sab

dexAldo

Article history:Received 23 March 2015Received in revised form 11 September 2015Accepted 22 September 2015Available online 26 September 2015

Keywords:SourdoughLactic acid bacteriaLactobacillus sanfranciscensis

dies (Ferchichi et al.,9; Vera et al., 2012).of two novel species,5) and Lactobacillus

International Journal of Food Microbiology 215 (2015) 161170

Contents lists available at ScienceDirect

International Journal o

j ourna l homepage: www.e lsevscribed by both culture-dependent and -independent methods (DeVuyst et al., 2014; Ercolini, 2013).

nantensis (Valcheva et al., 2006). Lactobacillus sanfranciscensis waseither not isolated or detected as sub-dominant bacterial species inFrench sourdoughs (Ferchichi et al., 2007; Robert et al., 2009;tively affect nutritional, sensory, texture, shelf-life and functional quali-ty of baked goods (DeVuyst et al., 2009; Gobbetti et al., 2014). Thereforeto study and safeguard the microbiota of traditional sourdoughs is anoteworthy subject of research. Sourdough microbiota may be de-

from France were rarely subject of research stu2007; Gabriel et al., 1999; Robert et al., 200Yet, some of them were the source of isolationLactobacillus hammesii (Valcheva et al., 2001. Introduction

Sourdough is amixture of our andwater, spontaneously fermentedby lactic acid bacteria and yeasts, and having acidication and leaveningcapacity (Gobbetti, 1998). A number of studies have shown that thelactic acid bacterium (LAB) and yeast microbiotas of sourdough posi-

In France sourdough biotechnology traces back to 200 B.C. and itshistory is characterized by highs (e.g., in the eighteenth century) andlows (e.g., in the rst two decades of the twentieth century) (Cappelleet al., 2013). To date, about 5% of the total bread consumed in Franceis obtained by sourdough (Observatoire du pain, 2011). Compared toBelgian, German, and Italian sourdoughs (De Vuyst et al., 2014), those Corresponding author at: Dipartimento di ScienzeAlimenti, Universit degli Studi di Bari Aldo Moro, via Am

E-mail address: fabio.minervini@uniba.it (F. Minervini1 These authors equally contributed to this work.

http://dx.doi.org/10.1016/j.ijfoodmicro.2015.09.0150168-1605/ 2015 Elsevier B.V. All rights reserved. 2015 Elsevier B.V. All rights reserved.a b s t r a c t

Sixteen sourdoughs (FS1FS16) used for the manufacture of traditional French breads were characterized bystrongly acid conditions (median value of pH 3.5). The concentration of free amino acids (FAA) was highlyvariable, due to different proteolytic activity of our used for back slopping and of dominant microorganisms.Median value of cell density of lactic acid bacteria (LAB) was 9.2 log CFU/g. The ratio between LAB and yeastsranged from 10,000:1 to 10:1. According to the culture-dependent method and 16S metagenetics, Lactobacillussanfranciscensiswas the dominant species in French sourdoughs. FS5 and FS15, propagated according to protocolsincluding one back slopping step at 14 C, were the only exceptions. High positive correlations were foundbetween L. sanfranciscensis, temperature of back slopping and FAA. The results of this study highlighted thebroad adaptability of L. sanfranciscensis to very acid sourdough. Besides species frequently encountered(e.g., Lactobacillus parabrevis/Lactobacillus hammesii, Lactobacillus plantarum and Leuconostoc mesenteroides), rstLactobacillus xiangfangensis (FS5) and Lactobacillus diolivorans (FS15) were found in sourdough. As determinedby RAPD-PCR analyses, the sourdough samples showed a different number of strains, ranging from 5 (FS9, FS11and FS15) to 12 (FS1 and FS13), meaning a highly variable bacterial diversity. Cluster analysis showed that differentsourdoughs, especially when propagated in the same bakery, may harbor similar strains. Except for L. plantarum(FS5) and Ln. mesenteroides (FS3), all the dominant species were detected by both 16S metagenetics and culture-dependentmethod. Yeast diversitywas lower than LAB. Except for FS4 (solely dominated byKazachstania servazzii),yeast microbiota of French sourdoughs was dominated by Saccharomyces cerevisiae. Strains isolated in this studycould be a useful base for developing new basic researches on physiology, metabolism, and intraspecic diversityof L. sanfranciscensis, as well as for standardizing the quality of traditional French breads.a r t i c l e i n f oLactic acid bacterium and yeast microbiotatraditional sourdoughs

Emilie Lhomme a,1, Anna Lattanzi b,1, Xavier Dousset a, FBernard Onno a, Marco Gobbetti b

a LUNAM Universit Oniris, Laboratoire de Microbiologie Alimentaire et Industrielle, Nantes Ceb Dipartimento di Scienze del Suolo, della Pianta e degli Alimenti, Universit degli Studi di Baric Puratos Group, Bakery Flavour & Yeast, Industrialaan, 25, 1702 Groot-Bijgaarden, Belgiumdel Suolo, della Pianta e degliendola 165/a, 70126 Bari, Italy.).of sixteen French

ioMinervini b,, Maria DeAngelis b, Guylaine Lacaze c,

3, FranceMoro, Bari, Italy

f Food Microbiology

i e r .com/ locate / i j foodmicroValcheva et al., 2005, 2006; Vera et al., 2012). Recently, LAB and yeastswere investigated in French traditional organic sourdough samples.L. sanfranciscensis was the dominant species, regardless of the bakery(Lhomme et al., 2014, 2015), whereas the dominant yeast species,mostly belonging to the Kazachstania clade, differed between bakeries

(Lhomme et al., 2014). Comparative studies on numerous sourdoughswhich are used for themanufacture of various traditional French breadsmay give a complete picture of the LAB and yeast microbiotas involvedin the developing of the main sensorial, nutritional and shelf-life traitsof the products (Vogelmann and Hertel, 2011).

The aim of this studywas to characterize themicrobiota of 16 Frenchsourdoughs, with special emphasis on LAB, which were studied byboth culture-dependent and culture-independent (16S metagenetics)methods. A comparison between the above methods was also carriedout.

2. Material and methods

2.1. Sourdoughs

Sixteen sourdoughs used for the manufacture of traditional Frenchbreads were studied. The sourdoughs (FS1FS16) were representativefor seven French regions and the bakeries selected for sourdoughcollection are indicated by the letters AJ (Table 1). Themain process

and fructose (only our samples), organic acids (only sourdough sam-ples) and FAA. In order to determine the concentrations of carbohydratesand organic acids, the water-soluble extract was diluted with H2SO410mM and analysed by liquid chromatography using an KTA Puriersystem (GE Healthcare Bio-Sciences, Uppsala, Sweden) equipped with aUV and a refractive index (Perkin Elmer Corp., Waltham, MA) detectors(Zeppa et al., 2001). The quotient of fermentation (QF) was determinedas the molar ratio between D,L-lactic and acetic acids. The concentrationof FAA in all samples was determined using the Biochrom 30 AminoAcid Analyser (Biochrom LTD, Cambridge Science Park, England)(De Angelis et al., 2007).

2.3. LAB and yeasts enumeration and isolation

Ten grams of sourdough was homogenized with 90 mL of sterilepeptone water (peptone 1 g/L and NaCl 8.5 g/L) solution. LAB werecounted and isolated by using de Man, Rogosa, Sharpe (MRS) (de Manet al., 1960) modied by addition of maltose 10 g/L and fresh yeastextract 50 mL/L (pH 5.6) (mMRS), Sour Dough Bacteria (SDB) (Kline

h so

ing

162 E. Lhomme et al. / International Journal of Food Microbiology 215 (2015) 161170parameters, including number, time and temperature of back slopping,are shown in Table 1. FS8 had been started by FS6 (data not shown)and was the unique sourdough that could be classied, on the basis ofits state (liquid), number of back slopping steps (one), time and temper-ature of back slopping, as type II, all the others being classied as type Ib(De Vuyst andNeysens, 2005). Three couples of sourdough samples (FS1and FS2 from bakery A, FS3 and FS4 from bakery B, and FS6 and FS7 frombakery D) are propagated with the same protocol, but using a differenttype of wheat our. FS11 differs from FS12 only for its lower watercontent (data not shown). To determine the proteolytic activity ofour, chemically acidied doughs were also made and incubated in thesame conditions reported in Table 1.

All samples were taken, in triplicate, and were stored at 4 C untilbeing analysed. All the analyses were carried out at least in duplicatefor each batch of sourdough.

2.2. Determination of pH, total titratable acidity, carbohydrates, organicacids and free amino acids

The values of pH were determined by a pH-meter. Total titratableacidity (TTA) was determined as previously described (Minervini et al.,2011). Ten grams of our, chemically acidied dough and sourdoughwas homogenized (3 min of treatment) with 90 mL of TrisHCl 50 mMpH 8.8 buffer in a 400P Bag Mixer (Interscience, St. Nom, France). Afteran extraction step (at 25 C for 30 min under stirring), the suspensionwas centrifuged (12,857 g, 10 min, 4 C). The supernatant (water-soluble extract) was analysed for the concentration of maltose, glucose

Table 1Geographical provenience, bakery of collection, and technology parameters of the 16 Frenc

Sourdough Location of the bakery Bakery Floura No. of back slopp

FS1 Ile-de-France A W 1FS2 Ile-de-France A W 1FS3 Ile-de-France B W 1FS4 Ile-de-France B W 1FS5 Ile-de-France C W 2FS6 Midi-Pyrnes D W 3FS7 Midi-Pyrnes D W 3FS8 Midi-Pyrnes D R 1FS9 Auvegne E R/W 2FS10 Aquitaine F W 1FS11 Pays de la Loir G W 1FS12 Pays de la Loir G W 1FS13 Rhne-Alpes H W 3FS14 Alsace I W 1FS15 Ile-de-France J W 1FS16 Pays de la Loir G R 1

a W, Triticum aestivum (soft wheat) our; R, Secale cereale (rye) our.b First number indicates the length of back slopping (h), the second number indicates the teand Sugihara, 1971), MRS5 (Meroth et al., 2003), and M17 + glucose(containing glucose 5 g/L instead of lactose) agar media (Oxoid,Basingstoke, Hampshire, UK), supplemented with cycloheximide(0.1 g/L). Plates were incubated under anaerobiosis at 30 C for48 h. For each sourdough batch, at least ten colonies were randomlyselected from the plates containing the highest sample dilutions,provided that the number of colonies on plates ranged from 100 to300. Gram-positive, catalase-negative, non-motile rods and cocciisolates were cultivated in mMRS, SDB, MRS5 or M17 + glucosebroth media at 30 C for 24 h and re-streaked onto the same agarmedia. All isolates considered for further analyses were able to acidifythe culturemedium. The number of yeasts was estimated on SabouraudDextrose Agar (SDA) (Oxoid) supplemented with chloramphenicol(0.1 g/L). Colonies were counted after incubation at 30 C for 48 h.Ten randomly selected colonies of yeasts were sub-cultured onSabouraud Dextrose broth and re-streaked onto the same agarmedium.

2.4. Genotypic characterization by Randomly Amplied PolymorphicDNA-Polymerase Chain Reaction (RAPD-PCR) analysis

Genomic DNA of LAB was extracted using DNeasy Blood and TissueKit (Qiagen, SA, Courtaboeuf, France), according to the manufacturer'sinstructions (Ahmed et al., 2009). Three oligonucleotides, P4 5-CCGCAGCGTT-3, P7 5-AGCAGCGTGG-3, and M13 5-GAGGGTGGCGGTTCT-3, were used. Reaction mixture and PCR conditions for primersP4 and P7 were those described by De Angelis et al. (2001). PCR

urdough samples (FS1FS16).

steps Time (h) and temp (C) of back sloppingb

5, 285, 284, 254, 251, 35 (1st back slopping); 16, 14 (2nd back slopping)3, 26 (1st back slopping); 12, 6 (2nd back slopping); 3, 26 (3rd back slopping)3, 26 (1st back slopping); 12, 6 (2nd back slopping); 3, 26 (3rd back slopping)20, 265, 25 (1st back slopping); 8, 8 (2nd back slopping)5, 265, 255, 253, 28 (1st back slopping); 1, 10 (2nd back slopping); 1, 14 (3rd back slopping)6, 204, 145, 25mperature (C) of incubation.

conditions for primer M13 were according to Siragusa et al. (2009). Thesimilarity of the electrophoretic proles was evaluated by determiningthe Dice coefcient. One unique dendrogram, including bacterial isolatesfrom all the sourdough samples, was built using the Unweighted PairGroupMethodwith Arithmeticmean (UPGMA) algorithm. Isolates show-ing signicantly different proles were grouped in one nal dendrogram.

Genomic DNA from yeast isolates were extracted using the WizardGenomic DNA Purication kit (Promega Corporation, Madison, WI),according to the manufacturer's instructions (Soteropoulos and Perlin,1998). Two oligonucleotides, M13m 5-GAGGGTGGCGGTTC-3 andRP11 5-GAAACTCGCCAAG-3, were used. Reaction mixture and PCRconditions for primers M13m and RP11 were those described by DelBove et al. (2009). The similarity of the electrophoretic proles was

template DNA in 1 Taq buffer (TrisHCl 100 mM pH 8.85, KCl250 mM, (NH4)2SO4 50 mM, MgSO4 20 mM). Amplicons from threePCRs per sample were puried with QIAquick kit (Qiagen), checkedfor size, quality and quantity on Experion DNA 12K chips (Biorad,Marne-la-coquette, France), then pooled in equal quantities (Chaillouet al., 2015). For each PCR pool, two sequencing replicates wereperformed using 454 GS-FLX Titanium platform (Eurons Genomics).Following sequencing, all failed sequence reads, low-quality sequenceends, and tags were removed (denoising). The resulting sequencecollections were chimera-checked using Decipher (Wright et al.,2012). Afterwards, the remaining sequences were assembled (99%similarity) into clusters using CD-HIT (Li and Godzik, 2006). The mostabundant sequence for each cluster was used as a query in the

con

163E. Lhomme et al. / International Journal of Food Microbiology 215 (2015) 161170evaluated as described for LAB. Isolates showing signicantly differentproles were grouped in one nal dendrogram using the UPGMAalgorithm.

2.5. Genotypic identication of LAB and yeasts

All strains of LAB were identied by partial sequence analysis of 16SrRNA and, if needed, of recA and pheS genes, using the primer pairsdetailed in Table 2.

Yeasts were identied by amplication of the D1/D2 domain of the26S rDNA (Kurtzman and Robnett, 1998). After purication with GFXPCR DNA gel band purication kit (GE Healthcare Bio-Sciences), PCRproducts of LAB and yeasts were sequenced at Eurons Genomics(Ebersberg, Germany). Pair-wise sequence alignments were carriedout using the BLAST search in the NCBI Nucleotide Collection Database(Altschul et al., 1990).

2.6. DNA extraction from sourdough samples and 16S metagenetics analysis

Bacterial DNA was directly extracted from 30 g of sourdoughs(Jaffrs et al., 2009). Samples were homogenized for 2 min with270 mL of sterile saline solution (NaCl 8.5 g/L, tryptone 1 g/L, Tween80 20 g/L) using a stomacher (AES Laboratories, France). The suspension(10 mL) was ltered on a Nucleospin Plant L column (Machery-Nagel,Hoerdt, France) by centrifugation (8078 g, 10 min, 20 C) to separatebacterial from eukaryotic cells. The resulting pellet was re-suspendedin 400 L of enzymatic lysis solution (TrisHCl 20 mM pH 8.0, sodiumEDTA 2 mM, Triton X-100 12 g/L, lysozyme 20 g/L, mutanolysin11.6 U) and incubated at 37 C for 1 h. 0.3 g of glass beads (150 to200 m diameter) were added and cells were broken (2 min shaking,2min pausing on ice, 2min shaking) in a bead beater (BioSpec Products,Bartlesville, OK, USA). DNA was puried using the DNeasy Blood andTissue kit (Qiagen) according to the manufacturer's instructions.

The bacterial diversity was studied by 16S metagenetics of theamplied V1V3 region of the 16S rRNA gene (Chaillou et al., 2013).The PCR mixture (50 L) contained: 0.2 mM of desoxynucleotidetriphosphate mix (Interchim, Montluon, France), 2.5 U of PWO DNApolymerase (Roche Diagnostics, Meylan, France), 0.16 to 0.30 ng/L of

Table 2Primers used for identication of lactic acid bacteria.

Primer Sequence (53) Annealing temperature (C) Ampli

LacbF TGCCTAATACATGCAAGT 49 1482LacbR CTTGTTACGACTTCACCCrecALb1F CRRTBATGCGBATGGGYG 55 770recALb1R CGRCCYTGWCCAATSCGRTCpheS-21-F CAYCCNGCHCGYGAYATGC 48 413pheS-23-R GGRTGRACCATVCCNGCHCCcasei TGCACTGAGATTCGACTTAA 55 290para CACCGAGATTCAACATGGY2 CCCACTGCTGCCTCCCGTAGGAGTLTPs104 database (Munoz et al., 2011), and multiple alignment wasdone using gsMAPPER.When anOTU stringently alignedwith a databasetaxon (at least 99% identity and 80% of length coverage), the OTU wasattributed to that taxon. OTU classied as chloroplasts andmitochondriawere removed. The relative abundance (%) of each bacterial OTU wasanalysed individually for each sample.

2.7. Enumeration of L. sanfranciscensis by quantitative PCR (qPCR)

The pheS gene of the DNA extracted from the sourdough sampleswasampliedwith primers LS-1F and LS-1R as described by Scheirlinck et al.(2009). Previously, a standard curve was constructed on a target strain,L. sanfranciscensis ATCC 43332, by preparing a bacteria-free doughusing sterilized soft wheat our and sterile tap water. Subsequently,the dough was inoculated with suspensions of L. sanfranciscensis ATCC43332, in the range 410 log CFU/g. One non-inoculated dough wasused as negative control. The different bacterial cell densities wereplotted against the corresponding CT values. Amplication efciency(E) was calculated as E = 101/slope (Klein, 2002). L. sanfranciscensis inthe sourdough samples was quantied by qPCR, using the mean valuesof CT obtained in three independent qPCR experiments. The relativeaccuracy, dened as the degree of correspondence between the celldensity of L. sanfranciscensis estimated by plate counting and by qPCR,was calculated as the ratio (cell density by qPCR/cell density by platecounting), multiplied by 100 (Rodrguez-Lzaro et al., 2004).

2.8. Statistical analysis

Microbiological and biochemical data were subjected to paircomparison of treatment means by Tukey's procedure at P b 0.05,using Statistica 7.0 for Windows (StatSoft Italia srl, Vigonza, Italy).Multiple testing of corrected pairwise Spearman correlations wascomputed between cell density of LAB, pH, TTA, lactic and aceticacid, percentage of LAB species and maltose, glucose, fructose andFAA in the our. Correlations between percentage of LAB species,lactic and acetic acid, time and temperature of back slopping werealso computed. Permutation analysis was also carried out usingPermutMatrix.

size (bp) Position of the primers in the 16S rRNA gene Reference

3855 from Lactobacillus brevis Corsetti et al. (2004)15031520 from L. brevis

Di Cagno et al. (2009)

Naser et al. (2005)

6584 from Lactobacillus casei Ward and Timmins (1999)6784 from Lactobacillus paracasei338361 from Escherichia coli

3. Results

3.1. Biochemical and microbiological characteristics of sourdoughs

Table 3 summarizes the biochemical characteristics of Frenchsourdoughs. pH ranged from 3.23 0.02 (FS4) to 4.01 0.06 (FS16).The median value was 3.5. TTA showed a median value of 16.2 mLNaOH 0.1 N. The concentration of D,L-lactic acid was 58 4 mM (FS5)to 117 2 mM (FS7), being the median value 94.5 mM. The medianvalue of acetic acid was 14.5 mM. Quotients of fermentation were low,with variations from 1.7 0.2 to 6.6 1.3. The 16 French sourdoughscontained variable concentrations of FAA, which ranged from742 12 mg/kg (FS12) to 4768 29 mg/kg (FS16) (median value1396 mg/kg).

In order to compare the FAA-generating capacity of the sourdoughmicrobiota with that of our endogenous protease, concentrations ofFAA were also determined in the ours and in the related chemicallyacidied and incubated doughs. Compared to our, chemically acidieddough showed higher amount of cys, val, met, ile, leu, tyr, phe, GABA,

8.B11 (bakery D, cluster II); 11.C1, 12.C15 and all the strains fromFS16 sourdough (bakery G, cluster II). Only in one case, an exact corre-spondence between the RAPD proles of two strains (12.B3 and16.C15), isolated from different sourdoughs of the same bakery (G),was found. Based on the partial sequence of 16S rRNA gene,L. sanfranciscensiswas identied in all the sourdoughs (SupplementaryTable S1). The only exception was FS5 sourdough, which did not harborthis species at the 107 dilution. The highest number of strains wasidentied as L. sanfranciscensis (63% of the total of isolates). FS5, FS6,FS7, and FS8 sourdough samples harbored strains allotted to Lactobacillusplantarum (5%). About the 73% of isolates from FS5 sourdough wereidentied as Lactobacillus xiangfangensis. Leuconostoc mesenteroidesco-dominated sourdough FS3 with L. sanfranciscensis. Lactobacillusdiolivorans dominated FS15 sourdough together with Lactobacillusparabrevis/L. hammesii.

As regards yeasts, the combined RAPD proles were subjected tocluster analysis, which revealed that similarity among isolates rangedfrom ca. 65 to 97% (Fig. 4). At 80% of similarity, strains were groupedin 13 clusters (IXIII), with just two unclustered. Overall, the clustering

FS15 sourdough samples. L. plantarum (57%) and L. hammesii (34%)were dominant OTU in FS5. In addition, these two species were

con

164 E. Lhomme et al. / International Journal of Food Microbiology 215 (2015) 161170his, lys, and arg (median value of total FAA of 648 and 928 mg/kg,respectively) (Fig. 1 and Supplementary Fig. 1). No signicant (P N 0.05)differences were found for ala, thr, ser, and pro, whereas asp, glu, gly,trp, and orn decreased in the chemically acidied dough. Except for thrand GABA, all the other FAA increased in the sourdoughs, compared tothe related acidied doughs. No signicant (P N 0.05) differences werefound for his and asp.

Median values of LAB cell densities were 6.2, 9.2, and 8.2 log CFU/g,as enumerated on mMRS, SDB, and MRS5, respectively (Fig. 2). Thehighest cell density (9.5 0.3 log CFU/g) was found for FS7 and FS8sourdoughs, regardless of the medium used. No presumptive LABwere detectable on M17 + glucose agar, except for sourdoughs FS3and FS4 (ca. 6.0 log CFU/g) (data not shown). Cell density of yeastsvaried from 4.7 0.2 (FS9) to 7.6 0.3 (FS6) log CFU/g (medianvalue 6.5 log CFU/g) (Fig. 2).

3.2. Isolation and identication of LAB and yeasts in sourdoughs

Four-hundred-thirty-one Gram-positive, catalase-negative, non-motile, cocci and/or rods acidifying isolates were subjected to RAPDanalysis resulting in 126 strains (Supplementary Table 1 and Fig. 3). At85% of similarity, strains were grouped in 20 clusters (IXX), with 20unclustered. Except for the cluster XV, grouping all the strains isolatedfrom sourdough FS10, the clustering of the strains was not related tothe sourdough samples they were isolated from. In addition, a fewstrains from sourdoughs collected in the same bakery grouped in thesame cluster: 1.C2 and 2.B2 (bakery A, cluster III); 6.B6, 7.B4, and

Table 3Mean values (and standard deviation) of pH, total titratable acidity (TTA, mL NaOH 0.1 N),amino acids (mg/kg) of the 16 French sourdough samples (FS1FS16).

Sourdough pH TTA (mL NaOH 0.1 N) Lactic acid (mM)

FS1 3.42 (0.02)fg 13.3 (0.2)f 95 (4)cde

FS2 3.63 (0.01)e 19.0 (0.4)d 91 (3)ef

FS3 3.42 (0.01)fg 10.7 (0.5)g 63 (3)h

FS4 3.23 (0.02)j 14.5 (0.4)f 102 (5)b

FS5 3.24 (0.02)j 8.3 (0.3)h 58 (4)h

FS6 3.27 (0.01)ij 19.7 (0.6)cd 99 (4)bcd

FS7 3.36 (0.02)gh 11.2 (0.5)g 117 (2)a

FS8 3.32 (0.03)hi 8.7 (0.5)h 101 (5)bc

FS9 3.44 (0.03)f 10.9 (0.2)g 63 (1)h

FS10 3.62 (0.02)e 21.5 (0.3)ab 100 (3)bc

FS11 3.81 (0.03)c 16.5 (0.4)e 73 (4)g

FS12 3.48 (0.04)f 21.3 (0.3)ab 89 (5)f

FS13 3.72 (0.06)d 20.8 (0.6)bc 100 (4)bc

FS14 3.98 (0.10)ab 22.1 (0.2)a 105 (5)b

FS15 3.89 (0.04)bc 16.0 (0.5)e 78 (3)g

FS16 4.01 (0.06)a 18.5 (0.4)d 94 (2)def

amValues within a column with different superscript letters are signicantly different (P b 0.0sub-dominant (b0.1%) in all the other sourdoughs, except for FS1,FS2, and FS6. L. diolivorans was dominant (95%) in FS15, andsub-dominant (0.2%) in FS1, FS5, FS8, FS12, FS13, and FS14 sour-doughs. Other sub-dominant species (relative abundance of 0.11%) var-iously detected were Acetobacter pasteurianus, Lactobacillus farraginis,Lactobacillus koreensis, Lactobacillus hilgardii, Lactobacillus pontis, andL. xiangfangensis.

centration of organic acids (mM), quotient of fermentation, and concentration of total free

Acetic acid (mM) Quotient of fermentation Free amino acids (mg/kg)

30 (2)c 3.2 (0.3)ef 1304 (22)h

22 (1)de 4.1 (0.4)de 2828 (29)c

15 (1)f 4.2 (0.5)cde 2268 (25)e

59 (3)a 1.7 (0.2)g 2835 (18)c

25 (5)cd 2.3 (0.6)fg 775 (15)l

15 (2)f 6.6 (1.3)a 1295 (25)hi

19 (1)def 6.1 (0.5)a 2172 (26)f

19 (1)def 5.3 (1.8)abc 3452 (29)b

15 (3)f 4.2 (1.1)cde 2775 (20)d

17 (1)f 5.9 (0.5)ab 1269 (16)i

16 (2)f 4.6 (0.9)bcde 1488 (19)g

18 (2)ef 4.9 (0.9)bcd 742 (12)m

15 (3)f 6.6 (2.0)a 1218 (20)j

17 (1)f 6.2 (0.7)a 953 (15)k

37 (4)b 2.1 (0.3)g 1278 (30)i

16 (1)f 5.9 (0.5)ab 4768 (29)aof the strains was not related to the sourdough samples they wereisolated from. Only few strains from sourdoughs collected in the samebakery fell in the same cluster (Supplementary Table 2). Saccharomycescerevisiae was identied in all the sourdoughs, except for FS4, thatharbored only isolates allotted to Kazachstania servazzii (formerlySaccharomyces servazzii). Yeast microbiota of FS3 sourdoughwas repre-sented by S. cerevisiae and K. servazzii (Supplementary Table 2).

3.3. 16S metagenetics analysis of the sourdoughs

A total of 683,962 quality-trimmed sequences of 16S rRNA geneampliconswere obtained. The average number of sequences per samplewas 42,748,with an average length of 571 bp. After analysis, a total of 20OTUwere identied. Table 4 shows, for each sourdough, the OTU foundwith a relative abundance of at least 0.1%. L. sanfranciscensiswas detectedat 99% of relative abundance in 14 out of 16 French sourdoughs. This OTUwas also detected, at much lower relative abundance, in FS5 and5).

165E. Lhomme et al. / International Journal of Food Microbiology 215 (2015) 1611703.4. qPCR quantication of L. sanfranciscensis in sourdoughs

Since the results of culture-dependent and -independent methodsshowed the large relevance of L. sanfranciscensis, this species was quan-tied also by qPCR in all sourdoughs. The linear relation (R2 = 0.98)between known cell densities and CT was: (1) CT = 3.0938 celldensity + 42.55, which indicates an amplication efciency of110%. The detection limitwas estimated as 4.0 log CFU/g (SupplementaryFig. 2). L. sanfranciscensis, as detected by qPCR, ranged from 4.9 (FS3) to9.9 (FS7) log CFU/g (Table 5). These results were compared with thecell density of L. sanfranciscensis estimated by plate counting, 16S rRNAand RAPD-PCR (from 7.0 to 9.5 log CFU/g). The relative accuracy of theqPCR-based method with respect to the plate counting method variedfrom 70 to 106%. The cell density estimated by qPCR was higher thanthat estimated by plate counting, with the exceptions of FS3 (70%), FS9and FS12 (99%), and FS15 (86%) sourdough samples.

3.5. Permutation analysis

Fig. 5 shows the permutation analysis based on time and temperatureof back slopping, results of pH, TTA, concentrations of lactic acid, aceticacid, and FAA, cell density of LAB and yeasts, presence of LAB species,and relative abundance of bacterial OTU in the 16 French sourdough sam-ples. Except for FS5 and FS15, all sourdoughswere grouped in one uniquecluster (I). As revealed by both culture-dependent and -independent

Fig. 1. Concentration of individual FAA in the ours (amino acid our) used for propagating th(amino acid AD), and in the 16 French sourdough samples (amino acid S). FAA are grounon-proteinogenic (panel D). The center line of each box represents the median (), the top antop and bottomof the error bars represent the 95th and 5th percentiles of the data, respectivelyare represented as individual data points (*).methods, FS5 and FS15 were unclustered because their LAB microbiotawas dominated by species different from L. sanfranciscensis and becausetheir protocol of propagation includes one back slopping step performedat 14 C. FS5 and FS15 differed also for the amount of lactic acid and FAA.FS13 and FS14 sourdoughs (cluster IA) were separated from the others(cluster IB) due to the high TTA, high concentration of lactic acid, andthe presence of L. paracasei as sub-dominant LAB species. Sourdoughsamples FS11, FS12, and FS16, collected in the same bakery (G), showedhigh similarity, due to the identical time and temperature of backslopping, and relatively low cell density of yeasts. FS6 (bakery D) wasvery similar to FS8 sourdough, started in the same bakery with FS6,but propagated with rye instead of wheat our and with one uniquelong (20 h) back slopping step.

3.6. Correlations between lactic acid bacteria, substrate nutrients, and otherenvironmental parameters

Cell density of LAB in the sourdoughs was positively correlated withconcentrations of glucose and fructose in the substrate (Fig. 6A). Positivecorrelations (r N 0.5; P b 0.05)were found between L. sanfranciscensis andall the FAA, except for thr, orn and pro. pH was positively correlatedwith ornithine. Correlations between species of LAB isolated fromthe sourdoughs, concentrations of lactic and acetic acid, timeand temperature of back slopping were also computed (Fig. 6B).L. sanfranciscensis was positively correlated (r = 0.90) with temper-ature of back slopping and negatively correlated with L. parabrevis/

e 16 French sourdough samples, in the related chemically acidied and incubated doughsped into polar charged (panel A), polar uncharged (panel B), non-polar (panel C), andd bottom of the box represent the 75th and 25th percentiles of the data, respectively. The. The circles in each box plot extend to the outliers of the data (), and very extreme points

Fig. 2.Histogram and box plot representations of cell density (log CFU/g) of presumptive lactic acid bacteria and yeasts in the 16 French sourdough samples (FS1FS16). The center line ofeachbox represents themedian (), and the top and bottomof the box represent the 75th and 25th percentiles of the data, respectively. The top andbottomof the error bars represent the95th and 5th percentiles of the data, respectively. Very extreme points are represented as individual data points (*).

Fig. 3.Dendrogram of combined (primers P4, P7 andM13) RAPD proles of lactic acid bacterium strains isolated from the 16 French sourdough samples (FS1FS16). Cluster analysis wasbased on the Dice coefcient of similarity and UPGMA algorithm. The rst number (1-16) of the strain name indicates the sourdough (FS1-FS16) of origin, whereas the letter of the strainname indicates the medium used for the isolation (A, mMRS; B, SDB; C, MRS5; D, glucose-M17).

166 E. Lhomme et al. / International Journal of Food Microbiology 215 (2015) 161170

167E. Lhomme et al. / International Journal of Food Microbiology 215 (2015) 161170hammesii, L. diolivorans and L. xiangfangensis. Positive correlationswere found between L. xiangfangensis and time of back slopping.

4. Discussion

This study describes the LAB and yeastmicrobiotas of 16 sourdoughsused for themanufacture of traditional French breads. Themedian value(3.5) of the pHwas lower than found for Italian sourdoughs (3.704.28)(Minervini et al., 2012a). According to this nding, concentrations oflactic and acetic acids were higher compared to previous studies onItalian sourdoughs (Di Cagno et al., 2014; Minervini et al., 2012a,2012b). According to other sourdoughs (Lattanzi et al., 2013), a highvariability was found for concentration of FAA. This was the resultantof multiple factors: (i) differences between ours in terms of initialconcentration of FAA and of endoprotease activity (Gnzle, 2014) and(ii) differences in terms of strains harbored in the sourdough samples(De Angelis et al., 2007). Based on the results of this study, endogenousproteolytic activity increased the concentration of FAA. The onlyexception was for FS3 sourdough. In agreement with other studies(Randazzo et al., 2005; Vera et al., 2009), viable cell counts of LABdiffered depending on the medium. Apart from the culture mediumand considering the highest value for each sourdough, the median celldensity of LAB was 9.2 log CFU/g. The ratio between LAB and yeasts ofthe 16 French sourdoughs ranged from 10,000:1 to 10:1.

Sourdoughs showed a different number of bacterial strains, rangingfrom 5 (FS9, FS11 and FS15) to 12 (FS1 and FS13), meaning a highlyvariable diversity. Similar results were found for Italian sourdoughs(Lattanzi et al., 2013; Minervini et al., 2012a, 2012b). Cluster analysisshowed that different sourdoughs, especially when propagated inthe same bakery, may harbor similar strains. According to the culture-

Fig. 4. Dendrogram of combined (primers M13m and RP11) RAPD proles of yeast strains isolaDice coefcient of similarity and UPGMA algorithm.dependent method, L. sanfranciscensis was the dominant species inFrench sourdoughs. FS5 and FS15 were the only exceptions. This resultwas in agreement with 16S metagenetics analyses performed on sour-doughs used for the manufacture of traditional Italian sweet leavenedbaked goods (Lattanzi et al., 2013) and on French organic sourdoughs(Lhomme et al., 2015). L. sanfranciscensis is probably the most adaptedspecies and regarded as autochthonous key organism in type-I sour-doughs (De Vuyst et al., 2014). Although the minimal growth pH forL. sanfranciscensis is 3.84.0 (Gnzle et al., 1998), it is found at high celldensity in sourdoughswith pHbelow3.8. Response of L. sanfranciscensisto different stresses has been previously studied. Following exposureto low (3.6) pH, L. sanfranciscensis switches from carbohydrates toamino acid catabolism. Leucine is converted into 3-methylbutanoicacid, allowing generation of ATP and contributing to maintain theNAD+/NADH balance (Serrazanetti et al., 2011). In the current studypositive correlations were found between L. sanfranciscensis and con-centration of almost all the FAA in the substrate.

Most of the sourdoughs object of study were characterized by short(36h) timeof back slopping,which selects for rapidly growing bacterialspecies (Vogelmann and Hertel, 2011). L. sanfranciscensis has a genera-tion time between 4 and 6 h that allows it to outcompete other bacteriawhen short fermentation times are applied for back slopping (Ferchichiet al., 2008; Garofalo et al., 2008; Picozzi et al., 2010; Venturi et al., 2012).High positive correlation was found between L. sanfranciscensis andtemperature of back slopping. FS5 and FS15, the only two sourdoughs,wherein L. sanfranciscensis was not detectable or subdominant, sharedone back slopping step run at 14 C. First, this study highlighted thepresence of L. xiangfangensis and L. diolivorans in sourdough ecosys-tem. L. xiangfangensis, dominant in FS5, was recently identied intraditional Chinese pickle (Gu et al., 2012). This species, belonging

ted from the 16 French sourdough samples (FS1FS16). Cluster analysis was based on the

Fig. 5. Differences in time and temperature of back slopping, pH, total titratable acidity (TTA), concentrations of lactic acid, acetic acid, free amino acids (FAA), cell densities of lactic acidbacteria enumerated onMRS5,mMRS, and SDB agarmedia, cell density of yeasts (SDA), percentage of isolates allotted (on the basis of 16S rRNA, recA, and pheS sequencing andRAPD-PCR)to the different lactic acid bacterium species, and relative abundance of bacterial OTU detected by 16Smetagenetics among the 16 French sourdough samples (FS1FS16). The ingredientsand technology parameters used for sourdough daily back slopping are reported in Table 1. Euclidean distance andMcQuitty's criterion (weighted-pair groupmethodwith averages)wereused for clustering. Colors correspond to normalizedmean data levels from low (green), to zero (black), to high (red). The color scale, in terms of units of standard deviation, is also shown. L. sf.,Lactobacillus sanfranciscensis; L. pl., Lactobacillus plantarum; L. r., Lactobacillus rossiae; L. pb., Lactobacillus parabuchneri; L. pbr., Lactobacillus parabrevis; L. x., Lactobacillus xiangfangensis; Leuc. m.,Leuconostoc mesenteroiodes; L. f., Lactobacillus fermentum; Leuc. c., Leuconostoc citreum; L. c., Lactobacillus casei; L. pc., Lactobacillus paracasei; L. d., Lactobacillus diolivorans; S. s., Streptococcussalivarius; E. f., E. faecium,; L. sf._P., OTU corresponding to Lactobacillus sanfranciscensis; L. pl._P, OTU corresponding to Lactobacillus plantarum; L. h._P, OTU corresponding to Lactobacillushammesii; L. d._P, OTU corresponding to Lactobacillus diolivorans. (For interpretation of the references to color in this gure legend, the reader is referred to the web version of this article.)

Fig. 6. Correlations between cell density of lactic acid bacteria (LAB), lactic and acetic acid, pH, total titratable acidity (TTA), percentage of lactic acid bacteria isolates and concentration ofmaltose, glucose, fructose, and individual and total free amino acids (Total FAA_S) in the substrate (A) andbetween percentage of lactic acid bacteria isolates, lactic and acetic acid, time andtemperature of back slopping (B). Concentrations of individual free amino acids are indicated by the three-letter code, except for -aminobutyric acid (GABA). Colors correspond tonormalized mean data levels from low (green), to zero (black), to high (red). The color scale, in terms of units of standard deviation, is also shown. L. parabuc, Lactobacillus parabuchneri;Leuc. cit, Leuconostoc citreum; L. xiang, Lactobacillus xiangfangensis; L. diol, Lactobacillus diolivorans; L. parac, Lactobacillus paracasei; E. faec, Enterococcus faecium; L. plant, Lactobacillusplantarum; L. ferm, Lactobacillus fermentum; L. sanfr, Lactobacillus sanfranciscensis; Leuc.mes, Leuconostoc mesenteroides; S. sal, Streptococcus salivarius. (For interpretation of the referencesto color in this gure legend, the reader is referred to the web version of this article.)

168 E. Lhomme et al. / International Journal of Food Microbiology 215 (2015) 161170

to the L. plantarum group, can grow at 37 C (Gu et al., 2012). FS5 was

Table 4Relative abundance (%) of OTU detected in the 16 French sourdough samples (FS1FS16).

Sourdough OTU detected and relative abundance (%)a

FS1 Lactobacillus sanfranciscensis (99.8)FS2 L. sanfranciscensis (100)FS3 L. sanfranciscensis (98.9); Lactobacillus plantarum (0.2); Lactobacillus

hammesii (0.2); Escherichia coli (0.6)FS4 L. sanfranciscensis (99.5); L. plantarum (0.2)FS5 L. sanfranciscensis (7.6); Lactobacillus diolivorans (0.2); L. plantarum

(57.4); L. hammesii (34.5); Lactobacillus xiangfangensis (0.1);Lactobacillus koreensis (0.1)

FS6 L. sanfranciscensis (99.9)FS7 L. sanfranciscensis (99.9)FS8 L. sanfranciscensis (98.9); Acetobacter pasteurianus (1.0)FS9 L. sanfranciscensis (99.9)FS10 L. sanfranciscensis (99.9)FS11 L. sanfranciscensis (99.9)FS12 L. sanfranciscensis (99.8)FS13 L. sanfranciscensis (99.9)FS14 L. sanfranciscensis (99.9)FS15 L. sanfranciscensis (3.6); L. diolivorans (95.1); L. hammesii (0.2);

A. pasteurianus (0.1); Lactobacillus farraginis (0.5); Lactobacillushilgardii (0.3)

FS16 L. sanfranciscensis (99.4); Lactobacillus pontis (0.5)

a OTU detected at a relative abundance of at least 0.1%.

169E. Lhomme et al. / International Journal of Food Microbiology 215 (2015) 161170a wheat-based sourdough characterized by a rst back slopping withhigh temperature (35 C) and short time (1 h) and a second stepwithlong time (16 h) and low temperature (14 C). L. diolivorans is anobligately heterofermentative LAB rst isolated from aerobicallystable maize silage (Krooneman et al., 2002). L. diolivorans converts1,2-propanediol into 1-propanol and propionate, which effectivelydelays mould growth on bread by several days (Zhang et al., 2010).As previously found for other sourdoughs (Lattanzi et al., 2013; Robertet al., 2009), the co-dominance of L. plantarum and L. sanfranciscensiswas not found.

16S metagenetics conrmed the strong dominance ofL. sanfranciscensis in French sourdough samples. Indeed, 14 out of16 sourdough samples showed ca. 99% of bacterial OTU assigned toL. sanfranciscensis. The low pH of the French sourdough samplesmay have inhibited some bacterial phyla (e.g., Proteobacteria), but alsoTable 5Quantication (log CFU/g) of L. sanfranciscensis in the 16 French sourdough samples(FS1-FS16), as estimatedby quantitative PCR (qPCR) andby plate counting, and percentageof relative accuracy of qPCR.

Sourdough qPCR(log CFU/g)a

Plate counting(log CFU/ga)

Relativeaccuracy (%)b

FS1 8.3 ef 8.08 f 102FS2 9.2 b 9.05 bc 102FS3 4.9 i 7.01 g 70FS4 8.8 cd 8.50 def 103FS5 6.5 gh nd nade

FS6 9.5 ab 9.18 b 103FS7 9.9 a 9.50 a 104FS8 9.7 ab 9.38 ab 103FS9 8.5 def 8.60 de 99FS10 8.3 ef 8.30 ef 100FS11 8.8 cd 8.71 cd 101FS12 9.2 b 9.28 ab 99FS13 9.6 ab 9.05 bc 106FS14 9.3 b 9.11 b 102FS15 6.0 h 7.00 g 86FS16 9.6 ab 9.11 b 105

aiValues within a columnwith different superscript letters are signicantly different (P b0.05).

a Mean values of triplicate determinations.b Relative accuracy was calculated as described in the Materials and methods section.c n.d., not detected in the plate coming from 107 dilution.d n.a, not applicable.some LAB genera (e.g., Lactococcus). Indeed, sourdoughs showing higherpH values (4.14.3) harbored, besides Lactobacillus, Lactococcus,Weissellaand Leuconostoc genera (Ercolini et al., 2013; Robert et al., 2009). Exceptfor L. plantarum (FS5) and Ln. mesenteroides (FS3), all the dominantspecies were detected by both 16S metagenetics and culture-dependentmethod. The highest amount of reads in FS5 was erroneously assignedto L. plantarum because 16S rRNA gene does not distinguish betweenL. plantarum and L. xiangfangensis. High discordance was found between16S metagenetics and culture-dependent method regarding sub-dominant LAB.

Compared to LAB, French sourdough samples were characterized bylower yeast diversity. One recent research on ve French organic sour-doughs showed nine different yeast species (Lhomme et al., 2014). Inthis study, K. servazzii was found as the unique (FS4) or co-dominant(FS3) yeast species. This maltose-negative species, typical of kimchi(Jin et al., 2007), was previously found only in one Italian sourdough(Di Cagno et al., 2014).

This study gave a comprehensive and comparative view of themicrobial and biochemical characteristics of a wide number of Frenchsourdoughs. The results of this study conrmed the broad adaptabilityof L. sanfranciscensis strains to sourdough ecosystem. Strains isolatedin this study could be a useful base for developing new basicresearches on physiology, metabolism, and intraspecic diversity ofL. sanfranciscensis. In addition, this study represents a base forexploiting further, following appropriate characterization, LAB andyeast strains as means to warrant a highly reproducible quality ofthe French breads, while keeping their traditional features.

Acknowledgments

This work was supported by Beldem S.A. (Rue Borrie 12, Andenne,Belgium).

Appendix A. Supplementary data

Supplementary data to this article can be found online at http://dx.doi.org/10.1016/j.ijfoodmicro.2015.09.015.

References

Ahmed, W., Sawant, S., Huygens, F., Goonetilleke, A., Gardner, T., 2009. Prevalence andoccurrence of zoonotic bacterial pathogens in surfacewaters determined by quantitativePCR. Water Res. 43, 49184928.

Altschul, S.F., Gish, W., Miller, W., Myers, E.W., Lipman, D.J., 1990. Basic local alignmentsearch tool. J. Mol. Biol. 215, 403410.

Cappelle, S., Lacaze, G., Gnzle, M., Gobbetti, M., 2013. History and social aspects ofsourdough. In: Gobbetti, M., Gnzle, M.G. (Eds.), Handbook of SourdoughBiotechnology. Springer Science + Business Media, New York, pp. 110.

Chaillou, S., Chaulot-Talmon, A., Caekebeke, H., Cardinal, M., Christieans, S., Denis, C.,Hlne Desmonts, M., Dousset, X., Feurer, C., Hamon, E., Joffraud, J.J., La Carbona, S.,Leroi, F., Leroy, S., Lorre, S., Mac, S., Pilet, M.F., Prvost, H., Rivollier, M., Roux, D.,Talon, R., Zagorec,M., Champomier-Vergs,M.C., 2015. Origin and ecological selectionof core and food-specic bacterial communities associated with meat and seafoodspoilage. ISME J. 9, 11051118.

Chaillou, S., Lucquin, I., Najjari, A., Zagorec, M., Champomier-Verges, M.C., 2013. Populationgenetics of Lactobacillus sakei reveals three lineages with distinct evolutionaryhistories. PLoS One 8, e73253.

Corsetti, A., Settanni, L., Van Sinderen, D., 2004. Characterization of bacteriocin-like inhibitorysubstances (BLIS) from sourdough lactic acid bacteria and evaluation of their in vitroand in situ activity. J. Appl. Microbiol. 96, 521534.

De Angelis, M., Corsetti, A., Tosti, N., Rossi, J., Corbo, M.R., Gobbetti, M., 2001. Characterizationof non-starter lactic acid bacteria from Italian ewe cheeses based on phenotypic,genotypic and cell-wall protein analyses. Appl. Environ. Microbiol. 67, 20112020.

De Angelis, M., Di Cagno, R., Gallo, G., Curci, M., Siragusa, S., Crecchio, C., Parente, E.,Gobbetti, M., 2007. Molecular and functional characterization of Lactobacillussanfranciscensis strains isolated from sourdoughs. Int. J. Food Microbiol. 114, 6982.

de Man, J.C., Rogosa, M., Sharpe, M.E., 1960. A medium for the cultivation of lactobacilli.J. Appl. Bacteriol. 23, 130135.

De Vuyst, L., Neysens, P., 2005. Biodiversity of sourdough lactic acid bacteria. Trends FoodSci. Technol. 16, 4356.

De Vuyst, L., Van Kerrebroeck, S., Harth, H., Huys, G., Daniel, H.M., Weckx, S., 2014.Microbial ecology of sourdough fermentations: diverse or uniform? Food Microbiol.

37, 1129.

De Vuyst, L., Vrancken, G., Ravyts, F., Rimaux, T., Weckx, S., 2009. Biodiversity, ecologicaldeterminants, and metabolic exploitation of sourdough microbiota. Food Microbiol.26, 666675.

Del Bove, M., Lattanzi, M., Rellini, P., Pelliccia, C., Fatichenti, F., Cardinali, G., 2009. Comparisonof molecular and metabolomic methods as characterization tools of Debaromyceshansenii cheese isolates. Food Microbiol. 26, 453459.

Di Cagno, R., Pontonio, E., Buchin, S., De Angelis, M., Lattanzi, A., Valerio, F., Gobbetti, M.,Calasso, M., 2014. Diversity of the lactic acid bacterium and yeast microbiota in theswitch from rm- to liquid-sourdough fermentation. Appl. Environ. Microbiol. 80,31613172.

Meroth, C.B., Walter, J., Hertel, C., Brandt, M.J., Hammes, W.P., 2003. Monitoring the bacterialpopulation dynamics in sourdough fermentation processes by using PCR-denaturinggradient gel electrophoresis. Appl. Environ. Microbiol. 69, 475482.

Minervini, F., Di Cagno, R., Lattanzi, A., De Angelis, M., Antonielli, L., Cardinali, G., Cappelle, S.,Gobbetti, M., 2012a. Lactic acid bacterium and yeast microbiotas of 19 sourdoughs usedfor traditional/typical Italian breads: interactions between ingredients and microbialspecies diversity. Appl. Environ. Microbiol. 78, 12511264.

Minervini, F., Lattanzi, A., De Angelis, M., Di Cagno, R., Gobbetti, M., 2012b. Inuence ofartisan bakery- or laboratory-propagated sourdoughs on the diversity of lactic acidbacterium and yeast microbiotas. Appl. Environ. Microbiol. 78, 53285340.

Minervini, F., Pinto, D., Di Cagno, R., De Angelis, M., Gobbetti, M., 2011. Scouting the applica-tion of sourdough to frozen dough bread technology. J. Cereal Sci. 54, 296304.

Munoz, R., Yarza, P., Ludwig, W., Euzeby, J., Amann, R., Schleifer, K.H., Glckner, F.O.,

170 E. Lhomme et al. / International Journal of Food Microbiology 215 (2015) 161170Guerzoni, M.E., Crecchio, C., Gobbetti, M., De Angelis, M., 2009. Different fecalmicrobiotas and volatile organic compounds in treated and untreated children withceliac disease. Appl. Environ. Microbiol. 75, 39633971.

Ercolini, D., 2013. High-throughput sequencing and metagenomics: moving forward inthe culture-independent analysis of food microbial ecology. Appl. Environ. Microbiol.79, 31483155.

Ercolini, D., Pontonio, E., De Filippis, F., Minervini, F., La Storia, A., Gobbetti, M., Di Cagno,R., 2013. Microbial ecology dynamics during rye and wheat sourdough fermentation.Appl. Environ. Microbiol. 79, 78277836.

Ferchichi, M., Valcheva, R., Oheix, N., Kabadjova, P., Prevost, H., Onno, B., Dousset, X., 2008.Rapid investigation of French sourdough microbiota by restriction fragmentlength polymorphism of the 16S-23S rRNA gene intergenic spacer region. WorldJ. Microbiol. Biotechnol. 24, 24252434.

Ferchichi, M., Valcheva, R., Prvost, H., Onno, B., Dousset, X., 2007. Molecular identicationof the microbiota of French sourdough using temporal temperature gradient gelelectrophoresis. Food Microbiol. 24, 678686.

Gabriel, V., Lefebvre, D., Vayssier, Y., Faucher, C., 1999. Characterization of the microorafrom natural sourdoughs. Microbiol. Aliment. Nutr. 17, 171179.

Gnzle, M.G., 2014. Enzymatic and bacterial conversions during sourdough fermentation.Food Microbiol. 37, 210.

Gnzle, M.G., Ehman, M., Hammes, W.P., 1998. Modeling of growth of Lactobacillussanfranciscensis and Candida milleri in response to process parameters of sourdoughfermentation. Appl. Environ. Microbiol. 64, 26162623.

Garofalo, C., Silvestri, G., Aquilanti, L., Clementi, F., 2008. PCR-DGGE analysis of lactic acidbacteria and yeast dynamics during the production processes of three varieties ofpanettone. J. Appl. Microbiol. 105, 243254.

Gobbetti, M., 1998. Interactions between lactic acid bacteria and yeasts in sourdoughs.Trends Food Sci. Technol. 9, 267274.

Gobbetti, M., Rizzello, C.G., Di Cagno, R., De Angelis, M., 2014. How the sourdough mayaffect the functional features of leavened baked goods. Food Microbiol. 37, 3040.

Gu, C.T., Wang, F., Li, C.Y., Liu, F., Huo, G.C., 2012. Lactobacillus xiangfangensis sp. nov.,isolated from Chinese pickle. Int. J. Syst. Evol. Microbiol. 62, 860863.

Jaffrs, E., Sohier, D., Leroi, F., Pilet, M.F., Prvost, H., Joffraud, J.J., Dousset, X., 2009. Study ofthe bacterial ecosystem in tropical cooked and peeled shrimps using a polyphasicapproach. Int. J. Food Microbiol. 131, 2029.

Jin, H.S., Kwon, Y.R., Yun, Y.J., Lee, K.J., 2007. Major microbial composition and its correlationto the taste of Jeonju kimchi. J. Korean Soc. Food Sci. Nutr. 36, 16171621.

Klein, D., 2002. Quantication using real-time PCR technology: applications and limitations.Trends Mol. Med. 8, 257260.

Kline, L., Sugihara, T.F., 1971.Microorganisms of the San Francisco sourdough bread process.II. Isolation and characterization of undescribed bacterial species responsible for thesouring activity. Appl. Microbiol. 21, 459465.

Krooneman, J., Faber, F., Alderkamp, A.C., Oude Elferink, S.J.H.W., Driehuis, F., Cleenwerck,I., Swings, J., Gottschal, J.C., Vancanneyt, M., 2002. Lactobacillus diolivorans sp. nov., a1,2-propanediol-degrading bacterium isolated from aerobically stable maize silage.Int. J. Syst. Evol. Microbiol. 52, 639646.

Kurtzman, C.P., Robnett, C.J., 1998. Identication and phylogeny of ascomycetous yeastsfrom analysis of nuclear large subunit (26S) ribosomal DNA partial sequences.Antonie Van Leeuwenhoek 73, 331371.

Lattanzi, A., Minervini, F., Di Cagno, R., Diviccaro, A., Antonielli, L., Cardinali, G., Cappelle, S.,De Angelis, M., Gobbetti, M., 2013. The lactic acid bacteria and yeast microbiota ofeighteen sourdoughs used for the manufacture of traditional Italian sweet leavenedbaked goods. Int. J. Food Microbiol. 163, 7179.

Lhomme, E., Mezaize, S., Bonnand Ducasse, M., Chiron, H., Champomier-Vergs, M.C.,Chaillou, S., Zagorec, M., Dousset, X., Onno, B., 2014. A polyphasic approach to studythe dynamics of microbial population of an organic wheat sourdough during itsconversion to gluten-free sourdough. Int. Microbiol. 17, 19.

Lhomme, E., Orain, S., Courcoux, P., Onno, B., Dousset, X., 2015. The predominance ofLactobacillus sanfranciscensis in French organic sourdoughs and its impact on relatedbread characteristics. Int. J. Food Microbiol. http://dx.doi.org/10.1016/j.ijfoodmicro.2015.05.010.

Li, W., Godzik, A., 2006. Cd-hit: a fast program for clustering and comparing large sets ofprotein or nucleotide sequences. Bioinformatics 22, 16581659.Rosello-Mora, R., 2011. Release LTPs 104 of the all-species living tree. Syst. Appl.Microbiol. 34, 169170.

Naser, S.M., Thompson, F., Hoste, B., Gevers, D., Dawyndt, P., Vancanneyt, M., Swings, J.,2005. Application of multilocus sequence analysis (MLSA) for rapid identication ofEnterococcus species based on rpoA and pheS genes. Microbiology 151, 21412150.

Observatoire du pain, 2011. http://www.observatoiredupain.fr/pro.asp?IDR=111550.Picozzi, C., Bonacina, G., Vigentini, I., Foschino, R., 2010. Genetic diversity in Italian

Lactobacillus sanfranciscensis strains assessed by multilocus sequence typingand pulsed-eld gel electrophoresis analyses. Microbiology 156, 20352045.

Randazzo, C.L., Heilig, H., Restuccia, C., Giudici, P., Caggia, C., 2005. Bacterial populationin traditional sourdough evaluated by molecular methods. J. Appl. Microbiol. 99,251258.

Robert, H., Gabriel, V., Fontagn-Faucher, C., 2009. Biodiversity of lactic acid bacteriain French wheat sourdough as determined by molecular characterization usingspeciesspecic PCR. Int. J. Food Microbiol. 135, 5359.

Rodrguez-Lzaro, D., Jofr, A., Aymerich, T., Hugas, M., Pla, M., 2004. Rapid quantitativedetection of Listeria monocytogenes in meat products by real time PCR. Appl. Environ.Microbiol. 70, 62996301.

Scheirlinck, I., Van der Meulen, R., De Vuyst, L., Vandamme, P., Huys, G., 2009. Molecularsource tracking of predominant lactic acid bacteria in traditional Belgian sourdoughsand their production environments. J. Appl. Microbiol. 106, 10811092.

Serrazanetti, D.I., Ndagijimana, M., Sado-Kamdem, S.L., Corsetti, A., Vogel, R.F., Ehrmann,M., Guerzoni, M.E., 2011. Acid stress-mediated metabolic shift in Lactobacillussanfranciscensis LSCE1. Appl. Environ. Microbiol. 77, 26562666.

Siragusa, S., Di Cagno, R., Ercolini, D., Minervini, F., Gobbetti, M., De Angelis, M., 2009.Taxonomic structure andmonitoring of the dominant population of lactic acid bacteriaduring wheat our sourdough type I propagation using Lactobacillus sanfranciscensisstarters. Appl. Environ. Microbiol. 75, 10991109.

Soteropoulos, P., Perlin, D.S., 1998. Genetic probing of the stalk segments associated withM2 and M3 of the plasma membrane H+-ATPase from Saccharomyces cerevisiae.J. Biol. Chem. 273, 2642626431.

Valcheva, R., Ferchichi, M.F., Korakli, M., Ivanova, I., Gnzle, M.G., Vogel, R.F., Prvost, H.,Onno, B., Dousset, X., 2006. Lactobacillus nantensis sp. nov., isolated from Frenchwheat sourdough. Int. J. Syst. Evol. Microbiol. 56, 587591.

Valcheva, R., Korakli, M., Onno, B., Prvost, H., Ivanova, I., Ehrmann, M.A., Dousset, X.,Gnzle, M.G., Vogel, R.F., 2005. Lactobacillus hammesii sp. nov., isolated from Frenchsourdough. Int. J. Syst. Evol. Microbiol. 55, 763767.

Venturi, M., Guerrini, S., Vincenzini, M., 2012. Stable and non-competitive association ofSaccharomyces cerevisiae, Candida milleri and Lactobacillus sanfranciscensis duringmanufacture of two traditional sourdough baked goods. FoodMicrobiol. 31, 107115.

Vera, A., Ly-Chatain, M.H., Rigobello, V., Demarigny, Y., 2012. Description of a Frenchnatural wheat sourdough over 10 consecutive days focusing on the lactobacilli presentin the microbiota. Antonie Van Leeuwenhoek 101, 369377.

Vera, A., Rigobello, V., Demarigny, Y., 2009. Comparative study of culture media used forsourdough lactobacilli. Food Microbiol. 26, 728733.

Vogelmann, S.A., Hertel, C., 2011. Impact of ecological factors on the stability of microbialassociations in sourdough fermentation. Food Microbiol. 28, 583589.

Ward, L.J.H., Timmins, M.J., 1999. Differentiation of Lactobacillus casei, Lactobacillusparacasei and Lactobacillus rhamnosus by polymerase chain reaction. Lett. Appl.Microbiol. 29, 9092.

Wright, E.S., Safak Yilmaz, L., Noguera, D.R., 2012. DECIPHER, a search-based approach tochimera identication for 16S rRNA sequences. Appl. Environ. Microbiol. 78, 717725.

Zeppa, G., Conterno, L., Gerbi, V., 2001. Determination of organic acids, sugars, diacetyl,and acetoin in cheese by high-performance liquid chromatography. J. Agric. FoodChem. 49, 27222726.

Zhang, C., Brandt, M.J., Schwab, C., Gnzle, M.G., 2010. Propionic acid production bycofermentation of Lactobacillus buchneri and Lactobacillus diolivorans in sourdough.Food Microbiol. 27, 390395.Di Cagno, R., Rizzello, C.G., Gagliardi, F., Ricciuti, P., Ndagijimana, M., Francavilla, R.,

Lactic acid bacterium and yeast microbiotas of sixteen French traditional sourdoughs1. Introduction2. Material and methods2.1. Sourdoughs2.2. Determination of pH, total titratable acidity, carbohydrates, organic acids and free amino acids2.3. LAB and yeasts enumeration and isolation2.4. Genotypic characterization by Randomly Amplified Polymorphic DNA-Polymerase Chain Reaction (RAPD-PCR) analysis2.5. Genotypic identification of LAB and yeasts2.6. DNA extraction from sourdough samples and 16S metagenetics analysis2.7. Enumeration of L. sanfranciscensis by quantitative PCR (qPCR)2.8. Statistical analysis

3. Results3.1. Biochemical and microbiological characteristics of sourdoughs3.2. Isolation and identification of LAB and yeasts in sourdoughs3.3. 16S metagenetics analysis of the sourdoughs3.4. qPCR quantification of L. sanfranciscensis in sourdoughs3.5. Permutation analysis3.6. Correlations between lactic acid bacteria, substrate nutrients, and other environmental parameters

4. DiscussionAcknowledgmentsAppendix A. Supplementary dataReferences