Little Guy in the EyeLittle Guy in the Eye of YHWH

Posts Tagged annunaki dna Mark of the Beast 14 DNAwith 10 comments

The mark of the beast is a counterfeit of the mark of YHWH which is His Image, His Word. DNA, in specific human DNA, is a physical representation of the Word. The DNA in the body of man is the word/blueprint which is used to produce man who was created in the image of Elohim. A corruption of the human DNA genome would constitute a corruption of the Image of YHWH and His Word. Messiah Yahshua came to earth as the Word made flesh. The antichrist beast manifests as a corruption of the Word, a counterfeit Image of YHWH.

ImageGoing back to part 1click here, it is seen that the mark is synonymous with an Image. The word for mark is ( aleph tav) which is significant because it is a title of Messiah (Revelation 1:8, 11; 21:6; 22:13) as well as represents the Hebrew alphabet of which DNA is modeled after.

&

This is the root for the word sign/mark. This is significant because the Torah is a sign on the hand and the forehead (Deuteronomy 6:8). The mark of YHWH is His Torah. The mark of the beast is lawlessness for the beast is the man of sin (2 Thessalonians 2:3; Psalm 130:3; Jeremiah 2:22; Job 10:14) .

The Hebrew word for letter is which is from the same root of aleph tav. In Greek this word is: G4592 semeion This is where semiology comes from, which is the study of signs/symbolsclick here. A related word is semen which means seed. This is very interesting because DNA is a language consisting of letters, sentences which is passed through the seed. Tav aleph is related to the word tav and aleph tav and means a mark/boundary.

tav aleph relates to the word tar which means the mark of man or the border/outline.

From this root we get taar and toar. These words mean form, outline or border. This is an important connection to see in that the mark of the beast versus the mark of YHWH ultimately reflects whose image/form you are in.

This connection between the mark and the image/form/outline/shadow picture of YHWH Yahshua versus the antichrist is further seen in that the word Torah comes from this same root.

We can have the mark of YHWH and be in His image by walking in His Torah and letting Messiah live through us (Galatians 2:20), or we can have the mark of the beast and be in the image of satan by walking in his torah which is lawlessness (Ephesians 2:2-3Isaiah 30:8-11; 1 Peter 2:8). In reality, this torah is the concept of do what thou wilt shall be the whole of the law. The ability of man to decide what is good or evil, right or wrong instead of relying on the Word to define the two. The word for image in Hebrew is tsel which means a shadow cast by an object forming an image. This is also seen in the concept of being under the shadow of His wings, which for the current study represents dwelling under the branches of the Tree of Life. The counterfeit, of

course, is the tree of knowledge and the shadow/image it casts. The word tsel is the combination of the letter tsadi which is the picture of a hunter, a man lying on his side with a spear or bow or a man with a fishing pole. The lamed is a the picture of a staff held by a shepherd which represents authority. Herein lies a beautiful picture of the current study. The shepherd who hunts. The Messiah, the Good Shepherd, holds out a fishing pole whose bait is the fruit of the tree of Life. The idol/worthless shepherd lies in wait as a lion seeking whom he may devour. The word translated as mark in Revelation is used only one other time in Scripture referring to man engraving an image to represent the Almighty Act 17:29 Then being offspring of God, we ought not to suppose that the Godhead is like gold or silver or stone, engraved by art and the imagination of man. This is the essence of the mark of the beastit is a counterfeit worship of YHWH. This is what the golden calf was. Making a golden calf and calling it YHWH. This is who the antichrist will be. A counterfeit Yahshua. Who was Messiah? He was the Word made flesh (John 1:14). The Greek word that is translated as mark G5480 charagma Thayer Definition: 1) a stamp, an imprinted mark 1a) of the mark stamped on the forehead or the right hand as the badge of the followers of the Antichrist 1b) the mark branded upon horses 2) thing carved, sculpture, graven work 2a) of idolatrous images Part of Speech: noun neuter A Related Word by Thayers/Strongs Number: from the same as G5482 Another Greek word that comes from the same root is: G5481 charakter Thayer Definition: 1) the instrument used for engraving or carving 2) the mark stamped upon that instrument or wrought out on it 2a) a mark or figure burned in (Lev_13:28) or stamped on, an impression 2b) the exact expression (the image) of any person or thing, marked likeness, precise reproduction in every respect, i.e facsimile Part of Speech: noun masculine A Related Word by Thayers/Strongs Number: from the same as G5482 This word charakter is only used once in the Scriptures. It is translated as express image. Again we see a connection to the mark and the image. Heb 1:3 who being the shining splendor of His glory, and the express image of His essence, and upholding all things by the Word of His power, having made purification of our sins through Himself, He sat down on the right of the Majesty on high, Psa. 110:1

DNA & the Word

DNA is a physical picture of the Word, it is a language that functions exactly the same as Hebrew, the language that traces back to Eden. DNA is the language of the book that is used to form our bodies, just as the Hebrew language is the language of the Word who became flesh and dwelt among us. The DNA molecule is the instruction manual for the forming of amino acids which make the structural elements of proteins that turn into the biochemical units that drive all biological processes. The proteins formed from the amino acids which the DNA molecule makes are 22 in number corresponding to the 22 letters in the Hebrew Aleph-Bet. These 22 letters point to Messiah Yahshua who is described as the Alpha & Omega/Aleph Tavclick here. The word for sign above is which is the same word in Hebrew word a letter. The 22 letters of the Hebrew Aleph-Bet form the Image of the Messiah who is the Word made flesh. This is seen in the physical realm in our bodies where the DNA forms 22 amino acids which make the proteins for each individual part of our bodies. Isa 8:18 Behold, I and the children {Messiah and His body} whom YHWH has given to me are for signs ( letters) and wonders in Israel from YHWH of Hosts, who dwells in Mount Zion.

Etymology of DNADNA is an abbreviation for deoxyribonucleic acid. When breaking down the different parts of this word it is seen that etymologically DNA points to the Word. This is no surprise as functionally, DNA is a picture of the Word. The first part of the word is de which means from or according to. As in de facto meaning in fact or reality in Latin. This could translate into Hebrew as lamed or mem. In Aramaic the d in front of a word is the same as b. de from, down from The next part of deoxyribonucleic acid is the oxy. Oxy is a Greek word which means sharp or pungent. It is the origin of the word acrid. Oxy/Oxus in Greek traces back to the Hebrew word ( qots) which means a thorn, or sharp. It is the origin of the Latin word acacia which means a thorn and is used in reference to the wood used in the Tabernacle which is a major theme of this study as the Tabernacle was a shadow picture of Messiah, and consequently the Word. deoxyribonucleic acid. Ribose comes from the Hebrew word chalav and is related to gum and the Hebrew word gome. These all connect to the Word which will be discussed in more detail below. Gome is the source for papyrus/paper and the Bible. deoxyribonucleic acid. The word nucleic means something that comes from the nucleus. Nucleus comes from the Latin word nucleus which means a kernel, little nut. The word kernel comes from Germanic word kurnilo which means the root of corn, seed/grain. Kernel traces even farther back to the Hebrew word karmel. Karmel means a seed but a seed planted in a Garden in particular. The word nucleus also links back to the Hebrew word qamat which has the meaning of compressing. Qamat is the origin of the Old English hem which was a doubling over or

compressing of the hem. Interestingly, on the hem of the garments of Messiah were placed tsitsit where are intimately linked with DNAClick Here The final part of deoxyribonucleic acid is the word acid. Acid comes from the Latin acidus meaning sour or sharp. Tracing the word acid farther back links it with the Hebrew word zayit which means the olive tree. The Olive tree is a picture of Messiah/the Word/the Tree of Life which will be discussed in more detail below. de according to oxi sharp (Hebrews 4:12 the Word is sharp, like unto a two edged sword) ribo sweet (Psalm 119:103) Papyrus/Word nucleic Seed (Luke 8:11) Acid Olive (Tree of Life Romans 11).

Life click hereLife comes forth from the instructions in the DNA molecule. The Holy Scriptures proclaim that the Word = Life. Joh 6:63 It is the spirit that quickeneth; the flesh profiteth nothing: the words that I speak unto you, they are spirit, and they are life. See also Deuteronomy 32:47; 1John 1:1-2; Philippians 2:16; John 11:25; 14:6; 1John 5:20. The English word life comes from the Hebrew word chalav which means fat, choicest part, milk. Interestingly, the word protein traces back to this same Hebrew word. Life comes forth from the proteins produced by the DNA molecule in the cell of living organisms Life and its connections to the current study are discussed in more detail in Messiah in the Torah: Genesis 1:20-23click here

523

The Hebrew word for Father, ,also equals 523 in full value. The Full Value of a word is calculated by replacing each letter of the word with its name, and summing the result. Further connecting Elohim to the Aleph-Bet is by calculating the entire sum of the Hebrew Alphabet which comes to 1495. This is equivalent to the Greek phrase The Everlasting God.

Going back to the number 523, it is interesting to note that the Greek word egersis, which means resurrection (Matthew 27:53) also equals 523. As seen in part 1click here, the resurrection is intimately linked to the mark.

Protein & Hebrew

Interestingly the English word protein traces back to the Hebrew word avar which is from whence the word Hebrew ivrit comes from. Protein comes from the Greek word protos which comes from avar. E-Word Dictionary Isaac Mozeson pg 312

Notice that the word is related to the word bar which means son (Psalm 2:12). It is no surprise then that the prophet Isaiah (Isaiah 8:18) speaks of those who are in Messiah as signs/letters ( )and children/protein. Notice that the 22 amino acids which correspond to the 22 letters of the Hebrew Aleph-Bet make proteins which correspond to the Hebrew language.

DNA & Language Nucleotide Character (Letter) Codon Letter Gene Word Operon Sentence Regulon Paragraph DNA BookSimplified it could be said Nucleotide bases Letters Codons Words Genes Sentences Book DNA The letters of the DNA strand are comprised of Adenine, Guanine, Cytosine and Thymine (A,C,G,T). These four letters combine in pairs to make all the information needed to form life. Adenine always pairs with Thymine and Guanine with Cytosine. This points to the Hebrew language where all words come forth from a 2 letter parent root. This is also alluded to in Scripture. Isa 34:16 Search and read from the Book of YHWH; not one of these misses, each not lacking her mate; for He has commanded my mouth, and by His Spirit He has assembled them.

These 2 letter parent roots, for the most part, cant be used in language without the adding of another letter to form the 3 letter root of which most are familiar with in the Hebrew language. This process happens through the means of messenger RNA. RNA is an exact copy of the DNA molecule where the helix ladder unzips itself in order to make an exact copy. DNA then is a picture of the Father on His throne. The Messenger RNA is a picture of Messiah who comes to earth to bring many sons to Glory. This DNA to RNA and back to DNA process is also seen in the work of the Scribes who made exact copies of the Torah. DNA transcription

DNA, Design, and the Origin of Life Charles B. Thaxton, Ph.D. the genetic code can be best understood as an analogue to human language. It functions exactly like a code indeed, it is a code: it is a molecular communication system within the cell In recent years, scientists have applied information theory to biology, and in particular to the genetic code It provides a mathematical means of measuring information The conclusion drawn from the application of information theory to biology is there exists a structural identity between the DNA code and a written language Molecular biology has now uncovered an analogy between DNA and written human languages. It is more than an analogy, in fact: in terms of structure, the two are mathematically identical.

http://www.redicecreations.com/specialreports/2006/03mar/holygrail.html A team of Russian geneticists and linguists, researching the electromagnetic behavior of DNA, discovered that junk DNA is critical not only for the construction of our body but also in data storage and communication. The Russian team discovered that this 90% of our DNA follows the same rules of grammar, syntax and semantics as human languages. Their conclusion is that human language mirrors the structure of our DNA.

Hebrew grammarDNA works in the same way as the Hebrew language. Each Hebrew word traces back to a 2 letter parent root. This parent root, for the most part, cant be used in a sentence without the addition of a 3rd letter. Hebrew verbs require a 3 consonant root in order to be conjugated. This 3 letter root is called the child root. The DNA helix is formed through the combination of 2 nucleotides. Adenine and Thymine or Cytosine and Guanine combinations. In order for amino acids of the genetic code to be formed into proteins the nucleotides must combine into 3 letter combinations to make codons.

The genetic code consists of 64 codons and the amino acids specified by these codons. When the DNA is in the nucleus, the DNA contains two letter pairs held together by hydrogen bonds. The letters are unable to form a body without leaving the nucleus and taking on a 3rd letter, just like the Hebrew language. In order to take on a 3rd letter the DNA helix must unwind, where it copies itself onto messenger RNA. The letters then make one long string of letters. Just like an ancient Torah scroll.

The DNA strand is made of letters: ATGCTCGAATAAATGTGAATTTGA The letters make words: ATG CTC GAA TAA ATG TGA ATT TGA The words make sentences: < ATG CTC GAA TAA> These sentences are called genes. Genes tell the cell to make other molecules called proteins. Proteins allow a cell to perform special functions, such as working with other groups of cells to make hearing possible.

NOVA - Ghost in Your Genes The DNA letters are transcribed by Messenger RNA, just as Scribes transcribed one Torah scroll onto another scroll. The messenger RNA is also called the Servant RNA. The Messenger RNA can go outside the nucleus, whereas the DNA must stay inside the nucleus. The DNA does not leave the nucleus in order to preserve the original copy. If the mRNA obeys the rules He will overcome the mutations (sins) of the world when He enters the cytoplasm. The mRNA leaves the nucleus through a hole called the gatekeeper, that prepares the way for the mRNA to leave the nucleus. When the mRNA leaves the nucleus it is translated. The 3 letters represent amino acids. There are 22 amino acids that are read by the ribosomes to produce protein. These amino acids are divided up into codons, from the English word code which traces back to the Hebrew word sod. Murray Eden of MIT one of the mathematicians attending the Wistar Institute Symposium (1966) DNA, like other languages, cannot be tinkered with by random variational changes; if that is done, the result will always be confusionNo currently existing formal language can tolerate

random changes in the symbol sequences which express its sentences. Meaning is invariably destroyed. You can not add or take away from the DNA or a mutation results Deu 12:32 All the things that I command you, take heed to do them and you shall not add to it, nor take away from it. Mat 5:17 Do not think that I came to annul the Law or the Prophets; I did not come to annul, but to fulfill. The genetic information that is read by the ribosomes determines what will be formed. Interestingly, tracing back the word information brings forth the same concept. The English word information comes from the Latin word informare which means to shape, form, train, instruct, educate, etc. Informare breaks down from in meaning into and forma meaning a form. The English word form comes from the Old French word forme which means a physical form, appearance, shape, image etc. This traces to the Latin word forma which further traces to the Greek word morphe meaning form, beauty, outward appearance. This word morphe is interesting as it is used in only a few places in the New Testament, all of which are referring to Messiah. (Mark 16:12; Philippians 2:6-7; Galatians 4:19). Morphe comes from the root meros which means the constituent parts of a whole. Combining small parts to make an image, this describes DNA becoming protein (image) very well. Morphe is used to translate multiple words, all of which link to the current study. G3444 morphe H2122 ziv an image that stands out morphe H6754 tselem shadow, image morphe H8389 toar mark or image, discussed in greater detail above. morphe H8403 tavnit image, pattern- the word used for pattern in reference to the Tabernacle/Temple of YHWH. The significance of this has been discussed throughout this series of studies in reference to Messiah and His body. morphe H8544 temunah Image, form- the root of this word is which means living waters/blood usually translated as type or kind which is linked to the passing of genes from father to son through the blood.

EpigenomeThe significance and importance of the epigenome has only recently been discovered by scientists. The genetic material which makes our eyes, ears, nose, feet, liver, heart etc., are all the same. It is the epigenome that translates this information to make each part what it is. This corresponds to the Holy Spirit. The Scriptures can be read by anyone yet it is only through the Holy Spirit that one can understand and see the image of Elohim. Interestingly, the epigenome doesnt alter the DNA sequence, it turns on or turns off different parts of the sequence. A good example of this is cancer. Cancer may be caused by several different mutations or epigenetic changes that cause genes to be expressed (turned on) and/or silenced (turned off) when they should not be. Cancer is an aberration in the cells which leads to death which can be caused by mutations (adding or taking away) or by certain parts of the Word being turned on or off. Not only does changing the Word lead to death, but misinterpretation of the Word. Rom 7:24 O wretched man that I am! Who shall deliver me from the body of this death? Rom 7:25 I thank God through Jesus Christ our Lord! So then I myself with the mind truly serve the Law of God, and with the flesh the law of sin.

The epigenome that translates the genetic code is likened to the Spirit. The Holy Spirit teaches man and leads him to interpret the Word correctly where he can be formed into the Image of Messiah. (2 Corinthians 3:18; Galatians 4:19; Romans 8:29) whereas the spirit of evil works in the children of disobedience where the Word is corrupted and leads to them being formed into the corrupted man of sin (Ephesians 2:2-3; Isaiah 1:4; 57:4; 1 Peter 1:13-16). Interestingly, DNA is dwelling in the midst of a matrix of water. The fact that it is in water plays a crucial role in how it gets its helix ladder shape. Because the four DNA bases are insoluble in water, they turn towards the interior molecule to form and join the two letter roots. They then wrap themselves around each other to avoid contact with their wet environment. The epigenome is then likened to the Spirit hovering over the waters in the beginningclick here. Gen 1:2 And the earth was without form, and void; and darkness was upon the face of the deep. And the Spirit of God moved upon the face of the water. Gen 1:3 And God said, Let there be light; and there was light. Psalm 139 speaks of man being formed in the womb and on a deeper level alludes to the DNA molecule. Psa 139:15 My bones were not hidden from You when I was made in secret; when I was woven* in the depths of the earth. * raqamthis words means fashion, needlework or twisted threads (DNA). Psa 139:16 Your eyes saw my embryo; and in Your book (an allusion to DNA the book of life) all my members were written the days they were formed, and not one was yet among them. Here we seen that the womb is likened to the earth. In Hebraic thoughtclick here, the womb is also likened to waters. As will be seen below, DNA also produces light. Here we see a replay in our very cells of the beginning of the universe.

RibosomesThe ribosomes read the 22 amino acids in order to form proteins. Ribosomes are a picture of Scribes. The word ribosome comes from ribose which is a sugar that is formed from gum arabic. Tracing back this word gum brings forth some interesting connections to scribes. Gum arabic comes forth from the acacia tree mentioned above and is used in the process of making ink for ancient Torah scrolls. More on this below. In the Scriptures, gum comes forth from chalvanah. This is translated as galbanum as in Exodus 30:34. Chalvanah comes from the root chalav which means the fat or choicest part. This was what was offered to YHWH on the altar along with the kidneys and liver (Exodus 29:13). Interestingly, the English word liver comes from the Hebrew word chalav. This is also the origin of the English word lip which is made up of fatty tissue. The word lobe as in the ear lobe comes from chalav as well. It is not hard to see the connection between lips, hearing (earlobe) and scribes (Proverbs 8:6).

The English word gum comes from the Hebrew gam.

The connection between gam and scribes/the Word is seen in more detail in Messiah in the Torah: Genesis 1:9-13click here. Gam has the meaning of a collection of a group of animals at a watering hole, in particular camels as seen in Genesis 24. Gam (gimmel) is the number 3 in Hebrew which is linked to resurrection and maturity which is a major theme of the current study on the mark. Gamal is also the word for a camel which is used as a descriptive tool of satan in Kabbalistic writingsclick here. Here is seen the counterfeit of the ribosome or scribe. Corrupting the word/DNA to bring forth a counterfeit image/protein. The Hebrew letter gimel originally was pronounced as gam.

Ancient Hebrew Lexicon of the Bible pg 22 This links back to baptism, as seen above, as the meaning of collecting at the waters. To further illustrate this, the word agam, which comes from the root gam is translated as pool in English, just as miqveh (baptism) is.

Amazingly, the account of Moshe being drawn out of the waters after being hidden for 3 months is linked to this word. Exo 2:3 And she was not able to hide him any longer, and she took a basket for him made of papyrus (Hebrew gome ,)and she daubed it with bitumen and with pitch. And she put the child in it, and placed it in the reeds by the lip of the Nile. The Hebrew letter gimmel/gam is a pictograph of a foot but also represents a camel.

The Holy Scriptures link the camel to the gathering of the waters: Gen 24:11 And he made the camels kneel* outside the city, by a well of water at the time of the evening, the time that women go out to draw. *In Hebrew this word is barakh which connects with the word gamal/miqveh through the English word pool. The word pool is translated from 3 different Hebrew words. Agam, miqveh, and berakah.

This word comes from the root:

Notice that the parent root of this word is ,bar. This is the word for Son (Psalm 2:12). It is also the root for the word for soap.

Washing of the body, as well as washing of the clothing points to Messiah. At Mt. Sinai, Yisrael was to was their clothing and be ready for the 3rd day when they would meet YHWH. Interestingly, the human body was designed to bathe with soap every 2-3 days. The word above, bar, is translated as son in Psalm 2:12; Proverbs 31:2 & Daniel 3:25, and is used in reference to the Word in Psalm 19:8. The link here is clear. The need for the body & our clothing to bathe in water and soap is a picture of man needing to be covered in the garments of the Word/Yahshua. Psa 24:3 Who shall go up into the hill of YHWH? And who shall rise in His holy place? Psa 24:4 He who has clean hands and a pure heart; who has not lifted up his soul to vanity and has not sworn deceit. Psa 24:5 He shall lift up the blessing (berakhah) from YHWH, and righteousness from the God of his salvation. What is the blessing (berakah)? Psa 133:3 like the dew of Hermon coming down on the mountains of Zion; for there YHWH commanded the blessing: life till everlasting. Act 3:25 You are sons of the prophets and of the covenant which God appointed our fathers, saying to Abraham, Even in your Seed all the families of the earth shall be blessed. Gen. 22:18 Act 3:26 Having raised up His child Jesus, God sent Him first to you, blessing you in turning away each one from your iniquities.

This blessing is seen in the natural realm, as described in the book of Hebrews, pointing back to the 3rd day of creation Heb 6:7 (For the earth drinking in the rain often coming upon it, and producing vegetation suitable for those for whom it is also worked, receives blessing from God; Heb 6:8 but bearing thorns and thistles, it is deemed unfit and near a curse, of which the end is for burning.) Gen. 3:17, 18 Being clothed with His righteousness is linked with the earth springing forth plants Isa 61:10 Rejoicing I will rejoice in YHWH. My soul shall be joyful in my God. For He clothed me with garments of salvation; He put on me the robe of righteousness, even as a bridegroom dons as a priest his head-dress, and as a bride wears her ornaments. Isa 61:11 For as the earth comes out with her buds, and as a garden causes that which is sown to grow, so the Lord YHWH will make righteousness and praise to grow before all the nations. Back to the letter gimmel The letter gimmel points to completion, just as the number 3 through does. Psa 57:2 I will cry to God Most High, to God who works (gamar=perfects) for me. Psa 138:8 YHWH will perfect His work in me; O YHWH, Your mercy endures forever; You will not forsake the works of Your hands. This concept of working to perfection through YHWHs Word/Image being formed in us is seen further in: 2Ti 3:16 All Scripture is God-breathed and profitable for doctrine, for reproof, for correction, for instruction in righteousness, 2Ti 3:17 so that the man of God may be perfected, being fully furnished for every good work. The Wisdom in the Hebrew Alphabet pg 71 The gimmel, is cognate to gamol, which means to nourish until completely ripe, as in , it produced mature almonds (Numbers 17:23). Of Isaac, the Torah states: The child grew, ,and was weaned (Genesis 21:8); there gamol refers to the development of an infant to the point that it can live without its mothers nursing. It is interesting to note that in the book of Maccabees the period of time that the mother nursed the child was 3 years. 2Ma 7:27 But she bowing herself toward him, laughing the cruel tyrant to scorn, spake in her country language on this manner; O my son, have pity upon me that bare thee nine months in my womb, and gave thee such three years, and nourished thee, and brought thee up unto this age, and endured the troubles of education. This concept of maturity being linked with being weaned is further seen in the book of Hebrews Heb 5:12 For indeed because of the time you are due to be teachers, yet you need to have someone to teach you again the rudiments of the beginning of the Words of God, and you came to be having need of milk, and not of solid food; Heb 5:13 for everyone partaking of milk is without experience in the Word of Righteousness, for he is an infant.

Heb 5:14 But solid food is for those full grown, having exercised the faculties through habit, for distinction of both good and bad. Heb 6:1 Because of this, having left the discourse of the beginning of Christ, let us be borne on to full growth, not laying down again a foundation of repentance from dead works, and of faith toward God, Heb 6:2 of baptisms, of doctrine, and of laying on of hands, and of resurrection of dead ones, and of eternal judgment. Heb 6:3 And this we will do, if indeed God permits. Heb 6:4 For it is impossible for those once having been enlightened, and having tasted of the heavenly gift, and becoming sharers of the Holy Spirit, Heb 6:5 and tasting the good Word of God, and the works of power of a coming age, Heb 6:6 and having fallen away, it is impossible for them again to renew to repentance, crucifying again for themselves the Son of God, and putting Him to open shame. Notice that Shaul links this concept of maturity with the springing forth of plants and fruit Heb 6:7 (For the earth drinking in the rain often coming upon it, and producing vegetation suitable for those for whom it is also worked, receives blessing from God; Heb 6:8 but bearing thorns and thistles, it is deemed unfit and near a curse, of which the end is for burning.) Gen. 3:17, 18 To further show this connection, the word for complete/mature is

is the source for the English word cell. This is a fascinating connection as it is the ribosomes which read the amino acids (22 letters) which makes proteins that form our cells. The Hebrew word for food comes from this same root:

On the 3rd day the plants, trees and fruit appeared which became food for man.

Gen 1:30 And to every beast of the earth, and to all birds of the heavens, and to every creeper on the earth which has in it a living soul, every green plant is for food. And it was so. Gen 2:9 And out of the ground YHWH God made to spring up every tree that is pleasant to the sight, and good for food. The Tree of Life was also in the middle of the garden; also the Tree of the Knowledge of Good and Evil. It is interesting that when Isaac was weaned (found mature) there was then a feast (Genesis 21:8). If Isaac was 3 years old, that would connect to the birth of the manchild of Revelation 12 & Isaiah 66:7-8, who partakes of the Wedding Supper 3 1/2 years after. Isaac is further linked to the manchild through Psalm 126. When the captivity is ended, our mouths will be full of laughter (sechoq same root as Yitschaq), Sarahs barren womb is a picture of Zion (Isaiah 49:13-23; 54:1-3; 66:7-11). It is believed that Isaac was born at Pesach which would link to the manchild in Revelation 12 who flees to the wilderness for 3 1/2 years. Subtracting 3 1/2 years from the Fall Feasts which are a picture of Messiahs return, brings one to the time of Pesach. The word for bride comes from the same root, :

It was on the 3rd day that the bride appeared before YHWH at Mt. Sinai Exo 19:10 And YHWH said to Moses, Go to the people and sanctify them today and tomorrow. And let them wash their clothes. Exo 19:11 And be ready* for the third day. For on the third day YHWH will go down before the eyes of all the people on the mountain of Sinai. *The Hebrew word here is kun which means to stand, firm. It comes from the following root word in Hebrew:

This word points to the resurrection and links to the 3rd day of creation. It is on the 3rd day (Hosea 6:2 that the bride is resurrected into the image of Messiah (clothes are cleansed Ephesians 5:26-28) to meet her bridegroom. The Hebrew word for priest, kohen, comes from this root, as the priest is a support/pillar of the community. Kun is a picture of a plant rising out of the ground which also links to the Word. Bible & Papyrus. The words for Bible and Papyrus come from same word in Hebrew E-Word pg 560 ABOOBH is a hollow pipe or tube derived from jointed reeds or knotgrass, an extension of AiBHeH (reed Job 9:26).

This is also the origin of the English word pipe. It is no surprise then that the adversary portrays himself as the pied piper as seen in the god Pan. Pan is equivalent to Saturn as has been discussed in previous studies. Aboobh comes from the root which is the word for Father. Going back to the ribosome gum connection. GUM, sticky resin, was first produced from lakeside plants, thus from ,lake, pond. This material was later replaced by the rubber plant, but the GUM name stuck. (E-Word pg 518) gome is the source of the word papyrus which is the source for paper and Bible as seen below. Interestingly, the English word syrup is also comes from SiRaPH which means gum, resin which traces further back to ,mentioned above in connection with sulfur. Here we see the negative side of gum or ribosomes. The counterfeit who is the seed of the serpent.

DNA BackboneOne strand of DNA has a backbone consisting of a polymer of the simple sugar deoxyribose bonded to something called a phosphate unit.

The nucleotides (letters) of the DNA strand attach to this sugar-phosphate backbone.

These sugar phosphates are based upon the geometry of the number 6. This is a significant number in relation to the mark of the beast study. There are 4 different types of sugar-phosphates. Dihydroxyacetone phosphate (DHAP)

Glucose 6-phosphate

Phytic acid

Teichoic acid

The etymology of the words sugar and phosphate bring forth interesting connections to the current study as well. Sugar comes forth from the Old French sugar which traces back to the Arabic sukkar and then to the Hebrew word shakar.

E-Word -Isaac Mozeson pg 760 The word phosphate comes from the Latin word phosphorous which traces further to the Greek word phosphoros which is translated as morning star from phos meaning light and phoros meaning to carry or bear. The Morning Star in Scripture is speaking of Messiah (Revelation 2:28; 22:16) and also the counterfeit Lucifer (Isaiah 14:12). Interestingly, modern science has found that DNA contains biophotons and weak proton emissions, a.k.a. light. Phosphorus ultimately traces back to the Hebrew word ( paz) which means fine gold (yellow). The link between gold and DNA and the mark of the beast has been discussed throughout this series of studies and will be addressed in more detail below.

E-Word Isaac Mozeson pg 555 Isaac Mozesons research into Edenics and the etymology of all languages tracing back to Hebrew brings forth some interesting connections to phosphorus. As seen in the above image, the word topaz traces back to paz as well.

E-Word - Isaac Mozeson pg 809 Sulfur connection Mozeson traces the English word serpent back to the Hebrew word saraph. Saraph means fiery, burning or to shine. This also is linked to the Hebrew word nachash used in Genesis 3 which also has the sense of shining.

E-Word pg 666 Is it any surprise that those who have had encounters with UFOs and the beings associated with them speak of a sulfur smell? Delving deeper into the etymology of phosphorus and paz brings forth even more interesting connections to the current study. Asfar the Arabic word for yellow, which comes from the Hebrew paz is also a branch of the Hebrew word matsebah which is usually translated as pillar. This is the word used in the Torah in Genesis 28 at Bethel where Jacob encounters the ladder which reaches to heaven and where he anoints the pillar (matstsebah). This ladder is intimately connected to the DNA helix as will be discussed below. The ladder, the pillar etc., all point to Messiah.

E-Word pg 461 The Word is likened unto sugar. Psa 135:3 praise Yah! For YHWH is good! Sing praises to His name, for it is delightful. The word delightful in the Hebrew is naam which means pleasant, delightful, beautiful, sweet. We are to speak the oracles of Elohim(1Peter 4:11)His Name is His Word (Revelation 19:13) these are the sweet delicacies that we are to partake of. In nature the same thing can be seen. The sugars of fruits and the sweetness of honey which Elohim created are good for our bodies the sugars that man created are detrimental. Sir 24:20 For my memorial is sweeter than honey, and mine inheritance than the honeycomb. The Memorial is connected w/ the Torah Psa 19:7 The law of the LORD is perfect, converting the soul: the testimony of the LORD is sure, making wise the simple. Psa 19:8 The statutes of the LORD are right, rejoicing the heart: the commandment of the LORD is pure, enlightening the eyes. Psa 19:9 The fear of the LORD is clean, enduring for ever: the judgments of the LORD are true and righteous altogether. Psa 19:10 More to be desired are they than gold, yea, than much fine gold: sweeter also than honey and the honeycomb. {Notice the connection here between fine gold (paz phosphorus) and honey (a type of sugar) Psa 19:11 Moreover by them is thy servant warned: and in keeping of them there is great reward. Psa 119:103 How sweet are Your Words to my palate! More than honey to my mouth! Psa 119:104 By Your Precepts I know; so then I hate every false way. The counterfeit is the sweet word of the beast. Psa 141:3 O YHWH, set a guard to my mouth; keep watch on the door of my lips. Psa 141:4 Do not let my heart turn aside to any evil thing, to practice deeds in wickedness with men who practice iniquity; and do not let me eat of their delicacies (from naam).

Psa 140:1 To the chief musician. A Psalm of David. O YHWH, deliver me from the evil man; keep me from the violent man, Psa 140:2 who devises evil things in the heart; they gather wars all the day. Psa 140:3 They sharpen their tongues like a snake; adders poison is under their lips. Selah. Pro 5:3 For the lips of a strange woman drip honey, and her palate is sweeter than oil, Pro 5:4 but afterwards, she is bitter as wormwood, sharp as a sword of mouths; The Word is likened unto Lightclick here phosphorus Psa 119:130 The entering of Your Word gives light, giving discernment to the simple.

His Name is His WordRev 19:13 And he was clothed with a vesture dipped in blood: and his name is called The Word of God. As seen in previous studies, His Name/Word is associated to the mark as this is what will be in the hand/head of His believers (Revelation 14:1; 22:4; Deuteronomy 6:6-8). The mark of the beast is the counterfeit name/word in the hand/head of his followers.

DNA & the NameGregg Braden in his book the God Code, speaks of the DNA sequence in man revealing the sacred name of YHWH. The God Code pg 112 Through determining their simple mass, the elements of DNA (hydrogen, nitrogen, oxygen and carbon) within our bodies may now be replaced with four letters of the Hebrew alphabet: Yod, Hey, Vav, and Gimel, thus revealing that our DNA may be read literally as a translatable alphabet within each of our cells.

The God Code pg 135

The God Code pg 136 When we substitute modern elements for all four letters of Gods ancient name, we see a result that, at first blush, may be unexpected. Replacing the final H in YHVH with its chemical equivalent of nitrogen, Gods name becomes the elements hydrogen, nitrogen, oxygen and nitrogen (HNON) all colorless, odorless, and invisible gases! In other words, replacing 100 percent of Gods personal name with the elements of this world creates a substance that is an intangible, yet very real form of creation! Additionally, the first chapters of Genesis relate that it is in a nonphysical form that the Creator was present during the time of creation (Genesis 1:2). It was the spirit of God that first moved over the face of the earth. The Sepher Yetzirah further describes the first Hebrew letter to emerge from the void of creation as the Mother Letter that made the universe possible: Alef. Through a great, mystical secret Alef then evolved into the first element to appear in our universe, hydrogen, as well as the first letter of Gods name : Yod. Joh 5:43 I have come in the name of My Father, and you do not receive Me. If another comes in his own name, you will receive that one.

The God Code pg 151 Yahshua came in the likeness of man YHVG, but also in the Name of the Father YHWH. It is interesting that Yahshua in Greek = 888. The man of sin = 666.

Bodies & BooksOur bodies are pictured by books. Psa 40:7 Then said I, Lo, I come: in the volume of the book it is written of me,

Tome is the root of the word anatomy

In the same passage of Scripture mentioned above in reference to Messiah, it speaks of the body being given to Him. Heb 10:5 For this reason, coming into the world, He says, Sacrifice and offering You did not desire, but You prepared a body for Me. Heb 10:6 You did not delight in burnt offerings and sacrifices concerning sins. Heb 10:7 Then I said, Lo, I come, in the heading*** of the Book (Biblion) it was written concerning Me, to do Your will, O God. LXX-Psa. 39:7 -9; MT-Psa. 40:6 -8 ***G2777 kephalis Thayer Definition: 1) a little head 2) the highest part, extremity of anything

2a) as the capital of a column 2b) the tips or knobs of the wooden rod around which parchments were rolled were called by this word, because they resembled little heads 3) the Alexandrian writers transferred the name to the roll or volume itself 3a) in the roll of the book Part of Speech: noun feminine A Related Word by Thayers/Strongs Number: from G2776 In Hebrew this word is megillah which is also related to the head. The word golgolet (Golgotha/skull) comes from this same root in Hebrew meaning round. The word megillah is related to the Hebrew word galgal (circle) which has the gematria of 66, referring back to the 66 books of the Word. The word for chapter, also means a head from the Latin capitulum. Traditionally, Torah scrolls were treated like living beings. They were clothed and when they wore out they were buried. The armor worn by a man (specifically speaking of Messiah) as mentioned in Isaiah 59:13; Ephesians 6:11 corresponds with the clothing of a Torah Scroll. The Armor of Elohim is linked with baptism in Messiah Armor of Elohim

The word in Greek for armor is panoplia which is used to translate the Hebrew word chalatz in the Septuagint

Going back to the word anatomy, as seen above it used to be a synonymous word with skeleton.

Notice that the word skeleton traces back to the meaning of dried up. This links to the current study through the word for dry land (yabesh). Interestingly, the body of Messiah is likened to dry bones in Ezekiel 37 which is resurrected and brought back to the land of Israel. The word for bone in Hebrew comes from the word meaning a treeit is no coincidence that Ezekiel 37 speaks of bones in reference to the resurrected body of Messiah and then speaks of 2 trees becoming one in reference to His body.

There are 206 bones in the human skeleton. Here are a few times that the gematria of 206 is seen in the Scriptures. Notice the connections to the current study.

The etymology of the word codex comes from a block of wood.

In the 5th century, Isidore of Seville explained the relation between codex, book and scroll in his Etymologiae (VI.13): A codex is composed of many books; a book is of one scroll. It is called codex by way of metaphor from the trunks (codex) of trees or vines, as if it were a wooden stock, because it contains in itself a multitude of books, as it were of branches. Those who are reborn in Messiah will be in His image. Walking Torah Scrolls. 2Co 3:3 it having been made plain that you are Christs letter, served by us, not having been inscribed by ink, but by the Spirit of the living God, not in tablets of stone, but in fleshly tablets of the heart.

The word for letter above is the Greek word Epistole (Epistle) which comes from the Hebrew word .In Hebrew means to gather and the letter tav means the cross/covenant. 2 Corinthians 3:3 describes the New covenant (Jeremiah 31:31; Hebrews 8:8; 10:16; Ezekiel 11:16-20; 36:26). Interestingly, comes from the root which literally means a walking man. It is translated as a sojourner, traveler, and as a stranger (Genesis 17:8; 47:9; Leviticus 25:23; Psalm 39:12; 1 Peter 2:11; 1:17; Hebrews 11:9, 13-16; 13:14). Interestingly, the word for ink in 2 Corinthians 3 is from the Greek word melan G3188 melan Thayer Definition: 1) ink Part of Speech: noun neuter A Related Word by Thayers/Strongs Number: from G3189 as noun This is the root word for melanin, that which is found in the skin which brings forth the various colors. Who is the one that writes on the hearts of the living epistles with the ink of the Spirit? Messiah, who is putting the Mark of YHWH on the foreheads of the righteous. Notice here that the man with the inkhorn is one among 7 Eze 9:2 And, behold, six men were coming from the way of the Upper Gate, which faces north. And each had his shattering weapon in his hand. And one man among them was clothed in linen, and an ink horn of a scribe at his loins. And they went in and stood beside the bronze altar. Eze 9:3 And the glory of the God of Israel had gone on, from on the cherub where it was on it, to the threshold of the house. And He called to the man clothed in linen with the ink horn of a scribe at his loins. Eze 9:4 And YHWH said to him, Pass through in the midst of the city, in the midst of Jerusalem, and mark a mark on the foreheads of the men who are groaning and are mourning over all the abominations that are done in her midst. Here we see an inkhorn instead of a sword. This links with the armor of Elohim mentioned above as the Word is the Sword of the Spirit. (Ephesians 6:17; Hebrew 4:12). Going even deep into this connection between men and books is DNA.

Jacobs LadderThe ladder Gen 28:11 And he came on a place and stayed the night there, for the sun had gone. And he took stones of the place and placed them at his head; and he lay down in that place. Gen 28:12 And he dreamed. And, behold, a ladder was placed on the earth, its top reaching to the heavens. And, behold, the angels of God were going up and going down on it! Gen 28:17 And he was afraid, and said, How fearful is this place! This is nothing except the house of God, and this is the door to Heaven. Gen 28:18 And Jacob started up early in the morning and took the stone which he had placed at his head, and he placed it as a pillar; and he poured oil on the top of it. Gen 28:19 And he called the name of that place, The House of God {Bethel}. And yet the name of the city was at first Luz.

The ladder = Messiah Joh 1:51 And He says to him, Truly, truly, I say to you, From now on you will see Heaven opened, and the angels of God ascending and descending on the Son of Man. Messiah Yahshua = the Word Joh 1:1 In the beginning was the Word, and the Word was with God, and the Word was God. DNA Ladder

DNA & Languageclick here Nucleotide Character (Letter) Codon Letter Gene Word Operon Sentence Regulon Paragraph DNA Book Simplified it could be said Nucleotide bases Letters Codons Words

Genes Sentences Book DNA DNA is a message from Elohim. The DNA molecule is just the carrier. Similar to the Torah. The Torah is YHWHthe scrolls and books on which it is written is the carrier. This is further seen in the epigenome. The Epigenome tells the cell how to translate the DNA code. All of the parts of our bodies have the same genetic code, it is the Epigenome that tells whether the cell is going to be a skin, hair, eye etc cell. This corresponds to the Holy Spirit. The Scriptures can be read by anyone yet it is only through the Holy Spirit that one can understand and see the image of Elohim. His Image is not seen through signs and symbols created by man, but only through the Holy Scriptures. Messiah, who is the Word, is the only Image of YHWH. The religious symbols carved out by man are counterfeits. Heb 1:1 In many ways and in various ways of old, God spoke to the fathers in the prophets; Heb 1:2 in these last days He spoke to us in the Son, whom He appointed heir of all; through whom He indeed made the ages; Heb 1:3 who being the shining splendor of His glory, and the express image of His essence, and upholding all things by the Word of His power, having made purification of our sins through Himself, He sat down on the right of the Majesty on high, Psa. 110:1 Express image in the above verse comes from the following Greek word: G5481 charakter Thayer Definition: 1) the instrument used for engraving or carving 2) the mark stamped upon that instrument or wrought out on it 2a) a mark or figure burned in (Lev_13:28) or stamped on, an impression 2b) the exact expression (the image) of any person or thing, marked likeness, precise reproduction in every respect, i.e facsimile Part of Speech: noun masculine A Related Word by Thayers/Strongs Number: from the same as G5482 As can be seen in part 1click here, this word traces back to the word for the mark in Revelation 13. Charakter comes from charax which is used in the Septuagint to translate multiple words, one of which is highly significant in connection with Jacobs ladder, the pillar & image. charax H4674 mutstsav

As explained in part 1click here, the mark is associated with an image & a garrison. It was at Bethel (House of God) that Jacob anointed the pillar where the ladder to heaven was seen (Genesis 2812-19):.

Jacobs pillar is connected with the ladder to Heaven. Messiah applies this to Himself (John 1:51). The ladder also points to DNA within our bodies which is the word that creates our bodies. Messiah is the Word made flesh who is the olive tree/tree of lifeclick here which we can be grafted into through faith. He is the body, we are members of that body through faith. He is the Temple, we are the stones of the building by faith. Satan seeks to be like the Most High {Isaiah 14} and is the great counterfeiterclick here. Hence, he wants a false Olive tree/tree of knowledge of good and evil. He wants a false temple. A false body. A corrupted body. A false Israel. A corruption of DNA/the word. As George Williams puts it: The gene is a package of information, not an object. The pattern of base pairs in a DNA molecule specifies the gene. But the DNA molecule is the medium, its not the message The DNA molecule is the instruction manual for the forming of amino acids which are made are the structural elements of proteins that turn into the biochemical units that drive all biological processes. There are only 22 amino acids found in proteins. Certain proteins are called enzymes. They are catalysts (agents that are necessary for a reaction to occur but are not themselves changed in the process); others are called structural proteins which help to build cells and tissues. If DNA can be thought of as the language of life, then the four bases can be seen as letters and the codons as arrangements of letters, or words. But like English, DNAs language is more than words. Some codons function as punctuation marks, containing instructions to stop or start manufacturing a protein. This chemically simple yet stunningly complex DNA molecule dictates not only what proteins the organism will be made of, but how these proteins are to be arranged. We have seen that one codon contains the instructions for one amino acid, and that sequences of codons specify the production of proteins. Groups of codons that have been arranged in grammatically correct sentences to form specific proteins are called genes. DNA contains all the information needed to perpetuate life. This information builds in complexity from nucleotides to codons to genes, ultimately giving the complete text to form the body. The word sign/symbol traces back to the Greek word sememe (smallest part of a word) which traces back further to semen which means seed in Latin. The smallest part of a word is called Sememe from same root as Semen (seed/DNA). root sem=sign in Greek (semiology=study of signs) English word seed is from Hebrew word sod (mystery/secret). Hebrew word for sign is ,which is the same word for letter(s) in Hebrew. ot=aleph vav tav also translated as a miracle from the root aleph tav. As seen in part 1click here, the word is the same word translated as mark. Again we see that language (words) are comparable to signs/symbols and DNA. Rev 1:1 A Revelation of Jesus Christ, which God gave to Him to show to His slaves things which must occur quickly. And He signified (Greek semaino=signed) by sending through His angel to His slave, John, Exo 18:20 And you warn them as to the statutes and the laws, and make known (Greek semaino = Hebrew yada*)to them the way in which they should walk, and the work which they should do.

*This word means to know intimately, as in a man knowing his wife. Here we see that the word semaino (sign in Greek) is associated with procreation. When a man and woman bring forth a child it is through their combination of DNA that the child gets its image. Blood (DNA) =image, resemblance

In Isaiah 14, Lucifer is described as desiring to be like the Most High. This word like is the same word above, damah. Heb 3:14 For we have become partakers* of Christ, if truly we hold the beginning of the assurance firm to the end; The word partakers here is metochos. This is used to translate three words in the Septuagint. One is bachar which means chosen. This is the true definition of the chosen people. For the connection to the mark see part 11 on Zionismclick here. The second word is chaber. This is the word for friend or companion as those who are joined to each other. This is the word used for the joining together of the Tabernacle which is a picture of the body of Messiah. The third word used is damim which comes from the above word dam (blood). First the natural, then the spiritual 1Co 15:44 It is sown a natural body, it is raised a spiritual body; there is a natural body, and there is a spiritual body. 1Co 15:45 So also it has been written, The first man, Adam, became a living soul; the last Adam a life-giving Spirit. Gen. 2:7 1Co 15:46 But not the spiritual first, but the natural; afterward the spiritual. 1Co 15:47 The first man was out of earth, earthy. The second Man was the Lord out of Heaven. Gen. 2:7 1Co 15:48 Such as is the earthy man, such also are the earthy ones. And such as is the heavenly Man, such also are the heavenly ones. 1Co 15:49 And as we bore the image of the earthy man, we shall also bear the image of the heavenly Man. DNA is a picture of the Word in the natural. The Tabernacle = our bodies. 2Co 6:16 And what agreement hath the temple of God with idols? for ye are the temple of the living God; as God hath said, I will dwell in them, and walk in them; and I will be their God, and they shall be my people. 1Co 3:16 Know ye not that ye are the temple of God, and that the Spirit of God dwelleth in you? 1Co 3:17 If any man defile the temple of God, him shall God destroy; for the temple of God is holy, which temple ye are.

Joh 2:19 Jesus said to them, Destroy this sanctuary, and in three days I will raise it up. Joh 2:20 Then the Jews said, This sanctuary was forty six years being built, and do You raise it up in three days? Joh 2:21 But He spoke about the sanctuary of His body. The Temple/Tabernacle = the Body Exo 25:8 And let them make a sanctuary for Me, that I may dwell in their midst. 2Co 6:16 And what agreement hath the temple of God with idols? for ye are the temple of the living God; as God hath said, I will dwell in them, and walk in them; and I will be their God, and they shall be my people. 1Co 3:16 Know ye not that ye are the temple of God, and that the Spirit of God dwelleth in you?

The body = the Tabernacle. The Holy of Holies =the cell. The ark of the covenant = the nucleus of the cell. The Word was placed inside the ark, DNA is inside the nucleus. Man was created in the image of Elohim. Specifically, believers in Yahshua are created in His image and are now sons of ElohimClick Here. Satan seeks to counterfeit this by creating people in his image. The mixture of the sons of God and the daughters of men. The mark of YHWH is His Word. The mark of the beast is a counterfeit word Psa 139:16 Your eyes saw my embryo; and in Your book all my members were written the days they were formed, and not one was yet among them. The adversarys desire is always to enter YHWHs secret place, hidden placeHis Temple. Eze 7:22 I also will turn My face from them, and they shall defile My hidden (KJV secret) place. And violent ones shall enter into it and defile it. The Holy of Holies contained the ark of the covenant which had the Word within. Our cells contain our DNA which is a physical picture of that Word. The womb is secret Psa 139:15 My bones were not hidden from You when I was made in secret; when I was woven* in the depths of the earth. * raqamthis words means fashion, needlework or twisted threads (DNA). Psa 139:16 Your eyes saw my embryo; and in Your book all my members were written the

days they were formed, and not one was yet among them. Psa 139:17 And how precious are Your thoughts to me, O God! How great is the sum of them! The Olive tree = His Body = the Pillar/Bethel Romans 11:16 the Root of the Olive Tree = Messiah Rom 11:16 Now if the firstfruit is holy, so also the lump. And if the root is holy, so also the branches. Isa 6:13 But yet in it shall be a tenth, and it shall return, and shall be eaten: as a teil tree, and as an oak, whose substance{H4678matstsebeth a monumental stone; also the stock of a tree: pillar, substance.} is in them, when they cast their leaves: so the holy seed(Gal 3:16) shall be the substance(H4678 ROOT) thereof. ROOT=MATSTSEBETH = PILLAR Gen 28:10 And Jacob went out from Beersheba, and went toward Haran. Gen 28:11 And he lighted upon a certain place, and tarried there all night, because the sun was set; and he took of the stones of that place, and put them for his pillows, and lay down in that place to sleep. Gen 28:12 And he dreamed, and behold a ladder set up on the earth, and the top of it reached to heaven: and behold the angels of God ascending and descending on it. Gen 28:16 And Jacob awaked out of his sleep, and he said, Surely the LORD is in this place; and I knew it not. Gen 28:17 And he was afraid, and said, How dreadful is this place! this is none other but the house of God, and this is the gate of heaven. Gen 28:18 And Jacob rose up early in the morning, and took the stone that he had put for his pillows, and set it up for a pillar{H4678 matstsebeth}, and poured oil upon the top of it. Gen 28:19 And he called the name of that place Bethel {H1008 house of God}:: but the name of that city was called Luz* at the first. Gen 28:20 And Jacob vowed a vow, saying, If God will be with me, and will keep me in this way that I go, and will give me bread to eat, and raiment to put on, Gen 28:21 So that I come again to my fathers house in peace; then shall the LORD be my God: Gen 28:22 And this stone, which I have set for a pillar, shall be Gods house: and of all that thou shalt give me I will surely give the tenth {Isaiah 6:13} unto thee. *Luz is linked to the spinal column, as mentioned above in connection with Kundalini. In My Flesh I see God pg 179 Relates the Midrash: The Roman emperor Hadrian once asked Rabbi Yehoshua ben Chananiah, From which part of the body will God make man sprout forth when the dead are revived? He replied, From the luz bone of the spinal column. Gen 35:14 And Jacob set up a pillar(H4678 matstsebeth) in the place where he talked with him, even a pillar of stone: and he poured a drink offering thereon, and he poured oil thereon. Gen 35:15 And Jacob called the name of the place where God spake with him, Bethel{H1008 beythel house of God} Mat 16:18 And I say also unto thee, That thou art Peter, and upon this rock I will build my church; and the gates of hell shall not prevail against it. 1Ti 3:15 But if I tarry long, that thou mayest know how thou oughtest to behave thyself in the house of God, which is the church of the living God, the pillar and ground of the truth.

Eph 2:19 Now therefore ye are no more strangers and foreigners, but fellowcitizens with the saints, and of the household of God; Eph 2:20 And are built upon the foundation of the apostles and prophets, Jesus Christ himself being the chief corner stone; Eph 2:21 In whom all the building fitly framed together groweth unto an holy temple in the Lord: Eph 2:22 In whom ye also are builded together for an habitation of God through the Spirit. This is interesting to note. Jacobs pillar is connected with the ladder to Heaven. Messiah applies this to Himself. The ladder also points to DNA within our bodies which is the word that creates our bodies. Messiah is the Word made flesh who is the olive tree/tree of life which we can be grafted into through faith. He is the body, we are members of that body through faith. He is the Temple, we are the stones of the building by faith. Satan seeks to be like the Most High {Isaiah 14} and is the great counterfeiter. Hence, he wants a false Olive tree/tree of knowledge of good and evil. He wants a false temple. A false body. A corrupted body. A false Israel. A corruption of DNA/the word. Going back to Genesis 28 and the word matstsebeth, it is interesting to note that this word further connects to the Tree of Life through Isaiah 6:13. Isaiah 6:13 is referring to the root of the Olive tree of Yisrael, who is Messiahclick here. Rom 11:16 For if the firstfruit (1Cor 15:52) be holy, the lump is also holy: and if the root (Isa 6:13; Gal 3:16) be holy, so are the branches (Joh 15:5).

Trees & MenThe Hebrew word for tree is:

The elders/mature are likened to trees.

Who is our Counselor? Isa 9:6 For a Child is born; to us a Son is given; and the government is on His shoulder; and His name is called Wonderful, Counselor, The Mighty God, The Everlasting Father, The Prince of Peace. The same word for counselor is the same word for spine

The English word spine comes from the Latin word Spica

Spica points directly to the Messiah as seen in the constellation of Virgo. In the hand of the Virgin is a sheaf of wheat with 5 stars. A virgin (Is. 7:14) holding a branch (Jer. 23:5-6) and an ear of corn. Corn = seed (Latin Spica, the modern name of this bright star. Old name was Arabic Al Zimach seed). Star Zavijaveh means gloriously beautiful (Is. 4:2). Zimach in Arabic refers back to the Hebrew tsemach, seen above, which is used 5 times in reference to the Messiah. The 33 bones in the human spine correspond to the 33 years of the life of Messiah. The link between the back and Messiah is further seen in Exodus 33 where Moshe is shown the glory of YHWH, specifically mentioning His back. Exo 33:22 And as My glory is passing it will be that I will put you in a cleft of the rock; and I will cover My hand over you during My passing. Exo 33:23 And I will remove My hand, and you shall see My back; but My face cannot be seen. Trees Books The English word book comes from the Old English boc which derives from the Germanic root bok which is a cognate of beech. Beech was a common writing material in Germanic societies before the development of paper. A single sheet within a book is called a leaf. Each side of the leaf is called a page.

A folio has similar meaning

Papyrus, a thick paper-like material made by weaving the stems of the papyrus plant, then pounding the woven sheet with a hammer-like tool.

As seen above, Exodus 2:2 speaks of the papyrus basket/ark that Moshe was placed in at the Nile Parchment, papyrus connection - hammering out Interestingly, the word for parchment is used in the New Testament (2 Timothy 4:13) as a translation of the Greek word membrane. Whitakers Latin Dictionary

Membrana, Membranae N11Fmembrane; skin; parchment; Thin skin, film membrane. The skin of a snake or the skin prepared to write on a parchment like a scroll. As seen in previous studiesclick hereclick here , the heavens were hammered out and likened to a scroll. Recent scientific theories liken the universe to a membrane as well. It is believed that our bodies are being held together by a membrane known as laminin as well. Papyrus sheets were glued together to form a scroll. Tree bark such as lime (Latin liber). Lime is an altered form of Middle English lind, in the 16th century also line, from Old English feminine lind or linde, Proto-Germanic *lend, cognate to Latin lentus flexible and Sanskrit lat liana. Within Germanic languages, English lithe, German lind lenient, yielding are from the same root. Linden was originally the adjective, made from lime-wood (equivalent to wooden), from the late 16th century linden was also used as a noun, probably influenced by translations of German romance, as an adoption of Linden, the plural of German Linde.[1] Neither the name nor the tree is related to the citrus fruit called lime (Citrus aurantifolia, family Rutaceae). The Linden tree in Scripture. The following passage of Scripture is speaking of the remnant of Yisrael, the olive tree who are in the image and likeness of Messiah. King James Version Isa 6:13 But yet in it shall be a tenth, and it shall return, and shall be eaten: as a teil tree (elah), and as an oak (allon), whose substance (matstsebeth) is in them, when they cast (shalakh from shel mentioned above) their leaves: so the holy seed shall be the substance (matstsebeth pillar,rootBethel)thereof. Keil & Delitszch commentary It shall happen as with the terebinth and oak. These trees were selected as illustrations, not only because they were so near akin to evergreens, and produced a similar impression, or because there were so many associations connected with them in the olden times of Israels history; but also because they formed such fitting symbols of Israel, on account of their peculiar facility for springing up again from the root (like the beech and nut, for example), even when they had been completely felled. As the forms yabbesheth (dryness), dalleketh (fever), avvereth (blindness), shachepheth (consumption), are used to denote certain qualities or states, and those for the most part faulty ones (Concord. p. 1350); so shalleceth here does not refer to the act itself of felling or casting away, but rather to the condition of a tree that has been hewn or thrown down; though not to the condition of the trunk as it lies prostrate upon the ground, but to that of the root, which is still left in the earth. Of this tree, that had been deprived of its trunk and crown, there was still a mazzebeth kindred form of mazzebah), i.e., a root-stump (truncus) fast in the ground. The tree was not yet entirely destroyed; the root-stump could shoot out and put forth branches again. And this would take place: the root-stump of the oak or terebinth, which was a symbol of Israel, was a holy seed. The root-stump was the remnant that had survived the judgment, and this remnant would become a seed, out of which a new Israel would spring up after the old had been destroyed (Matthew 3:10). Thus in a few weighty words is the way sketched out, which God would henceforth take with His people. The passage contains an outline of the history of Israel to the end of time. Israel as a nation was indestructible, by virtue of the

promise of God; but the mass of the people were doomed to destruction through the judicial sentence of God, and only a remnant, which would be converted, would perpetuate the nationality of Israel, and inherit the glorious future. This law of a blessing sunk in the depths of the curse actually inflicted, still prevails in the history of the Jews. The way of salvation is open to all. Individuals find it, and give us a presentiment of what might be and is to be; but the great mass are hopelessly lost, and only when they have been swept away will a holy seed, saved by the covenant-keeping God, grow up into a new and holy Israel, which, according to Isa_27:6, will fill the earth with its fruits, or, as the apostle expresses it in Rom_11:12, become the riches of the Gentiles. For more on this Olive Tree ; Netsarim Literal Version Isa 6:13 But yet a tenth shall be in it, and it shall return and be consumed like the terebinth and like the oak that in being felled yet has its stump (the holy seed is its stump). Treasury of Scripture Knowledge teil tree: The teil-tree is the linden or lime-tree, a species very common in Palestine; the leaf of which resembles that of the laurel, and its flower that of the olive. But the original ailah which our translators render the oak (but here distinguished from allon the oak) The word for teil tree/linden tree in Hebrew is elah which comes from the root el which is commonly translated as God.

The Scrolls were held together by lime/linden trees. This is seen in creation as well. It is Messiah who is holding all things together (Colossians 1:17). The Greek word used in Colossians 1:17 is sunistemi which translates back to the Hebrew word tseba. Tseba comes from the same root as matstsebah mentioned above, the House of El. Col 1:17 And He is before all things, and all things have subsisted (G4921 ) in Him. His Word is holding all things together. Interestingly, one of the Hebrew words for word is amar. What is the meaning of amar? Thoughts that are bound together. Amar comes from the following root word:

Liber In Latin Liber means a book, bark of a tree, treatise, letter from Latin, in original sense: tree bark] Liber is also a rare name for phloem

Phloem A tissue in vascular plants that conducts food from the leaves and other photosynthetic tissues to other plant parts. In vascular plants, phloem is the living tissue that carries organic nutrients (known as photosynthate), particularly sucrose, a sugar, to all parts of the plant where needed. In trees, the phloem is the innermost layer of the bark, hence the name, derived from the Greek word (phloos) bark. The phloem is concerned mainly with the transport of soluble organic material made during photosynthesis. This is called translocation. Interestingly, when looking at the cross section of a tree from the the tilia genus (such as the linden tree mentioned above), it is seen that it is divided into 7 sectionsjust like the Menorah

Interestingly, flax has this same division.

The word in Hebrew for flax links to the menorah as well. Flax was made into linen which then became wicks for lamps (menorot). Connecting flax to the current topic further, the root word for

linden comes from li which in the Indo-European language means flax. This would make *len (linden) an extension of the flax root meaning flexible as threads made of flax, then of rope or cord made of other materials, like the inner bark of the linden.

the Menorah = the Word = the Tree of Life = the Olive Tree = the Body of Messiah

Click picture for more details on how the Scriptures are in the form of a Menorah It is interesting to note as well, that the natural ecology of forests is divided into 7 sections. 1. The canopy 2. Low tree layer (dwarf fruit trees) 3. Shrubs 4. Herbaceous 5. Rhizosphere (root crops) 6. Soil surface (cover crops) 7. Vertical layer (climbers, vines)

The more diverse and complex an ecosystem is, the more stable it is. Rom 12:4 For even as we have many members in one body, but all members do not have the same function, Rom 12:5 so we the many are one body in Christ, and each one members of one another, Back to the word Liber Interestingly, If one looks at Latin versions of the TaNaKH, one will see that the 5 books of the Torah are headed with only their names. Genesis, Exodus, Leviticus, Numeri, Deuteronicum. The books that follow always have the prefix of Liber, Liber Jehoshua, Liber Judicum etc.

The Torah is the root and the other books are the branches that carry the food. Messiah is the vine/root, His body are the branches Food in Hebrew is lechem (bread). Bread in Greek is artos which is used to translate numerous words in Hebrew. Lechem, dagan (grain/fish ie believers), challah (from root cholsand ie believers), and also pat.

Isa 8:18 Behold, I and the children (Messiah & His Body) whom YHWH has given to me are for signs and wonders (mophat) in Israel from YHWH of Hosts, who dwells in Mount Zion. Amazingly, the Latin word liber also means children liber N23MP children (pl.); (sg. VOC) child. Going back to the link between Liber & bread, the Scriptures liken the Word/Torah to bread (Deuteronomy 8:2-3; Matthew 4:2-4; John 6:30-63). Messiah equates the manna/bread from heaven with Himself in John 6. Manna is also referred to as dew in the TaNaKH (Exodus 16:1314; Numbers 11:9, Torah is likened to dew (Deuteronomy 32:2), YHWH is likened to dew (Hosea 14:5). Deu 8:3 And He has humbled you, and caused you to hunger, and caused you to eat the manna, which you had not known, and your fathers had not known, in order to cause you to know that man shall not live by bread alone, but man shall live by every Word that proceeds* from the mouth of YHWH. The word for proceed in Hebrew is motsa which means to spring forth or bud.

This word is related to the Hebrew word for Apostle (sholiach) which comes from the word shalach which means to send forth, as the shoots of a plant. The Hebrew word for table also comes from this root. On the table of shewbread/bread of presence in the Tabernacle/Temple there were 12 loaves of bread representing the 12 tribes. It is the job of His branches, His apostles to take the bread of life to the world. This bread of life is His Word, the Messiah, His presence. The word Bible comes from papyrus The Greek word for papyrus as writing material (biblion) and book (biblos) come from the Phoenician port town Byblos, through which papyrus was exported to Greece.

From Greek we also derive the word tome (Greek: ), which originally meant a slice or piece and from there began to denote a roll of papyrus. Tomus was used by the Latins with exactly the same meaning as volumen which means a roll/scroll. The volume of the Scroll is written about Messiah Psa 40:7 Then said I, Lo, I come: in the volume of the book it is written of me, As seen above this verse is linked to the coming of the Messiah in a body. Here we see the human body linked with trees and the Word. There were two trees in the midst of the Garden. The tree of Life who is Messiah who is the Word made flesh. The tree of knowledge of good and evil who is the antichrist beast who is the word of lawlessness made flesh. Mankind has two choices. Life or death, blessing or cursing. Interestingly, roll(s) are mentioned 23 times in the Scriptures corresponding to the 23 chromosomes in the human body.

Chromosomes

In the egg cell of the woman is 22 autosomes and 1 sex chromosome. In the sperm cell of the man is 22 autosomes and 1 sex chromosomes. In order for life to be created, there needs to be 46 chromosomes. The Holy Scriptures are a combination of the Hebrew and Greek languages. The Hebrew language consists of 22 letters and the Greek language consists of 24. The total is 46.

The sperm cell in and of itself cannot produce life and neither can the egg cell of the woman. These must be combined. The seed is the Word (Luke 8:11). The seed is carried by the man. Here is the picture of the Letter of law which is dead in and of itself (2 Corinthians 3:6). It is only when the Spirit (ruach in Hebrew is a feminine word) is added to the Word that life is brought forth. The egg cell is carried by the woman but without the seed (the Word) it does not bring forth life either. The Hebrew word for egg is betsah which traces back to the word for house/temple beyit. Without the Word in our bodies (temples) we are dead. We must be born again through the incorruptible seed of the Word of Elohim (1Peter 1:23; Titus 3:5; 1John 3:9; James 1:18). This is the fruit of the Tree of Life, whose seed is in itself. Chromosomes are in the shape of an x or cross. The male carries the X and Y chromosome, the female carries only the X. The letter X is the Hebrew letter Tav which means a covenant or mark. The letter Y is the Hebrew letter vav. is the Hebrew word for mark as seen above. Again the link between genetics and the mark is seen. Etymology Chromosome comes from the Greek word khroma meaning color/skin and soma meaning body. Chromosomes were given this name because of the ability to be stained underneath a microscope. In Hebrew this is qaram which is a switching for raqam which is a word that means twisting of thread (DNA). Qaram means a covering as seen in Ezekiel 37:6 Eze 37:6 and I will put on you sinews and will bring flesh on you and spread skin over you and put breath in you, and you shall live. And you shall know that I am YHWH. Ezekiel 37 is an interesting connection to the above discussion on the seed and the egg. This chapter is speaking of the dry bones which are brought back together but dont have life until the wind (ruach-spirit) is breathed into them. Bones are from the same word as trees (which makes another interesting connection in the same chapter on the two sticks) which as seen above is linked to the Word. The Word is dead without the Spirit. Going back to the etymology of chromosome

Chromosome traces back to the Hebrew word qaram. Qaram means to spread or lay over. It comes from the root which means a gathering of heads/people. This word is associated with gatherings of people such as cities, assemblies etc. It is the word used for a gathering of believers to read the Word and worship the most High. To qara call upon His Name. This is the root of the word miqra or miqra qodesh speaking of the gatherings at the Sabbaths spoken of in Leviticus 23. These feasts are commonly referred to as statutes in the Scriptures which comes from the word chuq. Chuq has an interesting connection to chromosomes. The word chuq literally means to divide/separate and then come together. Interestingly, chromosomes are only visible during the dividing of a cell which in reality is a multiplying of the cell. Messiah came to divide Israel (Matthew 10:35; Luke 3:7-9) but in reality brought more people unto Himself through the cross (x in the same shape as the chromosome) (John 10:16; 12:32). 1Co 1:18 For the Word of the cross is foolishness to those being lost, but to us being saved, it is the power of God. 1Co 1:23 we, on the other hand, preach Christ crucified (truly an offense to Jews, and foolishness to Greeks), 1Co 1:24 but to the called out ones, both to Jews and to Greeks, Christ is the power of God and the wisdom of God; he Greek word kroma, means surface of body, skin, skin color, color and is related to the word grit. Grit has the meaning of tiny particles of crushed rock, sand {sand is an amazing shadow picture of Messiah & His bodyclick here}, dust, gravel. This has interesting parallels in regards to man coming from the dust/earth. On one level this is speaking of the elements of the earth from whence Adam was made but here it is seen in relation to the chromosomes. The God Code Gregg Braden pg 84 Through studies such as the IGY (International Geophysical Year), we now know that relatively few elements compose most of the earths outer crust, including the layers beneath the oceans. Silicon, oxygen, hydrogen, and aluminum amount for more than 90 percent of the composition of this layers. Of even greater significance is the discovery that two of those four elements hydrogen and oxygen also account for more than 99 percent of our bodies as well! Man is further linked to the earth in the word for man (adam), and the word for ground (adamah).

Adam/adamah comes from the root:

From one blood all mankind comes forth. In Adam, all the colors of the dust dwelled. Act 17:26 And He made every nation of men of one blood, to live on all the face of the earth, ordaining fore-appointed seasons and boundaries of their dwelling, Act 17:27 to seek the Lord, if perhaps they might feel after Him and might find Him, though indeed He not being far from each one of us. Act 17:28 For in Him we live and move and exist, as also some of the poets among you have said, For we are also His offspring. In the 2nd Adam (1 Corinthians 15:47), there is no difference in color, race, etc. Col 3:10 and having put on the new, having been renewed in full knowledge according to the image of the One creating him, Col 3:11 where there is no Greek and Jew, circumcision and uncircumcision, foreigner, Scythian, slave or freeman, but Christ is all things and in all. Col 3:12 Therefore, as elect ones of God, holy and beloved, put on a heart of compassions, kindness, humility, meekness, long-suffering, Rom 10:12 For there is no difference both of Jew and of Greek, for the same Lord of all is rich toward all the ones calling on Him. Gal 3:26 for you are all sons of God through faith in Christ Jesus. Gal 3:27 For as many as were baptized into Christ, you put on Christ. Gal 3:28 There cannot be Jew nor Greek, there is no slave nor freeman, there is no male and female; for you are all one in Christ Jesus. Gal 3:29 And if you are of Christ, then you are a seed of Abraham, even heirs according to promise.

Interestingly, the word for color in Hebrew is ,which has a similar meaning as ,the word for baptism. To dip the finger (especially in blood) to color something.

4 Skin colors 4 Soil Colors The four skin tones, pink, yellow, olive and brown, correspond to the 4 colors found in soil. Soil is found in white, red, yellow and brown colors. Adam, who came from the ground (adamah) was the father of all mankind. Later this was replayed in Noah. Gen 9:18 And the sons of Noah that went out of the ark were Shem, Ham, and Japheth. And Ham is the father of Canaan. Gen 9:19 These are the three sons of Noah, and the whole earth was overspread from them. Gen 9:20 And Noah, a man of the ground (adamah), began and planted a vineyard. From Shem, Ham and Japheth the world was overspread/scattered into 70 nations (Genesis 10). These 70 nations were divided according to the children of Yisrael (Deuteronomy 32:8). Deu 32:8 when the Most High divided to the nations their inheritance; when He separated the sons of Adam, He set up the bounds of the peoples, according to the number of the sons of Israel. Amazingly, the taxonomy of soil divides the types of dirt into twelve. Alfisols, Andisols, Aridsols, Entisols, Gelisols, Histosols, Inceptisols, Mollisols, Oxisols, Spodosols, Ultisols, Vertisols. Yisrael is a coat of many colors personified by the coat of Joseph. Gen 37:3 Now Israel loved Joseph more than all his children, because he was the son of his old age: and he made him a coat of many colours. colours: Kethoneth passim, a coat made of stripes of different coloured cloth. The Scriptures, as well as tradition speaks of Yisrael having different shades of skin color. Genesis Rabah 98:5 says that Simeon and Levi were light colored types Mishna Negaim 2:1 says that Israelites (in this case Jews of Judah) are mainly of an intermediate type color being neither black (Cushi) or white (Germani) Genesis Rabah 86:3 says that Joseph was Germani Talmud Sota 36 describes him as having a face like a pink rose Esau was ruddy/red/blonde Gen 25:25 as was David 1 Samuel 16:2 Laban means white or blonde The Shepherdess in Song of Solomon was black and comely Son 1:6 Interestingly, color further connects to Israel in the numbers of 7 and 12. There are 7 colors in the color spectrum which corresponds to the 7 branches of the Menorah. The Menorah is a picture of the body of Messiah{Revelation 1:20; John 15:5}. The 7 colors then expand into 12 color hues of the color wheel. Biblically, race is not defined by color. Race is defined by what nature you are. You are either in Messiah or you are not. You are either for Him or against Him. You are either the seed of the woman or the seed of the serpent. As seen above, the word for color in Hebrew has the same

meaning as being baptised and becoming anew. You are either sprinkled by the blood of Messiah (Isaiah 52:15; Hebrew 10:22) or you are still covered in the garments of sinful flesh. 1Pe 2:9 But you are an elect race, a royal priesthood, a holy nation, a people for possession, so that you may openly speak of the virtues of the One who has called you out of darkness into His marvelous light; LXX-Ex. 23:22; MT-Ex. 19:5, 6 In Hebrew the word for race is ,which means the stock/root of a tree. H1503 geza BDB Definition: 1) stem, trunk, stock (of trees) Who is the root of Yisrael? Messiah Yahshua Rom 11:16 For if the firstfruit (1Cor 15:52 -Messiah) be holy, the lump is also holy: and if the root (Isa 6:13; Gal 3:16 Messiah) be holy, so are the branches (Joh 15:5). Isa 11:1 And there shall come forth a rod out of the stem (H1503 geza)of Jesse, and a Branch{H5342 netser*} shall grow (parah -bear fruit) out of his roots: *Netser is the origin of the name Christian.Netsarim What is the counterfeit? Zionismclick here The other root spoken of in Scripture is the root of the serpent Isa 14:29 Do not rejoice, O Philistia, all of you, for the rod of your striking is broken, because a viper comes forth from the root of a snake, and his fruit shall be a fiery flying serpent. Notice that from the root of a snake comes for the fruit of a serpent. Above, from the root of Jesse comes forth the fruit of the Spirit. This is the true meaning of race. The seed of the woman or the seed of the serpent. Ye shall know them by their fruits. The second part of the word chromosome comes from the Greek word soma, , which means body and is used in various applications (body of man, animals, planets, society, church, etc.). This traces back to multiple Hebrew words which are significant to the current study. In Exodus 24:10 the word body is translated from the Hebrew word etsem which is the word for bone coming from the root etz meaning a tree. The connection to the Tree of Life is obvious. In Judges 8:30 the Hebrew word yarekh is translated as body. Yarekh has the meaning of a shaft as seen in the main trunk of the Menorah in the Temple. This is yet another picture of the Tree of Life and the Messiah. Here then we see the picture of the chromosome being a gathering of people to form a body. The chromosome is the body which holds the DNA which consists of the individual parts which make up the whole. The body of Messiah works the same way. Each individual has a particular purpose to fulfill the whole. This is pictured in the Tabernacle whose individual parts combined to make ONE building (Exodus 36:13). This is seen in the Word which contains many different letters and words to make ONE message.

The Cross

The chromosome is seen in the image of the crossclick here. The cross symbol is a mark of the beast, yet the mark that YHWH places on His faithful believers is in the same shape (Ezekiel 9:4). Herein lies the summation of this entire study. We can be a part of the body of Messiah, who is the Word or we can choose to be a part of the counterfeit body of the beast who is lawlessness. The Tree of Life or the tree of knowledge of good and evil.

CellThe DNA molecule resides in the nucleus of our cells. Each cells in our bodies is a picture of the Tabernacle/Temple of YHWH with the nucleus representing the Holy Place. The DNA in the nucleus of the cell is pictured by the Torah in/beside the ark of the covenant. The English word cell traces back to the Hebrew word kal which means to complete. This is also the root of the word kalah which means a bride. The cell is a picture of the Tabernacle/Body of Messiah/bride. The Hebrew word for cell is ta (Eze 40:7 chamber)

Tav aleph is related to the word tav ( tav=crosschromosome) and aleph tav and means a mark/boundary.

tav aleph relates to the word tar which means the mark of man or the border/outline.

From this root we get taar and toar. These words mean form, outline or border. This is an important connection to see in that the mark of the beast versus the mark of YHWH ultimately reflects whose image/form you are in.

This connection between the mark and the image/form/outline/shadow picture of YHWH Yahshua versus the antichrist is further seen in that the word Torah comes from this same root.

We can have the mark of YHWH and be in His image by walking in His Torah and letting Messiah live through us (Galatians 2:20), or we can have the mark of the beast and be in the image of satan by walking in his torah which is lawlessness (Ephesians 2:2-3Isaiah 30:8-11; 1 Peter 2:8). We can choose the tree of life or the tree of knowledge. The Light of the Word or the false light which is in reality darkness (Matthew 6:23). Cells, bride & bread As seen in Shadows of Messiah Alphabetclick here the Hebrew Aleph Bet is likened unto manna/bread. Bread is linked to the mark as seen in part 1click here (Exodus 13:9; 1 Corinthians 5:7-Exodus 12:13) and will be discussed in more detail below in the section on gold. = -Completion Col