istanbul technical university graduate school of … · mitoz bölünme geçirerek tomurcuklanma...
TRANSCRIPT
![Page 1: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/1.jpg)
ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF SCIENCE
ENGINEERING AND TECHNOLOGY
M.Sc. THESIS
JUNE 2012
FIRST STEPS TOWARDS A BETTER UNDERSTANDING OF THE
FUNCTION OF THE TPS COMPLEX FROM
Saccharomyces cerevisiae
Şerif KARABULUT
Department of Advanced Technologies
Molecular Biology-Genetic and Biotechnology Programme
Anabilim Dalı : Herhangi Mühendislik, Bilim
Programı : Herhangi Program
![Page 2: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/2.jpg)
![Page 3: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/3.jpg)
JUNE 2012
ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF SCIENCE
ENGINEERING AND TECHNOLOGY
FIRST STEPS TOWARDS A BETTER UNDERSTANDING OF THE
FUNCTION OF THE TPS COMPLEX FROM
Saccharomyces cerevisiae
M.Sc. THESIS
Şerif KARABULUT
(521091100)
Department of Advanced Technologies
Molecular Biology-Genetic and Biotechnology Programme
Anabilim Dalı : Herhangi Mühendislik, Bilim
Programı : Herhangi Program
Thesis Advisor: Prof. Dr. Zeynep Petek ÇAKAR
![Page 4: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/4.jpg)
![Page 5: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/5.jpg)
HAZİRAN 2012
İSTANBUL TEKNİK ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ
Saccharomyces cerevisiae TPS KOMPLEKSİNİN FONKSİYONLARININ DAHA
İYİ ANLAŞILMASINDA İLK ADIMLAR
YÜKSEK LİSANS TEZİ
Şerif KARABULUT
(521091100)
İleri Teknolojiler Anabilim Dalı
Moleküler Biyoloji-Genetik ve Biyoteknoloji Programı
Anabilim Dalı : Herhangi Mühendislik, Bilim
Programı : Herhangi Program
Tez Danışmanı: Prof. Dr. Zeynep Petek ÇAKAR
![Page 6: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/6.jpg)
![Page 7: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/7.jpg)
v
![Page 8: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/8.jpg)
vi
![Page 9: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/9.jpg)
vii
This thesis work was accomplished based on the ERASMUS Exchange Agreement
between Istanbul Technical University and Toulouse University (INSA Toulouse).
![Page 10: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/10.jpg)
viii
![Page 11: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/11.jpg)
ix
FOREWORD
I am grateful to my supervisors Prof. Zeynep Petek ÇAKAR for giving the chance to
me to study abroad and I would also like to thank to Prof. Jean Marie FRANÇOIS
for not only welcoming me to laboratory and for giving the chance to me to study in
this thesis project.
I would like to express my sincere gratitude to my advisor Dr. Jaen Luc PARROU
for his guidance and contribution. I appreciate the time Prof. Jean Marie FRANÇOIS
and Dr. Jaen Luc PARROU gave to read and comment on my thesis and his
continuous support and efforts throughout the study.
I would also like to thank to Marie Ange TESTE, as I have learnt so many things
from her and her continuous support throughout the study.
I would also like to thank to all JMF laboratory members for welcoming me to the
laboratory and their helps.
I would also like to thank to all ITU Yeast Laboratory members for their helps and
friendliness.
I would also like to thank to ERASMUS programme to give me a change to study
abroad.
I would also like to thank to my friends Gökhan KÜÇÜKGÖZE, İrem AVCILAR,
Deniz YÜCESOY and Suha AKAN.
Lastly, I would also thank to my family for their love and supports.
MAY 2012
Şerif KARABULUT
(Molecular Biologist)
![Page 12: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/12.jpg)
x
![Page 13: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/13.jpg)
xi
TABLE OF CONTENTS
Page
FOREWORD ............................................................................................................. ix TABLE OF CONTENTS .......................................................................................... xi
ABBREVIATIONS ................................................................................................. xiii LIST OF TABLES ................................................................................................... xv LIST OF FIGURES ............................................................................................... xvii
SUMMARY ............................................................................................................. xix ÖZET ........................................................................................................................ xxi 1. INTRODUCTION .................................................................................................. 1
1.1 Saccharomyces cerevisiae .................................................................................. 1 1.2 Reserve Carbohydrates ....................................................................................... 3
1.2.1 Trehalose as stress protectant ...................................................................... 4 1.2.2 Glycogen metabolism ................................................................................. 5
1.2.3 Trehalose metabolism ................................................................................. 5 1.2.4 Regulation of reserve carbohydrates metabolism ....................................... 6
1.3 TPS Complex ..................................................................................................... 6 1.4 Effect of TPS Complex on Glycolitic Influx ..................................................... 8 1.5 Aim of the Study ................................................................................................ 8
2. MATERIALS and MEDHODS .......................................................................... 11 2.1 Materials ........................................................................................................... 11
2.1.1 Strains ........................................................................................................ 11 2.1.2 Cultivation mediums ................................................................................. 11 2.1.3 Chemicals .................................................................................................. 12 2.1.4 Buffers, solutions and enzymes ................................................................ 12
2.1.5 Laboratory equipments ............................................................................. 13 2.2 Methods ............................................................................................................ 13
2.2.1 Strain construction .................................................................................... 13
2.2.1.1 DNA extraction .................................................................................. 14 2.2.1.2 PCR .................................................................................................... 14 2.2.1.3 Transformation protocol..................................................................... 15 2.2.1.4 Mutant selection and verification ....................................................... 15
2.2.1.5 Double mutant strain construction ..................................................... 16 2.2.1.5.1 Spore isolation ................................................................................. 16 2.2.1.5.2 Determination of mating type for double mutant ............................ 16
2.2.2 Obtaining growth curve of wild type and mutant strains ......................... 16 2.2.3 Measurement of intracellular trehalose and glycogen content .................. 17
2.2.4 Determination of growth phenotype and stress resistance on solid media 18 2.2.5 Sporulation efficiency ............................................................................... 18
3. RESULTS ............................................................................................................. 21 3.1 Mutant Strains .................................................................................................. 21
![Page 14: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/14.jpg)
xii
3.2 Evaluation of Growth Parameters and Intracellular Trehalose and Glycogen of
Strains ..................................................................................................................... 22 3.3 Strains Specific Growth Rates and Maximum Optical Density Values ........... 28 3.4 Carbon Source and Stress Plates ...................................................................... 29
3.4.1 Carbon source plates ................................................................................. 29 3.4.2 Stress plates ............................................................................................... 30
3.5 Sporulation Efficiency ...................................................................................... 31
4. DISCUSSIONS AND CONCLUSIONS ............................................................. 33
REFERENCES ......................................................................................................... 37 CURRICULUM VITAE .......................................................................................... 41
![Page 15: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/15.jpg)
xiii
ABBREVIATIONS
CFW : Calcofluor White
ddH2O : Double Distelled Water
g : Gram
Gly : Glycogen
Glc6P : Glucose 6 Phosphate
M : Molar
mg : Miligram
min : Minute
ml : Mililiter
mM : Milimolar
PCR : Polymerase Chain Reaction
rpm : Rotate Per Minute
sec : Seconds
SS-DNA : Single Strand DNA
Tre : Trehalose
Tre6P : Trehalose 6 Phosphate
UDP-Glc : Uridine Diphosphate Glucose
YN : Yeast Minimal Medium
YPD : Yeast Rich Medium with glucose
YPgal : Yeast Rich Medium with galactose
YP : Yeast Rich Medium
°C : degree Celsius
µl : Microliter
![Page 16: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/16.jpg)
xiv
![Page 17: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/17.jpg)
xv
LIST OF TABLES
Page
Table 2.1 : Yeast minimal medium.(YN) ingridients and amounts .......................... 11
Table 2.2 : Yeast rich medium (YP) ingredients and amounts. ................................ 12
Table 2.3 : Chemicals and their suppliers which used at this study .......................... 12
Table 2.4 : Solution and buffers used at the study. ................................................... 12
Table 2.5 : Enzymes and chemicals used for quantitative measurement of
intracellular trehalose and glycogen ....................................................... 13
Table 2.6 : Laboratory equipments used in the study ............................................... 13
Table 2.7 : Primers used in the study for amplification of deletion cassettes and
verification of transformation ................................................................. 14
Table 2.8 : PCR protocol used in the study for amplification of deletion cassettes and
verification of transformation ................................................................. 15
Table 2.9 : PCR components and their amount and concentrations used for gene
amplification ........................................................................................... 15
Table 2.10 : Solid YNgal medium with different stress conditions .......................... 19
Table 3.1 : Mutant strains and their mating types which were constructed at the
study ........................................................................................................ 22
Table 3.2 : Specifc growth rates and max. OD600 values................ .......................... 29
Table 3.3 : Sporulation efficiency for all homozygote diploid strains ...................... 32
![Page 18: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/18.jpg)
xvi
![Page 19: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/19.jpg)
xvii
LIST OF FIGURES
Page
Figure 1.1 : Morphology of budding and unbudded S. Cerevisiae cells and zygotes.
.............Magnification approximatelly X6.000. ................................................... 1
Figure 1.2 : Life cycle of budding yeast S. Cerevisiae. .............................................. 2 Figure 1.3 : Areas containing yeast biotechnology. .................................................... 3 Figure 1.4 : Structure of glycogen and trehalose and their metabolic routes from
.............glucose in the yeast S. Cerevisiae. .......................................................... 4
Figure 1.5 : TPS complex and trehalose synthesis reaction. ....................................... 7
Figure 3.1 : Growth curve of wild type strain and changes of intracellular trehalose
.............and glycogen concentration according to time (1st Experiment). ......... 23
Figure 3.2 : Growth curve of wild type strain and changes of intracellular trehalose
.............and glycogen concentration according to time (2nd
Experimet)............ 23
Figure 3.3 : Growth curve of tps1 strain and changes of intracellular trehalose and
.............glycogen concentration according to time (1st Experiment). ................ 24
Figure 3.4 : Growth curve of tps1 strain and changes of intracellular trehalose and
.............glycogen concentration according to time (2nd
Experiment). ............... 24 Figure 3.5 : Growth curve of tps2 strain and changes of intracellular trehalose and
.............glycogen concentration according to time (1st Experiment). ................ 25
Figure 3.6 : Growth curve of tps2 strain and changes of intracellular trehalose and
.............glycogen concentration according to time (2nd
Experiment) ................ 25 Figure 3.7 : Growth curve of tps3 strain and changes of intracellular trehalose and
.............glycogen concentration according to time (1st Experiment). ................ 26
Figure 3.8 : Growth curve of tps3 strain and changes of intracellular trehalose and
.............glycogen concentration according to time (2nd
Experimet). ................. 26 Figure 3.9 : Growth curve of tsl1 strain and changes of intracellular trehalose and
.............glycogen concentration according to time (1st Experimet). .................. 27
Figure 3.10 : Growth curve of tsl1 strain and changes of intracellular trehalose and
...............glycogen concentration according to time (2nd
Experiment). ............. 27 Figure 3.11 : Growth curve of tps3tsl1 strain and changes of intracellular trehalose
...............and glycogen concentration according to time.................................... 28
Figure 3.12 : Images of wild type and mutant individuals on YNgal plate after 48
...............hours of incubation as a control plate ................................................. 29 Figure 3.13 : Images of wild type and mutant individuals on YN medium palte
...............supplemented with 2% glucose, maltose and sucrose left to right. ..... 29 Figure 3.14 : Images of wild type and mutant individuals on YN medium palte
...............supplemented with 2% trehalose and ethanol left to right. ................. 30 Figure 3.15 : Images of wild type and mutant individuals on YN galactose as control
...............and 10 mM caffeine plate. ................................................................... 30
Figure 3.16 : Images of wild type and mutant individuals on 2%, 5% and 10%
...............Ethanol contain YNgal plate upon 48 hours incubation. .................... 31
![Page 20: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/20.jpg)
xviii
Figure 3.17 : Images of wild type and mutant individuals on CFW0,1 and 0.05
...............mg/ml and 1M sorbitol contain YNgal plate upon 48 hours ............... 31 Figure 3.18 : Sporulation efficiencies of strains. ...................................................... 32
![Page 21: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/21.jpg)
xix
FIRST STEPS TOWARDS A BETTER UNDERSTANDING OF THE
FUNCTION OF THE TPS COMPLEX FROM Saccharomyces cerevisiae
SUMMARY
The disaccharide trehalose has an important function in the adaptation of
microorganisms to environmental changes. It is also an important storage
carbohydrate together with glycogen in the yeast S. cerevisiae. In this yeast, trehalose
synthesis relies on a two-step catalytic process which is carried out by the TPS
protein complex: TPS1 encodes the trehalose-6P synthase, TPS; TPS2 encodes the
trehalose-6P phosphatase, TPP; while TSL1 and TPS3 may encode regulatory
partners. TPS1 and TPS2 deletion cause significant metabolic or phenotypic
disorders. In contrast, there is not much information about the function of the
regulatory subunits Tps3p and Tsl1p. They just show high degree of similarity and
may function as stabilizers of the complex as suggested by the fact that the tps3 tsl1
double mutant has a reduced TPS activity and trehalose content. The aim of this
study was therefore to clarify the function of these regulatory subunits of the TPS
complex. For this purpose, we have constructed the tps3∆, tsl1∆ and tps3∆tsl1∆
strains in the CEN.PK background. Batch cultures on galactose showed that tps3∆
and tsl1∆ mutants strictly behaved as the wild type strain relative to specific growth
rate, max. biomass yield and glycogen content. The only slight difference occurred
with intracellular trehalose accumulation, which reached in the tsl1∆ and tps2∆
strains only 60% of the level observed in WT. To screen further putative phenotypes,
we performed growth assays on plates with dilution series. No significant growth
delay could be observed on the different carbon sources for all of these strains,
including the double tps3∆tsl1∆ mutant. The clearest results arose from stress
experiments in the presence of chemical compounds, with a strong sensitivity of the
tps1∆ and double mutant strains to caffeine, while the tsl1∆ strain was the only strain
exhibiting enhanced resistance to high ethanol concentration. Finally, preliminary
experiments were performed relative to the sporulation process, already known to
interfere with trehalose metabolism. As expected, the homozygous tps1∆ diploid
![Page 22: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/22.jpg)
xx
strain exhibited a significant reduction in the efficiency of ascus formation, but also
the other mutant strains showed low sporulation efficiency. Further works are
underway to better clarify the roles and singularity of the ‘regulatory’ proteins of this
complex, which, interestingly, are apparently not present in other fungal TPS/TTP
complexes.
![Page 23: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/23.jpg)
xxi
Saccharomyces cerevisiae TPS KOMPLEKSİNİN FONKSİYONLARININ
DAHA İYİ ANLAŞILMASINDA İLK ADIMLAR
ÖZET
Saccharomyces cerevisiae fungi aleminin tek hücreli bir üyesi ve tomurcuklanan bir
maya türüdür. Fungilerin ortak özellikleri olan kalın hücre duvarı, hareketsizlik ve
kloroplast içermemek gibi özelliklere sahiptir. Basit besiyeri ortamı mayaların
büyümesi için yeterli olup uygun besiyeri ortamında bakteriler kadar hızlı bir şekilde
bölünebilir. Maya hücreleri doğada haploid ve diploid olmak üzere iki farklı formda
bulunabilir. Haploid form a ve alfa olmak üzere iki farklı eşey tipine sahiptir, farklı
eşey tipine sahip maya hücreleri eşleşerek diploid formu oluşturur. Her iki form da
mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna
ek olarak diploid form açlık ya da zor koşullar altında mayoz bölünme yoluyla
haploid sporlar oluşturur.
Tomurcuklanan maya S. cerevisiae ilk olarak H. Roman tarıfından 1930’lu yıllarda
deneysel organizma olarak kullanılmıştır ve zamanla uygun özelliklerinden dolayı
ökaryotik çalışmalar için model organizma olmuştur. Mayayı ökaryotik çalışmalara
uygun yapan özellikleri şu şekilde sıralanabilir; hızlı büyüme, basit besiyeri
ortamında üreyebilme, kolay tek hücre veya koloni izolasyonu, DNA
transformasyonu için uygun olması. Maya genomuna kolay müdahale edilebilmesi
maya ve diğer ökaryotlardaki metabolizma, gen ve protein fonksiyonları üzerindeki
çalışmalar için olanak sağlamaktadır. Ayrıca diploid ve haploid formlarda yaşamını
sürdürebilmesi, mayaya diğer model organizmalarda bulunmayan bir avantaj
sağlamaktadır.
Maya uzun zaman önce insanlar tarafından bira, şarap ve hamur mayalamak
amacıyla kullanılmıştır. Günümüze kadar gelen süreçte maya hakkında biriken bilgi
mayayı biyoteknoloji alanında kullanılmaya uygun hale getirmiştir. Günümüzde
maya; besin ve kimyasal teknolojisi, fermantasyon endüstirisi, biyolojik araştırmalar,
biyomedikal araştırmalar, çevre teknolojisi ve sağlık endüstirisinde kullanılmaktadır.
Maya glukoz deposu olarak glukojen ve trehaloz biriktirir. Glukojen, glikoz
moleküllerinin alfa 1-4 glikozidik bağı ile bağlanması ve alfa 1-4 glikozidik bağı ile
oluşan dallamaların meydana getirdiği yüksek moleküler ağırlıklı bir polimerdir.
Trehaloz ise a,a 1-1 glikozidik bağıyla bağlanan iki glikoz molekülünün oluşturduğu
bir disakkarittir. Depo karbonhidratların hücre içindeki miktarı çevresel koşullara
cevap olarak değişmektedir. Spor oluşturma ve spor çimlenmesi (germination), stres
koşullarına ve büyümenin fazına bağlı olarak, hücre içindeki depo karbonhidrat
oranının değişmesine sebep olur.
Hücre içindeki trehaloz miktarı maya hücrelerinin stres koşulları altında
büyüyebilmesi için önemli bir faktördür. Yüksek miktarda trehaloz maya hücrelerini
oksidatif, ısı ve donma stresine karşı daha dayanıklı hale getirmektedir. Trehaloz
miktarı ve stres koşullarına dayanıklılık arasında, büyümenin durağan fazı ve
fermente edilemeyen karbon kaynaklarında büyüme durumunlarında, doğrudan
![Page 24: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/24.jpg)
xxii
bağlantı bulunmuştur. Trehaloz stres koşullarında dayanıklılığı bazı temel faktörlerin
varlığında sağlamaktadır.
Trehalozun hidratlanmış maya hücrelerinde suyu proteinlerin yüzeyinden
uzaklaştırarak protein yapısını koruduğu düşünülmektedir. Ayrıca proteinlerin
sitozolde ve ısı ile hasar almış glikoproteinlerin endoplazmik retikulumdaki tekrar
katlanma süreci için trehaloz ve Hsp104 şaperonları gereklidir. Yüksek miktarda
trehaloz ayrıca protein denatürasyonunu ve protein yığılmasını da engellediği
bilinmektedir.
Saccharomyces cerevisiae’da trehaloz sentezi TPS kompleks adı verilen ve dört alt
birimden oluşan bir enzim kompleksi tarafından sitoplazmada gerçekleşmektedir.
TPS kompleks UDP-6-glikoz ve glikoz-6-fosfatı kullanarak iki basamakta trehaloz
sentezini gerçekleştirir. İlk basamakta trehalose-6-fosfat ara molekülü sentezlenir.
Daha sonra ikinci basamakta TPS kompleks bu ara molekülün fosfatını atarak son
ürün trehalozu üretir. Hücre içinde üretilen trehalozun yanında maya hücreleri AGT1
geni tarafından kodlanan alfa-glikozid taşıyıcılarıyla da bu şekeri hücre dışından
alabilir. Trehaloz maya hücrelerinde stoplazmada bulunan trehalaz enzimi tarafından
yıkılarak iki adet glukoz molekülüne dönüştürülür. Trehalozun hücre dışından
alınabilmesi ve sitoplazmada yıkılabilmesi maya hücrelerinin karbon kaynağı olarak
sadece trehaloz bulunan besiyerinde çoğalabilmelerine olanak verir. Maya
hücrelerinde hücre içi trehaloz biriktirilmesi büyüme sırasında ikincil büyüme
(diauxic shift) evresinde başlar. Bunun nedeni logaritmik fazın sonuna kadar süren
yüksek trehalaz aktivitesidir. Trehaloz-6P’nin glukoz alımında önemli bir molekül
olması ve sadece TPS kompleks tarafından sentezlenebilmesi, maya hücrelerinde
bazal bir TPS aktivitesi olduğunu göstermektedir.
Disakkarit trehaloz mikroorganizmaların çevreye adaptasyonlarında önemli bir
göreve sahiptir. Ayrıca Saccharomyces cerevisiae’da glikojenle birlikte önemli bir
karbonhidrat deposudur. Bu mayadaki trehaloz sentezi TPS protein kompleksi
tarafından iki basamakta katalizlenir. TPS komplex; TPS1 geninin ürünü Trehaloz-
6P sentaz (TPS); TPS2 geninin ürünü Trehaloz-6P fosfataz (TPP) ve düzenleyici
proteinler TPS3 ve TSL1 genlerinin ürünlerinden oluşur. TPS1 ve TPS2 genlerinin
silinmesi önemli metabolik ve fenotipik bozukluklara yol açar.
TPS1 geninin ürünü 56 kDa’lık alt birim ilk katalitik aktiviteyi yani trehaloz-6-fosfat
sentezlenmesinden sorumludur. Bu genin silinmesi durumunda maya hücreleri
mayalanabilen (fermentable) karbon kaynakları olan glukoz ve fruktoz gibi karbon
kaynaklarında büyüyemezler. Bunun yanında homozigot diploit tps1 mutant
hücreleri düşük sporlanma verimi gösterirler. Bu durum trehaloz-6-fosfatın
hekzokinazları inhibe etmemesi sonucu glukoliz akışının bozulması ve hekzokinazın
mayoz bölünmeden sorumlu genleri etkilemesiyle ilişkilendirilmektedir.
TPS2 geninin ürünü 100 kDa’lık alt birim ikinci katalitik aktiviteden yani trehaloz-6-
fosfatın trehaloza dönüştürülmesinden sorumludur. Bu genin silinmesi durumunda
maya hücreleri sıcaklığa karşı hassas bir büyüme fenotipi gösterir. Ayrıca tps2
mutant hücreleri kayda değer oranda trehaloz üretebilirler bu da spesifik olmayan
fosfatazların trehaloz üretimindeki ikinci basamağı katalizleyebildiklerini
göstermektedir.
TPS3 ve TSL1 genleri 123 kDa’lık yapıları yüksek derecede benzerlik gösteren iki alt
birimi kodlarlar. İkili mutant tps3tsl1 düşük TPS aktivitesi ve trehaloz miktarı
göstermesi nedeniyle kompleksi stabilize ettikleri düşünülmektedir. Buna ek olarak
kompleks içinde Tps1p ve Tps2p’nin temas etmeleri, diğer yandan Tps3p ve
Tsl1p’nin birbirleriyle temas etmemelerine rağmen katalitik altbirimler olan Tps1p
ve Tps2 ile temas etmeleri bu düşünceyi desteklemektedir. Ayrıca TPS3 ve TSL1
![Page 25: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/25.jpg)
xxiii
genlerinin büyüme fazlarında (durağan, logaritmik vb.) farklı miktarlarda
ekspresyonun olması da bu alt birimlerin TPS kompleksin regüle edilmesinde görev
aldıkları yönündeki düşünceyi desteklemektedir.
Bu çalışmanın amacı TPS kompleksin düzenleyici alt birimleri olan proteinlerin
(Tps3p ve Tsl1p) görevlerini aydınlatmaktır. Bu amaçla düzenleyici alt birimleri
sentezleyen TPS3 ve TSL1 genleri ayrı ayrı ve birlikte yaban birey genomundan
silinmiştir. Gen silme modülü KanMX4 kullanılarak yapılan bu işlemde silme
modülleri PCR kullanılarak Open Biosystem Collection’dan BY4741 suşu
kullanılarak çoğaltıldı ve yaban birey olan CEN.PK suşuna transformasyon
metoduyla yerleştirildi. Bu modül yaban birey maya hücrelerine genetisine karşı
dayanıklılık kazandırmasıyla mutant hücrelerin seçimini kolaylaştırmaktadır. Ayrıca
seçilen mutant hücrelerde, PCR kullanılarak silme modülünün doğru geni silip
silmediği kontrol edildi. Farklı eşey tipindeki tps3 ve tsl1 mutant suşlar ve genel
genetik metodlar (eşleşme, sporlanma, spor izolasyonu vb.) kullanılarak tps3tsl1 ikili
mutant suşu oluşturuldu.
Ayrıca sporlanma konusunda tps1 mutant suşunun yaban bireye göre düşük verim
gösterdiği bilindiği için TPS kompleksinin diğer alt birimlerinin sporlanmaya etkisi
incelendi. Bu amaç doğrultusunda tps2 MATα, tps3 MATa ve MATα, tsl1 MATa ve
MATα, tps3tsl1 MATa ve MATα mutant suşları oluşturuldu. Aynı mutasyona sahip
olan suşlar diğer eşey tipleriyle eşleştirilerek diploit homozigot mutant hücreler elde
edildi ve sporlanma verimleri incelendi.
Oluşturulan mutant suşlar (haploid ve MATa) ve yaban birey kullanılarak yapılan
uzun süreli kesiksiz (batch) kültürde spesifik büyüme hızları, maksimum biyokütle
üretimi ve belirli aralıklarla alınan örnekler aracılığıyla hücre içi glikojen ve
trehalozun zamana göre değişimi hakkında bilgiler toplandı.
Oluşturulan mutant suşlarda farklı fenotipik özellikler bulmak amacıyla karbon
kaynagı olarak sadece glukoz, maltoz, sükroz, trehaloz ve etanol bulunan minimal
(YN) katı besiyerinde seri dilusyon yöntemi ile ekim yapıldı ve büyüme profilleri
gözlemlendi. Aynı şekilde mutantlara ait farklı fenotipik özellikler bulmak amacıyla
farklı stres koşullarında suşlar büyütüldü. Bu amaç için galaktoz ile hazırlanmış katı
besi yerine farklı oranlarda etanol, “calcoflour white” (CFW), sorbitol ve kafein
kimyasalları eklendi
Sonuç olarak, yapılan kesiksiz (batch) kültürde tps3 ve tsl1 mutantlarının spesifik
büyüme hızı, maksimum biyokütle üretimi ve glikojen miktarı bakımından yabani
suş ile aynı özellikleri gösterdiği görülmüştür. Mutant türler arasında sadece tps2 ve
tsl1 yabani türün sadece %60’ı kadar trehaloz biriktirebilmişlerdir. Farklı fenotipik
özellikleri bulmak için seri dilüsyon metoduyla farklı karbonhidrat içeren katı
besiyerlerinde yapılan deneyde herhangi bir farklılık gözlenmemiştir. Stres
koşullarında yapılan deneylerin sonuçlarına göre, tps1 ve tps3tsl1 mutantları kafeine
hassaslık göstermiştir, aynı zamanda tsl1 mutant suşu yüksek konsantrasyondaki
etanole dayanıklılık göstermiştir. Bununla birlikte tps3tsl1 ikili mutantının tps3
mutant suşu ve yaban bireye benzer büyüme fenotipi göstermesi TPS3 geninin TSL1
geni üzerinde yüksek konsantrasyonda etanol varlığında epistatik bir etki gösterdiği
söylenebilir. Son olarak trehaloz metabolizmasıyla ilişkili olduğu bilinen sporlanma
süreciyle ilgili bir ön çalışma yapılmıştır. Beklendiği gibi homozigot tps1 suşunun
“ascus” oluşturmasında önemli düşüş gözlenmiştir, bunun yanında diğer mutant
suşlarda da önemli oranda sporlanmada düşüklük gözlenmiştir. Ayrıca diğer mantar
türlerinin TPS/TPP komplekslerinde bulunmayan bu yardımcı ve türe has
proteinlerin görevlerini açıklığa kavuşturmak için yapılan çalışmalar devam
etmektedir.
![Page 26: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/26.jpg)
xxiv
![Page 27: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/27.jpg)
1
1. INTRODUCTION
1.1 Saccharomyces cerevisiae
Saccharomyces cerevisiae is a single-celled member of the fungi kingdom and
generally known as budding yeast. It shows the common futures of the fungi
kingdom such as thick cell wall, relative immobility and no chloroplast. Simple
nutrition medium is enough to growth and it can divide as fast as bacterium when the
growth conditions are available. Proliferation occurs by budding process (mitosis)
and it can grow and divide both haploid and diploid forms. In addition, diploid cells
can divide with meiosis and produce haploid cells again (Albets, 2010). Figure 1.1
shows, an unbudded yeast cell (A), yeast cells with different size buds (B and C), a
zygote formed by mating a and an α haploid cells (D), and a budding zygote that
produces an a/α diploid daughter cell (E) (Herskowitz, 1988)
Figure 1.1 : Morphology of budding and unbudded S. Cerevisiae cells and zygotes.
Magnification approximatelly X6.000 (Herskowitz, 1988).
![Page 28: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/28.jpg)
2
Life cycle of S. cerevisiae can alters according to cell type; haploid form mating type
a and mating type α proliferate with mitosis and at the end of the division mother cell
generates identical daughter cell. Mating type a and type α cell can mate each other,
after cell and nucleus fusion diploid a/α cell (zygote) occur and this process named as
mating process. Diploid cells can divide with budding, besides under starvation or
hars condition they divide by meiosis cell division and produce 4 haploid cells. In
addition, this process called sporulation because all haploid cells have spore coat and
packaged in sac (ascus) (Herskowitz, 1988). Figure 1.2 shows life cycle of S.
cerevisiae, diploid and haploid form proliferation by mitosis and alterations between
diploid and haploid form by sporulation with meiosis.
Figure 1.2 : Life cycle of budding yeast S. Cerevisiae (Alberts, 2010).
Yeast was used as an experimental organism firstly by H. Roman in the 30s and
became a model organism to eukaryotic studies with time because of its suitable
properties (Feldman, 2010). First of all, yeast is a simple unicellular eukaryotic
organism (Feldman, 2005). The other properties make yeast suitable; it grows rapidly
and can grow in simple medium; it is easy to isolate single cell or/and colony and
easy replica plating; it is appropriate for DNA transformation. Easy manipulation of
yeast genome make it possible to study on metabolism, gene and protein function
![Page 29: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/29.jpg)
3
both yeast and other eukaryotes. Moreover, both stable haploid and diploid form of
yeast is another advantage different from other eukaryotes organisms (Sherman,
2002).
Yeast has started to be used long time ago by humans for brewing beer, wine and
dough. Furthermore, enormous information about molecular biology and other
properties of yeast makes is useful for biotechnological production in different fields
(Figure 1.3).
Figure 1.3 : Areas containing yeast biotechnology (Feldman, 2005).
1.2 Reserve Carbohydrates
Yeast accumulates two types of carbohydrate as glucose storage; glycogen and
trehalose. Glycogen is high molecular mass polymer that composed by glucose
molecules linked α-(1, 4) glucosidic bonds and α-(1, 6) branches. Trehalose is non-
reducing disaccharide composed by two glucoses molecule linked with α,α-1,1-
glucoside bond (François and Parrou, 2001). Figure 1.4 shows structure of these
carbohydrates.
The intracellular amount of trehalose and glycogen can significantly change
according to environmental conditions. In addition, sporulation, germination and
vegetative re-growth on fresh medium can cause alteration of these carbohydrates
![Page 30: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/30.jpg)
4
amount (Lillie and Pringle, 1980; Thevelein et al., 1984; François et al., 1991). All
these information indicate that reserve carbohydrates have well controlled by
complex regulation systems (François and Parrou, 2001).
Figure 1.4 : Structure of glycogen and trehalose and their metabolic routes from
glucose in the yeast S. Cerevisiae (François et al., 2012).
1.2.1 Trehalose as stress protectant
Intracellular amount of trehalose is one of the important factors for rapid growth
under stress conditions. Moreover, high amount of trehalose make yeast cells more
resistant to multiple stress which are ethanol, heat and freezing but not oxidative
stress (Mahmut et al., 2009). Trehalose level and stress resistance very often
correlate within yeast cells in stationary phase or growing on non-fermentable carbon
source. Trehalose just improve stress tolerance when the other essential factors exist,
it does not provide this ability itself (Djik et al., 1994). After head shock or saline
stress, cells require mobilization of accumulated trehalose for proper recovery of
viability upon return to normal conditions (Wera et al. 1999; Garre and Matallana,
2009).
Trehalose is believed to exclude water from protein surface, protecting them from
denaturation in hydrated cells. Moreover, protein-refolding process in cytosol and
![Page 31: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/31.jpg)
5
head damaged glycoprotein in the endoplasmic reticulum need both trehalose and
Hsp104 chaperons. High amount of intracellular trehalose also prevents denaturation
and aggregation of protein, which helps subsequent refolding of protein by chaperons
(Singer and Lindquisl, 1998; Simola et al., 2000).
1.2.2 Glycogen metabolism
The initiation step of glycogen synthesis process starts with glycogenin protein,
UDP-Glc molecule binds glycogenin covalently and produces a short α-(1, 4)
glycosyl chain. Glycogenin protein is encoded by two genes; GLG1 and GLG2.
Elongation step is catalayzed by glycogen synthase which is encoded by two genes;
GSY1 and GSY2. Glycogen synthase uses UDP-Glc as substrate and adds glucose to
the non-reducing end of glycogen with α-(1, 4) glycosydic bond. The amylo α-(1,4),
α(1,6)-transglucosidase is responsible for branching, and is encoded by GLC3. At the
end of the glycogen synthesis process, the molecule reach a spherical structure
because of α-(1,4) linear and α-(1,6) branching glycosydic bonds (François et al.,
2012).
The degradation of glycogen occurs by coupled enzyme activity of glycogen
phosphorylase (encoded by GPH1) and debranching enzyme (encoded by GDP1)
(François and Parrou, 2001).
1.2.3 Trehalose metabolism
The trehalose molecule is synthesized by an enzyme complex, which contains four
subunits. The trehalose synthase complex is known as tps/tpp complex because of its
catalytic subunits; trehalose-6-p synthase, TPS and trehalose-6-P phosphatase, TPP.
TPS complex uses UDP-Glucose and glucose-6P as substrates and catalyzes
trehalose molecule in a 2 steps process: TPS enzyme produces trehalose-6P, which is
subsequently dephosphorylated into trehalose by TPP.
In addition to endogenous trehalose synthesis by the TPS complex, yeast can
assimilate trehalose as an exogenous carbon source via high affinity α-glucoside
transporter encoded by AGT1 (Owobi et al., 1999), and its subsequent cleavage into
glucose by NTH1 (neutral trehalase) in the cytosol. On the other hand, acid trehalase
works at acidic pH and it is localized at cell surface and in the vacuole but only
extracellular trehalase able to hydrolyze trehalose (Jules et al.,2004).
![Page 32: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/32.jpg)
6
High affinity α-glucoside transporter with neutral trehalase and extracellular
localized acid trehalase therefore provide growth on trehalose as a sole carbon source
(Jules et al, 2004), therefore providing yeast cells with a second, independent system
for trehalose assimilation.
1.2.4 Regulation of reserve carbohydrates metabolism
Glycogen and trehalose pathways control depend on major nutrient sensing protein
kinases, which are TOR, PKA and Snf1 kinase. Intracellular level of these
carbohydrates changes significantly according to phase of growth, nutrient and stress
conditions. These well-controlled systems indicate that these two glucose stores are
important for growth and cell cycle of yeast.
These pathways are controlled at transcriptional and posttranscriptional level. PKA
pathway is the major control pathway for reserve carbohydrate metabolism and
Glc6P is the major effectors at substrate level. First of all, Glc6P is direct substrate
for trehalose synthesis, but also it activates glycogen synthase and inhibits glycogen
phosphorylase (François and Parrou, 2001).
1.3 TPS Complex
In the yeast S. cerevisiae, trehalose molecule synthesize by trehalose synthase
complex that is a large multisubunit complex. This complex consist four subunits
encoded by TPS1, TPS2, TPS3 and TSL1 but just two of them have catalytic activity:
TPS1 and TPS2. Recent two subunits of complex are encoded by TPS3 and TSL1
genes, know as regulatory subunits.
Figure 1.5 shows structure of TPS complex, trehalose synthesis pathway and its
substrates and product.
![Page 33: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/33.jpg)
7
Figure 1.5 : TPS complex and trehalose synthesis reaction (Lejeune, 2010).
The TPS1 gene encodes TPS enzyme that is 56 kDa and smallest subunit of the
complex. It is the important subunit of the complex because deletion of TPS1 stops
TPS activity and no accumulation of Tre6P and trehalose can be seen. Tps1p is
therefore a key subunit of the trehalose synthesis in the complex. Moreover, tps1
mutant cells can not grow on fermentable carbon source such as glucose and fructose
(Bell et al., 1998). Development of tps1 mutants was also abnormal since tps1 null
yeast diploids sporulated poorly (Ferreira and Panek, 1993). Poor sporulation was
associated with reduced expression of genes encoding meiotic inducers such as
IME1, IME2 and MCK1. This may be a consequence of alterations in glycolytic flux
since MCK1 is an inducer of IME1, whose expression is regulated by hexokinase-2.
Mutations in HXK2, encoding hexokinase-2, suppress the reduced sporulation
phenotype of tps1 mutants, indicating that Tre6P inhibition of hexokinase is required
for induction of MCK1 and sporulation in S. cerevisiae. Thus, growth inhibition and
poor sporulation in tps1 mutants could be associated with deregulation of the first
step of glycolysis involving conversion of glucose to glucose-6-phosphate by the
enzyme hexokinase (De Silva-Udawatta and Cannon, 2001).
The TPS2 gene encodes TPP enzyme that is 100 kDa. Deletion of TPS2 gene cause
temperature sensitive growth phenotype related to hyper accumulation of Tre6P
(Virglio et al., 1993; Reinders et al., 1997). In addition, tps2 mutant cells accumulate
significant amount of trehalose, indicating that other phosphatase can hydrolase
Tre6P independently from the complex (Bell et al., 1998).
The TPS3 and TSL1 genes encode two homolog, large subunits of the complex (123
kDa). Double deletion of the gene reduces TPS activity in vitro and trehalose
accumulation in vivo according to single deletions. TSL1 mutant cells reduce Pi
![Page 34: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/34.jpg)
8
inhibition of TPS activity and TPS3 mutant shows no effect. When both genes were
deleted, Pi inhibition turned to Pi stimulation on TPS activity (Bell et al., 1998).
In the TPS complex, Tps1p and Tps2p interact each other, but also with the other
subunits Tps3p and Tsl1p, while no interaction between Tps3p and Tsl1p could be
observed. Reinders et. al. suggested that no interaction between these subunits give
opportunity to regulate TPS complex in response to different environmental and
physiological conditions (Reinders et al, 1997). Different expression level of TPS3
and TSL1 support this idea. TSL1 expression was strongly enhanced with entrance of
stationary phase, while TPS3 was expressed at constant rate both during the
exponential and the stationary phase of growth (Winderickx et. al., 1996).In addition,
according to gel filtration experiment, molecular mass of complex is around 630-800
kDa on the other hand sum of subunits molecular mass is just about 400 kDa. This
situation indicates that some or all subunit must exist in more than one copy
(Reinders et al, 1997).
1.4 Effect of TPS Complex on Glycolitic Influx
Trehalose accumulation starts with diauxic shift because of high trehalase activity
which overcomes TPS complex activity in between the exponential phase and this
diauxic shift (during the transition phase of growth). When there is no neural
trehalase activity, trehalose accumulation is observed during the exponential phase of
growth. This indicates that there is basal activity of TPS complex during the phase
(Parrou et al., 1999). This is probably necessary for steady-state formation of
trehalose-6P, a key regulatory molecule controlling the glycolitic flux in yeast
(Blazquez et al., 1993; Thevelein and Hohmann, 1995).
1.5 Aim of the Study
The aim of this study was therefore to clarify the function of regulatory subunits of
the TPS complex through analysis of deletion mutants. The disaccharide trehalose
has an important function in the adaptation of microorganisms to environmental
changes. It is also an important storage carbohydrate together with glycogen in the
yeast S. cerevisiae. TSL1 and TPS3 may encode regulatory partners whose respective
functions have never been seriously investigated yet.
![Page 35: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/35.jpg)
9
The extent and pattern of trehalose accumulation during batch cultures was obviously
investigated. Mutant and wild type strains were screened for putative phenotypes in
stress response after exposure of yeast cells to harmful conditions. Finally, since
trehalose is important for spore formation and viability, and since tps1 mutants
severely affects meiosis, spore formation phenotype was also investigated in the
different mutants of the TPS complex.
![Page 36: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/36.jpg)
10
![Page 37: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/37.jpg)
11
2. MATERIALS and MEDHODS
2.1 Materials
2.1.1 Strains
Strains which were used in this study were the CEN.PK 113-7D MATa,CEN.PK
113-1A MATα, tps1∆::kanMX4 MATa, tps1∆::kanMX4 MATα and tps2∆::kanMX4
MATa, in the CEN.PK background from JMF laboratory (Toulouse, FRANCE)
stock. We also used the MATa strains tps3∆::kanMX4 and tsl1∆::kanMX4 from the
Open Biosystem Collection (in the BY 4741 background).
2.1.2 Cultivation mediums
YN medium was supplied with different carbon sources such as ethanol, fructose
galactose, trehalose, glucose maltose and sucrose, with final concentration adjusted
to 2% (w/v).
Table 2.1 : Yeast minimal medium (YN) ingredients and amounts.
Component Amount
Yeast Nitrogen Base (without amino asit
and ammonium sulfate) 1.7 g
Ammonium Sulfate 5 g
Carbon Source 20 g
Agar Type-E (for only solid media) 20 g
1 Liter ddH2O
for pH = 5
Succenic acid 13.5 g
NaOH 6.5 g
![Page 38: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/38.jpg)
12
Table 2.2 : Yeast rich medium (YP) ingredients and amounts.
Component Amount
Yeast Extract 10 g
Bacto Peptone 10 g
Carbon Source 20 g
Agar Type-E
(for only solid media) 20 g
1 lt ddH2O
YPD is glucose supplemented YP medium.
2.1.3 Chemicals
Chemicals used in this study were listed in Table 2.3.
Table 2.3 : Chemicals and their suppliers which were used in this study.
Chemicals Supplier
D(-)-Fructose BHD Prolabo
D(+)-Galactose Panreac
Maltose Merck
Sucrose Sigma
D(+)-Trehalose Sigma
D(-)-Sorbitol Sigma
CFW ICN Biomedical
Caffeine Sigma
Bacto Peptone BD
Yeast Extract Biokar
Yeast Nitrogen Base BD Difco
Ammonium Sulfate BHD Prolabo
NaOH BHD Prolabo
Agar Type-E Biokar
2.1.4 Buffers, solutions and enzymes
Buffers, solutions and enzymes used in this study were listed in Table 2.4 and 2.5
Table 2.4 : Solution and buffers used in the study.
Solution Concentration
Polyethylene glycol (PEG) 50% (w/v)
Lithium acetate (LiAc) 1 M
Acetic Acid 1 M
Sodium acetate 0.2 M
Na2CO3 0.25 M
![Page 39: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/39.jpg)
13
Table 2.5 : Enzymes and chemicals used for quantitative measurement of
intracellular trehalose and glycogen.
Product Supplier
Glucose oxidase/peroxidase reagent Sigma
o-dianisidine dihydrochloride tablet Sigma
Trehalose (from porcine kidney) Sigma
alpha-amyloglucosidase Roche
2.1.5 Laboratory equipments
Laboratory equipments used in this study were listed in Table 2.6.
Table 2.6 : Laboratory equipments used at the study.
Labrotary Equipment Company
Light Microscope Nikon Eclipse E 400
Micromanipulator Singer
Thermo Cycler Bio-Rad PCR
Spektrophotometer Biochrom Libra S11
Multiplate Spektrophotometer Bio-Rad 680-XR
Microcantrifuge Eppendorf 5415 D
Micropippette Gilson
Orbital Shaker Hybaid Micro 4
pH meter Drehzal Ikamag Reo
Deepfreze and Refrigerator Liebherr CN 3956
Sonicator Vibracell 72434 Bioblock S.
Centrifuge Beckman-Coulter Altegra 21R
2.2 Methods
2.2.1 Strain construction
Mutant strains were constructed by using the PCR-targeted gene disruption with
KanMX4 module. The kanMX module consist of the kanr open reading frame of E.
coli transposon Tn903 fused to transcriptional and translational control sequence of
the TEF gene of the filamentous fungus Ashbya gossypii. Transformant cells which
contain this module are resistant to geneticin (G418), which permits easy and
efficient selection of the mutant strain (Wach et. al., 1994).
Deletion cassettes were amplified by PCR from CEN.PK tps2∆::kanMX4, BY 4741
tps3∆::kanMX4 and tsl1∆::kanMX4 genomic DNAs for transformation of the
CEN.PK strain to construct mutant strains.
![Page 40: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/40.jpg)
14
2.2.1.1 DNA extraction
Genomic DNA was obtained by using the MasterPure Yeast DNA Prufication kit.
Strains were cultivated overnight on YPD medium at 30 °C, 200 rpm for genomic
DNA extraction
2.2.1.2 PCR
Amplification of deletion cassettes and verification of right transformation steps
were achieved by PCR. Table 2.8 shows the primers used.
Table 2.7 : Primers used at the study for amplification of deletion cassettes and
verification of transformation
Gene Forward/
Reverse Primer Name Sequence (5’ to 3’)
TPS2 F TPS2_A ACAATCTCGATTCTCATTTTCTTTG
R TPS2_D GTAGTACCCTCTTTTACCTACCGCT
TPS3 F TPS3_A TAACACCTAACCTCGATAGAGTTGC
R TPS3_D ACCACCTTTAGTGTTTTTCTTACCC
TSL1 F TSL1_-648dir GGTTTGGCATCCTGTACGGTTC
R TSL1_+3753rev TCATGAATAGCCGGAGCCAGTAG
TSL1 F TSL1_A CCAGATAGAAATTTCGAGAAAAGC
R TSL1_D AAACGCCTTTAATTAGAATATTGGG
KanMX4 R Kan Rev GCAACCGGCGCAGGAACAC
Table 2.8 : PCR protocol used at the study for amplification of deletion cassettes and
verification of transformation
Temperature Time Cycle
Denaturating
Initial
Denaturation 98 °C 30 sec 1
Amplification
Denauration 98 °C 10 sec
30 Annealing 58 °C 20 sec
Extension 72 °C 1.30 min
Final Extantion 72 °C 7 min 1
Cooling 15 °C ∞
![Page 41: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/41.jpg)
15
Table 2.9 : PCR components and their amount and concentrations used for gene
amplification
Component Amount Final Concentration
5X HF Buffer 5 µl -
Phusion Polymerase 0.5 µl -
Template DNA 1 µl -
Primers (Forw/Rev) 2.5 + 2.5 µl 250 nM
dNTP 2.5 µl 250 µM
H2O 11 µl -
Total = 25 µl
2.2.1.3 Transformation protocol
Wild type strain was inoculated in 5 ml YPD and incubated overnight at 200 rpm, a
temperature of 30 ºC. After overnight growth, strain was inoculated by adjusting
their initial OD600 value as 0.2 and pre-cultured again in 5 ml YPD. When culture
reach the exponential phase (OD600 value between 1 an 2) 3 ml culture was harvested
and centrifugated 2 min. at 13.000 rpm. After, growth medium discarded cells were
washed with 1 ml sterile water and cenrifugated for 2 min at 13.000 rpm. Water was
discarded and cells were resuspended in 200 µl (100 mM) LiAC and centrifugated
for 2 min. at 13.000 rpm. This step was repeated two times, than cells resuspended
again and waited for 5 min. at room temperature. At same time SS-DNA was boiled
for 5 min and placed in ice. Following the 30 sec., 13.000 rpm centrifugation basic
transformation mix was added to tube with this order; 240 µl PEG (50% W/V), 36 µl
LiAC (1 M), 50 µl SS-DNA (2.0 mg/ml), 8 µl PCR product (deletion cassette) and 8
µl sterile ddH2O. Tube was mixed until cells resuspend in transformation mix by
vortex and cultivated at 30 °C for 30 min. After cultivation heat shock was
performed at 42 °C for 30 min. Transformation mix discarded after 30 sec 13.000
rpm centrifugation, cells resuspended in 500 µl YPD with gentle pipetting and
cultivated at 30 °C overnight.
2.2.1.4 Mutant selection and verification
Overnight cultivated culture was inoculated on G418 plate with spreading
methodology and cultivated at 30 °C for few days (single colonies appear between 2-
3 days). After singe colonies were appeared, some of them were selected and
cultivated in YPD medium. After genomic DNA isolation of these mutant colonies,
![Page 42: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/42.jpg)
16
deletion of gene was determined by PCR. At this step, related gene forward primer
and KanMX reverse primer were used for verification.
2.2.1.5 Double mutant strain construction
To produce the double tps3tsl1 mutant strain, tps3 MATα strain was constructed and
crossed on YPD plate with tsl1 MATa strain.
After mating (verified by microscope), culture which consist haploid and diploid
cells (mostly diploids) was cultivated on KAc sporulation plate for 3 days.
Sporulation was verified by microscope and spores were isolated from mix culture.
Spores were cultivated on YPD plate and selected single colonies replicated on G418
plate. Growing colonies were selected and verified by PCR for both deletion of
genes.
2.2.1.5.1 Spore isolation
Sporulating cells were taken from KAc plate after 3 days and suspended in 100 µl
sterile water. 100 µl ether was added and mixed by vortex. After 15 min. at room
temperature, mixture was centrifugated 1 min., 13.000 rpm and supernatant was
removed. Pellet resuspended with 200 µl sterile water and spreaded on YPD plate for
cultivation (30 °C and 2 days).
2.2.1.5.2 Determination of mating type for double mutant
In order to determine the mating type of double mutant cells, all the double mutants
(germinated spores) were crossed with wild type MATa and MATα strains on YPD
plate. After 4-5 hours incubation at 30 °C, strains were checked for mating at
microscope and mating type was determined. Selected MATa and MATα strains
were crossed on YPD plate and checked for mating with same way for verification.
2.2.2 Obtaining growth curve of wild type and mutant strains
First, wild type and mutant individuals were incubated overnight in 5 ml YPgal
medium at 30°C, 200 rpm. OD600 values were then measured, cells were adjusted to
0.2 optical density and they were transferred to 7 ml YPgal medium in 50 ml falcons.
When cultures reach exponential phase, the optical density was set up to 0.015 and
start to cultivation in 150 ml YNgal medium. Wild type and all mutants in 500 ml
flasks were incubated at 30 ºC and 200 rpm. Samples were taken for measurement
![Page 43: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/43.jpg)
17
the OD600 value of cultures and all samples were sonicated for 3 sec. to disrupt cell
aggregates for accurate OD measurement (prevent cells aggregation). OD600 values
and cultivation time was recorded. Growth curve of strains were obtained by that
way. During the batch cultivation samples for analysis of intracellular glucose stores
(trehalose and glycogen) were taken if necessary.
Long term batch cultivation experiment was repeated with and without double
mutant strain tps3tsl1. At the first experiment wild type and all single mutants were
used and at the second experiment wild type, single mutants and double mutant strain
were used.
2.2.3 Measurement of intracellular trehalose and glycogen content
In order to compare the glycogen and trehalose amounts of the wild-type and mutants
during growth. While following growth, (for the measurement of glycogen and
trehalose amount) samples were taken. The amount of cells needed corresponded to
15-20 optical density unit. Samples were centrifugated for 30 sec., 13000 rpm and
supernatant was discarded. Pellet was washed 1 ml ddH2O and centrifugated 30 sec.,
13.000 rpm. All supernatant was removed with using vacuum. Prepared samples
were stored at -20 °C.
In order to measure the glycogen and trehalose amounts in all samples that were
previously obtained, the procedure was performed as described previously (Francois
and Parrou, 1997). First, 250 μl 0.25 M sodium carbonate was added to the pellets of
the cells and they were mixed by vortex. Then, these cells were placed to 95°C for 2-
4 hours. At the end of incubation, cell suspensions were adjusted to pH 5.2 with 1M
150 µl acetic acid and 600 µl 0.2M sodium acetate buffer (pH 5.2). Cell suspensions
were mixed well. Subsequently, 500 μl of the samples were transferred to new tubes
for trehalose determination, while the remaining 500 µl the rest was used for
glycogen analysis. 10μl of commercial trehalase (trehalase was already liquid) was
pipetted into 500 µl cell suspensions and the tubes were placed to 37 °C for
overnight incubation. On the other hand, 20 μl alpha-glycosidase (it is solubilized in
0.2 M sodium acetate ‘pH 5.2’) was pipetted into other half of cell suspensions and
the tubes were placed to 57°C for overnight incubation (in a rotary shaker).
Glucose standards, used for the determination of both glycogen and trehalose
concentration, were prepared by using glucose standard solution. All samples were
![Page 44: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/44.jpg)
18
centrifugated 2 min., 2000 rpm and clean supernatants were used as sample. 20 μl of
standards and all the samples (as dublicates) were delivered to different wells of 96-
well plate. Subsequently, 200 μl of glucose oxidase/peroxidase reagent was added
into each well of 96-well plate. Following 20 minute incubation at 37°C, the
absorbance of the samples was measured at 490 nm.
2.2.4 Determination of growth phenotype and stress resistance on solid media
In order to analyze the effect of the deletions, wild type and mutant strains were
cultivated overnight in YPgal medium at 30 °C. OD600 value was adjusted to 8 for
each strain. After that, mutant and wild type cells were serially diluted from 10-1
to
10-5
with distilled water in the sterile micro centrifuge tubes. From each diluted cell
suspension 2 µl were inoculated onto plates.
At the first part of the experiment, different carbon sources suplemented YN solid
mediums were prepared. Plates were cultivated at 30 ° and observed for their growth
phenotypes. Glucose, galactose, maltose, sucrose, trehalose and ethanol were used as
carbon source with 2% (w/v) final concentration.
Exposition to different stress conditions was also tested. For this purpose YNgal
solid mediums were prepared and chemicals were added, at the final concentration
shown in Table 2.10. YNgal 2% (w/v) plate was used as control plate. Plates were
cultivated at 30 ° and observed for their growth phenotypes.
Table 2.10 : Solid YNgal medium with different stress conditions
Stress Amount
Ethanol
2% (w/v)
5% (w/v)
10% (w/v)
CFW 0.05 mg/ml
0.1 mg/ml
Sorbitol 1 M
Caffeine 10 mM
2.2.5 Sporulation efficiency
To obtain diploid homozygote mutant strains, all the strains were crossed with their
opposite mating type strain on YPgal plates. After 5 hours incubation at 30 C diploid
single cells were isolated by using a micromanipulator. Selected zygotes (single
cells) were cultivated on YPgal plate for 5 days. Homozygote diploid mutant cells
![Page 45: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/45.jpg)
19
and the diploid wild type strain were then cultivated on KAc sporulation plate for 4
days at room temperature. Cells were taken from sporulation plate and suspended in
sterile water. Samples were diluted OD600=0.15 and 10 µl sample was loaded to
counting chamber. Number of ascus and yeast cells were counted by using
microscope for determination of the sporulation efficiency.
![Page 46: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/46.jpg)
20
![Page 47: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/47.jpg)
21
3. RESULTS
3.1 Mutant Strains
Construction of CEN.PK tps2 MATα mutant was carried out by homologous
recombination with a PCR product that was obtained as follows. A DNA fragment
tps2::kanMX4 allele was amplified by PCR using genomic DNA from CEN.PK
tps2::KANMX4 MATa strain and primers TPS2_A and TPS2_D (Table 2.7) as
explained in section 2.2.1.3 and CEN.PK MATα strain was used as host strain.
In order to construct tps3 mutant strains same method was used and CEN.PK MATa
and MATα strains were used as host strains. Deletion cassette was amplified with
TPS3_A and TPS3_D primers (Table 2.7) from genomic DNA prepared from the BY
4741 tps3::kanMX4 strain from the Open Biosystem collection.
For construction of tls1 mutant strains deletion cassette was amplified from genomic
DNA BY 4741 tsl1::kanMX4 from the Open Biosystem collection with TSL1_A and
TSL1_D primers (Table 2.7) for MATα mutant and tsl1_-567 and tsl1_+6784
primers for MATa mutant strain. CEN.PK MATa and MATα strains were used as
host strain.
To obtain double mutant tps3tsl1 strain tps3 MATa and tsl1 MATα strains were used
as described in section 2.2.1.5. Than mating type of double mutants were defined
using the methodology described section 2.2.1.5.2.
For all mutant strains, correct replacement of genes was analyzed by PCR with using
related forward primer and Kan Rev primer (Table 2.7). Table 3.1 shows the mutant
strains and their mating types constructed in this study.
![Page 48: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/48.jpg)
22
Table 3.1 : Mutant strains and their mating types which were constructed at the
study
Mutant Strain Mating type
tps2 MATα
tps3 MATa
tps3 MATα
tsl1 MATa
tsl1 MATα
tps3tsl1 MATa
tps3tsl1 MATα
3.2 Evaluation of Growth Parameters and Intracellular Trehalose and Glycogen
of Strains
In order to obtain growth curves, the absorbance values of all individuals incubated
in 500 ml flasks at 150 ml culture volume, were measured optical density at 600 nm
by spectrophotometer in regular time intervals during approx. 200 h cultivation.
Specific growth rates (µ) of wild type and mutants were obtained from growth
curves. For this purpose, apparent exponential phase of growth points were fitted
using exponential regression analysis with excel software and points was selected as
to reach higher correlation coefficient (r2) value.
Intracellular concentrations of two storage carbohydrates, glycogen and trehalose,
were determined as described previously (see Section 2.2.3) for all mutants and wild
type strains. Changes of concentration of these carbohyrates with time was shown on
growth curves graphics for each strain Figure 3.1 to 3.11.
![Page 49: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/49.jpg)
23
Figure 3.1 : Growth curve of wild type strain and changes of intracellular trehalose
and glycogen concentration according to time (1st Experiment).
Figure 3.2 : Growth curve of wild type strain and changes of intracellular trehalose
and glycogen concentration according to time (2nd
Experimet).
Wild type strain reached the almost same maximum optical density value at both
experiment. Rapid trehalose accumulation was observed at the end of the exponential
phase of growth. On the other hand, lower trehalose and glycogen accumulation was
observed at the second experiment but also during the stationary pahse wild type
strain accumulate about two times higher trehalose compared to glycogen at both
longterm batch cultivation.
0
5
10
15
20
25
30
35
40
0 50 100 150 200 250
OD
60
0
Time (h)
wt
wt
tre µg/ u. OD
gly µg/ u. OD
0
5
10
15
20
25
30
35
40
45
0 50 100 150 200 250
OD
60
0
Time (h)
wt
WT
tre µg/u OD
gly µg/u OD
![Page 50: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/50.jpg)
24
Figure 3.3 : Growth curve of tps1 strain and changes of intracellular
trehalose and glycogen concentration according to time
(1st Experiment).
Figure 3.4 : Growth curve of tps1 strain and changes of intracellular
trehalose and glycogen concentration according to time
(2nd
Experiment).
At both experiment same growth pattern was observed and almost same maximum
optical density value was measured for tps1 mutant strain. As expected no trehalose
accumulation was observed. On the other hand, rapid glycogen mobilisation was not
seen at the second experiment.
0
5
10
15
20
25
30
35
40
0 50 100 150 200 250
OD
60
0
Time (h)
tps1
tps1
tre µg/ u. OD
gly µg/ u. OD
0
5
10
15
20
25
30
35
40
45
0 50 100 150 200 250
OD
60
0
Time (h)
tps1
tps1
tre µg/u OD
gly µg/u OD
![Page 51: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/51.jpg)
25
Figure 3.5 : Growth curve of tps2 strain and changes of intracellular
trehalose and glycogen concentration according to time
(1st Experiment).
Figure 3.6 : Growth curve of tps2 strain and changes of intracellular
trehalose and glycogen concentration according to time
(2nd
Experiment)
At the first experiment tps2 strain reached OD600=25 and OD600=30 for the second
experiment. This mutant strain showed slower trehalose accumulation compared to
wild type also higher amount of glycogen accumulation observed according to
trehalose sugar.
0
5
10
15
20
25
30
35
40
0 50 100 150 200 250
OD
60
0
Time (h)
tps2
tps2
tre µg/ u. OD
gly µg/ u. OD
0
5
10
15
20
25
30
35
40
45
0 50 100 150 200 250
OD
60
0
Time (h)
tps2
tps2
tre µg/u OD
gly µg/u OD
![Page 52: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/52.jpg)
26
Figure 3.7 : Growth curve of tps3 strain and changes of intracellular trehalose and
glycogen concentration according to time (1st Experiment).
Figure 3.8 : Growth curve of tps3 strain and changes of intracellular trehalose and
glycogen concentration according to time (2nd
Experimet).
At the first experiment tps3 strain reached OD600=30 and OD600=35 for the second
experiment. Slower trehalose accumulation was observed at the second experiment
for tps3 mutant strain but also this mutant strain was accumulate higher amount of
trehalose compared the other mutant strains.
0
5
10
15
20
25
30
35
40
0 50 100 150 200 250
OD
60
0
Time (h)
tps3
tps3
tre µg/ u. OD
gly µg/ u. OD
0
5
10
15
20
25
30
35
40
45
0 50 100 150 200 250
OD
60
0
Time (h)
tps3
tps3
tre µg/u OD
gly µg/u OD
![Page 53: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/53.jpg)
27
Figure 3.9 : Growth curve of tsl1 strain and changes of intracellular trehalose and
glycogen concentration according to time (1st Experimet).
Figure 3.10 : Growth curve of tsl1 strain and changes of intracellular trehalose and
glycogen concentration according to time (2nd
Experiment).
At the both experiment almost same maximum optical density value was measured
for tsl1 mutant strain. At the second experiment, lower amount of trehalose and
glycogen accumulation was observed but also glycogen and trehalose amounts
reached almost the same level during the both experiment. In addition, slower
trehalose accumulation was observed compared to wild type strain.
0
5
10
15
20
25
30
35
40
0 50 100 150 200 250
OD
60
0
Time (h)
tsl1
tsl1
tre µg/ u. OD
gly µg/ u. OD
0
5
10
15
20
25
30
35
40
45
0 50 100 150 200 250
OD
60
0
Time (h)
tsl1
tsl1
tre µg/u OD
gly µg/u OD
![Page 54: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/54.jpg)
28
Figure 3.11 : Growth curve of tps3tsl1 strain and changes of intracellular trehalose
and glycogen concentration according to time.
During the longterm batch cultivation maximum optical density value was measured
as OD600=35 for tps3tsl1 double mutant strain. Slower trehalose accumulation was
observed compared to wild type. Furthermore, same amuont of trehalose and
glycogen was accumulated during the stationary phase.
3.3 Strains Specific Growth Rates and Maximum Optical Density Values
Specific growth rates and maximum OD600 values were determined from the growth
curve experiment. Table 3.8 shows the specific growth rate and max. optical density
value of each strain.
During the long term batch cultivation, tps1 and tps2 mutant strains could not reach
the higher OD600 value as wild type and other mutant strains tps3, tsl1 and tps3tsl1.
Moreover, lower max. OD600 value was measured for double mutant strain compared
to tps3, tsl1 and wild type. According to their specific growth rates, tps2 strain was
the slowest strain with µmax=18. In addition, tps3 and tsl1 strains grown at same rate
during the both experiments and tps3tsl1 mutant strain grown faster than single
mutants.
0
5
10
15
20
25
30
35
40
45
0 50 100 150 200 250
OD
60
0
Time (h)
tps3tsl1
tps3tsl1
tre µg/u OD
gly µg/u OD
![Page 55: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/55.jpg)
29
Table 3.2 : Specific growth rates and max. OD600 values.
Strain Specific Growth Rate Max. OD600 Values
1st Exp. 2
nd Exp 1
st Exp. 2
nd Exp
wt 0.24 0.22 38 40
tps1 0.22 0.20 25 24
tps2 0.18 0.18 23 29
tps3 0.23 0.20 30 36
tsl1 0.23 0.20 38 36
tps3tsl1 - 0.21 - 33
3.4 Carbon Source and Stress Plates
3.4.1 Carbon source plates
Mutants and wild type were analyzed for their growth performances on different
nutrients. Visual observation of growth performances on solid media was done as
described in 2.2.4. Plate images were taken upon 48 hours incubation at 30°C. They
were given below in Figure 3.12, Figure 3.13 and Figure 3.14. Rows from left to
right correspond to 1, 10-1
, 10-2
, 10-3
, 10-4
, 10-5
fold dilution, respectively.
Figure 3.12 : Images of wild type and mutant individuals on YNgal plate after 48
hours of incubation as a control plate
Figure 3.13 : Images of wild type and mutant individuals on YN medium palte
supplemented with 2% glucose, maltose and sucrose left to right.
![Page 56: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/56.jpg)
30
Figure 3.14 : Images of wild type and mutant individuals on YN medium palte
supplemented with 2% trehalose and ethanol left to right.
According to plate results YN medium supplemented with 2% (v/w) maltose,
sucrose, trehalose, ethanol, galactose and glucose, tps1 strain could not grown on
glucose, maltose and sucrose mediums. In addition significant growth delay was
observed on trehalose and ethanol medium for all strains. No significant growth
phenotype was observed for tps3, tsl1 and tps3tsl1 double mutant strains compared to
wild type.
3.4.2 Stress plates
Mutants and wild type were analyzed for their resistance against other stress factors.
Visual observation of growth performances on solid media was done as described in
2.2.4. Plate images were taken upon 48 hours incubation at 30°C. They were given
below in Figure 3.15, Figure 3.16 and Figure 3.17. Rows from left to right are 1, 10-
1, 10
-2, 10
-3, 10
-4 , 10
-5 diluted in each plate.
Figure 3.15 : Images of wild type and mutant individuals on YN galactose as control
and 10 mM caffeine plate.
![Page 57: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/57.jpg)
31
Figure 3.16 : Images of wild type and mutant individuals on 2%, 5% and
10% Ethanol contain YNgal plate upon 48 hours incubation.
Figure 3.17 : Images of wild type and mutant individuals on CFW0,1 and 0.05
mg/ml and 1M sorbitol contain YNgal plate upon 48 hours
According to visual observation results were made with plates, which strains were
cultivated on YN galactose (2%) supplemented with 1M sorbitol; 10mM caffeine;
0.05 and 0.1 mg/ml CFW; 2%, 5% and 10% v/w ethanol, respectively. Growth delay
was observed on Yngal control plate for tps1 strain while starting with same
inoculum. The presence of sorbitol lead to a significant growth delay of the tps1
strain. Mutant strains tsl1 and tps1 showed enhanced resistance to high concentration
of ethanol as compared to the WT and the control plate. At the caffeine plate, Lethal
effect was observed on tps1 and double mutants, while the single tps3 and tsl1
mutants showed slightly more (or no more) sensitivity than the WT. Chemical CFW
showed no significant effect on the strains.
3.5 Sporulation Efficiency
Trehalose is important for spore formation and viability, and since tps1 mutants
severely affects meiosis and sporulated poorly (Ferreira and Panek, 1993). Spore
formation phenotype was investigated in the different homozygote diploid mutants of
the TPS complex. The homozygous tps1 diploid strain exhibited a significant
![Page 58: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/58.jpg)
32
reduction in the efficiency of ascus formation about 5% as compared to 25% in the
WT diploid strain. İn addition, all other mutant strains from the TPS complex did
exhibit a serious deficiency in ascus formation. The tsl1 showed similar sporulation
deficiency as tps1 mutant. Dramatic scores in the tps2 and tps3 homozygous diploid
strains, only ~2% and ~1% scores, respectively. The tps3tsl1 diploid strain
apparently behaved as the tsl1 single mutant. Table 3.4 shows the sporulation
efficiency of independent diploid individual at study and mean value calculated from
these individuals, these later values being also plotted in Figure 3.18.
Table 3.3 : Sporulation efficiency for all homozygote diploid strains.
Strain Percentage Mean value
wt
23.5%
22.6% 22%
22.4%
tps1
6.2%
4.5% 2.4%
5%
tps2
4%
1.8% 0.7%
0.8%
tps3 1.9%
0.9% 0
tsl1 4.4% 4.4%
tps3tsl1
8%
5% 4.5%
2.5%
Figure 3.18 : Sporulation efficiencies of strains.
%22,6
%4,5 %1,8 %0,9
%4,4 %5
wt tps1∆ tps2∆ tps3∆ tsl1∆ tps3∆tsl1∆
Sporulation Efficiency
![Page 59: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/59.jpg)
33
4. DISCUSSIONS AND CONCLUSIONS
The aim of this study was therefore to clarify the function of TPS complex regulatory
subunits tps3p and tsl1p through analysis of deletion mutants. For this purpose,
single mutant strains were constructed with using the PCR-based gene disruption
methodology. Also double mutant strain tps3tsl1 was obtained by use of classical
genetics procedures such as crosses, sporulation, marker based selection and verified
by PCR. The extent and pattern of trehalose accumulation and growth phenotypes
during batch cultures was obviously investigated. In addition long term batch
cultivation, mutant and wild type strains were screened for putative phenotypes in
stress response after exposure of yeast cells to harmful conditions and different
carbon sources at solid mediums. In the last part of study, since trehalose is
important for spore formation and viability, and since tps1 mutants severely affects
meiosis, spore formation phenotype was quantified in the different mutants of the
TPS complex.
During the long term batch cultivation, tps1 and tps2 mutant strains could not reach
the higher max. optical density value as wild type and other mutant strains tps3, tsl1
and tps3tsl1. According to their specific growth rates, tps2 strain was the slowest
strain with µmax=18. On the other hand, tps3 and tsl1 strain grown at same rate but
double mutant strain grown faster than single mutants. These results may indicate
that the mutation at the TPS3 or TSL1 gene do not cause dramatic affects as TPS1
and TPS2 genes regard to specific growth rate and max. OD600 values but also
deletion of both TPS3 and TSL1 genes cause lower biomass production.
Glycogen and trehalose are two intracellular reserve carbohydrates present in the
yeast cells (Parrou and François, 1997) and TPS complex is responsible to synthesis
of trehalose (Bell et. al., 1998), also reserve carbohydrate metabolism controlled
hierarchically (François et al., 2012). Thus, for better understanding to effect of
mutations over the reserve carbohydrate metabolism intracellular trehalose and
glycogen levels were measured during the growth for each strain.
![Page 60: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/60.jpg)
34
As expected trehalose accumulation starts with entrance of diauxic shift for all
strains except tps1 and no trehalose accumulation was observed for this mutant.
Tps1p is essential subunit of TPS complex for trehalose synthesis (Parrou et al.,
1999; Bell et al., 1998). Tps3 mutant strain showed high amount of trehalose
accumulation compared the other mutant strains during the stationary phase also
showed more similar trehalose accumulation pattern with wild type compared to tsl1
and tps3tsl1. On the other hand, tsl1 and tps3tsl1 strain showed similarity to tps2
strain for trehalose accumulation pattern. Slower trehalose accumulation was
observed for these strains compared to wild type strain after entrance of diauxic shift.
Slower trehalose accumulation can be understandable for tps2 strain in that absence
of TPP activity and Tre-6P catalyzes by other phosphatases (Bell et al., 1998). It may
be concluded that, absence of tsl1p subunit can cause negative effect on TPS/TPP
complex activity.
This study showed that deletion of TPS complex subunits caused alteration on
glycogen accumulation. Our obvious result was higher accumulation of glycogen at
the entrance of, and all along stationary phase in the tps2 mutant as compared to all
other strains.
Growth assay on plates for influence of carbon sources was performed with serial
dilution series prepared from O/N cultures in liquid YP Gal medium. YN medium
with either %2 Fructose, Glucose, Maltose, Sucrose, Trehalose or Ethanol and YN
Galactose medium as control was used for experiment. Our results confirmed the
absence of growth of the tps1 mutant on fermentable carbon sources, but did not
highlight any growth defects of the other subunits of the TPS complex.
Putative phenotypes were also screened for stress response after exposure of yeast
cells to harmful conditions. For this purpose, growth assay on plates with serial
dilution series was performed with exposure to chemicals and stress conditions.
Strains were cultivated on YN galactose (2%) supplemented with 1M sorbitol;
10mM caffeine; 0.05 and 0.1 mg/ml CFW; and 2%, 5% and 10% v/w ethanol,
respectively. For tps1 strain expected growth delay was observed while starting from
the same inoculum. The presence of sorbitol lead to a significant growth delay of the
tps1 strain. Both tsl1 and tps1 mutants showed enhanced resistance to high
concentration of ethanol as compared to the WT. This resistance against high
concentration of alcohol could not be attributed to intracellular accumulation of
![Page 61: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/61.jpg)
35
trehalose since this disaccharide does not accumulate in this tps1 strain. In addition,
clear epistatic relationship between TPS3 and TSL1 was observed, with a dominant
effect of tps3 over tsl1 deletion compared with wild type strain. Caffeine showed
lethal effect on tps1 and double mutants, while the single tps3 and tsl1 mutants
showed slightly more (or no more) sensitivity than the WT. In contrast, the tps2
mutant showed striking insensitivity to this chemical.
Finally, since trehalose is important for spore formation and viability, and since tps1
mutants severely affects meiosis (De Silva-Udawatta and Cannon, 2001), spore
formation phenotype was also investigated in the different mutants of the TPS
complex. As expected from practice and difficulties in getting derivative strains
carrying the tps1 allele, the homozygous tps1 diploid strain exhibited a significant
reduction in the efficiency of ascus formation (~5% as compared to 25% in the WT
diploid strain). Very interestingly, all other mutant strains from the TPS complex did
exhibit a serious deficiency in ascus formation. The tsl1 showed similar sporulation
deficiency as tps1. Dramatic scores in the tps2 and tps3 homozygous diploid strains
(only ~2% and ~1% scores, respectively). The tps3tsl1 diploid strain apparently
behaved as the tsl1 single mutant.
In conclusion, according to growth curve analyses regulatory units of TPS complex
tps3 and tsl1 did not affect the growth phenotype compared to wild type strain. On
the other hand, in the light of intracellular trehalose and glycogen measurement
during growth, tsl1 mutant strain causes slower trehalose accumulation. In addition,
tps1 and tsl1 strains show resistance to high concentration of ethanol but it cannot be
related with trehalose accumulation because tps1 strain could not accumulate this
disaccharide. Moreover, there is clear epistatic relationship between TPS3 and TSL1,
with a dominant effect of tps3 over tsl1 deletion at high concentration of ethanol.
Finally, according to sporulation efficiency assay, very interestingly, all other mutant
strains from the TPS complex did exhibit a serious deficiency in ascus formation.
Nevertheless, Molecular and biochemical approaches will then be carried out to
clarify the molecular basis of the roles and singularities of the ‘regulatory’ proteins
of this complex, which, interestingly, are apparently not present in other fungal
TPS/TTP complexes (Avonce et al., 2006).
![Page 62: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/62.jpg)
36
![Page 63: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/63.jpg)
37
REFERENCES
Alberts, B. (2008). Molecular Biology of the Cell. New York, Garland Science.
Avonce, N., Mendoza-Vargas, A., Morett, E., Iturriaga, G. (2006). Insights on the
evolution of trehalose biosynthesis. BMC Evolutionary Biology, 6,
109
Bell, W., Sun W., Hohmann, S., Wera, S., Reinders, A., De Virgilio, C.,
Wiemken, A., Thevelein, J.M. (1998). Composition and Functional
Analysis of the Saccharomyces cerevisiae Trehalose Synthase
Complex. The Journal of Biological Chemistry, 273(50), 33311-
33319.
Blazquez, M. A., Lagunas, R., Gancedo, C., Gancedo, J.M. (1993). Trehalose-6-
phosphate, a new regulator of yeast glycolysis that inhibits
hexokinases. FEBS Lett, 329, 51–54.
Feldmann, H. (2010). Yeast : Molecular and Cell Biology. Weinheim, Wiley-VCH.
De Silva-Udawatta, M.N., Cannon, J.F. (2001). Roles of trehalose phosphate
synthase in yeast glycogen metabolism and sporulation. Mol
Microbiol, 40, 1345-1356.
De Virgilio, C., Bürckert, N., Bell, W., Jenö, P., Boller, T., Wiemken, A. (1993).
Disruption of TPS2, the gene encoding the 100-kDa subunit of the
trehalose-6-phosphate synthase/phosphatase complex in
Saccharomyces cerevisiae, causes accumulation of trehalose-6-
phosphate and loss of trehalose-6-phosphate phosphatase activity.
Eur. J. Biochem, 212, 315-323.
Van Dijck, P., Colavizza, D., Smet, P., Thevelein, J.M. (1995). Differential
Importance of Trehalose in Stress Resistance in Fermenting and
Nonfermenting Saccharomyces cerevisiae Cells. Applied and
Environmental Microbiology, 61, 109-115.
Ferreira, J.C., Panek, A.D. (1993). Trehalose metabolism during sporulation in
Saccharomyces cerevisiae. Biochem Mol Biol Int, 31, 1081-1090.
François, J., Neves, M.J., Hers, H.G. (1991). The control of trehalose biosynthesis
in Saccharomyces cerevisiae: evidence for a catabolite inactivation
and repression of trehalose-6-phosphate synthase and trehalose-6-
phosphate phosphatase. Yeast, 7, 575-587.
François, J., Parrou J.L. (2001). Reserve carbohydrates metabolism in the yeast
Saccharomyces cerevisiae. FEMS Microbiology Reviews, 25, 125-
145.
François, J. M., Walther T., Parrou, J.L. (2012). Genetics and Regulation of
Glycogen and Trehalose Metabolism in Saccharomyces cerevisiae.
![Page 64: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/64.jpg)
38
Microbial Stress Tolerance for Biofuels, Microbiology Monographs,
22, 29-55, Springer-Verlag
Garre, E., Matallana, E., (2009). The three trehalases Nth1p, Nth2p and Ath1p
participate in the mobilization of intracellular trehalose required for
recovery from saline stress in Saccharomyces cerevisiae.
Microbiology, 155, 3092–3099.
Herskowitz, I. (1988). Life Cycle of the Budding Yeast Saccharomyces cerevisiae.
Microbiological Reviews, 52, 536-553.
Jules, M., Guillou, V., François, J., Parrou, J.L. (2004). Two Distinct Pathways
for Trehalose Assimilation in the Yeast Saccharomyces cerevisiae.
Applied and Environmental Microbiology, 70(5), 2771-2778.
Lejeune, A., Delvigle, F., Thonart, P. (2010). Trehalose as a stress marker of the
physiological impact of mixing on yeast production: scale-down
reactors and mini-bioreactors investigations. Biotechnol. Agron. Soc.
Environ, 14(S2), 531-536.
Lillie, S.H., Pringle, J.R. (1980). Reserve Carbohydrate Metabolism in
Saccharomyces cerevisiae: Responses to Nutrient Limitation. Journal
of Bacteriology, 143(3), 1384-1394.
Mahmud, S.A., Hirasawa T., Shimizu H. (2010). Differential importance of
trehalose accumulation in Saccharomyces cerevisiae in response to
various environmental stresses. Journal of Bioscience and
Bioengineering, 109(3), 262-266.
Plourde-Owobi, L., Durner, S., Parrou, J.L., Wieczorke, R., Goma, G.,
François, J. (1999). AGT1, Encoding an a-Glucoside Transporter
Involved in Uptake and Intracellular Accumulation of Trehalose in
Saccharomyces cerevisiae. Journal of Bacteriology, 181(12), 3830-
3832.
Parrou, J.L., Francois, J. (1997). A simplified procedure for a rapid and reliable
assay of both glycogen and trehalose in whole yeast cells. Analytical
Biochemistry, 248(1), 186-188.
Parrou, J.L., Enjalbert, B., Plourde, L., Bauche, A., Gonzalez, B., François, J.
(1999). Dynamic Responses of Reserve Carbohydrate Metabolism
Under Carbon and Nitrogen Limitations in Saccharomyces cerevisiae.
Yeast, 15, 191–203.
Reinders, A., Bürckert, N., Hohmann, S., Thevelein, J.M., Boller, T., Wiemken,
A., De Virgilio, C. (1997). Structural analysis of the subunits of the
trehalose-6-phosphate synthase/phosphatase complex in
Saccharomyces cerevisiae and their function during heat shock.
Molecular Biology, 24(4), 687-695.
Sherman, F. (2002). Getting started with yeast. Methods in Enzymology, 350, 3-41.
Singer, M.A., Lindquist, S. (1998). Multiple e¡ects of trehalose on protein folding
in vitro and in vivo. Mol. Cell, 1, 639-648.
Simola, M., Hänninen, A.L., Stranius, S.M., Makarow, M. (2000). Trehalose is
required for conformational repair of heat-denaturated proteins in the
![Page 65: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/65.jpg)
39
yeast endoplasmic reticulum but not for maintenance of membrane
traffic functions after severe heat stress. Mol. Microbiol., 37, 42-53.
Thevelein, J.M., Den Hollander, J.A., Schulman, R.G. (1984). Trehalase and the
control of dormancy and induction of germination in fungal spores.
Trends Biochem. Sci.,9, 495-497.
Thevelein, J.M., Hohmann, S., (1995). Trehalose synthase: guard to the gate of
glycolysis in yeast?. Trends Biochem. Sci. 20, 3–10.
Van Dijck, P., Colavizza, D., Smet, P., Thevelein, J.M. (1995). Differential
Importance of Trehalose in Stress Resistance in Fermenting and
Nonfermenting Saccharomyces cerevisiae Cells. Applied and
Environmental Microbiology, 61, 109-115.
Wach, A., Brachat, A., Pöhlmann, R., Philippsen P. (1994). New Heterologous
Modules for Classical or PCR-based Gene Disruptions in
Saccharomyces cerevisiae. Yeast, 10, 1793-1808.
Wera, S., De Schrijver, E., Geyskens, I., Nwaka, S., Thevelein, J.M. (1999).
Opposite roles of trehalase activity in heat-shock recovery and heat-
shock survival in Saccharomyces cerevisiae. Biochem. J., 343, 621–
626.
![Page 66: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/66.jpg)
40
![Page 67: ISTANBUL TECHNICAL UNIVERSITY GRADUATE SCHOOL OF … · mitoz bölünme geçirerek tomurcuklanma adı verilen bölünme yoluyla ürerler. Buna ek olarak diploid form açlık ya da](https://reader034.vdocuments.us/reader034/viewer/2022050716/5e408418a99407736407298c/html5/thumbnails/67.jpg)
41
CURRICULUM VITAE
Name Surname: Şerif KARABULUT
Place and Date of Birth: Kırcaali/BULGARIA 25.10.1985
Address: Karadeniz Mah. Göçmen Evl. Açelya Apt. Daire: 9
59100 Tekirdağ/ Merkez
E-Mail: [email protected]
B.Sc.: Molecular Biology and Genetics
Istanbul Technical University (2004-2009)
M.Sc.: Molecular Biology-Genetics and Biotechnology
Istanbul Technical University (2009-…..)
PUBLICATIONS/PRESENTATIONS ON THE THESIS
Şerif Karabulut; Marie-Ange Teste; Jean M François; Jean-Luc Parrou. “Towards a
better understanding of the function of the TPS complex from Saccharomyces
cerevisiae” 10th
Francophone Conference Yeasts, Models & Tools (LMO10)
Toulouse, FRANCE, 2-4 April, 2012 (Poster Presentation)