Journal of Insect Biotechnology and Sericology 74, 95-102 (2005)

Larval RNAi Applied to the Analysis of Postembryonic Development in the Ladybird Beetle, Harmonia axyridis

INTRODUCTION

　RNA-mediated interference (RNAi) refers to the bio-logical process in which exogenous double-stranded RNA (dsRNA) results in a pronounced decrease or elimination of endogenous mRNA in a sequence-specific manner (Montgomery, 2004). Since the discovery of RNAi in Caenorhabditis elegans (Fire et al., 1998), it has become widely utilized for the analysis of gene function in a broad variety of organisms (Fjose et al., 2001). Although the exact mechanism of gene silencing by RNAi is not fully understood, various applications of the RNAi meth-od have been developed (Ueda, 2001; Bucher et al., 2002; Carpenter and Sabatini, 2004) and it has become increas-ingly important for gene function analyses in the post-ge-nomic era.　The first successful application of the RNAi method for the analysis of gene function in insects was performed by microinjection of dsRNA into early Drosophila embryos (Kennerdell and Carthew, 1998). Since then, RNAi by mi-croinjection of dsRNA into syncytial blastoderm embryos (embryonic RNAi) has become a potent approach for ana-lyzing embryogenesis and many subsequent studies on gene function by embryonic RNAi have been published in a diverse array of insect taxa (Fjose et al., 2001). Howev-er, the efficiency of embryonic RNAi is not sustained for

a sufficiently long period to facilitate analyses of adult de-velopment (Misquitta and Paterson, 1999). Recently To-moyasu and Denell (2004) have reported a new RNAi-based approach employing the injection of dsRNA into the larval body cavity, termed larval RNAi, which circum-vents the difficulties associated with analyzing adult de-velopment. These authors demonstrated that larval RNAi inhibits gene expression in the entire body for an extend-ed period, and thus creates pupal and adult loss-of-func-tion phenotypes in the red flour beetle, Tribolium castaneum.　In order to establish the general utility of larval RNAi for analyzing postembryonic development in non-model insects, we cloned the homeobox genes Distal-less (Dll) and aristaless (al) of the multicolored Asian ladybird bee-tle, Harmonia axyridis. Both Dll and al genes encode a transcription factor that contains a homeodomain (HD) as DNA binding domain. Isolation of these genes from ani-mal taxa including insects and vertebrates revealed that HD sequences of Dll and Al are highly conserved during evolution (Galliot et al., 1999; Panganiban and Ruben-stein, 2002; Beermann and Schröder, 2004). Furthermore, not only is the conservation of the expression pattern of these genes observed in the developing limbs during em-bryogenesis in divergent animals (Schneitz et al., 1993; Miyawaki et al., 2002; Panganiban and Rubenstein, 2002; Beermann and Schröder, 2004), but the functions of these genes in the developing limbs during embryogenesis are also conserved (Schoppmeier and Damen, 2001; Bucher et al., 2002; Angelini and Kaufman, 2004; Beermann and

1 Graduate School of Bioagricultural Sciences, Nagoya University, Chikusa, Nagoya 464-8601, Japan, and2 PRESTO, Japan Science and Technology Agency, 4-1-8 Honcho Kawaguchi, Saitama, Japan

(Received January 31, 2005; Accepted February 28, 2005)

　RNA-mediated interference (RNAi) provides a rapid and potent approach for analyzing gene function in vivo. The conventional RNAi technique is performed by microinjection of double-stranded RNA (dsRNA) into syncytial blastoderm embryos (embryonic RNAi). While the embryonic RNAi method is efficient for analyses of embryo-genesis, it is inappropriate for analyses of postembryonic development. To circumvent this problem, larval RNAi by the injection of dsRNA into the larval body cavity had been reported using Tribolium castaneum. In order to demonstrate the general utility of the larval RNAi method in non-model insects, we used the evolutionary con-served homeobox genes required for appendage formation, Distal-less (Dll) and aristaless (al), to affirm their function in adult development of the ladybird beetle, Harmonia axyridis. The injection of dsRNA for Harmonia Dll (Ha-Dll) and al (Ha-al) into the early stage of last instar larvae efficiently induced adult morphological defects that mimicked those of known loss-of-function phenotypes for these genes. Surprisingly, these adult defects by larval RNAi were induced with a 100% penetrance. We conclude that larval RNAi is extremely efficient for the analysis of adult development in Harmonia and that larval RNAi will become a powerful new tool for analyzing postembry-onic development at a molecular level, particularly in non-model insects.　Key Words: Larval RNAi, Harmonia axyridis, postembryonic development, gene function analysis, Distal-less, aristaless

*To whom correspondence should be addressed.Fax: +81-52-789-4036. Tel: +81-52-789-5504.Email: niimi@agr.nagoya-u.ac.jp

Teruyuki Niimi1,2,＊, Hisashi Kuwayama1 and Toshinobu Yaginuma1

Niimi et al.96

Schröder, 2004). However, in Drosophila, in addition to the above studies concerning embryogenesis, molecular genetic studies revealed that Dll and al genes play key roles in patterning the proximodistal axis in developing adult appendages (Panganiban, 2000; Kojima, 2004). In the Dll loss-of-function mutant of Drosophila and Triboli-um, the distal regions of adult appendages are missing (Campbell and Tomlinson, 1998; Beermann et al., 2001). Conversely, in al loss-of-function mutants of Drosophila, only the distal-most regions of adult legs (pretarsi) and antennae (aristae) are missing (Campbell and Tomlinson, 1998). Function of these genes during adult development has only been thoroughly studied in Drosophila so far. It is thus important to understand the function of these genes in adult development in evolutionary distant insect such as Harmonia.　In this study, we injected dsRNA of Harmonia Dll (Ha-Dll) and Harmonia al (Ha-al) into Harmonia larvae to examine whether larval RNAi is an efficient means with which analyzes postembryonic development. We demon-strated by larval RNAi that Ha-Dll and Ha-al are required for the formation of the distal regions of adult legs and antennae, and most distal segments of adult legs (pretarsi), respectively, and that larval RNAi is extremely efficient for the analysis of adult development in Harmonia.

MATERIALS AND METHODS

Insects　Laboratory stocks of Harmonia axyridis were derived from field collections in Nagoya and Gifu in 2003 and 2004. They were maintained at 25°C under constant illu-mination. They were usually fed on an artificial diet con-taining drone honeybee powder, sugar and ethyl-4-hydorxybenzoate in a ratio of 30:10:1 with a modification according to Niijima et al., (1977). Adults were fed on the pea aphid, Acyrthosiphon pisum (kindly provided by Dr. Miura) at the time of egg collection. Experimental larvae were derived from a few batches of eggs from a single Harmonia pair and were staged after the third ecdysis.

Cloning　Total RNA was extracted from 0 to 2-day-old Harmo-nia eggs with Trizol (Gibco BRL) according to the manu-facture’s instructions. The first-stranded cDNA was synthesized with SMART PCR cDNA Amplification Kit (Clontech) using 1 μg total RNA. Both Ha-Dll and Ha-al cDNA fragments were amplified by PCR with the follow-ing pairs of degenerate primers corresponding to the high-ly conserved amino acid sequences found in the homeodomain of Dll and Al from Drosophila and several vertebrates.

Degenerate primer set for Distal-less (Dll)

Dll-1: 5’-ATGMGIAARCCIMGIACIATHTA-3’ (23 mer)Dll-2: 5’-YTTISWICKICKRTTYTGRAACCA-3’ (24 mer)

Degenerate primer set for aristaless (al)al-1: 5’-CARYTIGARGARYTIGARAA-3’ (20 mer)al-2: 5’-YTCYTGYTTICKCCAYTTIGC-3’ (21 mer)

(W=A+T, R=A+G, M=A+C, K=T+G, Y=T+C, S=C+G, H=A+T+C, I =inosine)

The PCRs were performed using 2.5 μl of the 10-fold-di-luted first-stranded cDNA, a pair of primers above, and AmpliTaq Gold (Perkin Elmer).　To obtain a full-length cDNA, 5’ RACE and 3’ RACE were performed with the following gene-specific primers and the SMART PCR cDNA Amplification Kit (Clontech) according to the manufacturer’s instructions.

Gene-specific primer for 5’ RACEHa-Dll-#3: 5’-CTCAGCTCTTTCCGGTAAAGCT AAG-3’ (25 mer)Ha-Dll-#4: 5’-TTGCGTCAATCCTAAACTTGCT GCCAG-3’ (27 mer)Ha-al-#3: 5’- CTTCATTGCAAGTTCCTCCCTT GTG-3’ (25 mer)Ha-al-#4: 5’- AYACTTGTATTCTAGCCTCTGT GAGTCC-3’ (28 mer)

Gene-specific primer for 3’ RACEHa-Dll-#1: 5’-CCAACTGTCCTCCTTCGCCCAA AGA-3’ (25 mer)Ha-Dll-#2: 5’-CAAATGCCTGTCGTTGGAAAGG CCG-3’ (25 mer)Ha-al-#1: 5’-GCGTTTTCTAGGACGCATTACC CGGAT-3’ (27 mer)Ha-al-#2: 5’-CACAAGGGAGGAACTTGCAATG AAG-3’ (25 mer)

The 5’ RACE and 3’ RACE were performed using 2.5 μl of the 10-fold-diluted first-stranded cDNA, 10 × Universal Primer Mix (UPM), gene-specific primer #4 for 5’ RACE or gene-specific primer #1 for 3’ RACE and Advantage 2 Polymerase Mix. The nested PCR for 5’ RACE and 3’ RACE were performed using 0.2 μl of the primary PCR product, Nested Universal Primer (NUP), gene-specific primer #3 for 5’ RACE or gene-specific primer #2 for 3’ RACE and Advantage 2 Polymerase Mix.

Sequencing and sequence analysis　The PCR product was subcloned into the EcoRV site of the pBluescript KS+ vector (Stratagene). Nucleotide se-quence determination was performed by the dideoxy chain-termination method using an automatic DNA se-quencer CEQ 2000XL (Beckman Coulter). Sequence anal-ysis was done using the DNASIS system (Hitachi Software Engineering). Deduced amino acid sequences were aligned with ClustalW to determine amino acid se-

Larval RNAi in Harmonia 97

quence identities.

Sequence accession numbers　DDBJ/GenBank accession numbers for the sequence re-ported in this article are AB200969 for Ha-Dll and AB200970 for Ha-al.

Preparation of dsRNA　Ha-Dll, the PCR product indicated by red letters in Fig. 1A obtained using Ha-Dll-L1 (5’-ACAAGAAAAT GATGAAAGCGGCCCA-3’) and Ha-Dll-L2 (5’-TATCTT GCTTGCAGACTTATCCTGC-3’) as primers, was sub-cloned into the EcoRV site of the pBluescript KS+ vector. For the production of template for in vitro transcription, the PCR was performed using plasmids containing either Ha-Dll (the 333 bp PCR product described above) or Ha-al (1005 bp, 3’ RACE product indicated by red letters in Fig. 1B), two universal primers (T7-KS, 5’-TAATAC GACTCACTATAGGGAGACCACTCGAGGTCGACGG TATC-3’; T7-SK, 5’-TAATACGACTCACTATAGGGAGA CCACCGCTCTAGAACTAGTGGATC-3’) containing the T7 polymerase promoter sequence at their 5’ ends, and AmpliTaq Gold (Perkin Elmer). Sense and antisense tran-scripts were simultaneously synthesized using 1 μg PCR product and MEGAscript T7 Kit (Ambion) according to the manufacturer’s instructions. After DNase I treatment, RNA precipitated with LiCl was dissolved in RNase free water. The RNA solution was heated at 65°C for 30 min and cooled down slowly to room temperature for anneal-ing of the dsRNA. The concentrations of Ha-Dll and Ha-al dsRNA were 2.1 μg/ μl and 2.8 μg/μl, respectively. The quality of the dsRNA was examined by agarose gel elec-trophoresis and the small aliquots of the dsRNA were stored at −80°C until use.

Injection of dsRNA into Harmonia larvae　Each larva was anesthetized on a CO2 pad during injec-tion, which was performed under a dissection microscope (Stemi 2000, Carl Zeiss). Approximately 1 μg of dsRNA was injected laterally between segments T1 and T2 or T2 and T3 into each larva using a micromanipulator (Nar-ishige) and FemtoJet (Eppendorf). RNase free water was injected as control. Soon after the injection, the applica-tion of CO2 was stopped and the insects were reared on an artificial diet until the completion of adult develop-ment.

RESULTS AND DISCUSSION

Isolation and sequence comparison of Ha-Dll and Ha-al　Initial isolation of partial Ha-Dll and Ha-al homologs was achieved by PCR amplification of the first-stranded

cDNA prepared from 0 to 2-day-old eggs with a pair of degenerate primers based on the highly conserved amino acid sequence in HD. The sizes of the PCR products for Ha-Dll and Ha-al were 118 bp and 107 bp, respectively. Full-length cDNAs for Ha-Dll and Ha-al identified by 5’ and 3’ RACE were 1,528 bp and 1,379 bp, respectively (Fig. 1). The ORFs for Ha-Dll and Ha-al encode 226 ami-no acids and 314 amino acids, respectively (Fig. 1).　Comparison of entire Dll sequences of Harmonia with those of Tribolium castaneum (Beermann et al., 2001), Junonia coenia (Panganiban et al., 1994), Bicyclus any-nana (Beldade et al., 2002) and Drosophila melanogaster (Vachon et al., 1992) in Fig. 2A shows the highest identi-ty to Tribolium Dll (83%). Conservation was highest in HD, and all of the amino acids in HD were identical among Dll sequences of these insects. In addition to HD, the amino acid sequences from the N-terminus to HD were also highly conserved. Thus, the sequence compari-son demonstrates that the cloned Harmonia axyridis cDNA is a homolog of the known Dll. The C-terminus re-gion is less conserved because the truncation of this re-gion was found only in Ha-Dll.　Comparison with entire Al sequences in Fig. 2B shows that Ha-Al has 50% identity with Al sequences of Gryllus bimaculatus (Miyawaki et al., 2002) and Drosophila me-lanogaster (Schneitz et al., 1993). The highest extent of homology was found in HD, which was classified as Prd type. In addition to HD, the amino acid sequences from the C-terminus to HD, termed OAR domain using initials of otp, aristaless and rax (Furukawa et al., 1997), were also highly conserved. Thus, sequence comparison thus demonstrates that the cloned Harmonia axyridis cDNA is a homolog of the known al.

Larval RNAi in Harmonia　To develop a larval RNAi method for the analysis of gene function during postembryonic development in Har-monia, Ha-Dll and Ha-al were tested to determine wheth-er down-regulation of these genes induces the expected phenotypes in adult structures because the functions of these genes are known to be evolutionary conserved.　We initially examined the last larval instar (4th instar); the most effective larval stage for analyzing RNAi. When Harmonia larvae are reared on an artificial diet at 25°C, the duration of the last instar larval stage takes 4-6 days including the prepupal stage of 1 day. We injected Ha-Dll dsRNA into last instar larvae at different stages and ob-served the resulting phenotypes of adult structures (Ta-ble 1). When the injection was administered at one day (beginning of the prepupal stage) or two days (late feed-ing stage) before pupation, no phenotype or partial pheno-type was observed, respectively. In contrast, at five days before pupation (the early last-instar larval stage), severe

Niimi et al.98

phenotypes, such as shortening of all legs and antennae, were observed (Fig. 3). Severe developmental defects were observed in the distal leg (femur, tibia and tarsus) and distal antennae segments. This result shows that the maximum effect by Ha-Dll RNAi on adult appendage for-mation requires injection of dsRNA into last instar larvae at an early stage. These phenotypes obtained by larval RNAi for Ha-Dll were similar to those observed in loss-of-function mutants for the Dll gene in Drosophila (Campbell and Tomlinson, 1998) and Tribolium (Beermann et al., 2001). This result indicates that Dll function in the development of adult appendages is highly conserved. To the best of our knowledge, this is the first investigation of Dll function in the development of adult appendages by RNAi. Previous studies focused on Dll functioning during embryogenesis (Schoppmeier and Damen, 2001; Bucher

et al., 2002; Angelini and Kaufman, 2004) because of limitation in conventional RNAi methods using the injec-tion into early embryos.　Next we injected Ha-Dll dsRNA into 0-day-old last in-star larvae. All of the injected larvae (n = 10) completed adult development. However, the development of short legs as a phenotypic response to Ha-Dll RNAi impaired their ability to shed their pupal cuticles. Surprisingly, a 100% penetration of Dll-specific phenotype (all legs and antennae were short) - such as the phenotypes observed in larvae #5 and #7 in Table 1 - was induced by Ha-Dll dsRNA injection into 0-day-old last instar larvae (Table 2). On the contrary, these phenotypes were never induced by the injection of water into larvae (control).　To confirm the effect of larval RNAi on adult develop-ment, we injected Ha-al dsRNA into 0 to 2-day-old last

　Fig. 1. Nucleotide (top) and deduced amino acid sequences (bottom) of Ha-Dll (A) and Ha-al (B) cDNAs from Har-monia axyridis. Arrows indicate primer sequences used in RACE and RT-PCR (See MATERIALS AND METHODS). Nucleotide sequences indicated in red letters were used for RNAi experiments. Boxed nucleotides represent a putative polyadenylation signal (AATAAA) was found only in Ha-Dll cDNA.

Larval RNAi in Harmonia 99

　Fig. 2. Comparison of amino acid sequences for Dll (A) and Al (B) from various insects. Amino acids represented in red are shared among all of these Dll or Al orthologs, and those represented in orange are shared with Ha-Dll or Ha-Al. The homeodomain and OAR domain are shaded in blue and green, respectively. -, gap; Ha, Harmonia axyridis; Tc, Tribolium castaneum; Jc, Junonia coenia; Ba, Bicyclus anynana; Gb, Gryllus bimaculatus; Dm, Drosophila melanogas-ter.

Niimi et al.100

instar larvae. All of the injected larvae (n = 10) had de-fects in pretarsal claw formation, but other leg structures developed normally (Fig. 4). Similarly, a 100% penetra-tion of al-specific phenotype was induced by Ha-al dsRNA injection into 0 to 2-day-old last instar larvae (Ta-ble 2). This adult phenotype was also never observed in

control. These results provide the first evidence illustrat-ing the importance of al in pretarsus formation in an in-sect distantly related to Drosophila, suggesting that al function in pretarsus formation may be an evolutionary conserved trait among holometabolous insects. Loss-of-function mutants for al in Drosophila exhibit defects in

Table 1. Effect of Ha-Dll RNAi on Harmonia adults

Injected larva* Injection stage (days before pupation) Adult phenotype

#1 1 None#2 1 None#3 2 Short T3 leg#4 2 Short T1 leg#5 5 Short all legs and antennae#6 5 Short T2 legs and antennae#7 5 Short all legs and antennae

*Approximately 1 μg of dsRNA was injected.

　Fig. 3. Phenotypic analysis of Ha-Dll RNAi in adults. (A and D) Untreated control. The adult leg of Harmonia con-sists of coxa (co), trochanter (tr), femur (fe), tibia (ti), tarsus (ta) and pretarsus (pr) from proximal to distal. Antenna of Harmonia consists of 11 segments (blue arrowhead in D). (B, C, E, F and G) Adult phenotype obtained from Ha-Dll dsRNA (approximately 1 µg) injected larva #5 (B and E), #6 (F) and #7 (C and G) at five days before pupation. Indi-vidual number of injected larvae was the same as in Table 1. RNAi for Ha-Dll resulted in shortening of all legs (B and C) and antennae (red arrow head in E, F and G). (A-C) Ventral view of T1 (upper), T2 (middle), T3 (lower); (D-G) frontal view of head.

Larval RNAi in Harmonia 101

their pretarsus and arista (the most distal segment of the fly antenna) formation (Schneitz et al., 1993; Campbell and Tomlinson, 1998). Interestingly, Ha-al dsRNA injec-tion appeared to have no obvious effect on the develop-ment of antennae (data not shown). Morphological divergence in adult antenna between Harmonia and Dro-sophila may be brought by the different target genes of the proximodistal patterning genes such as the al gene.　In this study, we have clearly shown that larval RNAi is extremely efficient for the analysis of adult develop-ment in Harmonia. Therefore, similar to embryonic RNAi, it can be applied to numerous insect taxa. The larval RNAi method thus represents a powerful new tool for an-alyzing postembryonic development at a molecular level, particularly in non-model insects in which a straightfor-ward approach to the analysis of gene function in vivo has been difficult to date.

ACKNOWLEDGMENTS

　We would like to thank Dr. Y. Tomoyasu (Kansas State University), Dr. T. Kojima (University of Tokyo), Dr. M. Kobayashi (Nagoya University) and Dr. M. Ikeda (Nagoya University) for productive discussions. We would also like to express our gratitude to Dr. T. Miura (Hokkaido Univ-ersity) for providing aphids and Ms. M. Hayashi for in-sect rearing. This study was supported in part by a Grant-in-Aid from Formation and Recognition, PRESTO, JST, by a Grant-in-Aid from the Ministry of Education, Sci-ence, Sports and Culture of Japan (16208007 and 16580038), by a Grant-in-Aid (BDP) from the Ministry of Agriculture, Forestry and Fisheries, and by the Research for the Future Program of the Japan Society for the Pro-motion of Science (JSPS-RFTF99L01203).

REFERENCES

Table 2. Effect of Ha-Dll and Ha-al RNAi on Harmonia adults

Injection Number of injected larvae Number of adults Number of adults with

specific phenotypesa Effeciency (%)

Ha-Dll dsRNAb 10 10 10 100Ha-al dsRNAc 10 10 10 100Water 10 10 0 0

aShort all legs and antennae for Ha-Dll RNAi; defects in all pretarsi for Ha-al RNAi.bApproximately 1 μg of dsRNA was injected at 0-day-old last instar larvae.cApproximately 1 μg of dsRNA was injected at 0 to 2-day-old last instar larvae.

　Fig. 4. Phenotypic analysis of Ha-al RNAi in adults. (A and C) Untreated control. Pretarsus is present on the most distal tip of legs (blue arrowhead in A). (B and D) Adult phenotype ob-tained from Ha-al dsRNA (approximately 1 µg) injected larva at 1-day-old last instar. RNAi for Ha-al caused the deletion of the pretarsus (red arrowhead in B). C and D are magnifica-tions of the tarsus and the pretarsus of A and B, respectively.

Angelini, D.R., and Kaufman, T.C. (2004) Functional analyses in the hemipteran Oncopeltus fasciatus reveal conserved and derived aspects of appendage patterning in insects. Dev. Biol. 271, 306-321.

Beermann, A., and Schröder, R. (2004) Functional stability of the aristaless gene in appendage tip formation during evolu-tion. Dev. Genes Evol. 214, 303-308.

Beermann, A., Jay, D.G., Beeman, R.W., Hülskamp, M., Tautz, D., and Jürgens, G. (2001) The Short antennae gene of Tri-bolium is required for limb development and encodes the orthologue of the Drosophila Distal-less protein. Develop-ment 128, 287-297.

Beldade, P., Brakefield, P.M., and Long, A.D. (2002) Contribu-tion of Distal-less to quantitative variation in butterfly eye-spots. Nature 415, 315-318.

Bucher, G., Scholten, J., and Klingler, M. (2002) Parental RNAi in Tribolium (Coleoptera). Curr. Biol. 12, R85-R86.

Campbell, G., and Tomlinson, A. (1998) The roles of the ho-meobox genes aristaless and Distal-less in patterning the legs and wings of Drosophila. Development 125, 4483-4493.

Carpenter, A.E., and Sabatini, D.M. (2004) Systematic ge-nome-wide screens of gene function. Nature Rev. Genet. 5, 11-22.

Fire, A., Xu, S., Montgomery, M.K., Kostas, S.A., Driver, S.E., and Mello, C.C. (1998) Potent and specific genetic interfer-ence by double-stranded RNA in Caenorhabditis elegans. Nature 391, 806-811.

Fjose, A., Ellingsen, S., Wargelius, A., and Seo, H.-C. (2001)

Niimi et al.102

RNA interference: mechanisms and applications. Biotechnol. Ann. Rev. 7, 31-57.

Furukawa, T., Kozak, C.A., and Cepko, C.L. (1997) rax, a novel paired-type homeobox gene, shows expression in the anterior neural fold and developing retina. Proc. Natl. Acad. Sci. USA 94, 3088-3093.

Galliot, B., Vargas, C., and Miller, D. (1999) Evolution of ho-meobox genes: Q50 Paired-like genes founded the Paired class. Dev. Genes Evol. 209, 186-197.

Kennerdell, J.R., and Carthew, R.W. (1998) Use of dsRNA-mediated genetic interference to demonstrate that frizzled and frizzled 2 act in the Wingless pathway. Cell 95, 1017-1026.

Kojima, T. (2004) The mechanism of Drosophila leg develop-ment along the proximodistal axis. Develop. Growth Differ. 46, 115-129.

Misquitta, L., and Paterson, B.M. (1999) Targeted disruption of gene function in Drosophila by RNA interference (RNA-i): A role for nautilus in embryonic somatic muscle formation. Proc. Natl. Acad. Sci. USA 96, 1451-1456.

Miyawaki, K., Inoue, Y., Mito, T., Fujimoto, T., Matsushima, K., Shinmyo, Y., Ohuchi, H., and Noji, S. (2002) Expression patterns of aristaless in developing appendages of Gryllus bimaculatus (cricket). Mech. Dev. 113, 181-184.

Montgomery, M.K. (2004) RNA interference: Historical over-view and significance. Methods Mol. Biol. 265, 3-21.

Niijima, K., Abe, W., and Matsuka, M. (1997) Development of low-cost and labor-saving artificial diet for mass production of an aphidophagous coccinellid, Harmonia axyridis (Pallas).

Bull. Fac. Agr. Tamagawa Univ. 37, 63-74.Panganiban, G. (2000) Distal-less function during Drosophila

appendage and sense organ development. Dev. Dyn. 218, 554-562.

Panganiban, G., and Rubenstein, J.L.R. (2002) Developmental functions of the Distal-less/Dlx homeobox genes. Develop-ment 129, 4371-4386.

Panganiban, G., Nagy, L., and Carroll, S.B. (1994) The role of the Distal-less gene in the development and evolution of in-sect limbs. Curr. Biol. 4, 671-675.

Schneitz, K., Spielmann, P., and Noll, M. (1993) Molecular genetics of aristaless, a prd-type homeobox gene involved in the morphogenesis of proximal and distal pattern ele-ments in a subset of appendages in Drosophila. Genes Dev. 7, 114-129.

Schoppmeier, M., and Damen, W.G.M. (2001) Double-strand-ed RNA interference in the spider Cupiennius salei: the role of Distal-less is evolutionarily conserved in arthropod ap-pendage formation. Dev. Genes Evol. 211, 76-82.

Tomoyasu, Y., and Denell, R. (2004) Larval RNAi in Triboli-um (Coleoptera) for analyzing adult development. Dev. Genes Evol. 214, 575-578.

Ueda, R. (2001) RNAi: A new technology in the post-genomic sequencing era. J. Neurogenet. 15, 193-204.

Vachon, G., Cohen, B., Pfeifle, C., McGuffin, M.E., Botas, J., and Cohen, S.M. (1992) Homeotic genes of the bithorax complex repress limb development in the abdomen of the Drosophila embryo through the target gene Distal-less. Cell 71, 437-450.