacc8001ca37f8c6a0ca4/html5/thumbnails/16.jpg)
MATERIALS AND ME.THODS
removed. Constant current equal to twice the area of gel was applied (e.g. if the gel
area was 50 sq. em, 100 rnA current was applied) during transfer. Handling of
membrane was done wearing gloves. After the transfer was over, gel-facing side of the
membrane was marked and the membrane was stained in Ponceau S (0.1% Ponceau S
in 1% acetic acid). Markers were marked with a ballpoint pen and the membrane was
destained in water. Membrane was then kept in blocking solution containing 4% BSA
in TBST, at room temperature for 2 h. After this the membrane was washed in TBST
thrice (5 min each) with constant shaking. The membrane was incubated for 1 h at
room temperature with primary antibody at the appropriate dilution. Dilution was
made in TBST containing 0.1% BSA. After the incubation, membrane was washed in
TBST thrice (5 min each) with constant shaking and then incubated with alkaline
phosphatase-conjugated secondary antibody ( 1: 17000 dilutions) for 1 h at room
temperature. Membrane was again washed in TBST thrice (5 min each) with constant
shaking. The NC membrane was then stained using substrate for alkaline phosphatase.
Sixteen 111 of 5-bromo-4-chloro-3-indolyl phosphate (BCIP) and 331!1 of nitroblue
tetrazolium (NBT) were added to 5 ml of AP buffer. Stock solution of BCIP was
prepared by dissolving 0.5 g BCIP disodium salt in 10 ml of 100% dimethyl formamide
and stored at -20°C and of NBT was prepared by dissolving 0.5 g in 10 ml of 70%
dimethylformamide and stored at -20°C. The blot was developed till purple-blue bands
appeared at the site of antibody binding (Towbin et al., 1979).
Raising of poly clonal antibody
Polyclonal antibody against atCpn60(a) was raised in rabbit as per the standard
procedure (Horlow and Lane, 1988). Two-four months of old New Zealand white
rabbits were used for raising antibodies. Before the primary injection, pre-immune
serum was collected by bleeding the rabbit. For immunization recombinant protein for
a atCpn60(a) was run on a SDS-PAGE and the corresponding protein gel band was
excised from the gel. Primary immunization was carried out by making an emulsion of
crushed and homogenized gel pieces containing about 1501lg of purified atCpn60(a)
proteins with complete Freund's (Sigma adjuvant in equal proportions. After three
weeks, a secondary immunization was done with an emulsion of incomplete Freund's
adjuvent and 10011g of atCpn60(a) protein in gel pieces. Test bleeds were done to
check the titer of the antibodies by western analysis. A total number of 6 boosters were
70
![Page 17: MATERIALS AND METHODS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/14175/8/08_chapter 3.pdf · Pea Tic40(40K.Da) psTic40 1:7500 Arabidopsis Tic55(55K.Da) atTic55 1:1500](https://reader034.vdocuments.us/reader034/viewer/2022042209/5eacacc8001ca37f8c6a0ca4/html5/thumbnails/17.jpg)
MATE.IUALS AND M£THODS
given at time interval of 4 weeks and finally blood was collected using capillary from a
punctured vein. The serum isolated from blood was aliquoted and stored at -80°C.
Arabidopsis transformation by vacuum infiltration
Plant growth procedure
The plastic pots were filled to top with agropeat soil and covered with required size of
mosquito net using rubber bands. The Arabidopsis seeds vernalized at 4°C for 3 days
were resuspended in milli-Q water and 20-30 seeds per pot were uniformly distributed
over the agropeat soil. The pots were transferred to the growth chamber (Conviron,
Canada). Plants were allowed to grow photoperiodically (14h L/10h D) at 22°C in 100
11moles photons m-2 s-1 light intensity till bolts emerged. Bolts were clipped off to
produce multiple secondaries.
Vacuum infiltration
Arabidopsis transformation by vacuum infiltration was done according to Clough and
Bent, 1998. A single colony of Agrobacterium tumefaciens was inoculated into 25 ml
of liquid YEM with kanamycin (50 J..Lg/ml) and rifampicin (25 J..Lg/ml) and grown for 48
h at 28°C. One ml of this bacterial culture was inoculated into 1 L of fresh medium and
allowed to grow for overnight at 28°C. The cells were harvested at 5000 g for 10 min at
room temperature. The pellet was resuspended in infiltration medium (0.5X MS salts,
1X B5 vitamins, 5% sucrose, 0.04 M BAP, 0.02% silvet, pH 5.7).
Vitamin B5 stock (lOOX) was prepared by mixing myo-inositol (10 mg/ml), thiamin
HCl (10 mg/ml), nicotinic acid (1 mg/ml) and pyridoxine-HCl (1 mg/ml). The plants
having multiple secondary bolts were inverted on 250 ml beaker containing
Agrobacterium tumefaciens strain with proper construct. The entire set up was kept in
bell jar and the vacuum was applied till bubbles were formed on the leaves and stem.
The vacuum was rapidly released and plants were left in liquid for 1-2 min. The plants
were removed and covered with saran-wrap (to maintain humidity) and left overnight.
The plants were uncovered after one day and grown photoperiodically (16h L/8h D) in
plant growth chamber in 100 11moles photons m-2 s-1 of light intensity. After one month,
the seeds were harvested from individual plants and stored separately.
71
![Page 18: MATERIALS AND METHODS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/14175/8/08_chapter 3.pdf · Pea Tic40(40K.Da) psTic40 1:7500 Arabidopsis Tic55(55K.Da) atTic55 1:1500](https://reader034.vdocuments.us/reader034/viewer/2022042209/5eacacc8001ca37f8c6a0ca4/html5/thumbnails/18.jpg)
MATERIALS AND METHODS
Selection of Transgenic Plants on Kanamycin Plate
Seeds ( 40 mg) of Arabidopsis were surface sterilized with 2 ml of sterilisation solution
[2 % sodium hypochlorite) with 1 11Vml of 20 % Triton X-100] and gently mixed by
inversion for 15 min. The seeds were allowed to settle for 1 or 2 min before decanting
the bleach. The tube with seeds was filled with sterile water and mixed. Washing of
seeds was repeated several times till the bleach smell disappeared (it normally takes
more than 5 washes). The seeds were finally resuspended in required volume of sterile
water and then plated on GM medium containing kanamycin for selection of
heterozygous transgene. The sterile water was allowed to evaporate in laminar flow
hood and they were transferred to a refrigerator and kept in dark for 2 days. After 2 d
the plates were transferred to light (100 11moles photons m-2 s-1). The seedlings, which
contain transgene, survived on kanamycin plates and all other susceptible seedlings
were bleached out. Resistant seedlings were transferred to soil pots and grown for 3
months to collect the seeds. This process was continued for 3 to 4 generations to obtain
homozygous lines.
Analysis of transgenic plants
Preparation of plant genomic DNA for PCR analysis
Small piece of leaf tissue (lcm X lcm) was ground with 400 Jll of genomic DNA
extraction buffer (2% CTAB, 1.4M NaCl, 20 mM EDTA, 100 mM Tris-Cl and 0.1% f3-
ME) at room temperature. To the homogenate additional 400 Jll of genomic DNA
extraction buffer was added and kept at 60°C in a water bath for 30 min. To this 650 Jll
of tris saturated phenol (pH8.0): chloroform: isoamyl alcohol (24:24: 1) was added and
mixed by vortexing for 30 sec followed by centrifugation at maximum speed for 5 min
in a microfuge at room temperature. The aqueous layer was transferred to another fresh
tube and once again extracted with 650 111 of tris saturated phenol (pH8.0): chloroform:
isoamyl alcohol (24:24: 1) in eppendorf tube. To the final aqueous phase 2/3 volume of
isopropanol was added, mixed properly and kept at room temperature for 5-10 min to
precipitate the genomic DNA. After precipitation of genomic DNA samples were
centrifuged at maximum speed for 5 min at room temperature in a microfuge. The
pellet was washed 3 times with 70% ethanol, dried and dissolved in 30 Jll sterile water
containing 20 Jlg/ml RNase and incubated at 37°C for 30 min.
72
![Page 19: MATERIALS AND METHODS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/14175/8/08_chapter 3.pdf · Pea Tic40(40K.Da) psTic40 1:7500 Arabidopsis Tic55(55K.Da) atTic55 1:1500](https://reader034.vdocuments.us/reader034/viewer/2022042209/5eacacc8001ca37f8c6a0ca4/html5/thumbnails/19.jpg)
MATERIALS AND METHODS
PCR analysis of transgenic plants
Using 20 ng of genomic DNA of WT and AtTic22ptgs plants as template PCR was
carried using npt (kanamycin) gene specific forward and reverse primer (Table-5). PCR
amplification was done with a program having 94°C for 2 minutes (initial denaturation)
followed by 30 cycles of 94°C (denaturation) for 30 seconds, 58°C (annealing) for 30
seconds, 72°C (extension) for 1 minute in a Perkin-Elmer (USA) thermal cycler. The
PCR product was electrophoresed on 1% agarose gel to check for amplification. The
PCR was also done by using 35S internal forward primer and pHannibal terminator
specific reverse primer (Table-5). The PCR conditions for amplification was, 94°C for
2 minutes (initial denaturation) followed by 30 cycles of 94°C (denaturation) for 30
seconds, 55°C (annealing) for 30 seconds, 72°C (extension) for 1 min and 30 sec for
each cycle and continued for 30 cycles. The PCR product was electrophoresed on 0.8%
agarose gel to check for amplification.
PCR analysis for the AtCpn60( a) was carried out in the similar manner as of
AtTic22ptgs by using npt (kanamycin) gene specific forward and reverse primer for the
kanamycin gene and 35S internal forward primer and AtCpn60( a) forward and reverse
primer for antisense and sense orientation amplification(Table-4).
Analysis of transcript levels
Isolation of total RNA lby TRI reagent (Sigma) method
Total RNA was isolated from different tissues by TRI reagent (Sigma) according to
manufacture's instruction. All the glassware and mortar pestles used during RNA
isolation was baked overnight at 200°C, the plastic wares were treated with DEPC and
then autoclaved to avoid the possible contamination of RNase. The gel apparatus used
to check the quality of RNA was treated with H20 2 for 1-2 h, washed several times
with DEPC water.
Tissues (1 00 mg) were taken and homogenized in liquid nitrogen in mortar and pestle.
After the evaporation of liquid nitrogen, 1 ml of TRI reagent was added to powdered
tissues and homogenized again. The TRI reagent containing the powdered tissues was
transferred to 1.5 ml centrifuge tube and the insoluble material was separated from the
homogenate by centrifugation at 11,000 g for 10 min at 4°C in a microfuge. The
supernatant was transferred into a fresh Eppendorf tube and to this 0.2 ml chloroform
was added and mixed vigorously. The sample was centrifuged at 12,000 rpm for 15 min
73
![Page 20: MATERIALS AND METHODS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/14175/8/08_chapter 3.pdf · Pea Tic40(40K.Da) psTic40 1:7500 Arabidopsis Tic55(55K.Da) atTic55 1:1500](https://reader034.vdocuments.us/reader034/viewer/2022042209/5eacacc8001ca37f8c6a0ca4/html5/thumbnails/20.jpg)
MAT£RIALS AND METHODS
at 4°C and the upper aqueous phase was transferred to a fresh Eppendorf tube. The
RNA was precipitated from the aqueous phase by mixing with 0.5 ml isopropanol
followed by centrifugation at 12,000 rpm for 15 min. The pellet was washed with 75%
ethanol, dried and dissolved in minimal volume ofRNase free sterile water.
RNA gel
After isolation of RNA, the quality was checked by running 1.2% formaldehyde
denaturing agarose gel. The constituents of the formaldehyde gel:
5X formaldehyde gel running buffer Sample Buffer
MOPS 0.1M (pH 7.0)
Sodium acetate 40mM 10XMOPS 1ml
EDTA 5 mM (pH 8.0) Formaldehyde 1.8ml
Formaldehyde 2.2M Formamide 0.5ml
Ethidium bromide 10mg I ml DEPC-water 2.2ml
RNA gel loading dye
Glycerol 50%
EDTA 1 mM (pH 8.0)
Bromophenol blue 0.25%
Xylene cyanol 0.25%
1.2% agarose gel was prepared by dissolving appropriate amount of agarose in water
(heating the agarose in water and then cooling it to 60°C). To it, 5X formaldehyde gel
running buffer and formaldehyde were added to give final concentrations of 1X and 2.2
M respectively. Ethidium bromide (0.25 Jlg/ml) was added to the gel. Gel was cast in
acrylic tray in chemical hood and allowed to polymerize for 30 min-1 h.
To load RNA, 5)lg RNA was mixed with 2 volumes of sample buffer and was
incubated at 65°C for 15 min. To this 2).!1 gel-loading dye was added, mixed and
centrifuged at 12,000 rpm for 30 sec in Beckman microfuge. The RNA was loaded to
the gel. Before loading the samples, the gel was prerun at 5 V/cm for 5 min in 1X
formaldehyde gel-running buffer. After samples were loaded in different lanes of the
gel, the gel was run at 5 V/cm for 2-3 h. After run was complete, the gel was kept on
UV -transilluminator to visualize the rRNA bands in the gel.
74
![Page 21: MATERIALS AND METHODS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/14175/8/08_chapter 3.pdf · Pea Tic40(40K.Da) psTic40 1:7500 Arabidopsis Tic55(55K.Da) atTic55 1:1500](https://reader034.vdocuments.us/reader034/viewer/2022042209/5eacacc8001ca37f8c6a0ca4/html5/thumbnails/21.jpg)
MATERIALS AND METHODS
Northern hybridization
Total RNA was fractionated on 1.2% formaldehyde denaturing agarose gel as described
above (Sambrook et al., 1989). Gel was electrophoresed for 2-3 h and after completion
of the run, the gel was rinsed in DEPe treated water and equilibrated with 5X SSe for
10 min. Nylon membrane (Amersham Hybond NX) and Whatman paper 3 MM equal
to the size of gel were cut and were in 5X sse along with the gel. RNA was
transferred to nylon membrane by capillary transfer in 5X SSe for 16 h. 5X SSe was
taken in the Borosil tray and a glass plate was placed on it. A wick of Whatman paper
3mm was placed on the glass plate with both of its ends dipped in 5X SSe. On the
wick, a piece of Whatman paper was placed followed by gel and nylon membrane. A
piece ofWhatman paper was then placed on nylon membrane. Air bubbles between the
gel and the membrane were removed using a glass rod. A stack ofblotting sheets (5-8
em height) was placed on this followed by a weight of 0.5 kg. RNA was then allowed
to transfer by capillary action for 16 h. Once the transfer was over, wells on membrane
were marked and the membrane was washed in 2X sse to remove any agarose. The
membrane was then allowed to dry and cross-linked in UV-cross linker at 0.15 J/sq.cm.
Membrane was then stored at 4 oe in a plastic bag till further use.
The membrane was pre-hybridized for 6-8 h at 65°e in buffer containing 5 X sse, 5X
Denhardt reagent (0.5% Ficoll, 0.5% PVP, 0.5% BSA) 0.1% SDS and 100 J..lg/ ml
denatured salmon sperm DNA and 10% dextran sulphate. Thereafter, to the
prehybridization solution radio labelled probe (pre- denatured by boiling for 10 min)
was added. After 16- 18 h of incubation at 65°e in the hybridization solution, the
membrane was washed twice with 2X SSe, 0.1 % SDS at room temperature for 5 min,
twice with 0.5X sse, 0.1% SDS at 65 °e for 15 min and twice with 2X sse at room
temperature for 5 min. The membrane was then exposed to X-ray film for
autoradiography.
Preparation of probe by random primer labeling method
[Megaprime™ DNA labelling system RPN 1605]
Twenty-five ng of kanamycin (npt) DNA or AtTic22 DNA (PeR amplified by using
primers of RTintAtTic22 forward and RTintAtTic22 reverse,), and 5 J..ll of random
primer was taken in an eppendorf tube. After denaturation by heating to 95-1 00°e for 5
min, brief spin was given. Then dNTPs (4 J..ll each) (without deTP that was used as
75
![Page 22: MATERIALS AND METHODS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/14175/8/08_chapter 3.pdf · Pea Tic40(40K.Da) psTic40 1:7500 Arabidopsis Tic55(55K.Da) atTic55 1:1500](https://reader034.vdocuments.us/reader034/viewer/2022042209/5eacacc8001ca37f8c6a0ca4/html5/thumbnails/22.jpg)
MATERIALS AND METHODS
label), 5 ~1 of reaction buffer, 5 ~1 of a 32P dCTP and 2 ~1 of enzyme and appropriate
volume of water was added to make total volume of 50 ~1. The contents were mixed
gently. The reaction mixture was incubated at 37 °C for 1 hand stopped by adding of 5
~1 of 0.2 EDT A. Before use in a hybridization reaction the labelled DNA was
denatured by heating to 1 00°C for 5 min and chilled on ice.
Probe for the AtCpn60( a) sense plants confirmation was also generated by above
mentioned method. The primer used for amplifying AtCpn60(a) DNA are RTint
AtCpn60( a) forward and RTint AtCpn60( a) reverse.
DNase I treatment of total RNA
To remove the traces of genomic DNA, 5 unit of RNase free DNase I was added to
total RNA in 10 mM Tris-Cl, pH 8.3, 50 mM KCl, 1.5 mM MgCh and incubated for 10
min at 37°C. After this, DNase I was inactivated by heating at 75°C and extracted twice
with phenol: chloroform: Isoamyl alcohol (24:24: 1. RNA was precipitated from the
aqueous phase by sodium acetate, pH 4.8 and ethanol, washed twice with 75% ethanol,
vacuum dried and finally dissolved in DEPC-treated water. The pure RNA was either
used immediately or stored at -80°C.
Semi-quantative RT -PCR
Reverse transcription was carried out using 3~g of total RNA and oligo-dT as primer.
The RNA was treated with RNase free DNase (5unit/~l) to make sure that there is no
contamination of DNA. The reaction mixture includes 1 mM dNTPs, 0.5~M oligo-dT,
20 U RNase inhibitor, 10 mM DTT, IX RT buffer and 20-30 unit AMV reverse
transcriptase in total volume of 50~1. The reaction mixture was incubated for one hour
at 37°C. Using this reaction mixture as template PCR was carried out with gene specific
primers to check the expression of the respective genes. To ensure linearity of the
reaction, the minimum number of cycles needed to visualize the transcripts was first
determined. When the condition for RT-PCR linearity was established, runs were
performed and repeated at least for three times using independently treated samples.
Actin was used as an internal control.
The PCR reaction mixture (25 ~1) contained 50 ng DNA template, 150 ng (or
30pmoles) of each primer, 8 ~1 of 1.25 mM dNTPs, 5 ~1 lOX Taq buffer and 2.5 units
of Taq polymerase. The reaction condition of PCR consisted of denaturation (94°C),
76
![Page 23: MATERIALS AND METHODS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/14175/8/08_chapter 3.pdf · Pea Tic40(40K.Da) psTic40 1:7500 Arabidopsis Tic55(55K.Da) atTic55 1:1500](https://reader034.vdocuments.us/reader034/viewer/2022042209/5eacacc8001ca37f8c6a0ca4/html5/thumbnails/23.jpg)
MATERIALS AND METHODS
annealing (varies from gene to gene) and extension (72°C) for 1 min per 1 kb pair to be
amplified. PCR was performed for 25-29 cycles within a linear range of amplification
of atToc159, atToc75, atToc64, atToc34, atTic110, atTic62, atTic55, atTic40,
atTic22, atTic20, and ACTIN genes. The number of cycles and annealing
temperature were optimized for each specific primer pairs. Ten ml of the PCR
products were loaded and separated on 1% agarose Tris-acetate EDTA gel. Ethidium
bromide stained PCR products were quantified using Alpha imager 3400 (California,
USA). RT-PCR for each gene was done in triplicate and average value was
determined using Alpha Ease FC software.
Real-Time PCR
For template preparation of Real Time PCR, 3J.tg of mRNA was taken from respective
treated samples and respective cDNAs were prepared by using first strand eDNA
synthesis kit from Promega, following manufacturer's protocol. Primer pair was
designed for atTic22, atCpn60( a) and for the house keeping gene, PActin (given in the
table 5) by using the Primer Express v.3 designing program from Applied Bio-System.
Real-time PCR reactions were set up using 1J.tl of eDNA, 12.5 Jll of SYBR Green
Master Mix (Applied Bio-systems, ABI), and 5 picomoles concentration of each primer
in a total volume of 25 Jll in optical tubes provided by the manufacturer. All the
reaction mixture was set in fume hood to avoid contaminations. The real-time PCR was
run for 40 cycles on the ABI Prism 7500 Sequence Detection System (ABI) according
to ABI protocol. A threshold cycle (Ct) value was determined, and the relative
expression level of a specific gene is expressed as ~Ct (the Ct value of the gene of
interest normalized to the Ct value of actin as control for equal RNA in all samples).
Identification of Homozygous Mutants through PCR
Putative mutants were screened by electronic searches of available population of
sequence-indexed Arabidopsis T-DNA-insertion mutants using the Arabidopsis
genomic AtTic22 (At4G33350) gene sequence. A single putative AtTic22 knockout
SALK line SALK_013359.47.20.x (Alonso et al., 2003) was obtained from
Arabidopsis Biological Resource Center (ABRC) and screened using kanamycin
marker. Positive plants were screened for homozygous line using gene and T-DNA
specific primers. Genomic DNA PCR with gene specific primers LP and RP should
77
![Page 24: MATERIALS AND METHODS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/14175/8/08_chapter 3.pdf · Pea Tic40(40K.Da) psTic40 1:7500 Arabidopsis Tic55(55K.Da) atTic55 1:1500](https://reader034.vdocuments.us/reader034/viewer/2022042209/5eacacc8001ca37f8c6a0ca4/html5/thumbnails/24.jpg)
MATERIALS AND METHODS
gtve an amplification of 10 13bp in WT and heterozygous and no amplification in
homozygous plants. PCR with T-DNA specific LBa1 forward primer and gene specific
RP reverse primer should give an amplification of 440bp in homozygotes and
heterozygotes and no amplification in wild type plants.
Transmission electron microscopy
Leaves block of 1 mM/1 mM from A. thaliana WT, transgenics and mutant plants were
taken and vacuum infiltrated with 2.5% glutaraldehyde solution for 30 minutes. After
fixation the samples were kept for overnight in the same solution (Kamovsky, 1965).
The fixation solution was discarded and to that 0.1M sodium-phosphate buffer (pH 7.0)
was added. Then tissue was kept in secondary fixative containing 1% Os04. Fixation
was done by immersing the tissue in fixative at 4 °C for 2-4 h. Tissue was washed with
0.1M P04 buffer, dehydration was done, which involved following steps:
1) 30% acetone twice for 15 minutes each time.
2) 50% acetone twice for 15 minutes each time.
3) 70% acetone twice for 15 minutes each time.
4) 80% acetone twice for 15 minutes each time.
5) 90% acetone twice for 15 minutes each time.
6) 95% acetone twice for 15 minutes each time.
7) Dry acetone twice for 15 minutes each time ..
8) Dry acetone twice for 30 minutes each time.
All these steps were done at room temperature. For clearing tissues of acetone, epoxy
propane or xylene was used twice for 30 minutes at room temperature and infiltration
was done in a resin containing araldite and toluene in following ratios:
1) 1 part of araldite + 3 parts of toluene.
2) 2 parts of araldite + 2 parts of toluene.
3) 3 parts of araldite + 1 part of toluene.
For embedding araldite cy212 embedding medium was prepared. After embedding, the
liquid araldite was polymerized in a gradual process by keeping blocks at 50°C for 12-
24 h and then at 60°C for 24-48 h. After this, sectioning was done using
ultramicrotomes. These ultra thin sections were then stained in uranyl acetate.
Saturated solution of uranyl acetate was prepared in 50% ethanol. This was mixed
vigorously and centrifuged to allow the excess of uranyl acetate to settle down. For
78
![Page 25: MATERIALS AND METHODS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/14175/8/08_chapter 3.pdf · Pea Tic40(40K.Da) psTic40 1:7500 Arabidopsis Tic55(55K.Da) atTic55 1:1500](https://reader034.vdocuments.us/reader034/viewer/2022042209/5eacacc8001ca37f8c6a0ca4/html5/thumbnails/25.jpg)
MATERIALS AND METHODS
staining small amount of uranyl acetate was taken in a clean watch glass. Grid
containing section was placed on to the stain. Staining was done in dark for 10-15 min.
Each grid was then washed in 50% ethanol twice and distilled water twice with
continuous agitation. This was then dried carefully on filter paper. After this sections
were viewed in a Transmission Electron Microscope (JEOL 21 OOF) at the Advanced
Instrumentation Research Facility (AIRF), Jawaharlal Nehru University, New Delhi.
Plant growth conditions for Tissue and Developmental studies
The plastic pots were filled to top with agropeat soil. The Arabidopsis seeds (WT,
transgenics and mutant) vernalized at 4°C for 3 days were resuspended in milli-Q water
and 10 - 15 seeds per pot were uniformly distributed over the agropeat soil. The pots
were transferred to the growth chamber (Conviron, Canada). Plants were allowed to
grow photoperiodically (14h L/10h D) in cool-white-fluorescent + incandescent light
(100 J-Lmoles photons m-2 s- 1) at 22°C.
Light Treatment
WT plants were grown at 22°C in dark for five days. They were subsequently exposed
to white light (80 J-Lmoles photons m-2 s-1) for different time periods (1-36 h). For light
quality dependent regulation seedlings grown in dark for 5-days were transferred to
continuous white light (40 J-Lmoles photons m-2 s-1), red light or blue light (40 J-Lmoles
photons m-2 s-1) for 4 h. Visible light (400-700 nm) intensity was measured in aLl-COR
(USA) quantum sensor.
Isolation of intact chloroplasts
Intact plastids were isolated as described before (Aronsson and Jarvis, 2002; Tewari
and Tripathy, 1998). Briefly, arabidopsis leaves were homogenized using a
kitchen blender in 7 vol of cold IX grinding buffer consisting of 0.05M HEPES,
0.33M Sorbitol, 1 mM MgCh, 1 mM MnCh, 2 mM Na2EDTA, 2 mM EGT A,
0.1% BSA, 0.025% isoascorbate, pH 7.5. The filtrate was centrifuged at 3000 rpm
for 5 min at 4 °c in Sorvall RC5C refrigerated centrifuge using a SS34 rotor.
Supernatant was discarded, and the pellet was suspended in about 2ml of 1 X
grinding buffer using a paintbrush. The suspended pellets were added to the two
step gradients consisted of a bottom layer (8.5ml percoll, 0.5ml water and
79
![Page 26: MATERIALS AND METHODS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/14175/8/08_chapter 3.pdf · Pea Tic40(40K.Da) psTic40 1:7500 Arabidopsis Tic55(55K.Da) atTic55 1:1500](https://reader034.vdocuments.us/reader034/viewer/2022042209/5eacacc8001ca37f8c6a0ca4/html5/thumbnails/26.jpg)
MATEJUAI..S AND METHODS
l.Oml lOX grinding buffer) and the top. layer (4ml percoll, lml water and
5ml 2X grinding buffer). The contents were centrifuged at 7700rpm for 25min
with brake off in a Sorvall RC5C refrigerated centrifuge using a SS34 rotor. After
centrifugation two bands were observed. The lower green band containing intact
chloroplasts was collected and diluted with 3 volumes of IX import buffer (ill)
composed of 0.05 M HEPES, 3 mM MgS04 , 0.33 M sorbitol, (pH adjusted to 8.0).
It was centrifuged at 4000rpm for 5 min with brake on. The supernatant was
discarded. Pellet was suspended in 1 ml of IX IB. An aliquote (20 Jll) was taken for
assaying chlorophyll (Porra et al., 1989). The remaining chloroplasts were pelleted
at 3000rpm for 5 min, and resuspended in IX IB at a concentration of 1 mg
Chl/ml.
Preparation of precursor proteins
In vitro 35S-Met-labelled precursor proteins (pRSS) were prepared by the TNT
coupled SP6 polymerase in vitro translation system (Promega, Wisconsin, USA).
The reaction was set at room temperature. A reaction mixture was prepared containing
25 111 wheat germ extract, 2 111 reaction buffer, 2 111 35S-Methionine, 1 Jll SP6
polymerase, 1 Jll amino acid mix minus methionine (1 mM), lJ.il RNAsin ( 40U/ml),
2 111 DNA template~ 1 11 g and RNAse-free water to make the final volume of 50 111.
The mixture was incubated at 25°C for 1 h. The reaction was terminated by adding 50
Jll of cold methionine ( 60 mM) in 2X import buffer and was kept in ice for
immediate use.
Import/binding of precursor proteins
Chloroplast protein binding and import reactions were performed as described
(Aronsson and Jarvis, 2002; Olsen and Keegstra, 1992). The reaction mixture was
prepared containing 5 Jll precursor protein (Translation mixture), 3 mM ATP, 35
Jlg of chloroplast suspension (1 mg Chl/ml) and IX IB (containing 10 mMNaHC03
and 20 mM gluconic acid potassium salt) to make final volume of 100 Jll. The
transport reaction was set at 25°C for 20 min in dark, with gently agitating the
reactions every 5 min. For binding, the reaction mixture consisted essentially the
same components except the amount of A TP was reduced (0.3 mM). The reaction
was performed in dark, keeping the tubes in ice. The import and binding reactions
were terminated by adding 1 ml of cold lxiB. Intact plastids were pelleted by
80
![Page 27: MATERIALS AND METHODS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/14175/8/08_chapter 3.pdf · Pea Tic40(40K.Da) psTic40 1:7500 Arabidopsis Tic55(55K.Da) atTic55 1:1500](https://reader034.vdocuments.us/reader034/viewer/2022042209/5eacacc8001ca37f8c6a0ca4/html5/thumbnails/27.jpg)
MATERIALS AND METHODS
layering the reaction m1x on the top of 5 ml of 40% percoll in I x IB and by
centrifuging at 4500rpm for 6 min with brake off. The pellet was suspended in I ml of
cold IX lB. A 50 f!l aliquot was taken for protein estimation by Bradford method
(Bradford, I989) and rest was pelleted for 5 min at 6000rpm. The pellet was
dissolved in 50 f!l of IX sample buffer, boiled for 3min and analyzed by SDS-PAGE
(Laemmli, I970). A I5% polyacrylamide gel was run to analyze the Rubisco small
subunit protein. The translation product (TM) loaded indicates an aliquot of the
translation mixture equivalent to I 0% of the amount added to each import assay. Gel
was run for ~5 h at a constant current of 25mA. After the electrophoresis, gel was
dried onto a filter paper. Gels containing radiolabeled proteins were quantified using
Fuji FLA-5000 Imaging System (Fujifilm, Tokyo).
For time course experiments the import reactions were stopped at indicated time
points by adding chilled IX import buffer containing 50 mM Na2EDTA.
Stress-treatment of plants
For temperature stress treatment, Arabidopsis plants were initially grown on agropeat
photoperiodically (14h L/IOh D) at 22°C in IOO 11moles photons m-2 s-1 light intensity.
After 5 weeks of growth they were transferred to 7°C (chill-stress) and 40°C (heat-
stress) in light (80 11moies photons m-2 s-I). The heat stress was carried out till
96h and chill stress was carried out for I5 days.
For salt stress treatment, seedlings were initially grown on MS plates
photoperiodically (14h L/10h D, 100 11moles photons m-2 s-1) at 22°C for 10 days and
were subsequently transferred to another set of MS plates for 7-9 days containing 0
mM, 100 mM, or 150 mM NaCl.
Chlorophyll and carotenoid estimation
The extraction of Chlorophylls & carotenoids from tissues was done under a dim, green
safe light. Leaf tissues (also seedlings) were homogenized in 90% chilled ammonical
acetone (10 ml) in a pre-chilled mortar and pestle. Ammonia solution (0.1 N) was
prepared by dissolving 7.48 ml ofN~OH in 1000 ml distilled water. For preparation
of 90% ammoniacal acetone, 10 ml of 0.1N ammonia solution was added to 90 ml of
acetone. Three replicates were taken for each batch. Homogenate was centrifuged at
10,000 rpm for 10 min at 4°C. Supernatant was taken for estimating Chl and
81
![Page 28: MATERIALS AND METHODS - Shodhgangashodhganga.inflibnet.ac.in/bitstream/10603/14175/8/08_chapter 3.pdf · Pea Tic40(40K.Da) psTic40 1:7500 Arabidopsis Tic55(55K.Da) atTic55 1:1500](https://reader034.vdocuments.us/reader034/viewer/2022042209/5eacacc8001ca37f8c6a0ca4/html5/thumbnails/28.jpg)
MATE.RIALS AND M£THODS
carotenoids. Absorbance was taken at 663 nm, 645 nrn and 470 nrn. Reference cuvette
contained 90% ammonical acetone. Chl was calculated as described by Porra et al.,
1989 and carotenoids were calculated as described by Welbum and Lichenthaler, 1984.
Chl a= (14.21 x OD663 - 3.01 x OD64s) V/W
Chl b = (25.23 X OD645- 5.16 X OD663) V/W
Chl (a+b) = (9.05 x OD663 + 22.2 x OD645) V/W
Carotenoids = (1000 x OD470 - {3.27 x Chl a- 1.04 x Chl b}/5) V/227 x W
Chlorophyll a fluorescence measurements
All measurements of chlorophyll fluorescence were performed with a portable PAM-
2100 fluorometer (Walz, Effelteich, Germany). Before each measurement, the sample
leaf was dark-adapted for 20 min (Demmig et al,. 1987) with leaf-clips provided by the
Walz Company. The angle and distance from the leaf surface to the end of the optic
fiber cable were kept constant during the experiments. Chl a fluorescence was detected
by a photodiode (BPY 12; Siemens, Munich, Germany) that was shielded by a long
pass far-red filter (RG9; Southbridge, MA, USA) and a heat filter. To determine the
initial fluorescence, Fo, the weak measuring light was turned on and Fo was recorded.
Then the leaf sample was exposed to a 0.8s saturation flash of approximately 3000!Jmol
photons m-2 s-1 to obtain the maximal fluorescence, Fm. Optimum quantum efficiency
of PSII was calculated as Fv/Fm = (Fm-Fo)/Fm and the quantum yield of PSII as
Fv'/Fm' = (Fm'- F)/Fm' where Fm' and Fare maximum fluorescence yield reached in
a pulse of saturating light when the sample is preilluminated and measured fluorescence
yield at any given time respectively (Genty et al,. 1989). The electron transport rate
(ETR), expressed in ll moles electrons m -2 s -1, was calculated on the basis of the
measured value of Yield and PAR (photosynthetically active radiation, measured in
j.lmoles photons m -2 s -1) assuming that the absorbed photon is equally distributed
between the PSI and PSII and 84% of light incident on the leaf surface is absorbed. The
equation used for calculation ofETR =yield x PAR x 0.5 x 0.84. The coefficient of
photochemical fluorescence quenching ( qP) and non-photochemical fluorescence
quenching (qN) were calculated using the following equations, qP = (Fm' -F)/(Fm' -Fo)
and qN = (Fm-Fm')/(Fm-Fo). All measurements of Fo were performed with the
measuring beam set to a frequency of 0.6 KHz, whereas all measurements of Fm were
performed with the saturation flash automatically switching to 20KHz.
82