j popow et al. nature 000 , 1-4 (2014) doi:10.1038/nature13284

J Popow et al. Nature 000, 1-4 (2014) doi:10.1038/nature13284 Archease co-purifies with human RTCB upon in vivo crosslink.

Upload: hye

Post on 05-Jan-2016

41 views

Category:

Documents

2 download

Report

Download

Embed Size (px):

DESCRIPTION

Archease co-purifies with human RTCB upon in vivo crosslink. J Popow et al. Nature 000 , 1-4 (2014) doi:10.1038/nature13284. - PowerPoint PPT Presentation

TRANSCRIPT

J Popow et al. Nature 000, 1-4 (2014) doi:10.1038/nature13284

Archease co-purifies with human RTCB upon in vivo crosslink.

Nature Photonics 8, 695-700 doi: 10.1038/ (2014). The

DOI: 10.1038/NMAT4299 Supplementary file for P … · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4299. NATURE MATERIALS | . 1 1 Supplementary file for Photo-oxidation and quantum

GI Motility online (May 2006) | doi:10.1038/gimo31

GI Motility online (May 2006) | doi:10.1038/gimo12

Nature Biotechnology: doi:10.1038/nbt

Published in Nature Materials (2016) doi:10.1038/nmat4569

Neuropsychopharmacology (2014) 39 , 1603-1613; doi:10.1038/npp.2014.7

GI Motility online (May 2006) | doi:10.1038/gimo6

Nature Genetics: doi:10.1038/ng - Seth Field's Lab at UCSDsethfield.ucsd.edu/Papers/Bielas..Gleeson NatureGenetics 2009 suppl... · Nature Genetics: doi:10.1038/ng.423. Supplemental

Nature Structural & Molecular Biology: doi:10.1038/nsmb Structural & Molecular Biology: doi:10.1038/nsmb.3120. reduction in the pocket volume, we combine the volumes from the closed

GI Motility online (May 2006) | doi:10.1038/gimo46

doi:10.1038/nature05202 LETTERS

Guo et al ., Nature Materials, DOI:10.1038/ nmat3234 (2012)

doi:10.1038/nature06481 LETTERS

Neuropsychopharmacology (2011) 36, 2406-2421; doi:10.1038/npp.2011.128

doi:10.1038/nature12886 Neanderthal from the Altai

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/cermak_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3666. Supplementary Figure 13 Comparison of precision

DOI: 10.1038/ncomms1280 molecular dynamics of single

Vol 453 1 May 2008 doi:10.1038/nature06733 LETTERS

DOI: 10.1038/NPHOTON.2015 - media.nature.com PHOTONICS | . 3. DOI: 10.1038/NPHOTON.2015. 181. SUPPEENTAR INORATION 1 polarized laser beams to …

Ecosystem turnover in palaeoecological records: …€¦ · Web viewNature Publishing Group: 53–59. DOI: 10.1038/nature08227. DOI: 10.1038/nature08227. Seddon AW, Macias-Fauria

doi:10.1038/nature05150 LETTERS

17 September 2009 doi:10.1038/nature08355 LETTERS

DOI: 10.1038/NPHYS3211 Supplementary Information for

Modulationofthermalandthermoelectric ... · PDF fileLETTERS PUBLISHEDONLINE:31JULY2017|DOI:10.1038/NMAT4946 Modulationofthermalandthermoelectric transportinindividualcarbonnanotubesby

DOI: 10.1038/NCHEM - Nature · NATURE CHEMISTRY | 3 DOI: 10.1038/NCHEM.1870 SUPPLEMENTARY INFORMATION S3 1. Syntheses (i) General methods and instrumentation

Nature Structural and Molecular Biology: doi:10.1038/nsmb · Nature Structural and Molecular Biology: doi:10.1038/nsmb.2938 Supplementary Figure 1 Characterization of designed leucine-rich-repeat

GI Motility online (May 2006) | doi:10.1038/gimo48

DOI: 10.1038/NGEO2405 Moist convection in hydrogen

Calcium modulates force sensing by the von ... - aj-lab.gitlab.io · ARTICLE nATuRE CommunICATIons | DoI: 10.1038/ncomms1385 nATuRE CommunICATIons | 2:385 | DoI: 10.1038/ncomms1385

Neuropsychopharmacology (2013) 38 , 1521-1534; doi:10.1038/npp.2013.51

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

Neuropsychopharmacology (2013) 38 , 2150-2159; doi:10.1038/npp.2013.112

DOI: 10.1038/NMAT4801 Metal-Oxide-Semiconductor