legacy event one act play team wins...
TRANSCRIPT
All Saints Episcopal School 3222 103rd St. Lubbock, TX 79423 806.745.7701 fax 748.0454 allsaintsschool.org
December 2, 2015
DID YOU KNOW? Car Raffle Tickets are still available. Contact Shirley in the office for more today!
LEGACY EVENTTICKETS, TICKETS, TICKETS ... We need tickets SOLD and turned in! Remember the party is THIS Sunday, and we anticipate a great turn out from our All Saints community as well as the Lubbock community! Legacy will be held at the McKenzie Merket Alumni Center at Texas Tech University.
Selling tickets to others is a great way to cover the extra expenses of educat-ing your child. Thank you to everyone who has helped to sell tickets.
Have you seen the Mercedes GLA250? This is the car YOU can win on Sun-day! Remember, each raffle ticket provides one opportunity in the raffle and admits two people to the party.
Wait until you see all of the awesome live and silent auctions items! Just to whet your whistle, items in this year’s auction include: a fabulous trip to Napa Valley, a Premier Cinema Stars Wars: The Force Awakens movie and dinner party, another All Saints puppy, and as usual, much, much more! Check the school’s Facebook and Instagram accounts for item updates. Fol-low along using the hashtag #asesLegacy2015.
Bottom line: buy or sell your tickets, invite your friends, and come to a great party this Sunday, December 6, from 6-9pm. BONUS: There will be three “tuition” drawings at the party. Each drawing is for $1,000 towards 2016-2017 tuition. You must be present to win the tuition drawings!
MARK YOUR CALENDARS FOR THIS SUNDAY, DECEMBER 6!
What a great time—what a great school!
ONE ACT PLAY TEAM WINS STATECongratulations to the high school STATE CHAMPION OAP Team! Turn to page fi ve for more details on this historic win.
VARSITY VOLLEYBALL COMPETES AT STATEIn its second year of compe-tition, our high school Var-sity Volleyball team makes it to the state fi nals. Page seven provides more details on their strong season.
U-CAN-SHARE UpdateThe drive will end on De-cember 10. At this point, more than 5,000 cans have been donated, making us al-most halfway to our goal of 12,000 cans. Please do all you can to help the school fi nish strong. Thank you all for all your contributions to this worthy cause.
LEGACY RESERVED TABLE BIDDING LIVEGo to the school’s Face-book page today to bid on a reserved table for eight for Legacy. Also includes Limo service for eight, and a bottle of wine at the table! Bidding closes Friday at noon.
CALENDAR OF EVENTSThursday, Dec. 3 8:00am
5:45pm6:15pm6:45pm
TBATBATBA
Parent Group Meeting, Board Room AnnexPreschool and Pre-Kindergarten Carol at Village Shopping CenterKindergarten, Pre-First and First grade Carol at Village Shopping Ctr.8th grade and HS Choir Carol at Village Shopping Center7th and 8th grade All Saints Girls BB TournamentVarsity Boys BB Tournament in LamesaVarsity Girls BB Tournament in Anton
Friday, Dec. 4 9-11:30am9:30am
First grade field trip, TTU International Cultural CenterHigh School Blessing of the Altar with Bishop Mayer, Kirby Commons7th and 8th grade All Saints Girls BB Tournament continuesVarsity Boys and Girls BB Tournaments continueHS Debate Competition
Saturday, Dec. 5 7th and 8th grade All Saints Girls BB Tournament continues Varsity Boys and Girls BB Tournaments continueHS Debate Competition continues
Sunday, Dec. 6 6:00-9:00pm Legacy EventMonday, Dec. 7 4:00/5:00/6:00/7:00pm 7th Girls/7th Boys/8th Girls/8th Boys BB at Christ the King
Tuesday, Dec. 8 12:30-1:30pm6:00/7:30pm
All Saints Prayer Moms Group, Board Room AnnexV Girls and Boys Basketball vs PCA
Wednesday, Dec. 9 1:15-2:15pm HS Toys for Tots Advent Project
Thursday, Dec. 10
3;00pm1:20-2:30pm6:00-8:00pm
LAST DAY OF U-CAN-SHARE Food Drive7th and 8th grade All Saints Boys BB TournamentHS Mock Trial Leaves for DallasHS Choir performs off campusHour of Code
Friday, Dec. 11 7th and 8th grade All Saints Boys BB TournamentVarsity Boys compete in the Floydada BB TournamentMock Trial Competes in DallasFourth grade celebrates St. Lucia Day
Saturday, Dec. 12 7th and 8th grade All Saints Boys BB TournamentVarsity Boys BB at the Floydada TournamentMock Trial Competes in Dallas
Monday, Dec. 14 4:00/5:00/6:30pm4:00/5:00/6:00/7:00pm
JV Boys/V Girls/V Boys Basketball @ Amarillo Ascension7th Girls/7th Boys/8th Girls/8th Boys BB vs. Kingdom Prep
Tuesday, Dec. 15 1:15pm5:00pm
HS Chemistry Club Guest SpeakersBoard of Trustees meeting, Board Room Annex
LOOKING AHEADDec. 16 Family Eat Out Night at Back 40 GrillDec. 17 MS Girls and Boys BB @ SouthcrestDec. 18 DRESS UNIFORM Advent Festival of Lessons and Carols All School dismisses at Noon JV Boys/V Girls/V Boys BB @ Midland TrinityDec. 21-Jan. 4 Christmas/New Year’s Break - School is NOT in sessionDec. 21 JV Boys/V Girls/V Boys BB @ PCADec. 29-31 V Boys BB @ the AMBUCS Caprock Tourn.Jan. 2 JV Boys/V Girls/V Boys BB @ WF ChristianJan. 4 Faculty/Staff InserviceJan. 5 School resumes
Please note: When a game is listed as “vs.” it is a home game. When listed as “at” it is an away game.
Follow @GoAllSaintsPats on Twitter for the latest
in Patriot Athletics.
CongratulationsPatriot Artists
of the WeekLAUREN BRASHEAR
(1) - 11/16ZANE KILLIAN
(2) - 11/30
3
CHAPEL PARTICIPANTSDec 3 (Thurs) Dec 4 (Fri) Dec 7 (Mon) Dec 8 (Tues) Dec 9 (Wed)
Lesson Chloe Conover Diego Cervera Walker Blue Nicholas Blevins Abigail BarrittPsalm Portia Clary Sara Carothers Sadie Blue Lauren Bayouth Regan Andrews
Acolytes Paden KeithBilal Kharrat
Razanne Malki Maddie Matthews
Colby Matzner Tanusha Nath Rowe Osborne Joseph Paone
Emily PayneMadison Roberts
Scott SanfordBlake Sherwood
Isabella Stallcup Ripon Tarafdar
Lee Taylor Rodney Thomas
Avery Thompson Sophie Thwaits
Daniel Vermillion Kate White
Dec 10 (Thurs) Dec 11 (Fri) Dec 14 (Mon) Dec 15 (Tues) Dec 16 (Wed)Lesson Ella Scolaro Jack Robinson Jacob Rector Olivia Needham Caden MeadPsalm Reghan Rose Harry Roberts Brooke Payne Brown Mercer JJ Keyton
Acolytes Jack RobinsonHarry RobertsJacob RectorBrooke Payne
Olivia NeedhamBrown MercerCaden Mead
JJ Keyton
Kaden JimenezLandon Hutcheson
Jacque HunterEmme Hocker
Kennedy FranklinRohan Felton
Jayci DonaldsonLuke D’Alise
Peyton CrosbyCampbell CarperCalvin CarpenterSavannah Busse
Please remember, if your student is scheduled to acolyte, he or she needs to be in Jones Gym no later than 7:45 a.m. on the morn-ing in which he/she is scheduled to serve. After 7:45 a.m., we find replacements as needed, in order to provide time to practice.
DID YOU KNOW? The All Saints campus resides on more than 50 acres of land donated by the Key family.
CHAPEL NOTES~Happy New Year!The season of Advent is upon us. It is the first season in the Church year, which is why it is time for Happy New Year greetings. Advent is a period of expectant waiting and preparation, and is a season that last four weeks, leading up to Christmas. For many, the weeks leading up to Christmas include a great deal of preparation: shopping, cooking, wrapping, and often, more shopping. It is easy to get caught up in the commercialized “get-get-get” mentality. For children, it is easy to focus on simply what they want to “get.” During this hustle and bustle, Advent has great purpose in giving us time to pause and reflect on the what should be a paramount focus, the joyful expectation of Christ’s coming!
At All Saints, we strive to focus at this time of year on the opportunities to share and to give of oneself to others. The prayers our students share in chapel are rarely about themselves. Their sense of compassion and concern for the community is immense. As we wrap up the U-Can-Share Food Drive next week, our students have heard much about the gift of giving. We move into Advent ready and excited to share through our grade-level service projects.
There are many ways to celebrate the Advent season at home. Consider incorporating an Advent wreath of candles at your dinner table. A new candle is lit each Sunday during the four weeks, and then the same candles are lit each meal during the week. An Advent calendar is a great way to track the days of the season. A unique and specialized Advent calendar that can be used in the home is a Jesse Tree, which begins with the prophecy from the book of Isaiah that “a shoot will spring forth from the stump of Jesse, and a branch out of his roots.”
This year at school we have a “traveling” nativity set. The nativity figures are separated, and they “journey” to Bethlehem during the season. For example, Mary and Joseph start at one end of the school and make their way a little closer each day to the stables (Jones Gym). The shepherd, his flock, as well as the wise men, “journey” at their own speeds at the appropriate times.
If you have any questions or would like more information on Advent traditions and bringing them into your home, please just ask. And you are invited to share in the Advent season with us during chapel at All Saints. There is always room for parents and friends!
Peace -Chaplain Paige +
4
TECHNICALLY SPEAKING with Dr. Penny CarpenterIt’s Science Fair time! Students in fourth to twelfth grade are eligible to present projects. Middle School fifth and sixth grade students are al-ready in full swing preparing projects. They are using the computer lab, laptops, and iPads to prepare. A variety of science probes are available for data collection if they meet the needs of the experiment. Mrs. Lutrick or Dr. Carpenter can help with the use of the school’s probeware: temperature probes, heart rate monitors, light sensors, motion detectors, and pH sensors. December is the month to conduct experiments and the local fair is scheduled for January. Qualifiers may advance to the South Plains Regional Science and Engineering Fair in February.
HOUR OF CODEThe Hour of Code is coming! On Thursday, December 10 the fifth grade will host an Hour of Code event beginning at 6:00pm in Kirby Commons. Bring your smartphone, iPad, or laptop and join the hands-on coding activities.
BOX TOP FINAL RESULTSThe SUPER SUCCESSFUL Fall Box Top competition ended with more than 8,000 Box tops collected (which means more than $800 dollars raised for our school)! The Box Top committee happily presented donut parties to the most Box Tops collected per student in each division: Kindergarten (PLC), 2nd grade (Lower School), 7th grade (Middle School) and Sophomores (High School). Once again the Patriot com-munity came through in amazing fashion to raise money for our school - a heartfelt thanks from your Box Top committee. Keep clipping! The Spring competition is right around the corner!
HIGH SCHOOL ACADEMIC AND DEBATE MEET NEWSHigh School students participated in the Texas Tech UIL Fall Fandango Academic Practice Meet on Satur-day, November 21. Senior Ben Tipton earned 3rd place in 12th grade Science resulting in 3rd place Science overall. He also earned 5th place in 12th grade mathematics resulting in 7th place Mathematics overall. Sophomore Sarah Going earned 6th place in 10th grade Number Sense. Freshman Myles Tipton earned 2nd place in 9th grade mathematics. Congratulations to these students.
On that same weekend, High School debate students participated in the West Texas A&M Guy Yates In-vitational Tournament. Senior Catherine Latour earned 2nd in extemporaneous commentary and 8th in impromptu. Senior Jack Brehmer placed 4th in extemporaneous commentary. Sophomore Ava Moranearned 8th in domestic extemporaneous speaking. Way to go, debaters!
Follow @AllSaintsSTEM on Twitter for the latest on Patriot Technology.
Don’t forget to use the hashtag#ASESPride
on all of your PatriotPosts!
2015-2016 Lunch TimesPS: 12-12:30 in PLCPre-K: 11:25-11:50K/P1: 11:30-12:00
1st & 2nd Grade: 11:45-12:152nd Grade: 11:45-12:153rd Grade: 12:50-1:154th Grade:12:50-1:15
Middle School: 12:27-1:07High School: 1:20-2:10
DID YOU KNOW? All Saints utilizes SMART Board technology in all four divisions in the school daily?
2016 Lun12-12:30200000000000000000000000000000000000000000000001616161616161661616161616161616161661161616161616161616161616166666616161611111611 LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLuuuuuuuuuuuuuuuuuuuuuuuu12 12222 3
Follow @AllSaintsSTEM
U-CAN-SHARE U-CAN-SHARE
Food drive Food drive ends on ends on
December 10!December 10!
welfth grade are eligible h d d l
y ur PatriotPost
adadaadadadadadadaaddddddddde
Posts!
5
DID YOU KNOW? Our student enrollment is expected to reach 477 in January. That’s a bunch of Patriots!
THEATER NEWSThe All Saints High School One Act Play defeated seven schools to win the 1A-2A TAPPS State Championship. Four cast members earned All-Star honors.
Students earning All Star honors are: senior Keely Umstot, All Star Cast; senior Matt Harper, All Star Crew; freshman Susannah Bumstead, All Star Cast; and sophomore Raymond Rider, Honorable Mention All Star Cast.
Paula Chanda is the director. Other cast members are: freshmen Abi Jordan, Meghan Mitchell, Kenyan Mortensen, Bri Sanchez, and Brooke Stevenson; soph-omores Joshua Duemer, Zac Paston, Mallory Staggs, and John Gamble Streit; and senior Alyssa Smith.
The cast performed the 40-minute one-act play, The Cau-casian Chalk Circle, written by Bertikt Brecht. The play is a parable about a Russian peasant girl who rescues a baby and becomes a better mother than its wealthy natu-ral parents. It is loosely based on the Biblical story of the Judgment of Solomon.
The contest requires all plays be performed in one act lasting no more than 40 minutes. Sixty percent of the scoring is based upon acting while 40 percent is judged on other elements like sets, costumes, and lighting.
Congratulations to Mrs. Chanda and the entire cast and crew for a job well done!
SECOND AND THIRD GRADE THANK YOUThank you to all of the parents who helped decorate and serve our Thanksgiving Feast.
TEACHER THANKSGIVING CLASS WISHESThe Parent Group Teacher Wishes campaign is almost over! Don’t forget to grab a sticky note so we may fulfill faculty classroom wishes. Our teachers have written on sticky notes an item or two that, if re-ceived, would enhance their classroom teaching. The Giving Boards are separated by divisions and located throughout the school. Please take a moment to come in and help make our teachers feel a little extra spe-cial. Here are the locations of the Giving Boards:
PLC = East PLC doors (doors facing courtyard doors) Lower School = 3rd and 4th grade arcade on window by courtyard Middle School = Southeast door closest to bus parking High School = Across from Mrs. Belk’s office
Thanks for helping take care of those who take care of our children! Have a wonderful rest of your week!
THANKS TO OUR D.O.G.S.A special thank you to our D.O.G.S. (Dads of Great Students) group. These kind men installed new tether ball poles and balls for the Lower School Playground to enjoy! Thanks so much!
6
CHOIR NEWSSenior Keely Umstot, and sophomores Anna Arnett and Kenyan Mortensen sang in the TMEA All-Region Choir last month in Abilene. They competed against over 100 other singers in their sections and were among the top singers selected to participate in the All-Region Choir.
The High School Choir had oppor-tunities to sing in the Lubbock com-munity on Veter-ans Day. One of our stops was the
Bender Terrace Nursing Home where we were honored to sing for several of our veterans.
The combined Middle School and High School Choirs were invited to pres-ent a musical program at the Silent Wings Museum on Veterans Day. What an amazing experience! The choirs represented All Saints beauti-fully and were immediately invited back next year.
REPORTERS AND PHOTOGS WANTEDThe School’s social media accounts are a great way to communicate with our community about the great things that happen at All Saints. If you are at an All Saints event and snap a photo or two, feel free to send them to Paige McKay (via text or email.) She is always looking for more con-tent for our Facebook, Instagram and Twitter ac-counts. In particular, she would love a few parent or student ‘reporters’ for middle school athletics and other activities.
facebook.com/allsaintsprideTwitter@allsaintspride (general school)@GoAllSaintsPats (athletics)@AllSaintsSTEM (technology)
Instagram@AllSaintsPride
Don’t forget to use the hashtag #asespride on your school-related social media posts. It’s a great way to keep up with all of the Patriot happenings!
All Saints Family Dinner Night!Tuesday, March 25
Wednesday, December 16
98th and SlideJoin us ALL DAY for Dine-In or
Take-Out.
7
MIDDLE SCHOOL BASKETBALLAll Saints Boys and Girls MS Basketball teams are off to a fast start this season with all four teams competing hard and posting good wins. On the Thursday before the Thanksgiving break all four of the MS teams were vic-torious against cross-town rival Christ the King. The boys’ teams are off this week, but both the 7th & 8th grade girls teams will compete in the All Saints 7th & 8th Grade Girls Tournaments on Friday, December 4 & Saturday, December 5. All Saints will host 15 teams in two concurrent tournaments played in Jones and Patriot Gyms.
The following weekend All Saints will host the All Saints’ Boys 7th & 8th Grade Tournaments on December 11 & 12. More that 20 boys teams will compete in the boys tournaments and both weekends will offer some great middle school basketball action.
The Girls and Boys Basketball Tournaments are a fantastic opportunity for All Saints to open its doors to the pub-lic as each weekend brings in several hundred athletes and more than a thousand spectators. It is a great time to raise funds for the athletic department as well as showcase All Saints to teams from Midland, Amarillo, Plainview and Lubbock. Please make plans to cheer your Patriot teams to victory!
HIGH SCHOOL BOYS BASKETBALLThe ASHS Boys JV team is off to a great start this season with wins over Floydada and Sundown along with a couple of close losses to Midland Classical. This is the fi rst year of a boys JV program at All Saints, and the future looks bright with these developing players!
Varsity Boys Basketball is off to a 2-2 start with 79-55 & 58-54 losses to #8 ranked Midland Classical and a 79-55 win over Floydada and a 70-29 win over Christ the King. The ASHS Boys Varsity Basketball team will get a chance to compete against some of the best teams in West Texas this coming weekend in the Lamesa Tournament where they will play Lamesa, Amarillo Caprock, Lubbock High, Big Spring and Ft. Stockton in round robin play.
HIGH SCHOOL GIRLS BASKETBALLThe ASHS Girls Varsity team is off to a strong start. On Nov. 17, the girls posted their fi rst win in their fi rst ever game, taking care of Talkington 48-34. Over the fi rst weekend of the Thanksgiving break, the team competed in the Wilson Round Robin Tournament, bringing home third place. After a losing last night to a scrappy Christ the King team, the girls now hold a 4-3 record. This weekend, the girls head to Anton to compete in the Anton Tournament, with Seagraves, Floydada, Hart, Tahoka and Anton. Coach Kyle Simons is working hard with the girls to make this fi rst year of high school girls basketball at All Saints a strong and memorable start!
DID YOU KNOW? All Saints will celebrate its 60th “Diamond” Anniversary next year! Go, Patriots!
HIGH SCHOOL VOLLEYBALL ADVANCES TO STATE FINALSIn only its second year of fi elding a team, your Patriot High School Varsity Volleyball team advanced to the TAPPS 1A State fi nals on November 14 in San Antonio. After sweeping teams in District 1-1A, the team earned a bye in Bi-District, swept Wichi-ta Christian in the Area Finals, and defeated North Central Texas Academy for the Regional Championship. The win over NCTA punched the team’s ticket to State! The State semifi nal match was against defending state champion Waxahachie Prep. Win-ning this match earned the girls a trip to the State Championship! The girls played a tough state fi nal, and lost to a strong Mission Juan Diego team. Juniors Brook Bowman and Riley Higgins, along with sophomores Tatum Harper and Abby Macha, were named to the TAPPS 1A State All Tournament team. Congratulations to these four, along with Coaches Kimberli Swett and Hayley Clark and the entire high school team for a job very well done! Can’t wait until next season!
8
ALL THE SCOOP ON THE CAR RAFFLEYour support of this year's Legacy Car Raffle will help the school raise important funds! Every All Saints family is asked to sell a minimum of FIVE RAFFLE TICKETS. To encourage everyone to sell, we are offering one free ticket as a bonus for you, every time you sell five tickets. Re-member that each ticket admits two guests to the Legacy Event on December 6. Here are a few fun raffle facts:
• The raffle prize (car) is purchased by the school. Ticket sales are important as the car costs must be raised and exceeded in order for the school to profit. Last year's raffle raised approximately $40,000.
• Only 2,000 tickets will be sold.
• The winner need not be present to win - out of town tickets may be sold.
• The car may be traded, upgraded, or sold by the winner.
Legacy Event News
A few of the Gift Baskets provided by each grade level up for
auction!
Amazing treasures
inside!
9
GET YOUR BID NUMBER EARLY!Upon arrival, guests will be encouraged to check in and ‘get’ your bid number from the entry table. Please secure your bid number with a credit card so you can enjoy the ease of skipping the check out line at the end of the auction! We promise to keep your personal and financial information safe and secure. Auction checkout begins at 9pm. If you must leave prior to check out, your auction items may be pick up next week at school.
WHAT’S AVAILABLE IN THE SILENT AUCTION• Would you like Saint Nick or Mrs. Claus to make a personal visit to your home? We have an inside
connection with the North Pole! Come bid.• Love Sports? Come bid on riding lessons, shooting range practice, sports camps, a personal trainer, or
an autographed TTU flag.• Looking for unique holiday gifts? Every All Saints class is contributing a special gift to our auction this
year and you won’t want to miss these.• Amazing grade level auction items, such as: TTU Tailgating package, Couples Wine Dinner, Little
Girl’s Dream Dress-Up Box, Fitness Package, and much more!
COMING TO BID BOARD• Custom TTU Fire Pit for your backyard• Beautiful jewelry from Heather Henry and David Yurman• Trip packages to Santa Fe and Fredricksburg• Catered Dinner for eight in the home of Dr. Mike and Sharon Bennett• Reserved seats for your favorite All Saints events
LIVE AUCTION• Napa Valley Sip and Soar - tour the wine country by hot air balloon!
• Drest to Impress! A personalized shopping expe-rience at Drest by Scott Malouf.
• Love to Hunt? Bid on a Pig Hunt for four with lodging and meals.
• Want to Golf? Escondido trip for four with ca-sita, golf, & dining.
• Reserved Parking at All Saints - four of the best parking spots.
• Puppy Love! Your kids will fall in love with our 6-week-old male Morkie.
• Grill Masters will love the Green Egg Cooker with accessories and a grilling lesson from BBQ Champion, Robert Wood.
DID YOU KNOW? Only 2,000 Car Raffle tickets are available for sale. Those are pretty great odds!
Legacy Schedule of Events6:00 pm - Auction Opens7:00 pm - First Tuition Drawing7:30 pm - Silent Auction Closes (Santa’s Bag/Cheers to your Health)7:45 pm - Silent Auction Closes (Enchanted Entertainment/Home for the Holidays)8:00 pm - Silent Auction Closes (Holiday Gourmet / Festive Fashions)8:00 pm - Second Tuition Drawing 8:10 pm - Silent Auction Close (Grade Level Gifts)8:15 pm - Bid Boards Close 8:20 pm - Third Tuition Drawing, Live Auction8:40 pm - Special Presentation8:50 pm - Car Raffle9:00 pm - Auction Pick Up
10
A big Thank You to our Legacy Event Sponsors
United Supermarkets
Wagner Office Supply
•
Brady’s Dairy Queen
Happy State Bank
Lubbock National Bank
Merrill Lynch
Alderson Auto Group
Dr. & Mrs. Gurdiv Gill
•
Robinson & Hamblin Dentistry
Miller / Coors / Great Plains Distributors
•
Stephen Joseph Inc.
11877-544-8555
Winspire, Inc.
Laguna Hills, CA
HHHHoootttt AAAAiiiirrr BBBBaaalllllllloooooonnn RRRRiiiiddddeee,,, WWWWiiiinnneeerrryyy TTTTooouuurrrsss &&&& TTTTaaasssttttiiiinnngggsss,,, CCCChhhhaaauuuffffffffeeeuuurrr,,, MMMMeeerrriiiittttaaagggeee RRRReeesssooorrrtttt aaannndddd SSSSpppaaaHHHHHooooooottttttt AAAAAAAiiiiiiirrrrrrr BBBBBBBaaaaaaallllllloooooooooooooonnnnnnn RRRRRRRiiiiiiidddddddeeeeeee,,,,,,, WWWWWWWiiiiiiinnnnnnneeeeeeerrrrrrryyyyyyy TTTTTTTooooooouuuuuuurrrrrrrsssssss &&&&&&& TTTTTTTaaaaaaassssssstttttttiiiiiiinnnnnnngggggggsssssss,,,,,,, CCCCCCChhhhhhhaaaaaaauuuuuuuffffffffffffffeeeeeeeuuuuuuurrrrrrr,,,,,,, MMMMMMMeeeeeeerrrrrrriiiiiiitttttttaaaaaaagggggggeeeeeee RRRRRRReeeeeeesssssssooooooorrrrrrrttttttt aaaaaaannnnnnnddddddd SSSSSSSpppppppaaaaaaa33333--NNNNNiiiiigggghhhhhttttt SSSSStttttaaaayyyy wwwwiiiiittttthhhhh AAAAAiiiiirrrrfffffaaaarrrreeee fffffoooorrrr 222223333333------NNNNNNNiiiiiiiggggggghhhhhhhttttttt SSSSSSStttttttaaaaaaayyyyyyy wwwwwwwiiiiiiittttttthhhhhhh AAAAAAAiiiiiiirrrrrrrfffffffaaaaaaarrrrrrreeeeeee fffffffooooooorrrrrrr 2222222
Suggested Retail Value:
Priceless
Enjoy an early morning journey in a hot air balloon, soaring above the magnificent Napa Valley, including a post-flight Champagne breakfast. Then
visit some of Napa’s best wineries in style with 6 hours of chaufferred luxury
sedan service.
1
For more information,see Package Description.
1From any major metropolitan airport in the 48 contiguous U.S. 2A full-service travel team who will book all reservations for your Winspire Experience.
12
ADVENT OFFERINGSService to God in our community
It is a long-standing tradition at All Saints Episcopal School to ask students and their families to give of themselves so that others might catch a glimpse of the true gift of the Advent Season. We will continue this tradition with grade-level service projects.
PRESCHOOL, PRE-KINDERGARTEN and KINDERGARTEN are gathering items to be given to the children at Buckner Children’s Home at its annual Christmas party. A list of suggested items has been sent home. Items will be collected through December 15.
PRE-FIRST is collecting art supplies for High Point Village. The last day to contribute is December 18.
FIRST GRADE is collecting items for children visiting the Covenant Outpatient Cancer Center. A complete list of suggested items has been set home. Collection deadline is December 16.
SECOND GRADE will collect various items for Ronald McDonald House. Donations will be col-lected through December 16.
THIRD GRADE has ‘adopted’ a family in need. They are collecting gift cards for clothing and other items. Information has been sent home with students with suggestions.
FOURTH GRADE is remembering the patrons of the South Plains Food Bank during the Advent Sea-son. Students are bringing a variety of items, and a list was sent home with suggestions. Items are due on December 16.
FIFTH GRADE - has adopted two families from My Father’s House Lubbock. More information is being provided to the fifth grade families.
SIXTH GRADE - Sixth grade will remember the Salvation Army during Advent. They will stuff stockings for younger recipients.
SEVENTH GRADE completed a coat drive last month for Women’s Protective Services and Faith Promise. 91 coats were donated!
EIGHTH GRADE is assisting The Haven Animal Shelter. The Haven is in great need for pet supplies, and a list was sent home. All donations need to be at school by December 14.
HIGH SCHOOL - On December 9, the entire high school will help sort toys and fill orders for the annual Toys for Tots campaign. In ad-dition, the students are filling bags of personal care items for Lubbock Impact. Parents received an email about this today.
STAFF and FACULTY - This year, the school’s staff and faculty participated in a group Advent Offering as well. Participants donated money to provide small gifts to the staff/faculty of Bowie Elementary. Bowie school has a great group of employees who work hard to sup-port and provide necessities to students in need all year. The ASES staff wanted to help provide a small gift to their Bowie peers.