investigations on zinc resorption usingmaria maares, claudia keil, susanne thomsen, dorothee...
TRANSCRIPT
![Page 1: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/1.jpg)
Investigations on Zinc Resorption using
in vitro Intestinal Models
vorgelegt von:
Dipl.-LMChem. Maria Henrietta Maares
von der Fakultät III – Prozesswissenschaften
der Technischen Universität Berlin
zur Erlangung des akademischen Grades
Doktorin der Naturwissenschaften
- Dr. rer. nat. -
genehmigte Dissertation
Promotionsausschuss:
Vorsitzender: Prof. Dr. Eckhard Flöter
Gutachter: Prof. Dr. Dr. Hajo Haase
Gutachterin: Prof. Dr. Anna Kipp
Tag der wissenschaftlichen Aussprache: 29.03.2019
Berlin 2019
![Page 2: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/2.jpg)
![Page 3: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/3.jpg)
Table of Contents
Table of Contents
Declaration .................................................................................................................................. I
Summary ................................................................................................................................ III
Zusammenfassung ...................................................................................................................... V
Abbreviations ........................................................................................................................... VII
List of Tables .............................................................................................................................. XI
List of Figures ............................................................................................................................. XI
Chapter 1. Introduction ............................................................................................................. 1
Chapter 2. Literature Review .................................................................................................... 3
2.1 The Intestinal Tract ..............................................................................................................3
2.2 Zinc – Role in the Organism .............................................................................................. 11
2.3 In vitro Studies on Intestinal Zinc Resorption ................................................................... 27
Chapter 3. Objectives and Structure of Thesis ........................................................................ 37
Chapter 4. Characterization of Caco-2 cells Stably Expressing the Protein-based Zinc
Probe eCalwy-5 as a Model System for Investigating Intestinal Zinc Transport ... 39
4.1 Introduction ...................................................................................................................... 40
4.2 Experimental ..................................................................................................................... 41
4.3 Results ............................................................................................................................... 44
4.4 Discussion and Conclusion ................................................................................................ 54
4.5 Conflict of Interest ............................................................................................................ 56
4.6 Funding ............................................................................................................................. 57
4.7 References ........................................................................................................................ 57
Chapter 5. The Impact of Apical and Basolateral Albumin on Intestinal Zinc Resorption
in the Caco-2/HT-29-MTX Co-culture Model, ........................................................ 61
5.1 Introduction ...................................................................................................................... 62
5.2 Methods ............................................................................................................................ 64
5.3 Results ............................................................................................................................... 68
5.4 Discussion ......................................................................................................................... 76
5.5 Conclusion ......................................................................................................................... 79
5.6 Conflict of Interest ............................................................................................................ 79
5.7 Acknowledgements .......................................................................................................... 79
5.8 References ........................................................................................................................ 79
![Page 4: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/4.jpg)
Table of Contents
Chapter 6. In vitro Studies on Zinc Binding and Buffering by Intestinal Mucins ..................... 85
6.1 Introduction ...................................................................................................................... 86
6.2 Results ............................................................................................................................... 88
6.3 Discussion ......................................................................................................................... 99
6.4 Materials and Methods ................................................................................................... 103
6.5 Conclusion ....................................................................................................................... 106
6.6 Author Contributions ...................................................................................................... 107
6.7 Funding ........................................................................................................................... 107
6.8 Acknowledgements ........................................................................................................ 107
6.9 Conflicts of Interest ......................................................................................................... 107
6.10 References ...................................................................................................................... 107
Chapter 7. General Discussion .............................................................................................. 113
Chapter 8. References ........................................................................................................... 127
Appendix VIII
A. Supplemental Material of Chapter 4 ............................................................................... VIII
B. Supplemental Material of Chapter 5 .................................................................................. X
C. Supplemental Material of Chapter 6 ................................................................................ XV
D. Experimental conditions for Instrumental Zinc Quantification ........................................ XX
E. Supplemental Results of Zinc Resorption Studies with in vitro Intestinal Models .......... XXI
F. Application of in vitro Caco-2 Monocultures .................................................................. XXV
G. Author contributions .................................................................................................... XXXII
List of Publications............................................................................................................... XXXIV
Acknowledgements ............................................................................................................ XXXVII
![Page 5: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/5.jpg)
Declaration
I
Declaration
This cumulative dissertation comprises three scientific studies (Chapter 4-6), which were
prepared as independent manuscript and published in peer-reviewed journals. As the
manuscripts were composed in cooperation with co-authors, they are written in first person
plural (detailed listing of author contributions in Appendix G). The publications in Chapter 4-
6 are the final versions of the articles post-refereeing, thus the articles include contributions
of co-authors as well as of referees as outcomes of the peer-review process.
As leading author of the three manuscripts (Chapter 4-6), I developed the concept of the
studies with support of my supervisors Prof. Dr. Dr. Hajo Haase and Dr. Claudia Keil. I
executed most of the experiments, conducted the analysis and wrote the text of the
manuscripts. Experiments carried out by co-authors were performed as mentioned in
Appendix G. Published data or methods used in the manuscripts as well as results or
statements provided by others were cited as indicated by references in the respective
manuscripts.
I hereby declare that this thesis is the result of my own independent work, except where
otherwise stated. Other sources are acknowledged by explicit references.
Berlin, 28.01.2019
Maria Maares
![Page 6: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/6.jpg)
Declaration
II
This thesis is based on three peer-reviewed publications1:
Chapter 4:
Maria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo
Haase. "Characterization of Caco-2 cells stably expressing the protein-based zinc
probe eCalwy-5 as a model system for investigating intestinal zinc transport."
Journal of Trace Elements in Medicine and Biology 2018. 49: 296-304, DOI:
10.1016/j.jtemb.2018.01.004.
https://doi.org/10.1016/j.jtemb.2018.01.004
https://www.sciencedirect.com/science/article/pii/S0946672X17309033?via%3Dihub
Chapter 5:
Maria Maares, Ayşe Duman, Claudia Keil, Tanja Schwerdtle, Hajo Haase. "The impact of
apical and basolateral albumin on intestinal zinc resorption in the Caco-2/HT-29-
MTX co-culture model." Metallomics 2018. 10(7): 979-991, DOI:
10.1039/C8MT00064F.
https://doi.org/10.1039/C8MT00064F
https://pubs.rsc.org/en/Content/ArticleLanding/2018/MT/C8MT00064F#!divAbstract
Chapter 6:
Maria Maares, Claudia Keil, Jenny Koza, Sophia Straubing, Tanja Schwerdtle, Hajo Haase.
"In vitro Studies on Zinc Binding and Buffering by Intestinal Mucins." International
Journal of Molecular Science 2018. 19(9): 2662, DOI: 10.3390/ijms19092662.
https://doi.org/10.3390/ijms19092662
https://www.mdpi.com/1422-0067/19/9/2662
1 The publications in Chapter 4-6 are the accepted versions of the articles post-refereeing.
![Page 7: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/7.jpg)
Summary
III
Summary
The essential trace element zinc is mainly resorbed in the small intestine, where the luminal
available cation is absorbed by enterocytes of the intestinal epithelium and transported into
the blood circulation. In the past four decades substantial progress in the overall
understanding of zinc homeostasis was made by elucidating that the intestinal zinc
resorption regulates the systemic homeostasis of the metal. This was further complemented
by the discovery of the intestinal zinc transporters as well as the zinc binding protein
metallothionein and their regulatory role for zinc resorption. Despite these
accomplishments, molecular parameters that control intestinal zinc resorption are still
scarce and dietary factors affecting its luminal availability for the intestinal epithelium have
to be further scrutinized. For this, in vitro intestinal models provide a standardized and
versatile microenvironment to analyze zinc uptake into enterocytes and its subsequent
transport into the blood.
Hence, this thesis aimed to investigate intestinal zinc resorption with innovative in vitro
intestinal cell models. For this, a three-dimensional in vitro model to analyze zinc transport
via the intestinal epithelium had to be developed, which is closer to the in vivo situation than
the already existing ones. Herein, luminal and basolateral factors as well as cellular
composition should be optimized investigating their impact on zinc resorption. Moreover,
the scope of this thesis was to establish intestinal model systems to investigate cellular zinc
uptake with chemical- and protein-based fluorescent zinc sensors in addition to conventional
analytical approaches (such as inductively-coupled plasma mass spectrometry (ICP-MS) and
atomic absorption spectrometry (AAS)).
For investigation of zinc transport in an experimental setting closer to the physiological
environment in vivo, a three-dimensional co-culture of Caco-2 cells and the mucin-producing
goblet cell line HT-29-MTX was established. This Caco-2/HT-29-MTX model improves various
disadvantages of conventional Caco-2 monocultures, including the lack of a mucus layer
covering the cell monolayer as well as optimized luminal and basolateral buffer composition.
More precisely, the luminal and basolateral medium composition was adapted with regard
to its future application for zinc resorption studies, excluding apical addition of proteins
(such as fetal calf serum (FCS)) which would severely impact zinc availability and does not
represent the luminal situation in vivo, and including albumin in the basolateral
compartment to resemble the blood serum in vivo.
In fact, zinc transport studies in both improved Caco-2 monocultures and co-cultures
demonstrated that basolateral albumin is certainly important for investigating the in vitro
zinc resorption and acts as a basolateral zinc acceptor increasing cellular zinc release into the
basolateral compartment. Interestingly, the optimized in vitro model Caco-2/HT-29-MTX
showed enhanced net absorption of apically applied physiological zinc concentrations (25-
100 µM) compared to conventional Caco-2 monocultures. Lastly, the amounts of actually
transported zinc with this in vitro model are quite similar to the estimated amounts
transported in vivo.
![Page 8: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/8.jpg)
Summary
IV
Furthermore, the present work suggests that the mucus layer plays a beneficial role in
intestinal zinc absorption, making it an integral part of intestinal zinc resorption. More
specific, mucins bind zinc with physiologically relevant affinity and provide several binding
sites for the metal. Consequently these glycoproteins buffer the available zinc concentration
for intestinal cells, as demonstrated in short-term zinc uptake experiments. The presence of
mucins increased zinc absorption and yielded higher transport of the cation to the
basolateral side of three-dimensional models, suggesting that this physical barrier even
facilitates zinc resorption and act as a zinc delivery system to the underlying epithelium.
In addition, the intestinal cell line Caco-2 was stably transfected with the zinc Förster
resonance energy transfer (FRET)-biosensor eCalwy and characterized regarding enterocyte-
specific properties and its maintenance of intracellular zinc homeostasis compared to Caco-2
wildtype cells; generating a well characterized intestinal model system for future
investigations of zinc uptake in enterocytes. In fact, applying the low molecular weight
sensor Zinpyr-1 and Caco-2-eCalwy cells to analyze free zinc in intestinal cells, even small
changes in cellular zinc can be determined which is of particular interest for short-term zinc
uptake. Moreover, these sensors provide the promising option to investigate spatial
distribution of zinc upon its uptake into enterocytes and to illuminate the zinc transfer in
enterocytes throughout the intestinal resorption process. To this end, involvement of two
different cellular free zinc pools in the maintenance of enterocytes’ zinc homeostasis during
zinc resorption could be illuminated.
In conclusion, findings of this thesis indicate that mucins assist apical zinc uptake and what is
more, basolateral albumin increases enterocytes’ zinc release to the blood side. This
contributes profoundly to our knowledge of the in vitro and in vivo zinc uptake and transport
processes on the apical mucosal membrane as well as on the serosal side of enterocytes.
Consequently, combining these luminal and basolateral factors in the three-dimensional in
vitro model Caco-2/HT-29-MTX, this in vitro model represents a suitable platform to
investigate intestinal zinc transport as well as further elucidate molecular mechanisms that
regulate intestinal zinc resorption. By applying Caco-2-eCalwy clones and the low molecular
weight sensor Zinpyr-1 in Caco-2 the cellular distribution of the essential metal upon its
absorption and its transfer during its resorption can be additionally examined.
![Page 9: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/9.jpg)
Zusammenfassung
V
Zusammenfassung
Das essentielle Spurenelement Zink wird hauptsächlich im Dünndarm resorbiert. Hier wird
luminal verfügbares ionisches Zink von Enterozyten des intestinalen Epithels aufgenommen
und an das Blut abgegeben. Die Forschung der letzten vier Jahrzehnte hat maßgeblich zum
Verständnis der Zink-Homöostase beigetragen; bedeutende Fortschritte waren dabei vor
allem die Aufklärung der regulatorischen Rolle der intestinalen Zinkresorption in der
Aufrechterhaltung der Homöostase des Mikronährstoffes und die Zink-abhängige Expression
der intestinalen Zinktransporter und des Zink-bindenden Proteins Metallothionein. Dennoch
gibt es weiterhin Forschungsbedarf bezüglich der molekularen Parameter der Regulation der
intestinalen Zinkresorption sowie nahrungsbedingten Faktoren, die die Verfügbarkeit des
Kations im intestinalen Lumen beeinflussen. In vitro Intestinalmodelle stellen hierfür eine
standardisierte und vielseitig einsetzbare Mikro-Umgebungen dar, in denen sowohl die
Aufnahme des Metalls in die Enterozyten als auch dessen Transport über das intestinale
Epithel in die Blutzirkulation detaillierter analysiert werden können.
Das Ziel dieser Arbeit war daher, die intestinale Zinkresorption mit geeigneten in vitro
Intestinalmodellen zu untersuchen. Hierfür sollte zum einen ein drei-dimensionales in vitro
Modell für die Analyse des intestinalen Zinktransportes entwickelt werden, dass die in vivo
Situation im Darm so nah wie möglich abbildet. Dabei sollten luminale und basolaterale
Faktoren sowie die zelluläre Zusammensetzung optimiert und deren Einfluss auf die
Zinkresorption näher aufgeklärt werden. Des Weiteren sollten intestinale Modellsysteme
etabliert werden, mit denen die zelluläre Zinkaufnahme, zusätzlich zu der Anwendung von
konventionellen analytischen Methoden, wie zum Beispiel der Massenspektrometrie mit
induktiv gekoppeltem Plasma (ICP-MS) und Atomabsorptionsspektrometrie (AAS), mit
chemischen und Protein-basierten Zink-Fluoreszenzsonden analysiert werden können.
Zur Untersuchung des Zinktransportes wurde eine Ko-kultur aus Caco-2 Zellen und der
Muzin-produzierenden Becherzelllinie HT-29-MTX etabliert. Das Caco-2/HT-29-MTX Modell
entspricht der physiologischen Situation in vivo besser als konventionelle Caco-2
Monokulturen, da es eine Mukusschicht beinhaltet und die apikale und basolaterale
Pufferzusammensetzung an eine ideale Umgebung für Zinkresorptionsstudien angepasst ist.
Hierbei wird zum einen auf den apikalen Zusatz von Proteinen (wie fötales Kälberserum
(FKS)) verzichtet, da diese das zellulär verfügbare Zink stark beeinflussen würden und nicht
der in vivo Situation im Lumen entsprechen, zum anderen muss der basolateralen Seite des
Modells Albumin zugesetzt werden, um die Umgebung im Blutserum in vivo darzustellen.
Demgemäß zeigten Zinktransportstudien mit Caco-2 Mono- und Ko-kulturen, dass
Serumalbumin einen wichtigen Faktor für die in vitro Zinkresorption darstellt, indem es als
basolateraler Zinkakzeptor fungiert und die zelluläre Zinkabgabe in das basolaterale
Kompartiment erhöht. Zinktransportstudien mit dem optimierten in vitro Intestinalmodell
dieser Arbeit ergaben dabei nicht nur eine erhöhte fraktionelle Resorption nach apikaler
Zugabe von physiologischer Zinkkonzentration, sondern zeigten zusätzlich, dass die absolut
![Page 10: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/10.jpg)
Zusammenfassung
VI
transportierten Zinkmengen vergleichbar mit den geschätzten Werten in der
Humanresorption in vivo sind.
Zudem legt diese Arbeit dar, dass der intestinale Mukusschicht eine förderliche und unter
Umständen regulatorische Rolle in der Zinkresorption hat. Die Ergebnisse dieser Arbeit
belegen, dass Muzine eine Vielzahl an möglichen Zinkbindungsstellen mit einer physiologisch
relevanten Affinität für das Kation enthalten und dadurch die verfügbare Zinkkonzentration
für die darunterliegenden Intestinalzellen puffern. In drei-dimensionalen Zellkulturstudien
nahm die Zinkaufnahme in Anwesenheit von Muzinen in das intestinale Epithel zu und führte
zu einem erhöhten Zinktransport zur basolateralen Seite. Diese Ergebnisse deuten darauf
hin, dass die Mukusschicht die intestinale Zinkresorption erleichtert und somit als eine Art
Zink-Transportsystem für das darunterliegende intestinale Epithel darstellt.
Des Weiteren wurde in dieser Arbeit die intestinale Zelllinie Caco-2 mit der Förster
Resonanzenergietransfer (FRET)-basierten Zinksonde eCalwy stabil transfiziert und
hinsichtlich Enterozyten-spezifischer Eigenschaften und der Aufrechterhaltung der
Zinkhomöostase mit dem Caco-2 Wildtyp verglichen. So wurde ein gut charakterisiertes
Modellsystem geschaffen, dass für zukünftige Studien der Zinkaufnahme in Enterozyten
angewendet werden kann. Die Anwendung der niedermolekularen Sonden Zinpyr-1 in Caco-
2 und des Caco-2-eCalwy Modells in dieser Arbeit verdeutlicht, dass diese eine geeignete
Methode darstellen, um bereits kleine Änderungen des zellulären Zinkgehaltes nach
Zinkaufnahme nachzuverfolgen. Das ist besonders relevant bei der Analyse von Kurzzeit-
Zinkaufnahmen. Diese Sonden liefern weiterhin die ideale Möglichkeit, auch die
intrazelluläre Verteilung des freien Zinks in Enterozyten nach dessen Aufnahme aufzuklären
und den Zinktransfer durch den Enterozyten während des Resorptionsprozesses zu
untersuchen. Auf diese Weise konnte gezeigt werden, dass zwei verschiedene zelluläre
Zinkpools in der Aufrechterhaltung der Zinkhomöostase in Enterozyten während der
Zinkaufnahme beteiligt sind.
Zusammenfassend zeigen die Ergebnisse dieser Arbeit, dass die intestinale Mukusschicht
und basolaterales Serumalbumin wichtige Faktoren für die Zinkresorption darstellen, was zur
Aufklärung der Prozesse an der apikalen und basolateralen Membran der Enterozyten
während der intestinalen Zinkresorption beiträgt. Das Caco-2/HT-29-MTX Model kombiniert
diese luminalen und basolateralen Faktoren und stellt somit ein geeignetes in vitro
Intestinalmodell zur Verfügung, mit dem der intestinale Zinktransport sowie molekulare
Regulationsmechanismen der Zinkresorption weiter aufgeklärt werden können. Durch die
Anwendung von Caco-2-eCalwy Klonen und Zinpyr-1 in Caco-2 Zellen können zudem bereits
kleine Änderungen des intrazellulären Zinkgehaltes nach dessen Aufnahme in Enterozyten
erfasst werden und die zelluläre Verteilung des Metalls während des Resorptionsprozesses
aufgeklärt werden.
![Page 11: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/11.jpg)
Abbreviations
VII
Abbreviations
3D three-dimensional
λem emission wavelength
λex excitation wavelength
ALP alkaline phosphatase
ANOVA analysis of variance
BB brush border
BCA bicinchoninic acid
BRET bioluminescence resonance energy transfer
BSA bovine serum albumin
Calwy CFP-Atox1-linker-WD4-YFP
cDNA complementary deoxyribonucleic acid
CLSM confocal laser scanning microscopy
DAPI 4′,6-diamidin-2-phenylindole
DGE German Society for Nutrition; ger. Deutsche Gesellschaft für Ernährung
DMEM Dulbecco’s Modified Eagles Medium
DMT-1 divalent metal transporter
ECACC European Collection of Authenticated Cell Cultures
EDTA ethylene-diamine-tetra-acetic acid
EFSA European Food Safety Authority
FAAS flame atomic absorption spectrometry
FCS fetal calf serum
FD (FITC)-Dextran
FITC fluorescein isothiocyanate
FLIM fluorescence lifetime imaging microscopy
F fluorescence signal
![Page 12: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/12.jpg)
Abbreviations
VIII
Fmax maximal fluorescence signal
Fmin minimal fluorescence signal
FRET Förster resonance energy transfer
Fuc fucose
Gal galactose
GalNAc N-acetylgalactosamine
GlcNAc N-Acetylgluosamine
HD high density
HBSS Hanks' Balanced Salt Solution
HEPES 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid
HSA human serum albumin
ICP-MS inductively-coupled plasma mass spectrometry
ICP-OES inductively-coupled plasma optical emission spectrometry
IZiNCG International Zinc Nutrition Consultative Group
JAM junctional adhesion molecule
Km half saturation constant
KHB Krebs-Henseleit buffer
L lysosomes
LC lethal concentration
LIM Lin-11, Isl-1, Mec-3
LMW low molecular weight
M mitochondria
M cell microfold cells
mRNA messenger ribonucleic acid
MT metallothionein
MTF-1 metal regulatory transcription factor 1
MTT 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide
![Page 13: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/13.jpg)
Abbreviations
IX
MUC mucin apoprotein
N nuclei
n.a. not available
NAC N-acetylcysteine
NEAA, non-essential amino acids
NeuAc N-Acetylneuraminic acid
NRU neutral red uptake
Nx nexus
PAR 4-(2-pyridylazo)resorcinol
Papp apparent permeability
PAS periodic acid Schiff
PBMC peripheral blood mononuclear cells
PBS phosphate buffered saline
PC polycarbonate
PE polyethylene
PES polyester
PET photo-induced electron transfer
pNPP p-nitrophenyl phosphate
PTS proline, threonine, serine
qPCR quantitative real time polymerase chain reaction (PCR)
Ref reference
RING really interesting new gene
SD standard deviation
SEM scanning electron microscopy (in Chapter 4)
standard error of mean (in Chapter 5 and 6)
SLC solute carrier
SRB sulforhodamine B
![Page 14: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/14.jpg)
Abbreviations
X
TBS Tris(hydroxymethyl)aminomethane-buffered saline
TBST Tris-buffered saline with Tween 20
TEER transepithelial electrical resistance
TEM transmission electron microscopy
TJ tight junction protein
Tris Tris(hydroxylmethyl)aminomethan
TPEN N,N,N′,N′-tetrakis(2-pyridylmethyl)ethylenediamine
vWF von Willebrand factor
WHO World Health Organization
WST water soluble tetrazolium
ZE zinc excess
ZD zinc deficiency
Zincon 2-carboxy-2′-hydroxy-5′-sulfoformazylbenzene monosodium salt
ZIP Zrt-, Irt-like protein
Zn zinc
ZnT zinc transporter
ZO zonula occludens
![Page 15: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/15.jpg)
List of Tables
XI
List of Tables
Table 2.1 Expression profile of secreted and transmembrane gastrointestinal mucin .......... 10
Table 2.2 Total human body zinc ............................................................................................. 11
Table 2.3 Recommended daily allowance for dietary zinc intake for selected life-stages ...... 21
Table 2.4 Zinc and phytate content, as well as phytate : zinc-molar ratios of foods adapted from ........................................................................................................... 22
Table 2.5 Zinc transport studies using in vitro intestinal models ............................................. 30
Table 4.1: Oligonucleotide sequences used for qPCR ............................................................... 43
Table 5.1. Oligonucleotide sequences used for qPCR ............................................................... 66
Table 7.1 Main Results of in vitro zinc transport studies from this thesis ............................. 121
Table 7.2 Total amounts of resorbed zinc in vivo and in the Caco-2/HT-29-MTX model of this thesis ............................................................................................................ 124
List of Figures
Figure 2.1 Human gastrointestinal tract ...................................................................................... 3
Figure 2.2 Structure and composition of the small intestinal epithelium ................................... 6
Figure 2.3 Molecular structure of mucins and intestinal mucin O-glycan types ......................... 8
Figure 2.4 Cellular zinc homeostasis .......................................................................................... 13
Figure 2.5 Zinc buffering and muffling role of metallothioneins ............................................... 14
Figure 2.6 Regulation of intestinal zinc resorption .................................................................... 17
Figure 2.7 Schematic representation of the three-dimensional in vitro intestinal model Caco-2 ............................................................................................................ 28
Figure 2.8 Application of in vitro intestinal models to study intestinal zinc transport ............. 34
Figure 2.9 Chemical- and protein-based fluorescent sensors ................................................... 35
Figure 4.1: Alkaline phosphatase (ALP) in Caco-2-WT and Caco-2-eCalwy cells. ....................... 45
Figure 4.2: Transmission electron micrographs. ......................................................................... 46
Figure 4.3: Scanning electron microscope images. ..................................................................... 47
Figure 4.4: Localization of tight junction proteins. ..................................................................... 48
Figure 4.5: Zinc-toxicity on differentiated Caco-2-WT and -eCalwy. .......................................... 49
Figure 4.6: Effect of zinc on cellular protein levels. .................................................................... 50
Figure 4.7: Zinc homeostasis in Caco-2-WT and -eCalwy. .......................................................... 51
Figure 4.8: Life cell imaging. ........................................................................................................ 52
Figure 4.9: Two photon microscopy. .......................................................................................... 53
Figure 5.1: Impact of serum and Zinpyr-1 on short-term zinc uptake. ....................................... 68
Figure 5.2: Effect of albumin digestion on intestinal zinc resorption. ........................................ 69
Figure 5.3: Impact of serum on zinc cytotoxicity. ....................................................................... 70
Figure 5.4: Influence of serum on zinc uptake in Caco-2 cells after incubation for 24 h. .......... 71
Figure 5.5: Impact of zinc concentration and serum on gene expression of proteins involved in cellular zinc homeostasis. ....................................................................... 72
Figure 5.6: Effect of serum albumin as a basolateral zinc acceptor on intestinal zinc resorption in a Caco-2/HT-29-MTX co-culture. ........................................................ 74
Figure 5.7: Impact of basolateral albumin concentration on cellular zinc uptake and transport. .................................................................................................................. 75
Figure 6.1: Effect of mucins on zinc availability for 4-(2-pyridylazo)resorcinol (PAR). ............... 88
![Page 16: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/16.jpg)
List of Figures
XII
Figure 6.2: Zinc binding properties of gastrointestinal mucins. ................................................. 89
Figure 6.3: Zinc binding affinity of gastrointestinal mucins. ....................................................... 90
Figure 6.4: Effect of mucin depletion on zinc-resorption in HT-29-MTX. ................................... 92
Figure 6.5: Impact of zinc-depleted mucins on zinc uptake by enterocytes. ............................. 93
Figure 6.6: Impact of extracellular mucins on zinc uptake in Caco-2 cells measured with FAAS. ................................................................................................................. 94
Figure 6.7: Effect of mucin zinc saturation on zinc uptake by enterocytes. ............................... 95
Figure 6.8: Comparison of zinc resorption in Caco-2 monocultures and Caco-2/HT-29-MTX co- cultures. .................................................................................................... 97
Figure 6.9: Zinc transport rates in Caco-2 monocultures and Caco-2/HT-29-MTX co-cultures...................................................................................................................... 98
Figure 7.1 The role of the intestinal mucus layer as a luminal factor of intestinal zinc resorption ................................................................................................................ 117
![Page 17: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/17.jpg)
Introduction
1
Chapter 1. Introduction
The essential trace element zinc plays a key role for several important biological processes as
it is required in more than 3000 metalloproteins in the human body [1]. To compensate the
daily endogenous zinc loss and to maintain the human body zinc homeostasis, the
micronutrient has to be replenished on a daily basis by dietary intake [2]. Human body zinc
homeostasis is in fact generally regulated by its resorption in the intestine [3]. Here zinc
resorption occurs mainly in the duodenum and proximal jejunum of the small intestine [4,5],
where the metal is absorbed by enterocytes of the intestinal epithelium and transported
into the blood circulation [3]. In this process, zinc transporter on the apical and basolateral
membrane of enterocytes are engaged, regulating cellular and body zinc homeostasis
together with the cellular zinc binding protein metallothionein [6,7]. Despite this knowledge
and ongoing research, a deeper understanding of the molecular processes that regulate zinc
resorption via the intestinal epithelium are still scarce.
A severe zinc deficiency is particularly manifested in an impaired immune system [8,9],
placing zinc deficiency among the ten highest risks for human health for people from
developing countries with high morbidity rates [10]. Deprivation of this essential cation is
mostly related directly to an inadequate resorption in the intestine [11,12], either due to
insufficient zinc intake, inadequate bioavailability from the diet, or malabsorption diseases,
and is to date affecting about one third of the world’s population [13]. Absorption in the
intestine is influenced by various dietary factors, among them inhibitory components,
decreasing luminal bioavailability of the cation as well as beneficial ingredients that enhance
its absorption by enterocytes [11]. Consequently zinc resorption is not only dependent on an
adequate dietary intake but highly dependent by its intestinal availability from the diet’s
ingredients.
To further illuminate the impact of these factors on zinc absorption by the intestinal
epithelium remains of topic in research [14,15]. Herein, in vivo human studies using (stable)
isotope techniques are still the main standard [16]. During the past 50 years though,
attempts to establish suitable three-dimensional in vitro models to mimic processes in vivo
got more attention. This is mainly due to high costs and ethical standards of animal studies
and the benefits of in vitro models providing a microenvironment benefitting studies of
cellular processes on a molecular level [17,18].
In fact, in vitro intestinal models provide a promising and standardized platform to analyze
molecular mechanisms of enterocytes’ zinc transport. Investigating zinc uptake and
transport via intestinal epithelium using three-dimensional models can further identify
dietary or physiological factors that impact zinc resorption. What is more, application of
chemical and protein based fluorescent zinc sensors in in vitro enterocytes extends the
investigation of cellular zinc content to its (sub-) cellular zinc pools and offers the great
opportunity to additionally track its intracellular distribution after its uptake into
enterocytes. Yet, suitable in vitro intestinal models are still needed to further study zinc
transport and its bioavailability from different (food derived) matrices in the intestine.
![Page 18: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/18.jpg)
Introduction
2
It is crucial that these models always represent the in vivo situation as close as possible with
respect to their cellular composition as well as apical and basolateral buffer constituents,
simulating intestinal epithelium as well as its luminal and serosal environment in vivo.
Particularly buffer and medium components are known to severely impact the zinc
speciation affecting the actual free zinc concentration that is available for cells [19,20].
Hence, it is of great importance to consider these effects when using in vitro models.
Although some previous three-dimensional in vitro intestinal models studying zinc resorption
adapted the apical buffer composition, basolateral components were rarely acknowledged.
The intestinal epithelium in vivo is covered by a mucus layer produced and secreted by
goblet cells protecting the underlying epithelium against dehydration, physical damage and
most importantly pathogens [21]. Moreover, this physical barrier is essential for absorption
of nutrients [22] and was suggested to play an important role for zinc uptake by the
intestinal mucosa [23,24]. However, neither mucins nor goblet cells were included in
hitherto existing in vitro models to investigate intestinal zinc transport.
This thesis aimed to develop and apply different in vitro intestinal models to study intestinal
zinc uptake and resorption. Herein, using three-dimensional in vitro intestinal models, the
influence of cellular composition as well as luminal and basolateral factors on zinc resorption
via the intestinal epithelium was evaluated. Moreover, luminal and basolateral factors of
intestinal zinc resorption were scrutinized, demonstrating that basolateral albumin acts as a
zinc acceptor and enhances the zinc resorption. What is more, these findings indicated that
the intestinal mucus layer facilitates the zinc uptake into enterocytes and acts as a zinc
delivery system for the intestinal epithelium. Lastly, by applying chemical and genetically
encoded fluorescent zinc sensors in enterocytes, already small changes of cellular zinc upon
its absorption were tracked and the involvement of two different cellular free zinc pools in
the maintenance of enterocytes’ zinc homeostasis during zinc absorption could be
illuminated, making them suitable model systems to further study the metal’s distribution
and transfer throughout the resorption process.
![Page 19: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/19.jpg)
Literature Review
3
Chapter 2. Literature Review
2.1 The Intestinal Tract
The intestinal tract is the main organ of nutrient absorption in the human body. Here, food
components, already partly digested in the mouth and stomach, are further degraded into
small fragments for their uptake and transfer by enterocytes, the absorptive cells of the
intestinal epithelium. The intestine consists of the small intestine which is the major site for
digestion and resorption [25], and the large intestine, the so called colon (Figure 2.1). The
intestines main role besides absorption of nutrients is the active absorption and secretion of
electrolytes and water as well as the protection against pathogens [26,27].
Figure 2.1 Human gastrointestinal tract
Schematic representation of the human gastrointestinal tract. The digestion already starts in the mouth (not shown), where the food is mechanically broken and in parts digested by salivary enzymes. Swallowed food subsequently enters the stomach. In this acidic environment (pH = 2) proteins are mainly digested by pepsin. The main digestion and absorption of nutrients takes place in the small intestine (duodenum (length = 20-32 cm), jejunum (length = 100-250 cm), ileum (length = 200-350 cm)) [25]. For this, intestinal liquid contains enzymes, mucins, hormones, pancreatic and bile secretions, the latter is released from the gall bladder into the duodenal lumen, and is complemented by various enzymes at the brush border of the intestinal epithelium. Subsequently, the chyme enters the large intestine (ascending colon - descending colon) for further digestion and absorption of not yet absorbed nutrients and is finally excreted with the feces [25,28].
Generally, the small intestine is divided into three functional regions: the duodenum, the
jejunum and the ileum. Although these segments are structurally similar, they differ
regarding their functionality. In detail, the intestinal epithelium in duodenal and jejunal
regions produces vast amounts of brush border digestive enzymes [26], whereby 90% of
absorption takes place in duodenum and proximal jejunum [25,29]. Both duodenum and
![Page 20: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/20.jpg)
Literature Review
4
jejunum are major sites for absorption of water-soluble vitamins, iron, calcium and zinc
[29,30]. In the jejunum the majority of monosaccharides, amino acids as well as fatty acids
are resorbed, whereas bile salts and vitamin B12 are mostly absorbed in the ileum [29,30]. In
the colon, metabolites produced by the intestinal microbiota, such as short chain fatty acids
[30], are absorbed [25]. Otherwise, mostly water and electrolyte absorption as well as
hydrogen carbonate and potassium secretion is maintained in this intestinal segment [25].
The gastrointestinal liquid is mainly comprised of water, electrolytes, enzymes, mucins, and
other bioactive substances which are mostly secreted by the exocrine glandular cells or
goblet cells throughout the gastrointestinal tract. In the intestinal tract, about 3 L fluid per
day is secreted into the intestinal lumen following a gradient of osmosis, while 6.8–7.2 L are
reabsorbed daily [28]. Aside of mucus secretion by goblet cells throughout the entire
intestinal tract, intestinal secretions are mostly maintained by specialized glands in the
duodenum as well as the ileum and complemented by pancreatic and bile secretions that
contain digestive enzymes and bile acids [28]. More precisely, duodenal secretions are
produced by specialized gland cells, mainly controlling the gradual pH increase from the
acidic environment in stomach (pH = 2) to the intestinal pH of 6–7.4 [31] by secreting
bicarbonate [28]. In the Ileum these secretions contain enzymes, mucins, and hormones
secreted by cells in the crypt of Lieberkühn, including enterocytes, goblet cells,
enteroendocrine cells and antimicrobial Paneth cells [28,29]. The latter are also limiting
bacterial growth in the small intestinal lumen that is additionally supported by peristaltic
movements constantly flushing the small intestinal lumen and keeping it bacterial free and
sterile. The colon on the other hand provides the perfect habitat for commensal bacteria,
which amongst other functions contribute to the digestion of nutrients [22].
![Page 21: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/21.jpg)
Literature Review
5
2.1.1 Intestinal epithelium
The intestinal tract can be described as a tube, lined with a monolayer of intestinal cells
forming the intestinal epithelium which lays on the lamina propria [26,28] (Figure 2.2A). This
intestinal mucosa consisting of the intestinal epithelium, the lamina propria, and the
muscularis mucosa, is bolstered by the underlying submucosa and muscularis externa
[26,29]. The latter is formed by circular and longitudinal muscles which are responsible for
peristaltic movements and contradictions facilitating degradation and transport of food
along the gastrointestinal tract [29]. Furthermore, the mucosal and submucosal layers of the
small intestine are highly organized by folds, so called plica circularis, as well as villi and
microvilli, increasing the absorptive area about more than 100-fold from ca. 0.33 m² [32] to
30–40 m² [33]. Consequently, the intestinal tract has a small volume (~3 L) [28], but a very
large surface area.
In general the epithelium is divided into the apical side which is turned towards the
intestinal lumen and the basolateral, serosal side [29] (Figure 2.2C-D). In detail, apical and
basolateral membranes of epithelial cells are structurally and functionally different,
guaranteeing biased partitioning of membrane proteins that results in polarization of the
epithelium [26]. This polarization is very important for transcellular transport of nutrients
and is therefore additionally maintained by tight junction as well as adherens junction
proteins and desmosomes [29,34-36]. In fact, intestinal tight junction proteins, particularly
claudin and occludin, provide a sealed and intact epithelium that is additionally supported by
cell-cell adhesion molecules like cadherin assembling the adherens junction between
adjacent cells [36,37]. Moreover, scaffolding proteins like zonula occludins-1 (ZO-1) anchor
tight junction proteins to the cytoskeleton (Figure 2.2D) [36]. Of note, the integrity of the
intestinal barrier can be experimentally monitored by impedance measurements. The
transepithelial electrical resistance of an intact human intestinal barrier is reported to be 25–
60 Ω cm2 [18,38].
The intestinal epithelium is composed of different cell types with specific functions [26]. The
columnar shaped enterocytes represent 80% of intestinal epithelial cells [27]. In general
these cells are divided into non-absorptive enterocytes, mainly found in the upper part of
the crypt, and absorptive enterocytes, which are mainly located in the middle of the villi and
whose primary role is the absorption of nutrients [40]. To accomplish their functions,
absorptive enterocytes are structurally specialized by apically expressing microvilli,
approximately 3000–7000 per cell [25] and 1 µm in length. These microvilli form the
characteristic brush-like shape of enterocytes’ apical membrane and are important for
nutrient absorption, as they increase the cellular surface as well as the amount of present
enzymes [29].
![Page 22: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/22.jpg)
Literature Review
6
Figure 2.2 Structure and composition of the small intestinal epithelium
(A) Layers of the small intestinal tract, including the intestinal epithelium, submucosa and muscularis externa (adapted from [28]). (B) The mucosal and submucosal layers are folded into the so called plica circularis which has a surface covered by villi (adapted from [28]). (C) Shown is a close-up of two villi, which are covered by intestinal cells, including absorptive enterocytes, goblet cells as well as Paneth cells and stem cells in the intestinal crypts. Additionally, the intestinal epithelium is covered by a mucus layer [39]. (D) The intestinal barrier is sealed by tight junction (TJ) and adherens junction proteins as well as desmosomes. Depicted are major TJ proteins: claudin, occludin and junctional adhesion molecules (JAM) as well as the cell-cell adhesion molecule E-cadherin. Additionally, zonola occludens-1 (ZO-1) anchors to the actin cytoskeleton [35,36].
The most abundant cells after the enterocytes are goblet cells, which mainly produce and
secrete mucins [29], but are also discussed to release antimicrobial proteins [39].
Furthermore, the intestinal epithelium consists of enteroendocrine cells, Paneth and
microfold (M) cells. Enteroendocrine cells produce peptide hormones that regulate
gastrointestinal functions, thereby linking central and enteric neuroendocrine systems [39].
Antimicrobial Paneth cells and M cells mediate the intestinal immune system [41]. In detail,
while Paneth cells secrete antimicrobial substances into the lumen [41], M cells are thought
to rapidly take up pathogens or antigens and deliver them to dendritic cells in the underlying
mucosa [39,42].
Specific distribution of these cell types, from the crypt up to the tip of the villus, results in
specific functions of the respective areas. Whereas stem cells, enteroendocrine cells and
Paneth cells are primarily localized in the crypt, enterocytes and goblet cells reside alongside
the villus. [29] Stem cells differentiate into specialized cell types of the intestinal epithelium
![Page 23: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/23.jpg)
Literature Review
7
[27]. In this process, except regarding their differentiation into Paneth cells, stem cells
migrate from the crypt toward the villus until they reach the villus tip. Here, self-renewal of
the intestinal epithelium takes place, detaching and releasing adult cells of the villus into the
lumen [26,27]. This self-renewal occurs every 3-4 days, whereas a complete turnover of the
intestinal epithelium takes place on a weekly basis [27].
2.1.2 Mucus Layer
2.1.2.1 Composition and Structure
The mucus layer covers the whole gastrointestinal tract, protecting the underlying
epithelium against mechanical damage from the chyme as well as the luminal pH and serves
as an additional diffusion barrier for commensal bacteria, pathogens and macromolecules
[43-45]. Additionally, this physical barrier is essential for the intestinal resorption of
nutrients [22] and was shown to play a beneficial role in the enterocytes’ uptake of metals,
like iron and lead [24,46,47]. Although the organization of the small intestinal mucus is not
yet well characterized [48], it consists of a single, discontinuous, and loosely bound layer
that enables the absorption of nutrients [21]. In the colon and stomach on the other hand,
this loosely bound barrier is complemented by an additional adherent mucus layer [22].
Additionally, the mucus provides a pH gradient increasing from the gastrointestinal lumen up
to pH 7 at the epithelium. This is due to bicarbonate secretion by secretory cells facilitating
the protective function of this physical barrier, particularly in the stomach. [49]
In rats, the stomach mucus layer was analyzed to be 200–280 µm in total, decreasing down
to 170 µm and 125 µm in the duodenum and jejunum, respectively. Subsequently, the
mucus layer is increasing again in downstream direction reaching a thickness of 480 µm in
the ileum and 830 µm in the colon [50]. The inner distal colonic mucus layer is firmly
attached to the underlying epithelia cells [48] and impermeable to bacteria [48,51], whereas
the outer layer is a perfect habitat for commensal bacteria [45]. However, mucus layer
thickness in the human gastrointestinal tract was proposed to be even thicker, but has yet
not been possible to measure.
On a daily basis up to 10 L mucus are secreted into the gastrointestinal tract (mainly by
specialized mucin-producing cells), recycled and excreted with the feces [52]. Interestingly,
the turnover rate of the mucus layer in the intestine is suggested to occur even faster than
that of the intestinal epithelium [53,54], particularly preventing the invasion of the inner
mucus layer by bacteria and contact with the intestinal epithelium in the colon [53].
The mucus layer is mainly composed of ~95 % water, ~5-10% mucins, ~0.5-1% salts, ~1-2%
lipids, ~0.5% non-mucin proteins [43]. The latter include antimicrobial components mainly
produced by Paneth cells [41], which play an important role in keeping the small intestine
bacteria free and sterile [22].
![Page 24: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/24.jpg)
Literature Review
8
Figure 2.3 Molecular structure of mucins and intestinal mucin O-glycan types
(A) The intestinal mucus layer is mainly constituted of water, ions, lipids and 5-10% highly glycosylated proteins: mucins [21]. These glycoproteins are produced by goblet cells which are either anchored into their apical membrane (not shown) or secreted densely packed in granules, resulting in a viscoelastic gel which covers the intestinal epithelium [55]. (B) Molecular structure of a mucin monomer which is mainly composed of proline, threonine, serine (PTS) tandem repeats and O-linked oligosaccharides (adapted from [21]). (C) Common mucin type O-glycans found in the intestinal tract (core 1–4) [55] (adapted from [55]).
Mucins are the major structural compound of the mucus layer (Figure 2.3), maintaining its
physicochemical properties and being essential for its viscoelasticity [43]. They are highly
glycosylated proteins with a molecular weight of 0.5–20 MDa [21], wherein intestinal mucins
are reported to have an approximate molecular mass of 2.5 MDa [56,57] Their network-like
structure, depicted in Figure 2.3A, is mainly derived by proline, threonine, serine (PTS)
tandem repeats containing O-linked oligosaccharides, building the main structure of mucin
monomers. Further, PTS tandem repeats are intermitted by less-glycosylated regions,
containing some N-glycans and cysteine-rich regions, like von Willebrand factor (vWF) D and
C domains and cysteine-knots. The latter were shown to be involved in the dimerization of
these mucin monomers [21,58,59]. In detail, mucins consist of about 80% carbohydrates
[22], mainly N-acetylgalactosamine (GalNAc), N-acetylglucosamine (GlcNAc), fucose (Fuc),
galactose (Gal) and N-acetylneuraminic acid (NeuAc or sialic acid) [58] (Figure 2.3C). More
precisely, oligosaccharides are linear or branched and can contain up to 20 monosaccharides
![Page 25: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/25.jpg)
Literature Review
9
[21,60]. The intestinal glycan paradigm is grouped in core- and peripheral regions, wherein
the core-region mainly consists of GalNAc binding one or two additional monosaccharides.
This is additionally prolonged by Gal, GalNAc, NeuAc, GlcNAc, fucose or even sulfates
forming the peripheral region [55,61]. However, the human O-glycosylation pattern was
shown to be highly diverse in the gastrointestinal tract [62] and alterations in glycosylation
are discussed to be associated with gastrointestinal diseases [55,63].
Nomenclature of mucins is defined by their mucin apoprotein (MUC), leading to 21 mucin
families based on the number of so far identified muc-genes [43]. In addition,
gastrointestinal mucins are classified into two main mucin-types: secreted, gel forming
mucins (MUC2, MUC5AC, MUC5B and MUC6) and transmembrane bound mucins (MUC1,
MUC3, MUC4, MUC12, MUC13, MUC16, and MUC17) [45,64]. Transmembrane mucins are
anchored into the apical cell membrane, covering the surface of epithelial cells, such as
enterocytes. These firmly attached glycoproteins are part of the glycocalix [22], which was
estimated to be around 0.5-1 µm thick [45]. Besides providing protection for the cells,
transmembrane mucins are probably engaged in cell surface sensing and signaling [65],
whereas secreted mucins are pivotal for forming the network-like structure of the mucus
layer [45].
Expression profile of muc-genes, encoding for MUC apoproteins differs greatly between the
distinct parts in the gastrointestinal tract (Table 2.1) [55]. Herein, the main gel-forming
mucin produced in the intestinal tract is MUC2, whereas the gastric and colonic mucus layer
is mainly structured by MUC5AC alone and MUC2 and MUC5AC, respectively [57,64,66]. Yet,
diversity of gastrointestinal mucins is not only influenced by the variate expression profile of
the MUC apoprotein, but above all influenced by its highly diverse O-glycan paradigm [62],
mostly dependent on the individual glycosyltransferase profile [55]. Regardless, the human
small intestine mainly contains core-3 O-glycan, whereas core-1 and 2 were found in the
duodenum and stomach and core-3 and -4 structures are most prominent in the human
colon [55,67] (Figure 2.3C, p. 8).
![Page 26: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/26.jpg)
Literature Review
10
Table 2.1 Expression profile of secreted and transmembrane gastrointestinal mucin [55]
Mucin type muc-gene Localization
Transmembrane
MUC1 stomach, duodenum, colon
MUC3A/B jejunum, ileum, colon
MUC4 stomach, colon
MUC12 stomach, colon
MUC13 small intestine, colon
MUC15 small intestine, colon
MUC17 stomach, small intestine (duodenum), colon
MUC20 colon
MUC21 colon
Secreted
MUC2 small intestine (jejunum, ileum), colon
MUC5AC stomach
MUC5B colon
MUC 6 stomach (glands), duodenum
Mucin synthesis and secretion is generally inherited by specialized mucus producing cells
throughout the gastrointestinal epithelium. In the intestine this is maintained by goblet cells,
whereas gastric foveolar mucous cells mainly secrete mucins in the stomach [68]. More
precisely, mucin apoproteins are modified co- and post-translationally. In the rough
endoplasmic reticulum, C-mannosylation, N-glycosylation and dimerization of their C-
terminal ends takes place [64,69]. The most important step in mucin synthesis, the O-
glycosylation, occurs in the Golgi during transit to the cell surface [70]. This process is
maintained by O-glycosyltransferases, stepwise adding single monosaccharides.
Subsequently, dimers at their N-termini are multimerized and mucins densely packed into
granules due to high calcium concentration and low pH [21,55,64]. These granules are either
stored or directly secreted by exocytosis, which occurs continuously or induced by
extracellular stimuli [71]. The exocytosis of these granules results in hydration of the packed
mucin by which it rapidly expands in size yielding a viscoelastic gel, covering the underlying
epithelium [55] (Figure 2.3). In contrast to secreted mucins, transmembrane mucins are
cleaved into two subunits in the endoplasmic reticulum before the O-glycosylation in the
Golgi and their subsequent transport to the apical cell membrane: one that is anchored into
the apical membrane of the cells and the N- and O-glycosylated extracellular side [64].
![Page 27: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/27.jpg)
Literature Review
11
2.2 Zinc – Role in the Organism
Zinc is an essential trace element and the most abundant micronutrient in the human body
after iron [72,73]. Here, more than 3000 metalloproteins [1] require the bivalent cation for
catalytic, structural and regulatory functions [7]. In detail, zinc is crucial for gene expression,
influences the activity of metalloenzymes and provides a major structural component in zinc
fingers and zinc finger-containing domains such as LIM (Lin-11, Isl-1, Mec-3) and RING (really
interesting new gene) domains [74,75]. Consequently, zinc is essential for various biological
processes in the cell such as differentiation, apoptosis, and proliferation, influencing growth
and development [76]. Moreover, in the past two decades, the knowledge about its
importance as a signaling molecule increased [77] particularly in the immune system and as
a neuro-modulator in synaptic vesicles [78]. Body zinc status is therefore especially critical
for the immune system [8,9] and brain function [79]. Hence, to maintain these processes, it
is of particular significance to guarantee a stable zinc homeostasis.
2.2.1 Zinc Homeostasis
The human body consists of 2–3 g zinc from which the highest concentration can be found in
bone and skeletal muscle (~ 86%), followed by skin (6%) and liver (5%) [80]. Detailed
distribution of zinc in the human body is summarized in Table 2.2. Plasma zinc levels in
healthy individuals vary from 12–16 µM [81-83] from which 60% is bound to albumin, 30% to
α-macroglobulin, and 10% to transferrin [84], corresponding to less than 1% of whole body
zinc in serum. In fact, serum represents the rapidly exchangeable zinc pool, distributing zinc
within the body to guarantee biological processes which require this micronutrient. In
contrast, skeletal muscle and bone comprises zinc with a lower turnover and slower
availability for the systemic zinc homoeostasis. [85].
Table 2.2 Total human body zinc [80]
Tissue Approximate Zinc Concentration
[µg/g wet weight]
Total Zinc
Content [g]*
Proportion of
human body zinc [%]
Skeletal muscle 51 1.53 ~57
Bone 100 0.77 29
Skin 32 0.16 6
Liver 58 0.13 5
Brain 11 0.04 1.5
Kidneys 55 0.02 0.7
Heart 23 0.01 0.4
Hair 150 <0.01 ~0.1
Blood plasma 1 <0.01 ~0.1
*calculated for a 70 kg male.
![Page 28: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/28.jpg)
Literature Review
12
There is no zinc storage in the human body, thus zinc has to be continuously replenished by
dietary intake [2]. The main regulatory mechanisms for human zinc homeostasis are
resorption and excretion of the trace element [3] and the small intestine, pancreas and liver
play a central role in its maintenance [3]. Of note, endogenous zinc is continuously excreted
into the intestinal lumen, from which parts are reabsorbed [3] while the remainder, varying
between 0.82.7 mg zinc per day, is excreted with feces [86-89]. Thus the close interplay of
resorption of exogenous zinc and excretion and reabsorption of endogenous zinc provides a
stable balance of body zinc homeostasis. In this manner, body zinc homeostasis can be
maintained over a wide range of exogenous zinc intake [3,11,90-92], balancing its systemic
content between very small (2.8 mg zinc/d) and high (40 mg zinc/d) amounts of dietary zinc
intake [90].This was also observed in zinc deficient states, where fecal and urinal zinc losses
rapidly decreased adapting to the low zinc supply [86,93,94]. Only when these processes fail
to sustain zinc-requiring processes, the plasma zinc pool is mobilized followed by reduction
of the less exchangeable zinc from tissues like liver, testes and bone [7,95]. Consequently,
plasma zinc is declining during zinc deficiency [90,94]. Anyhow, the plasma zinc level itself is
not a reliable biomarker for body zinc status [7], as it also changes during inflammation [9],
stress or even after a meal [7].
2.2.1.1 Cellular Zinc Homeostasis
On the cellular level, zinc homeostasis comprises three main cellular zinc pools: zinc bound
to proteins, stored in vesicles, also called zincosomes [96], and cytoplasmic free zinc (Figure
2.4). The latter is only complexed by small molecule ligands [97] and was suggested to be the
biological active form of the metal [98]. In fact, this mobile zinc species is either in transit
through the cell, being “re-distributed”, or serves as a signaling molecule [99]. Therefore, the
cytoplasmic free zinc concentration has to be tightly regulated [98] and is buffered to a
picomolar level [97] being either transported out of the cell, sequestered into vesicles or
bound to proteins such as metallothioneins (MTs) [99] (Figure 2.4).
As depicted in Figure 2.4, cellular zinc is regulated by two main zinc transporter families: the
zinc transporter (ZnT)-family (solute carrier (SLC)30A), exporting zinc or sequestering it into
organelles or vesicles [96,101,102], and members of the Zrt-, Irt-like protein (ZIP)-family
(SLC39A), which transport the metal from outside the cell, vesicles or organelles into the
cytosol [103].
![Page 29: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/29.jpg)
Literature Review
13
Figure 2.4 Cellular zinc homeostasis
There are three main cellular zinc pools: cytoplasmic free zinc which is only complexed by low molecular weight ligands, protein-bound zinc, depicted as metallothionein (MT)-bound zinc, and zinc stored in vesicles. The cellular zinc homeostasis is maintained by three main groups of proteins: the zinc transporter (ZnT)- and the Zrt-, Irt-like protein (ZIP)-family as well as the zinc binding metallothioneins. They regulate the cytoplasmic free zinc concentration and provide its distribution into organelles, such as the endoplasmic reticulum, Golgi complex, mitochondria, and nucleus. Adapted from [100] and [101].
In contrast to the reported total zinc concentration in eukaryotic cells of several hundred
micromolar, the intracellular free zinc pool represents only transients of the cellular zinc
content [97]. A stable intracellular free zinc concentration is crucial to maintain the
intracellular zinc homeostasis, as increase of cellular free zinc above a certain level was
shown to be cytotoxic in several cell lines [98,104]. This is controlled by an elaborate zinc
buffering and muffling system, which guarantees sufficient available zinc for re-distribution
in the cell while keeping the amount of cytoplasmic buffering proteins as low as possible
[101]. The term “muffling” includes all processes that encompass changes of cellular free
zinc other than steady-state fluctuations [101]. In addition to the thermodynamic buffering
of zinc ions, this concept introduces a time-dependent component to the equilibrium of
cellular zinc homeostasis [105]. Three main protein families are discussed to be involved in
this system: on the one hand the aforementioned zinc transporters, regulating export and
import of cytoplasmic zinc and therefore taking part in muffling cellular free ion content. On
the other hand metallothioneins, the main zinc binding proteins in the cytoplasm which
buffer this zinc pool and muffle its transfer to proteins, such as transporters [106] (Figure
2.5A).
Metallothioneins are relatively small proteins (6 kDa) and incorporate seven zinc-binding
sites with a wide range of affinities [107,108]. This protein-family was suggested to bind
![Page 30: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/30.jpg)
Literature Review
14
about 5-15% of the cellular zinc pool [109] and although the zinc-MT-complex is
thermodynamically stable it releases the cation quickly [110], mainly mediating its re-
distribution within the cell, e.g., transfer to proteins and zinc transporters, by a redox-active
mechanism [111] (Figure 2.5). Aside of zinc, MTs also store the essential trace element
copper and bind toxic metals such as cadmium playing an important role in their
detoxification [109].
Figure 2.5 Zinc buffering and muffling role of metallothioneins
(A) Zinc buffering and muffling role of metallothioneins (MTs). MTs and other ligands (such as proteins) bind free zinc and thereby buffer its cytoplasmic concentration. Additionally to zinc transporters, MTs represent zinc muffling moieties, decreasing free zinc content in the cytoplasm by transferring the bound cation to transporters, sequestering it into organelles, vesicles or outside the cell. Notable, free zinc itself can also be transported into organelles, where in this process the zinc transporter (ZnT) solely undertakes the muffling [101]. Moreover, MTs re-distribute intracellular zinc by transferring it to other ligands, such as metalloproteins [112]. (B) This zinc transfer is based on a redox-active mechanism. Oxidation of the sulfur-ligand by oxidants such as glutathione disulfide, selenium compounds or reactive species like nitric monoxide releases zinc to other zinc binding proteins. In addition, the oxidized MT form thionin can also be reduced to its apo-protein thionein. This redox-cycle requires redox-couples like glutathione/glutathione disulfide. [113] Moreover, zinc itself induces mt expression by binding to the metal regulatory transcription factor 1 (MTF-1) [114] (B adapted from [111]).
The importance of MTs for cellular zinc homeostasis is additionally supported by the fact
that these proteins are ubiquitously distributed in the human body. There are four known
MT genes (MT-1–MT-4) encoding eleven functional human MT-isoforms. While MT-1 and
MT-2 are expressed in all body cell types, MT-3 and -4 were mainly found in brain or
epithelial tissues, respectively [106,115]. The relevance of MTs as the only proteins
mediating zinc trafficking, however, is limited by the fact that MT knockout mice (for MT-1
and -2 genes) were indeed more sensitive to additional dietary zinc, but were still viable and
reproductive [116,117]. Furthermore, experimental modeling of MTs as mufflers indicated
that metallothioneins are possibly not the only proteins mediating its transfer to
![Page 31: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/31.jpg)
Literature Review
15
transporters [118]. Hence, these findings imply that there must be other proteins
maintaining zinc trafficking through the cell.
2.2.2 Intestinal Zinc Resorption
Zinc is absorbed throughout the whole small intestine [5,119]; though the major site of
intestinal human zinc resorption still is controversial. In animal studies using rats the highest
resorption rate was reported to occur both in the duodenum and ileum [120-122] or only in
the ileum [123] or jejunum [5,124], respectively. In vivo studies investigating the actual site
of zinc resorption in humans are scarce. However, using small intestine perfusion techniques
in healthy individuals, the major resorption sites in the human intestine were revealed to be
both the duodenum [4] and jejunum [5]. Hence, it is most likely that zinc absorption mainly
occurs in the duodenum and proximal jejunum as these are the sites in the intestine that
dietary zinc passes first [125].
In detail, zinc uptake takes place at the intestinal brush border membrane, where it is
transported from the lumen into absorptive cells of the epithelium: the enterocytes. The
following excretion of the cation at the basolateral side of enterocytes releases it into the
portal blood, where it is mostly bound to albumin, distributing the metal in the body [3,126].
Interestingly, while several in vitro studies showed transport from the basolateral to the
luminal site of the intestinal epithelium [127-129], this was not yet observed in humans
[130]. Additionally, only a rather low mucosal zinc secretion into the lumen was reported in
vivo using perfused rat intestines and physiological serum zinc concentrations [131].
Although, the recent discovery of a bidirectional zinc transporter (ZnT-5B) on the apical
membrane of enterocytes [132] suggests that this could possibly represent an additional
regulatory mechanism of cellular and body zinc homeostasis [133,134].
Zinc resorption kinetics were described by carrier-mediated and saturable processes
[5,125,130,135], where the zinc uptake at the apical membrane of the intestinal mucosa
seems to be the rate limiting step [131]. Saturation of these transport mechanisms at a
certain luminal zinc level is reflected by an absorption plateau with a half saturation constant
(Km) of cellular zinc uptake of 29–55 µM zinc in vivo [92,131,136]. However, at higher luminal
zinc concentrations, zinc uptake was also reported to be nonsaturable, indicating passive
diffusion [3,119,125]. Notably, the so called ‘high zinc concentrations’ applied in these
studies varied from >200–1000 µM [119,125,135]. However, this might not be relevant in
vivo under normal zinc administration, as physiologically relevant concentrations in the
intestinal lumen after consummation of a standard meal were reported to vary around 100
µM [4,5,137], a concentration range where a saturable and carrier-mediated transport
kinetic was observed both in in vitro and in vivo studies.
Human fractional absorption of dietary zinc was estimated to be around 16–50% [15,88,138-
141] increasing inversely related to the oral zinc intake [11]. Accordingly, human zinc
resorption is more efficient from low zinc diets and was even shown to adapt to low dietary
zinc intake [15]. Moreover, net absorption is regulated by body zinc homeostasis and thus
dependent on the individual zinc status adapting to prolonged low zinc diets. Consequently,
![Page 32: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/32.jpg)
Literature Review
16
zinc deficient humans and animals showed an increased fractional zinc resorption [89,142-
144], absorbing almost 92% of dietary zinc [89,144]. It has to be noted that zinc resorption is
also affected by its orally administered form. Herein, the net absorption was reported to be
higher from orally administered aqueous zinc solutions than the resorption of the same
amount of zinc included in a meal [119]. This is mainly because absorption of the mineral is
dependent on its bioavailability in the intestinal lumen and highly affected by food
components, which will be discussed in detail in section 2.2.3.
2.2.2.1 Intestinal Zinc Transporters
Intestinal zinc absorption is mainly mediated by ZIP-4 (SLC39A4), which imports ionic zinc
from the lumen into enterocytes [145,146], and ZnT-1 (SLC30A1), a basolateral membrane
protein exporting zinc on the basolateral site of enterocytes into the portal blood [147]. The
basolaterally localized transporter ZIP-5 (SLC39A5) and ZIP-14 (SLC39A14) complement these
two transporters by importing zinc from circulation into enterocytes [148,149]. Moreover,
the protein ZnT-5 variant B (SLC305B) was shown to be localized at the apical membrane of
enterocytes [132,137] and is discussed to function in a bidirectional manner, transporting
both luminal zinc into the enterocytes and cellular ions back into the lumen [132,134].
Earlier findings indicated involvement of the divalent metal transporter (DMT)-1, a broad
specific cation transporter, in intestinal zinc uptake [150]. The raise of ZIP-4 as the major
transporter for zinc uptake and contradictory results in several in vitro studies [151-155],
however, leads to questioning the role of DMT-1 in physiological zinc transport.
Even though the exact transport mechanisms of ZIP and ZnT transporters are not yet fully
investigated, it is known that these proteins transport ionic zinc [74,156]. Dietary zinc in the
intestinal lumen, however, is mainly complexed by food components influencing the actual
available and absorbable zinc concentration (in detail discussed in section 2.2.3, p. 20 ff.). In
addition to the uptake of the ionic form, zinc was also suggested to be absorbed as complex
with certain amino acids possibly utilizing another transport pathway than the ionic zinc
[157].
![Page 33: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/33.jpg)
Literature Review
17
2.2.2.2 (Cellular) Regulation of Intestinal Zinc Absorption
The discovery of intestinal zinc transporters and elucidation of the role of the zinc binding
MT proteins in maintaining enterocytes’ zinc homeostasis contributed to the increased
knowledge of regulatory parameters of intestinal zinc resorption.
Figure 2.6 Regulation of intestinal zinc resorption
Shown is a potential regulatory mechanism of zinc resorption in enterocytes during (A) zinc excess (ZE), (B) adequate supply and (C) zinc deficiency (ZD) based on experimental data on the zinc-dependent expression pattern of zinc transporters and metallothionein (MT) in enterocytes and what we know about general zinc homeostasis in cells (refer to Figure 2.4). Enterocytes’ zinc homeostasis is discussed to be controlled by these proteins regulating the amount of intestinal absorbed and basolateral exported zinc [158]. Both protein and messenger ribonucleic acid (mRNA) of MTs are increasing with absorbed zinc concentration (A) and decreasing during ZD (C) [132,159-161]. Thus, together with increased sequestering of the cation into vesicles, due to upregulation of znt-2 [162] and znt-4 [162,163] in response to zinc intake, MTs might tightly regulate cytoplasmic free zinc levels in enterocytes (A,B). During zinc excess, the zinc importer Zrt-, Irt-like protein (ZIP)-4 at the apical membrane of enterocytes is endocytosed and degraded [164-166] (A), while during ZD its mRNA is stabilized leading to accumulation of the protein at the apical membrane [166,167] (C). Basolateral ZIP-14 is unaffected by dietary zinc [163] (A-C), while the ZIP-5 protein is decreased during zinc deficiency (C). Data for the basolateral zinc transporter (ZnT)-1 during ZE and ZD are contradictory and scarce regarding its differential expression in humans. The mRNA and protein of ZnT-1 are decreased during ZD [168] (C) and both down- und up-regulated [117,132,147,162] after zinc supply (A, C). The bidirectional transporter ZnT-5B is not affected during ZD, but was reported to localize to the plasma membrane as response to dietary zinc [134,137].
In the intestine, mainly MT-1 and MT-2 are expressed [115], these MT isoforms are
ubiquitously found in all tissues with particularly high expression in liver, pancreas, kidney
and intestine [169]. In the following, the singular form of MT refers to both MT-isoforms for
![Page 34: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/34.jpg)
Literature Review
18
the sake of convenience and readability. Similar to its role in cellular zinc homeostasis in
general, MT plays an important role in regulating enterocytes’ zinc homeostasis binding zinc
that is absorbed into the cells [131]. Thus, the protein controls free levels of the cation and is
discussed to mediate zinc trafficking through the cell as well as its transfer to other proteins
such as zinc transporters (Figure 2.4 and Figure 2.6) [106,170]. Hence, MT’s zinc buffering
and muffling properties might consequently regulate the amount of zinc that is finally
exported into the portal blood and distributed into the body.
Expression of MT is related to changes in enterocytes’ zinc levels as elevated cellular free
zinc itself induces mt expression via the metal regulatory transcription factor 1 (MTF-1) [171]
(Figure 2.5). Protein and messenger ribonucleic acid (mRNA) levels of intestinal MT was
reported to increase in response to elevated dietary zinc in animals and humans in vivo
[132,159-161], acting as an initial defense mechanism against high luminal zinc
concentrations [161]. Furthermore, it was suggested that its upregulation has an impact on
zinc transport kinetics and decreases the luminal zinc absorption [125,172-174]. In this
regard, serum and body zinc levels were observed to decrease with elevated intestinal MT
[117,173,175]. Interestingly, in an earlier study, MT was also suggested to be involved in zinc
export from enterocytes back into the intestinal lumen [174]. In fact, luminal secretion of MT
after treatment with physiological zinc concentrations was observed in a three-dimensional
in vitro intestinal model, indicating that MT might also mediate enterocytes’ zinc
homeostasis by apically sequestering excess zinc [176]. As already mentioned in section
2.2.1 there is evidence that MT is not the only protein involved in cellular zinc trafficking
[116-118,161]. In this context, Cousins and coworkers proposed the involvement of the
cysteine rich intestinal protein (CRIP) as an additional mediator of enterocytes’ zinc
trafficking possibly competing with MT [177-179]. However, CRIP was later shown to be
expressed in nearly all organs and suggested to play a role in immune response [180]. It is
most likely, that there is another moiety involved in zinc muffling and transfer through the
cell, possibly similar to chaperones involved in enterocytes’ iron and copper homeostasis
[181].
Similar to MT, intestinal zinc transporters are not only part in the maintenance of
enterocytes’ zinc homeostasis but are also decisive for zinc resorption, thereby regulating
body zinc homeostasis. The main intestinal zinc importer ZIP-4 is regulated by dietary zinc in
a transcriptional, translational and post-translational manner [182]. ZIP-4 is essential for zinc
resorption. This is particularly demonstrated in the zinc malabsorption disease
acrodermatitis enteropathica which originates from different mutations in the gene
encoding the human ZIP-4 protein [145,146,183,184]. Moreover, surface localization of ZIP-4
of enterocytes is regulated by zinc concentrations in the cytoplasm [166]. Under zinc
deficiency, zip-4 mRNA was shown to be stabilized [184-186] and the protein accumulated at
the apical plasma membrane of enterocytes resulting in higher zinc uptake [166,167]. Zinc
repletion results in endocytosis of the protein [166] and ubiquitin-mediated degradation at
even higher zinc concentrations [164,165], but not downregulation on the mRNA level [132].
In contrast to ZIP-4, zip-5 mRNA abundance is not changed by dietary zinc but its translation
was reported to be zinc-dependent [185]. During zinc insufficiency, the basolateral plasma
![Page 35: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/35.jpg)
Literature Review
19
membrane protein is internalized while its mRNA is associated with polysomes, minimizing
the secretion of body zinc from the blood into the intestinal tract [185,186]. After zinc
repletion the protein is again rapidly accumulated at the membrane [185]. Consequently,
ZIP-5 is important for the control of systemic zinc homeostasis and was suggested to even be
involved in sensing zinc body status [187].
Regulation of ZIP-14 mRNA on the other hand was not altered during dietary zinc deficiency
or excess in mice [163].
ZnT-1 mRNA expression is zinc-dependent and, similar to MT, was shown to be regulated by
MTF-1 [147,162]. MTF-1 directly senses cytoplasmic zinc concentration in enterocytes and
regulates ZnT-1 expression guaranteeing a reasonable export of the cation into the portal
blood and controlling intracellular free zinc levels [106]. To this end, in animal studies, high
oral zinc doses increased protein [147] and mRNA expression [117,147,162]. Conversely, znt-
1 mRNA and the corresponding protein were downregulated after zinc supplementation in
humans in vivo [132]. Zinc restriction on the other hand resulted in downregulation of mRNA
and protein in weanling rats [168], whereas no effect was reported in mature rats [162].
Interestingly, in contrast to the aforementioned MT knockout mice, ZnT-1 knockout mice
already died in an early embryonic state [188].
The apically localized bidirectional zinc transporter ZnT-5B was reported to be
downregulated [132] and upregulated [134,137] with elevated cellular zinc availability in in
vitro and in vivo studies. This converse regulation indicates a rather complex role in zinc
homeostasis and was suggested to be based on both transcriptional repression and
stabilization of its mRNA [133]. Aside of its apically located variant B, ZnT5 is also distributed
in cytoplasm of enterocytes and goblet cells and was shown to be essential for zinc
homeostasis, as ZnT-5 knockout mice displayed impaired growth and bone development
[189].
All in all, this zinc sensitive regulation of intestinal zinc transporters and metallothionein
expression is pivotal for the control of enterocytes’ zinc absorption and release into
circulation. However, the distinct molecular parameters by which the transporters are
regulated and zinc is absorbed remain to be fully understood. To this end, the involvement
of a systemic moiety in regulating zinc transporters, such as the humoral factor hepcidin,
was already suggested and is topic of ongoing research [130,190].
![Page 36: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/36.jpg)
Literature Review
20
2.2.3 Zinc in Nutrition and Intestinal Bioavailability
2.2.3.1 Human Zinc Requirements
To maintain human body zinc homeostasis, the essential trace element has to be supplied
with food on a daily basis. Herein, daily intestinal and non-intestinal losses of endogenous
zinc have to be counterbalanced with the nutrition [76,191]. Based on several human studies
these losses include fecal zinc excretions and excretions with urine, sweat, menstrual flow
and semen (for adults) as well as zinc losses with hair, nails and desquamated skin [138] and
were estimated to be around 2–3 mg per day for healthy adults [13,76,192,193]. Moreover,
additional zinc is needed for particular physiological states such as pregnancies, lactation or
early infancy [191]. To this end, nowadays human requirements are mostly estimated using
a factorial approach which considers the overall zinc losses including the additional
physiological requirements as well as bioavailability of the mineral from the diet [138,191].
The latter is very important as the actual amount of absorbed zinc is highly dependent on its
availability in the intestinal lumen from the diet. Therefore, a sufficient zinc supply is only
guaranteed when accessibility and availability of the mineral from food is taken into account.
Table 2.3 depicts daily recommendations for dietary zinc intake from different governmental
agencies and non-governmental organizations. Estimations for the physiological
recommendations from the World Health Organization (WHO) differ between high (50%),
moderate (30%) and low (15%) zinc bioavailability which represents molar phytate : zinc
ratios <5, 5-15 and >15 and other factors impacting zinc absorption in diets [13]. Likewise,
the European Food Safety Authority (EFSA) includes different phytate levels for their
recommendations for adults using a trivariate model from Miller et al. to assess the
relationship between total absorbed zinc, dietary phytate and dietary zinc [194]. In contrast,
the German Society for Nutrition (ger. Deutsche Gesellschaft für Ernährung, DGE) does not
classify their recommended daily zinc intake by its bioavailability from food [195].
![Page 37: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/37.jpg)
Literature Review
21
Table 2.3 Recommended daily allowance for dietary zinc intake for selected life-stages
WHO [13] EFSA [192] DGE [195]
Age, Sex RW [kg] RNI [mg/d]
Age, Sex RW [kg] PRI [mg/d] Age, Sex RDI [mg/d] High
a Mod
b Low
c
7-12 mos 9 0.8d; 2.5
e 4.1 8.4 7-11 mos 2.9 < 4 mos 1.0
1-3 yr 12 2.4 4.1 8.3 1-3 yr 11.9 4.3 4-12 mos 2.0
4-6 yr 17 2.9 4.8 9.6 4-6 19.0 5.5 1- 4 yr 3.0
7-9 yr 25 3.3 5.6 11.2 7-10 28.7 7.4 4-7 yr 5.0
10-18 yr, m 49 5.1 8.6 17.1 m f m f 7-10 yr 7.0
10-18 yr, f 47 4.3 7.2 14.4 11-14 yr 44.0 45.1 9.4 9.4 m f
19-65 yr, m 65 4.2 7.0 14.0 15-17 yr 64.1 56.4 12.5 10.4 10-13 yr 9.0 7.0
19-65 yr, f 55 3.0 4.9 9.8 Age Phytate [mg/d] 13-15 yr 9.5 7.0
> 65 yr, m 65 4.2 7.0 14.0 ≥ 18 yr 300 68.1 58.5 9.4 7.5 15-19 yr 10.0 7.0
> 65 yr, f 55 3.0 4.9 9.8 ≥ 18 yr 600 68.1 58.5 11.7 9.3 19-25 yr 10.0 7.0
Pregnancy ≥ 18 yr 900 68.1 58.5 14.0 11.0 25-51 yr 10.0 7.0
1st
trimester 3.4 5.5 11.0 ≥ 18 yr 1200 68.1 58.5 16.3 12.7 51-65 yr 10.0 7.0
2nd
trimester 4.2 7.0 14.0 ≥ 65 yr 10.0 7.0
3rd
trimester 6.0 10.0 20.0 Pregnancy +1.6 Pregnancy 10.0
Lactation Lactation +2.9 Lactation 11.0
0-3 mo 5.8 9.5 19.0
3-6 mo 5.3 8.8 17.5
6-12 mo 4.3 7.2 14.4
BV, bioavailability; EFSA, European Food Safety Authority; DGE, German Society for Nutrition; ger.: Deutsche Gesellschaft für Ernährung; f, female; m, male, mos, months; PRI, population
reference intake; RDI, recommended daily intake; RNI, recommended nutrient intake; RW, reference weight; WHO, World Health Organization; yr, years; aHigh bioavailability (50%);
bModerate
bioavailability (30%); c
Low bioavailability (15%); dexclusively breastfed infants (bioavailability 80%);
enot exclusively breastfed.
![Page 38: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/38.jpg)
Literature Review
22
2.2.3.2 Zinc in Nutrition
The amount of food that has to be consumed to meet the daily recommended levels highly
depends on its zinc content and as already mentioned, on the bioavailability of this
micronutrient. In Table 2.4 the general zinc content for selected foods is depicted,
illustrating the general variance of the trace element in esculents. Highest zinc
concentrations are found in animal products from pork, beef, poultry, fish and shellfish,
particularly in their flesh and organs. Regarding plant-based food, zinc content is high in
seeds and nuts, followed by legumes (beans and lentils) and whole-grain cereals while lesser
amounts can be found in vegetables, fruit and refined cereal grain [138].
Table 2.4 Zinc and phytate content, as well as phytate : zinc-molar ratios of foods adapted from [138]
Food group Zinc content
[mg/100g]
Phytate content
[mg/100g]
Phytate : zinc
molar ratio
Liver, kidney (beef, poultry) 4.2-6.1 0 0
Meat (beef, pork) 2.9-4.7 0 0
Poultry (chicken, duck, etc.) 1.8-3.0 0 0
Seafood (fish, etc.) 0.5-5.2 0 0
Eggs (chicken, duck) 1.1-1.4 0 0
Dairy (milk, cheese) 0.4-3.1 0 0
Seeds, nuts 2.9-7.8 1,760-4,710 22-88
Beans, lentils 1.0-2.0 110-617 19-56
Whole-grain cereal 0.5-3.2 211-618 22-53
Refined cereal grain 0.4-0.8 30-439 16-54
Bread 0.9 30 3
Fermented cassava root 0.7 70 10
Tubers 0.3-0.5 93-131 26-31
Vegetables 0.1-0.8 0-116 0-42
Fruits 0-0.2 0-63 0-31
Phytate : zinc-molar ratio was estimated based on (mg phytate/660) / (mg zinc/65.4) [138].
An insufficient zinc absorption results in zinc deficiency with severe health consequences,
such as poor growth, retardation in development, decreased brain function and impairment
of the immune defense [79,196-198]. Severe and prolonged deficiency increases the risk of
infection, often connected with diarrhea and impaired wound healing, all causing high
morbidity rates [199,200]. According to the WHO, one third of the world’s population are at
risk for zinc deficiency [13], placing this micronutrient deficiency among the ten highest risks
for human health in developing countries with high morbidity rates [10].
The main obstacle in this situation, however, is the lack of a suitable biomarker for
physiological zinc status and thus a low possibility to recognize insufficient zinc absorption,
particularly in the early stages of a mild zinc deficiency [76,201]. Inadequacy of zinc status is
often connected to an insufficient food supply but mostly dependent on poor bioavailability
![Page 39: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/39.jpg)
Literature Review
23
of the mineral from the consumed diet [11]. In this context, particularly phytate content of
consumed food is severely impairing zinc bioavailability in the intestine, the underlying
physico-chemical interactions will be discussed in detail in section 2.2.3.3 on p. 23 ff. Herein,
the molar ratio of food’s phytate and zinc content was shown to be more important than the
phytate content of the product itself [202,203]. As illustrated in Table 2.4, plant-based diets
contain higher phytate levels than mixed diets, providing the person with less intestinally
available zinc than from meat-based diets [204,205]. Therefore, people suffering from zinc
deficiency are more likely to live in developing or poor countries [206,207]. Vegans [204],
vegetarians [204], elderly [138,207] and people with disorders connected with a diminished
zinc absorption, such as acrodermatitis enteropathica or celiac disease [208] as well as
diseases that cause increased zinc loss, such as Crohn’s disease [209] and inflammatory
bowel disease [210], are also at risk.
Symptoms of zinc deficiency are reversible when the essential trace element is administered
again [76,196,197,199]. In most cases, (pharmaceutical) zinc supplementation in addition to
dietary zinc provides a convenient option to compensate inadequate zinc intake,
malabsorption or increased zinc loss due to intestinal diseases [211-213]. For this a variety of
zinc compounds are available: zinc complexes with aspartate, acetate, ascorbate, citrate,
gluconate, histidine, methionine, oxide, chloride or sulfate [138,214].
2.2.3.3 Intestinal Zinc Bioavailability
According to the International Zinc Nutrition Consultative Group (IZiNCG), zinc bioavailability
from a mixed or vegetarian diet, based on refined cereal grains, was estimated to be 26–
34%, whereas 18–26% was resorbed from an unrefined cereal based diet [138]. As already
mentioned above, the actual absorbed amount of zinc not only depends on the zinc content
of the consumed diet but is highly affected by its intestinal zinc bioaccessibility and -
availability. Bioavailability describes the amount of zinc absorbed by the cells that is
subsequently released into the blood and therefore available for the systemic circulation and
body homeostasis [215]. The term bioaccessibility in this context includes the potentially
free and absorbable zinc concentration in the intestinal lumen and represents a preselection
in addition to bioavailability of the nutrient [215,216].
Due to the digestion process, a wide range of different zinc species is available in the
intestinal lumen, mainly complexed by food-derived macromolecules or even low molecular
weight ligands [3]. Hence the accessibility and availability of the essential micronutrient is
certainly dependent on its solubility and stability of the respective complexes in the
intestinal lumen. This is affected by the particular diet as well as by physiological factors such
as the mucus layer and the intestinal fluid. Together these luminal factors alter the
speciation of the metal as well as its luminal free and available concentration, consequently
affecting its absorption by the intestinal epithelium. In the following, the beneficial or
inhibitory impact of these diet-derived and physiological luminal factors on the intestinal
zinc bioavailability will be briefly summarized.
![Page 40: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/40.jpg)
Literature Review
24
2.2.3.4 Dietary Factors Recognized to Influence Zinc Absorption
The fractional zinc resorption is mainly dependent on the zinc intake itself, as the efficiency
of this process is declining with increased zinc consumption [15,16,87] (refer to section 2.2.2,
p. 15 ff.). Additionally, the zinc species itself influences its intestinal absorption, which is
particularly of great interest regarding their use as pharmaceutical zinc supplement. Many
studies aimed to characterize different zinc complexes regarding their bioavailability, which
is mainly dependent on their solubility in intestinal environment. Herein, zinc oxide has the
lowest availability, whereas results for other zinc complexes, with citrate, chloride,
gluconate, sulfate, amino acids or even ethylene-diamine-tetra-acetic acid (EDTA) are
contradictory suggesting that their bioavailability is quite comparable [121,138,217-220].
Particularly phytate, a natural component of plants, severely decreases the intestinal zinc
bioavailability and is regarded as the main inhibitor of zinc resorption. Notably, the term
phytate includes magnesium, calcium or potassium salts from phytic acid and comprises a
mixture of myo-inositol hexa-, penta-, tetra- and triphosphates [221]. Actually, tetra- and
triphosphates were described to have little impact on zinc absorption, whereas hexa- and
pentaphosphates of inositol severely impaired the intestinal zinc availability in in vivo studies
[221-223]. Nevertheless, phytate can be hydrolyzed by phytase, an enzyme that degrades
the molecule to tetra- and triphosphates, consequently increasing the zinc availability
[224,225]. In contrast to sheep and pigs, which are able to degrade phytate with their own
intestinal phytase, levels of this enzyme in human small intestine are very low and thus
phytate degradation is highly dependent on phytogenic and microbiotic phytase
[221,224,226,227]. Phytogenic phytase, particularly in grains, can be activated during
fermentation and food processing [224,225,228], subsequently enhancing zinc absorption
[228].
Zinc is bound by phosphates of the molecule yielding a 2:1 stoichiometry of the zinc-
phytate-complex [229] with strong binding affinities: 1. 8·106 L mol-1 (site 1) and 8·104 L mol-1
(site 2) (myo-inositol hexaphosphates at 37°C) [230]. Moreover, stability of the zinc-phytate-
complex is pH dependent, illustrating moderate solubility at low pH and poor solubility at pH
7 [230]. Hence, zinc must not be bound to phytate when consumed with the meal [231], at
intestinal pH (luminal pH 6–7.4), however, phytate binds the cation effectively, forming
stable complexes with low solubility and bioaccessibility [232,233]. Consequentially,
complexed zinc is not available for absorption and is excreted with the feces [234]. Phytate is
also discussed to severely impact body zinc homeostasis by binding endogenous zinc that is
excreted into the lumen by inhibiting its reabsorption [3]. Thus the total phytate content of
the diet can affect the overall zinc bioavailability in one meal. More precisely, the inhibitory
effect of phytate on zinc absorption is concentration-dependent and the molar phytate :
zinc-ratio of the diet (Table 2.4) is applied to estimate zinc bioavailability [13] (for details
refer to section 2.2.3.2., p. 22 ff.). Significant changes in zinc absorption in humans were
observed beginning with a molar ratio of 5, reducing fractional zinc absorption from 21%
without phytate to moderate levels of 11-16% at a molar phytate : zinc-ratio of 5–15 and
lower 4-11% bioavailability at molar ratios >15 [235]. Additionally, these complexes were
![Page 41: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/41.jpg)
Literature Review
25
observed to be stronger when calcium is present, suggesting calcium as an inhibitor of zinc
absorption in the presence of phytate [235]. Contradictory, the calcium content did not
increase the inhibition of zinc absorption by phytate in several human dietary studies
[141,231,236]. Other than phytate, fiber like cellulose seems to have no significant impact on
zinc absorption [225,234].
Dietary protein levels were shown to positively correlate with zinc uptake [12,141]. In
general, human zinc absorption is higher in the presence of protein from animal-sources
than plant-based protein, mainly because of the phytate content of the latter [237]. In fact,
addition of animal protein to vegetable-based food significantly improved its zinc
bioavailability in vivo. [238]. This beneficial impact, however, was discussed to be rather
based on the fact that protein itself counteracts the impairing effect of phytate and not
because of its animal origin [239]. It has to be noted that to investigate the role of plant-
derived protein on intestinal zinc uptake, phytate has to be removed in advance, as it would
strongly affect the zinc availability [11]. In this manner, zinc resorption from soy-protein
increased after phytate-removal [240]. Casein is the main zinc binding protein in cow’s milk
and was suggested to be the main reason why zinc from cow’s milk is less bioavailable than
from human milk [241]. This, however, was not confirmed when adding isolated casein to
test meals [239]. In this in vivo human study only the addition of bovine serum albumin and
soy protein decreased zinc absorption [239].
Protein is digested in the gastrointestinal tract and degraded into peptides or amino acids
[30]. These low molecular weight (LMW) compounds form complexes with zinc increasing its
bioavailability by enhancing the solubility of the cation in the intestinal lumen [11] and
possibly by being resorbed via amino acid transporters [157]. The latter increase their
relevance for zinc supplementation in zinc malabsorption diseases, such as acrodermatitis
enteropathica [157]. Several studies investigated the impact of amino acids on zinc
absorption, yielding contradictory results. For example, histidine was shown to increase zinc
bioavailability in humans [140,242] and was even reported to elevate its absorption from
zinc-phytate-complexes together with methionine [243]. Moreover, tryptophan, histidine,
imidazole, proline, and pyroglutamate were shown to increase zinc absorption in perfused
rat intestine [244]. In contrast, cysteine and histidine had no beneficial effect on zinc uptake
of isolated rat enterocytes in vitro [245] and methionine even reduced zinc resorption in rats
in vivo [246].
The interrelation of micronutrients on their resorption is still topic of ongoing research. The
possible inhibitory impact of calcium on the intestinal zinc bioavailability was already
discussed above. Further, negative effects of both heme-iron and inorganic iron on zinc
absorption were reported by several in vivo studies [242,247-250], whereas the effect was
greater when iron was administered as aqueous solutions than together with the meal
[242,251]. Copper on the other hand seems to have no decreasing impact on zinc absorption
[252]. High zinc doses though were described to crucially affect intestinal copper resorption,
thus a balanced zinc and copper nutrition is by all means very important [253]. Lastly,
cadmium [254] and tin were reported to inhibit zinc absorption [255], although it has to be
![Page 42: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/42.jpg)
Literature Review
26
noted that the latter study applied unrealistically high amounts of tin. Nonetheless, naturally
occurring tin concentrations were observed to severely affect zinc homeostasis by increasing
urinary excretion of zinc [256].
In contrast to its beneficial role in iron resorption [251], ascorbic acid has no effect on
intestinal zinc bioavailability [237,257,258]. Citrate on the other hand positively influences
zinc availability and thus zinc-citrate-complexes are already used as zinc supplements [219].
Citrate is the main low-molecular weight ligand binding zinc in milk possibly influencing
zinc’s bioavailability from milk and milk products [259]. Concentrations of zinc-citrate-
complexes are higher in human milk compared to cow’s milk [260], which might explain the
higher human zinc absorption from human milk than from cow’s milk [241].
Lastly, chemical and physical food processing were also shown to affect the bioaccessibility
and -availability of the essential cation [261]. In this context, particularly the formation of
heat-derived zinc binding ligands such as Maillard browning products [262,263] decreased its
availability, whereas fermentation or germination elevated its accessibility due to phytate
reduction [224,264].
2.2.3.5 Physiological Factors Discussed to Regulate Zinc Absorption
Aside of dietary components various physiological factors in the intestinal lumen influences
the solubility of the mineral and its subsequent availability for the intestinal epithelium.
Most notably, at intestinal pH of 6–7.4 [31] the divalent zinc cation tends to form insoluble
hydroxypolymers (Zn(OH)2) which would affect its luminal availability [265]. About three
decades ago, the intestinal mucus layer was suggested to have an impact on luminal zinc
uptake, possibly binding luminal zinc and enhancing its availability for the intestinal
epithelium [130,266]. Subsequent animal studies confirmed this hypothesis and even
indicated zinc buffering properties of this physical barrier [23,24,267]. In fact, mucins were
already shown to bind several other metals, such as iron, lead, calcium and aluminum
[46,268,269], with increased affinity from M+ < M2+ < M3+ [24]. Consequentially, this
competitive binding was suggested to influence the luminal availability of these metals for
the underlying epithelium which might also explain the mutual interference observed in
intestinal trace element resorption. Hence, there is evidence that mucins represent an
important luminal factor for zinc resorption, influencing luminal accessibility of the cation
and consequently its bioavailability. Nevertheless, there is still a lot we do not know about
this physiological factor, including its zinc binding properties as well as its distinct role in
luminal zinc uptake into enterocytes.
Most recently, systemic factors were discussed to play a role in intestinal zinc resorption by
regulating the uptake and transport into the systemic circulation. In this context, Hennigar et
al. studied the impact of the liver-derived humoral factor hepcidin, which plays an important
role in iron resorption [270], on enterocyte’s zinc transport [190]. Herein, basolaterally
added hepcidin was shown to reduce serosal zinc transport into the blood by post-
translationally downregulating ZnT-1 in Caco-2 cells. Furthermore, zinc concentration in
![Page 43: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/43.jpg)
Literature Review
27
enterocytes increased and mt-1a was upregulated, possibly controlling subcellular zinc pools
[190].
In this manner, zinc resorption seems to not only be influenced by luminal factors affecting
its bioavailability, but might also be managed by basolateral factors possibly providing a
direct regulating mechanism of systemic zinc supply by the intestine.
2.3 In vitro Studies on Intestinal Zinc Resorption
In the past 50 years, several analytical approaches have been applied to investigate
intestinal zinc resorption and its underlying mechanisms. The latter was mainly elucidated
with ex vivo animal studies, such as everted rat gut sacs [121,122], isolated vascularly
perfused rat intestine [92,131,143,172,271] and intestinal brush-border membrane vesicles
from rat [135] and pig [272,273] small intestine. Moreover, some human studies using
perfused intestine were performed as well [4,5]. Conversely, zinc transport kinetics,
fractional absorption, efficiency of transport, and the impact of dietary components on zinc
bioavailability were studied with in vivo human and animal studies using mostly (stable)
isotope techniques [15,87,234,259]. Distinct processes on the cellular level, like the role of
zinc transporters and metallothionein, however, were mostly investigated with in vitro cell
models [132,137,148,166,190], as they provide a standardized and easy platform to study
various cellular processes.
Furthermore, in times were the three R paradigm of animal testing [274] is getting more
important, calling for refined and reduced animal studies, the application of suitable in vitro
cellular models has to be increased to achieve the “third R” of replacing animal experiments
[275]. The aim of this thesis was to establish a three-dimensional in vitro intestinal model to
investigate intestinal zinc transport and to further elucidate regulatory parameters of its
resorption. Hence, the following should only focus on the application of in vitro cell models
in the investigation of intestinal zinc resorption to summarize the hitherto obtained results
using in vitro intestinal models.
2.3.1 Investigation of Zinc Transport using in vitro Intestinal Models
Until now, predominantly the Caco-2 cell model was used to elucidate human intestinal zinc
resorption and transport with in vitro studies. This model is widely employed to determine
the absorption of various drug compounds as well as the uptake and transport kinetics of
(micro-) nutrients [276-279]. When cultured for 21 d, the colon carcinoma cell line Caco-2
differentiates resembling human enterocytes functionally and morphologically [280,281].
They form an intact monolayer with important characteristics of the intestinal epithelium,
including microvilli as well as tight junction proteins, and express several important proteins
of intestinal transport [282,283]. Furthermore, this model is a validated intestinal model to
study drug absorption, recognized by the FDA, giving promising correlations for fractional
resorption of several drug components [284].
![Page 44: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/44.jpg)
Literature Review
28
Figure 2.7 Schematic representation of the three-dimensional in vitro intestinal model Caco-2
(A) The intestinal epithelium in vivo is mostly composed of enterocytes and goblet cells [28], which represent about 90% of intestinal cells of the brush border membrane [27,285], and are covered by a viscoelastic gel: the mucus layer. This physical barrier is synthesized and secreted by goblet cells and serves as a protective layer for the underlying epithelium. (B) Three-dimensional Caco-2 monoculture in the so called “Transwell® system”. The intestinal cell line Caco-2 is cultured in transwell inserts on a permeable membrane, mostly composed of polycarbonate. This forms three compartments: an apical compartment representing the intestinal lumen, a basolateral side illustrating the serosal blood side of enterocytes, and the intestinal barrier which is formed by differentiated Caco-2 cells.
In three-dimensional cultures, the cellular monolayer, seeded on transwell inserts, forms an
intact barrier mimicking the intestinal epithelium, whereas the apical transport chamber
depicts the intestinal lumen and the basolateral side illustrates the serosal blood side [18].
By these means, uptake and transport of a substance of interest can be tracked in all three
compartments. In detail, transport of apically added zinc inside the cells and via the
intestinal epithelium into the blood side can thus be determined.
Whilst zinc resorption and transport kinetics (Table 2.5) were characterized using three-
dimensional Caco-2 models, two-dimensional culture of these cells was additionally applied
to investigate zinc uptake parameters. Furthermore, this model was widely used to study the
effect of various dietary food components on intestinal zinc bioavailability [157,279,286-301]
and was also applied to elucidate the regulatory role of intestinal zinc transporters and
metallothionein in zinc resorption [132,134,137,302-310]. Notably, the impact of dietary zinc
on zinc transporters and metallothionein expression in Caco-2 cells is very well comparable
to the homeostatic regulation of these proteins in human small intestine [132]. For detailed
results of these studies, refer to Table S5 and S6 in Appendix F, which summarizes their main
study design and outcome.
![Page 45: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/45.jpg)
Literature Review
29
Table 2.5 summarizes studies of zinc resorption using three-dimensional Caco-2
monocultures, depicting parameters of cell models including buffer composition and the
main outcome of the study. Regardless of the detailed experimental setting almost all
transport studies obtained with Caco-2 models observed a saturable apical zinc uptake and
transport kinetic. Interestingly, Km values for zinc uptake of 41 µM [127], 11.7 µM [125]
obtained with Caco-2 are in the same order of magnitude as those observed with in vitro rat
intestine (Km = 10-12 µM, [125]), rat perfused intestine (Km = 32 µM, [92]; Km = 29 µM, [136];
Km = 55 µM, [131]), or brush-border membrane vesicles from pig (Km = 67 µM, [254] or rat
(Km = 24 µM, [311]). Accordingly, Caco-2 cells are very well suitable to study intestinal zinc
uptake. Of note, two different studies observed no saturable zinc uptake from the apical
side, both using regular cell culture medium with 10% FCS for their apical zinc treatment
[128,129] and very high and not physiologic zinc concentrations [129]. Therefore it is very
important that the amount of applied zinc corresponds to physiological concentrations in
lumen in vivo, particularly when analyzing transport and uptake kinetics to prevent the
analysis of artefacts. Additionally, medium or buffer constituents have to be carefully
considered when investigating metal uptake and transport with in vitro models, particularly
with regard to metal binding components [19]. In fact, speciation of zinc in cell culture
medium or buffer severely affects its availability and cellular uptake [19,20].
It has to be noted that the in vitro Caco-2 model lacks one very important factor of the
intestinal epithelium: the mucus layer. The intestinal epithelium is not only composed of
enterocytes but also includes goblet cells, producing and secreting mucins that cover the
whole gastrointestinal tract (in detail discussed in section 2.1.2, p. 7 ff.). The co-culture of
Caco-2 cells together with the goblet cell line HT-29-MTX improves this disadvantage,
forming a mucus layer, which was shown to cover the whole cell layer [312]. This Caco-2/HT-
29-MTX model is well characterized [313-316] and was already used to investigate the
resorption of different metal species [312,317-319], the effect of nanoparticles on nutrient
absorption [320], and bacterial adhesion [321]. However, this model has never been used to
study intestinal zinc resorption, even though mucins are discussed to play an important role
in this process.
![Page 46: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/46.jpg)
Literature Review
30
Table 2.5 Zinc transport studies using in vitro intestinal models
Cell model Incubation parameter Zinc Quantification
Main Outcome Reference
Caco-2 cells Cultivation time: 14 d 3D Transwell (PC membrane) 14 d
ZnCl2
20 µM (Kinetic 0-50min) 0-100 µM (10 min) (in salt buffer on apical and basolateral side) Inhibitor: oubain, vanadate, dinitrophenol, sodium cyanide, ammonium vanadate Potential zinc ligands: histidine, cysteine, proline, glutathione
65Zn
- cellular zinc uptake is saturable process - Km = 41 µM
Vmax= 0.3 nmol/cm²/10min - basolateral zinc uptake was partially inhibited
(30%) by oubain and vanadate, suggesting an involvement of the (Na-K)-ATPase in serosal uptake
- apical Zn uptake was not affected by metabolic inhibitors and ligands
- basolateral zinc uptake (50 min) ~0.47 nmol/cm² - zinc transport ~0.8 nmol/cm² (20 µM; after 50
min) - transport from basolateral to apical is higher than
from the apical to the basolateral compartment
Raffaniello et al. 1992 [127]
Caco-2 cells Cultivation time: 18-21 d 3D Transwell
ZnSO4 10-1000 µM (for 90 min) 10 nM 1α,25-dihydroxyvitamin D3 (preincubation for 72 h) + 100 µM ZnSO4 (for 90 min) Apical: MES-buffer with NaCl, KCl, MgSO4, CaCl2, glutamine, glucose, Basolateral: 2.5 mg/mL BSA in Hepes with NaCl, KCl, MgSO4, CaCl2, glutamine, glucose,
65Zn
- saturable zinc uptake kinetic up to 1000 µM - Km = 226 µM - zinc transport rate (after 90min):
~ 10 µM: ~ 0.12 nmol/cm² ~ 50 µM: ~ 0.25 nmol/cm²
- zinc transport increased in vitamin D3 incubated cells
- mt-2a mRNA and protein was increased with increased zinc concentrations
- Crip mRNA (30% less expressed in Caco-2 cells than in rat mucosa) was decreased by vitamin D3 treatment
Fleet et al. 1993 [322]
![Page 47: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/47.jpg)
Literature Review
31
Caco-2 cells Cultivation time: 21 d 2D,3D Transwell (PE membrane)
n.a. 1-200 µM (in DMEM + 10% FCS on apical and basolateral side) for 0 - 30 h
65Zn
- saturable zinc uptake at the basolateral membrane
- apical zinc uptake and zinc transport, both from apical to basolateral and vice versa, were not saturable
- higher transport from apical to basolateral - transport rate
50 µM: 6 pmol/h/cm² - transport from apical to basolateral was
independent from basolateral zinc concentration - study indicates that zinc uptake and transcellular
movement are different at the apical and basolateral side
Finley et al. 1995 [128]
Caco-2 cells Cultivation time: 14 - 16 d 3D Transwell (Polyethylene terephthalate membrane)
ZnSO4
0-1000 µM (in DMEM + 10% FCS on apical) and 0-450µM (in DMEM + 10% FCS on basolateral side) for 24 h
FAAS
- applied 0-1000 µM zinc on apical or 7 – 450 µM zinc basolateral side
- transport occurs from both sides to the other compartment
- accumulation in the cells was low, particularly when zinc was added on the apical side
- zinc toxicity on cell viability and integrity of the intestinal barrier (TEER) 0-2000 µM zinc:
- observed higher toxicity when adding high zinc concentrations to the basolateral side
Rossi et al. 1996 [129]
Caco-2 cells Cultivation time: 18-21 d 3D Transwell (PC)
ZnCl2 50-200 µM (in serum free medium on apical and basolateral side) for 6 h, 12 h, 24 h
65Zn
- zinc transport an MT secretion (HPLC analysis) - this study suggest that MT is secreted into the
gastrointestinal lumen and plays a role in intestinal zinc uptake
- zinc transport (after 6 h) - 100 µM:~ 2.0 nmol/cm²
Moltedo et al. 2000 [176]
![Page 48: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/48.jpg)
Literature Review
32
Caco-2 cells Cultivation time: 21 d 3D (PES-HD membranes)
ZnSO4
5 µM or 25 µM (in DMEM + 10% FCS on apical and basolateral) (preincubation for 7d)
65Zn
- zinc uptake and transport were measured in both apical (AP) and basolateral (BL) directions
- rate of apical zinc uptake and transport rate to basolateral was lower in cells pretreated 25 µM zinc
- basolateral zinc release was higher in cells treated with 25 µM
- cellular zinc uptake 2-3 nmol mg-1
protein - induction of MT (analyzed using radiolabeled
cadmium) was zinc-dependent, increasing with zinc concentration
Reeves et al. 2001 [323]
Caco-2 cells Cultivation time: 21 d 3D Transwell (PC)
ZnSO4
15.6 - 500 µM ( apical: KHB buffer, basolateral: KHB-buffer + 5% BSA)
ICP-MS
- comparison with zinc transport across isolated rat small intestine
- rat: Km = 10-12.1 µM - Caco-2 Km = 11.7 µM
Vmax = 31.8 pmol min-1
cm-2
- transport across Caco-2 monolayers is carrier-
mediated and energy-dependent - zinc transport into basolateral chamber followed
a saturated process
- transport rate: 50 µM: 39 pmol min
-1 cm
-²
- mRNA expression of zip-4, zip-5, znt-1, mt1, mt2 in duodenum, jejunum and ileum of isolated rat small intestine
Yasuno et al. 2012 [125]
Caco-2 cells Cultivation time: 17 d 3D Transwell (Polytetrafluoroethylene)
ZnSO4 100 µM (serum free medium on apical and basolateral side)
for 3-24 h 1 µM hepcidin
67Zn
- hepcidin reduces basolateral zinc export by post-translationally downregulation of ZnT-1
- cells incubated with hepcidin showed less zinc export while cellular zinc and mt-1a mRNA increased; cell surface ZnT-1 as well as ZnT-1 protein decreased
- hepcidin might play a role in controlling zinc resorption and enterocytes’ subcellular zinc pool
Hennigar et al. 2016 [190]
3D, three-dimensional; BSA, bovine serum albumin; DMEM, Dulbecco’s Modified Eagles Medium; FAAS, flame atomic absorption spectrometry; FCS, fetal calf serum; HBSS, Hank's Balanced Salt Solution; HD, high density; ICP-MS, inductively-coupled plasma mass spectrometry; KHB, Krebs-Henseleit buffer; n.a., not available; PC, polycarbonate; PE, polyethylene; PES, polyester; Zn, zinc.
![Page 49: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/49.jpg)
Literature Review
33
2.3.2 Analytical Approaches to Study in vitro Zinc Resorption and Zinc
Bioavailability
Zinc resorption and bioavailability in humans’ in vivo is mostly analyzed with (stable) isotope
tracer techniques, primarily measuring fractional zinc resorption [324]. In earlier studies, the
zinc radioisotope 65Zn was also used to investigate zinc homeostasis [325] and bioavailability
in humans [326], but is nowadays mostly replaced by non-radioactive and stable isotopes
[327] and solely employed in vitro [125,127,143].
In three-dimensional in vitro intestinal models, the quantity of the metal in the apical and
basolateral compartment as well as the cellular zinc content is analyzed to determine the
amount of absorbed and actually transported zinc to the blood side (Figure 2.8A). Thus,
transport kinetics and bioavailability of luminally added zinc species is investigated. Aside of
(stable) isotope techniques, zinc is generally quantified with inductively coupled mass
spectrometry (ICP-MS), inductively coupled plasma optical emission spectrometry (ICP-OES)
or atomic absorption spectrometry (AAS) [328].
Aside of determining enterocytes’ zinc uptake or transport, in vitro intestinal models offer
the great opportunity to scrutinize (sub-) cellular concentration of the metal, providing
additional information about its disposition and cellular availability after its absorption into
enterocytes (Figure 2.8B). For this, fluorescent zinc sensors are employed, offering a
versatile tool to analyze small subcellular changes of free zinc [100]. These sensors bind free
or mobile zinc, which represents a particular small part of the cellular zinc content. In fact,
this cellular zinc pool includes zinc that is in transit through the cell or serves as a cellular
signal [97,329] (for details refer to 2.2.1.1, p. 12 ff.).
![Page 50: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/50.jpg)
Literature Review
34
Figure 2.8 Application of in vitro intestinal models to study intestinal zinc transport
In vitro intestinal cell models provide a standardized and versatilely applicable microenvironment to study enterocytes’ zinc uptake and transport via the intestinal epithelium. Zinc resorption and transport kinetics can be analyzed using three-dimensional cell models, such as the Caco-2/HT-29-MTX model shown in A. For this, zinc is quantified in all three compartments (apical, cellular, basolateral) with conventional analytical approaches, such as inductively coupled mass spectrometry (ICP-MS) or flame atomic absorption spectrometry (FAAS). Furthermore, the application of chemical- or protein-based fluorescent zinc sensors in enterocytes provides additional information about the (sub-) cellular distribution of the micronutrient upon its uptake into the cell. More precisely, these sensors bind intracellular free zinc and track already small changes of intracellular free zinc. Depending on the (sub)-cellular accumulation of the sensor, the cytoplasmic free zinc pool or free zinc in organelles, like vesicles and the endoplasmic reticulum etc. (as circled in red), can be investigated (B).
Generally, fluorescent zinc sensors are mainly classified into low molecular weight sensors
(or chemical sensors) and genetically encoded biosensors (Figure 2.9) [100]. In the following
their function and application in vitro, as well as advantages and disadvantages of the two
classes of sensors, are briefly summarized.
The principle of most LMW sensors is based on photo-induced electron transfer (PET)
between the fluorophore and a chelating unit, which in case of a non-ratiometric sensor
quenches fluorescence when no metal is present. Metal binding leads to disruption of PET
and increase of fluorescence (in detail reviewed in [330]). After entering the cells by passive
diffusion, changes in their fluorescence upon binding of intracellular free zinc can then be
analyzed with fluorescence spectrometric methods to quantify free zinc concentration or
using fluorescence microscopy to image spatial distribution of the cation [330,331].
![Page 51: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/51.jpg)
Literature Review
35
Figure 2.9 Chemical- and protein-based fluorescent sensors
(A) Shown are selected low molecular weight (LMW) or chemical sensors and genetically encoded biosensors or protein sensors (B). LMW sensors Zinypr-1, Fluozin-3 and Zinquin are all non-ratiometric zinc probes that lead to increase of fluorescence upon zinc binding [330], in which Zinpyr-1 provides two zinc binding sides and Fluozin-3 and Zinquin bind only one zinc molecule. The sensors’ fluorescent domain is indicated in color. (B) Schematic representation of Förster resonance energy transfer (FRET) -sensor (eCFP-Atox1-linker-WD4-YFP) (eCalwy) [332] and bioluminescence resonance energy transfer (BRET)-sensor Zinch-3 [333] from Merkx and co-workers. These genetically encoded zinc probes on the other hand are ratiometric sensors based on FRET or BRET. Changes of FRET or BRET-ratio decreases (in the case of eCalwy) or increases (Zinch-3) due to conformational change upon zinc binding by these proteins can be measured.
In addition to low molecular weight probes, genetically encoded sensors are applied to study
intracellular zinc concentration in a less invasive and more sensitive way than chemical
probes [100]. Main principal of these sensors is comparable to LMW probes, resulting in
measurable changes upon zinc binding. Various ratiometric biosensors have been developed
based on Förster resonance energy transfer (FRET) or bioluminescence resonance energy
transfer (BRET), respectively, between two fluorescent molecules [332-336]. These fusion
proteins are composed of two fluorescent domains and a metal binding site connected by a
flexible linker (Figure 2.9B). In detail, emission wavelength of donor fluorescent domain
overlaps with excitation wavelength of acceptor domain, resulting in a FRET or BRET signal
when these fluorescent molecules are in proximity. Conformational changes upon zinc
binding consequentially lead to a shift of FRET or BRET signals [330,333]. Most recently, the
group from Palmer et al. developed a biosensor based on a single fluorescent protein [337].
In contrast to low molecular weight sensors these probes are genetically encoded and thus
transfected as plasmids into the cells [332]. Consequently, the cell produces the sensor
controlling its subcellular concentrations and distribution, which makes them particularly
convenient for long-term measurements and not as invasive as chemical probes [97,100].
![Page 52: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/52.jpg)
Literature Review
36
Introduction of BRET-based biosensors improved some disadvantages of FRET-sensors
including autofluorescence and photobleaching of fluorophores due to the illumination of
the sample, which is necessary for the excitation of the donor domain [333]. Furthermore,
FRET analysis requires an elaborate technical approach mostly based on laser scanning
microscopy determining FRET or fluorescence life time imaging (FLIM)-FRET, almost entirely
analyzing single cells [338]. BRET-based biosensors instead can be employed in high
throughput screening assays using bioluminescence plate readers [333,339,340].
Of particularly interest are zinc biosensors with organelle-specific targeting, accumulating in
distinct organelles within the cell, such as mitochondria, Golgi apparatus and endoplasmic
reticulum and cell membrane [334,341-343]. Although subcellular distribution of LMW
sensors is generally not easy to control, chemical probes with specific cellular targeting were
already successfully developed [344-346].
In terms of application of these sensors in human intestinal cell lines to either measure zinc
uptake or analyze its subcellular distribution, low molecular weight sensors Zinpyr-1 [157]
and Fluozin-3 [190,347,348] were already used in Caco-2 and HT-29 cells. Until now,
however, genetically encoded biosensors have never been applied in intestinal cells to study
intestinal zinc resorption.
![Page 53: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/53.jpg)
Objectives and Structure of Thesis
37
Chapter 3. Objectives and Structure of Thesis
The aim of this thesis was to investigate the intestinal zinc resorption using in vitro intestinal
models. For this a three-dimensional in vitro model had to be established that resembles the
in vivo situation of the intestinal epithelium as close as possible, optimizing the conventional
Caco-2 model with regard to its cellular composition as well as luminal and basolateral
factors. Herein, the impact of these factors on in vitro cellular zinc uptake and transport to
the basolateral side should be scrutinized in detail. Furthermore, low molecular weight and
genetically encoded zinc sensors should be applied in the intestinal cell line Caco-2 to
provide an additional intestinal model system to determine intestinal zinc absorption aside
from conventional analytic approaches (ICP-MS, FAAS) and to elucidate its subsequent
intracellular distribution in enterocytes.
This thesis is based on three accepted peer-reviewed publications, which are structured in
three Chapters (Chapter 4 – Chapter 6) and include the following subjects:
In Chapter 4, the application of zinc biosensors in enterocytes is addressed. Therefore, the in
vitro intestinal cell line Caco-2 was stably transfected with the zinc biosensor (eCFP-Atox1-
linker-WD4-YF (eCalwy). Before its use, the Caco-2-eCalwy clone had to be characterized
regarding characteristic features of the intestinal cell line Caco-2 and changes in its zinc
homoeostasis compared to Caco-2-wild type (WT) cells (detailed parameters of FAAS
measurements in Appendix D). Furthermore, functionality and application of Caco-2-eCalwy
cells to measure enterocytes’ zinc uptake was analyzed. Supplemental material of this
manuscript can be found in Appendix A.
Chapter 5 deals with the importance of serum albumin as a basolateral zinc acceptor for
intestinal zinc resorption and examines the critical aspects of medium composition,
particularly the use of FCS and albumin, with regard to zinc speciation and availability when
investigating zinc uptake using in vitro cell models. In this context, the impact of apical
protein on short and long-term zinc uptake in Caco-2 cells as well as the influence of in vitro
digestion on the zinc availability from a protein matrix was examined. Supplemental material
of this manuscript can be found in Appendix B. Moreover, detailed parameters of ICP-MS
and FAAS measurements are depicted in Appendix D as well as additional results of zinc
transport using mono- and co-cultures with and without basolateral added albumin in
Appendix E.
Lastly, the role of intestinal mucins in the intestinal zinc resorption is discussed in Chapter 6.
For this, the binding capacity and affinity of mucins as well as the effect of mucins on short-
and long-term zinc absorption into enterocytes and goblet cells in two-dimensional
experiments was analyzed. Moreover the impact of the intestinal mucus layer on zinc
resorption was investigated with zinc transport-studies using three-dimensional intestinal
models: mucus-lacking Caco-2 monocultures and mucin-producing Caco-2/HT-29-MTX co-
cultures (detailed parameters of FFAS and ICP-MS measurements are listed in Appendix D).
Supplemental material of this manuscript can be found in Appendix C as well as additional
![Page 54: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/54.jpg)
Objectives and Structure of Thesis
38
results of zinc transport using mono- and co-cultures with and without basolateral added
albumin in Appendix E.
The main findings from Chapter 4-6 will be related and discussed in the light of current
knowledge in Chapter 7. References of Chapter 1, 2 and 7 can be found at the end of this
manuscript, whereas references of Chapters 4-6 are at the end of the respective chapter.
![Page 55: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/55.jpg)
Characterization of Caco-2 cells Stably Expressing the Protein-based Zinc Probe eCalwy-5 as a Model System for Investigating Intestinal Zinc Transport
39
Chapter 4. Characterization of Caco-2 cells Stably Expressing
the Protein-based Zinc Probe eCalwy-5 as a Model System for
Investigating Intestinal Zinc Transport2
Abstract
Intestinal zinc resorption, in particular its regulation and mechanisms, are not yet fully
understood. Suitable intestinal cell models are needed to investigate zinc uptake kinetics and
the role of labile zinc in enterocytes in vitro. Therefore, a Caco-2 cell clone was produced,
stably expressing the genetically encoded zinc biosensor eCalwy-5. The aim of the present
study was to reassure the presence of characteristic enterocyte-specific properties in the
Caco-2-eCalwy clone. Comparison of Caco-2-WT and Caco-2-eCalwy cells revealed only slight
differences regarding subcellular localization of the tight junction protein occludin and
alkaline phosphatase activity, which did not affect basic integrity of the intestinal barrier or
the characteristic brush border membrane morphology. Furthermore, introduction of the
additional zinc binding protein in Caco-2 cells did not alter mRNA expression of the major
intestinal zinc transporters (zip4, zip5, znt-1 and znt-5), but increased metallothionein 1a
expression and cellular resistance to higher zinc concentrations. Moreover, this study
examines the effect of sensor expression level on its saturation with zinc. Fluorescence cell
imaging indicated considerable intercellular heterogeneity in biosensor-expression. However,
FRET-measurements confirmed that these differences in expression levels have no effect on
fractional zinc-saturation of the probe.
2 The following article is the accepted version and appears as journal version in:
Maria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing the protein-based zinc probe eCalwy-5 as a model system for investigating intestinal zinc transport." Journal of Trace Elements in Medicine and Biology 2018, 49: 296-304, DOI: 10.1016/j.jtemb.2018.01.004, https://doi.org/10.1016/j.jtemb.2018.01.004 https://www.sciencedirect.com/science/article/pii/S0946672X17309033?via%3Dihub
![Page 56: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/56.jpg)
Characterization of Caco-2 cells Stably Expressing the Protein-based Zinc Probe eCalwy-5 as a Model System for Investigating Intestinal Zinc Transport
40
4.1 Introduction
The essential trace element zinc plays an important role for a variety of biological processes
in the human body [1]. Zinc homoeostasis is mainly dependent on dietary intake and
bioaccessibility from food in the intestine, where zinc is resorbed [2]. Intestinal zinc
homeostasis is primarily mediated by four zinc transporters: zinc uptake from the
gastrointestinal lumen is controlled by ZIP4, which is expressed on the apical membrane of
the intestinal epithelium, whereas ZIP5 at the basolateral membrane transports zinc from
the blood into enterocytes. The zinc exporters ZnT-1 and ZnT-5 are essential for zinc
transport from the enterocytes into the blood or back into the intestinal lumen, respectively
[3]. Despite ongoing research [4], knowledge of the amount of labile zinc and zinc uptake
kinetics in intestinal cells is scarce. In particular, the mechanism and regulation of human
zinc resorption is not fully understood [5].
There are several ways to investigate cellular zinc resorption in vitro. Alongside the
quantification of whole cellular zinc using analytical methods such as ICP-MS (inductively-
coupled plasma mass spectrometry) and FAAS (flame atomic absorption spectrometry) [6],
fluorescence- based sensors are increasingly used to study intracellular free zinc [7,8].
Recently, several genetically encoded fluorescent sensorproteins have been developed to
analyze intracellular labile zinc. Among them are the eCalwy sensors from the Merkx group,
which are based on Förster resonance energy transfer (FRET) between two fluorescent
domains bound to the metal binding domains WD4 and ATOX1, connected by a flexible
linker [9]. Upon zinc binding, FRET is decreasing because of conformational change and
growing distance between the donor-domain (cerulean) and the acceptor mCitrine. Zinc
biosensors offer several advances compared to synthetic sensors. They are produced by the
cell itself, providing control over their subcellular distribution and concentration and are
well-suited for long term-measurements [10,11]. In this sense, applying these sensors in
enterocytes would be suitable to monitor free zinc in these cells and illuminate sensitive
parameters of intestinal zinc resorption. Therefore, a Caco-2 cell clone was produced stably
expressing eCalwy-5.
Future research aims to include Caco-2-eCalwy-5 cells in in vitro models for the intestinal
epithelium. Therefore, this study investigates if characteristic properties of the wildtype cells
are conserved in the stably transfected cell clone and examines the effect of sensor-
expression level on its zinc-saturation.
![Page 57: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/57.jpg)
Characterization of Caco-2 cells Stably Expressing the Protein-based Zinc Probe eCalwy-5 as a Model System for Investigating Intestinal Zinc Transport
41
4.2 Experimental
4.2.1 Materials
ApaLI (NEB, Ipswich, USA), Cell Counting Kit-8/WST-8 (Sigma Aldrich, Munich, Germany), Cy-
2-labeled goat anti mouse and Cy-5- labeled goat anti rabbit secondary antibodies (Jackson
ImmunoResearch, Dianova, Hamburg, Germany), Claudin 2 polyclonal antibody, Occludin
monoclonal antibody and ZO-1 polyclonal antibody (Invitrogen, ThermoFisher Scientific,
USA), Cloning cylinders (Sigma Aldrich, Munich, Germany), DAPI (Invitrogen, ThermoFisher
Scientific, USA), DMEM (PAN-Biotech, Aidenbach, Germany), FCS (CCPro, Oberdorla,
Germany), G 418 disulfate (Geneticin) (Santa Cruz Biotechnology, Dallas, Germany), Invisorb
Spin Tissue Mini Kit (Stratec Molecular GmbH, Berlin, Germany), iScript cDNA Synthesis Kit
(Quantabio, Beverly, USA), Lipofectamin 2000 (Invitrogen, ThermoFisher Scientific, USA),
MTT (Carl Roth, Karlsruhe, Germany), NucleoSpin II (Macherey-Nagel GmbH & Co. KG, Berlin,
Germany), Opti-Mem (Sigma Aldrich, Munich, Germany), PCR Clean-Up System (Promega,
Madison, USA), peCalwy-plasmid (addgene, Cambridge, USA), pNPP (PanReac AppliChem,
Glenview, USA), pNP (Sigma Aldrich, Munich, Germany), ProTaqs Mount Fluor (Biocyc,
Luckenwalde, Germany), Purified Mouse Anti-E-Cadherin (BD Transduction Laboratories™,
BD Biosience, New Jersey, USA), SYBR™- Green (Quantabio, Beverly, USA), Transwell inserts
(Corning, New York, USA), TPEN (Sigma Aldrich, Munich, Germany), Qiagen Plasmid Maxi Kit
(Qiagen, Venlo, Netherlands), ZnSO4·7H2O (Sigma Aldrich, Munich, Germany). All other
chemicals were purchased from standard sources.
4.2.2 Cell Culture
Cells were cultured at 37°C, 5% CO2 and humidified atmosphere in Dulbecco’s Modified
Eagles Medium (DMEM), containing 10% fetal calf serum (FCS), 100 U mL-1 penicillin and 100
µg mL-1 streptomycin. Media were changed every other day. A final concentration of 0.6 mg
mL-1 G418 was added to Caco-2-eCalwy clones.
4.2.3 Stable Transfection
Plasmid-DNA of peCalwy-5 was introduced to E. coli, isolated using Qiagen Plasmid Maxi Kit
and purified using Invisorb Spin Tissue Mini Kit, according to the manufacturers’ protocols.
Purified peCalwy-5-DNA was linearized using ApaLI and successful linearization was
confirmed by gel-electrophoresis. Finally, 4·104 Caco-2-WT cells were seeded into 24 well-
plates, cultivated for 24 h and transfected by adding a total of 0.5 μg plasmid DNA and 2.5 μg
Lipofectamin 2000 directly to the medium. After additional 24 h, medium was changed and
transfection was checked by fluorescence microscopy. 48 h after transfection 1.2 mg mL-1 G
418 disulfate was added to cells and cultured for additional 6 days. Finally cells were
transferred to a 100 cm2 dish and isolated cell clones were selected, picked by using cloning
cylinders and transferred into 24 well plates.
![Page 58: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/58.jpg)
Characterization of Caco-2 cells Stably Expressing the Protein-based Zinc Probe eCalwy-5 as a Model System for Investigating Intestinal Zinc Transport
42
4.2.4 Alkaline Phosphatase Activity
Alkaline phosphatase (ALP) catalyzes the hydrolyzation of pNPP to yellow p-nitrophenol,
which can be measured photometrically at 405 nm. Extracellular ALP-activity was analyzed
on live cultured cells according to the method described by Ferruzza et al. [12]. Caco-2
clones (5000 cells/well) were cultured for 21 days in 96 well plates, washed with PBS, and 10
µM pNPP in reaction buffer (10 mM Tris-HCl, 150 mM NaCl, pH 8.0) was added to the cells.
Samples were collected at different time points and p-nitrophenol was quantified using an
external calibration. Protein was quantified using the BCA-assay as described [13] and ALP-
activity is depicted in mU/mg protein (Hydrolyzation of 0.346 nmol pNPP/min=1 mU ALP).
4.2.5 Immunofluorescent Staining
Immunofluorescence analysis was performed with cells (8·104 cells/well) grown on
polycarbonate transwell membranes (pore size 0.4 μm) for 21 d. Cell culture media were
changed every other day and integrity of the cell layer was monitored by measuring TEER
(transepithelial electrical resistance) with the epithelial volt-ohm meter Millicell® ERS-2
(Millipore, USA). Differentiated cells were washed with PBS, fixed with 2 %
paraformaldehyde for 20 min at room temperature and permeabilized with 0.5 % Triton-X-
100 in PBS for 10 min. Cells were incubated overnight at 4°C with primary antibodies against
claudin-2, occludin, zonula occludens-1 (ZO-1) protein and E-cadherin diluted 1:200 in PBS.
After three washes, cells were incubated with Cy-2-labeled goat anti mouse and Cy-5-labeled
goat anti rabbit secondary antibodies and 4′,6-diamidino-2-phenylindole (DAPI) (final
concentration 1 μg mL-1) for 45 min at room temperature. Subsequently cells were washed,
dehydrated with 95% ethanol and mounted in ProTaqs Mount Fluor. The mounting medium
was allowed to solidify for 1 h in the dark, before fluorescence measurements were
performed using confocal laser scanning microscopy (Zeiss LSM780) at excitation
wavelengths of 488 nm (Cy-2), 633 nm (Cy-5) and 405 nm (DAPI).
4.2.6 Transmission Electron Microscopy (TEM) and Scanning Electron
Microscopy (SEM)
Cells grown on cover slips (6·104 cells/well; 12 well plates), were fixed with 2.5%
glutaraldehyde in 0.1 M sodium-cacodylat buffer for 30 min at room temperature and
dehydrated trough a graded series of ethanol. TEM imaging was performed using an EM906
(Zeiss, Germany). SEM measurements were conducted with a DSM982Gemini (Zeiss,
Germany).
4.2.7 Viability Assays
Cells were seeded with an initial density of 5000 cells/well in 96 well plates and cultured for
21 d. For acute zinc toxicity, differentiated cells were incubated with 0–1000 μM ZnSO4·7H2O
for 24 h in DMEM without phenol red and fetal calf serum. Subsequently, cells were washed
with PBS and cell viability was analyzed incubating either with the water soluble tetrazolium
salt (WST)-8 (diluted 1:10) or 1 mg mL-1 3- (4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium
![Page 59: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/59.jpg)
Characterization of Caco-2 cells Stably Expressing the Protein-based Zinc Probe eCalwy-5 as a Model System for Investigating Intestinal Zinc Transport
43
bromide (MTT) in DMEM without phenol red for 30-60 min. In case of the MTT-assay cells
were lysed in isopropanol. The absorption was determined on a well plate reader (M200,
Tecan, Swiss) at 490 nm (WST) or 570 nm (MTT), respectively. A total of 0.01% Triton-X-100
was used as a positive control. Data were analyzed with GraphPad Prism software version
5.01 (GraphPad Software Inc., CA, USA) and a non-linear regression using a sigmoidal dose–
response curve with variable slope as a function of the logarithm of concentration was
applied. Chronic zinc toxicity was measured by incubating the cells with 0, 5 and 10 μM
ZnSO4·7H2O in standard cell culture medium during differentiation. Cell viability of
differentiated cells was measured as the amount of cellular protein using the
sulforhodamine B (SRB)-assay as described [14].
4.2.8 Quantitative Real Time PCR (qPCR)
1.2·105 cells were seeded in 6 well plates and cultured for 21 d. Cells were harvested in PBS
on ice using a cell scraper, and cell pellets were stored at -80°C. RNA was isolated with
Nucleo Spin II and cDNA synthesized using iScript cDNA Synthesis Kit according to the
manufacturers’ protocols. Finally, mRNA-levels were quantified by qPCR with SYBR™Green
Super Mix, using the primer listed in Table 4.1, and normalized to β-actin.
Table 4.1: Oligonucleotide sequences used for qPCR
Primer NCBI Reference
Sequence
Sequence fwd 5'-3' Sequence rev 5'-3' Ref
zip-4 NM_017767 AGACTGAGCCCAGAGTTGAGGCTA TGTCGCAGAGTGCTACGTAGAGGA [15]
zip-5 NM_173596 GAGCAGGAGCAGAACCATTACCTG CAATGAGTGGTCCAGCAACAGAAG [15]
znt-1 NM_021194 GGCCAATACCAGCAACTCCAA TGCAGAAAAACTCCACGCATGT [16]
znt-5 NM_024055 AAGGACATCATGACAGTGCTCTAACTC CCAACTTTACAACACAAAGCCAGTAC [16]
mt1a NM_005946.2 CTCCTGCAAGAAGAGCTGCTG CAGCCCTGGGCACACTT
alp NM_001631.4 CCGCTTTAACCAGTGCAACA CCCATGAGATGGGTCACAGA
β-actin NG_007992.1 CGCCCCAGGCACCAGGGC GCTGGGGTGTTGAAGGT [17]
4.2.9 Atomic Absorption Spectrometry
1.2·105 cells were seeded in 6 well plates and cultured for 21d. Cell layers were harvested on
ice with a cell scraper, and an aliquot was collected for protein quantification as described
[13]. Subsequently cells were dissolved in a mixture of 67% ultrapure HNO3 and 30% H2O2
(50/50; v/v) and dried at 92°C overnight using a thermoshaker. Residues were dissolved in
0.67% HNO3 and samples were analyzed by FAAS using a Perkin Elmer AAnalyst800 (Perkin
Elmer, Germany).
4.2.10 Live Cell Imaging and FRET-Measurements
Confluent Caco-2-eCalwy cells on cover slips were used for live cell imaging with a confocal
laser scanning microscope (Zeiss LSM710, Germany). Cells were washed twice with buffer
![Page 60: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/60.jpg)
Characterization of Caco-2 cells Stably Expressing the Protein-based Zinc Probe eCalwy-5 as a Model System for Investigating Intestinal Zinc Transport
44
(120 mM NaCl, 5.4 mM KCl; 5 mM Glucose; 1 mM CaCl2; 1 mM MgCl2; 1 mM NaH2PO4; 10
mM HEPES; pH 7.35) and a fluorescence emission scan was conducted after excitation at 458
nm (40×/1.3 oil objective; λem=462 nm–590 nm). Additionally, an emission scan of the
acceptor-domain mCitrine was measured after direct excitation at λex=514 nm (λem =526nm–
590 nm). FRET is expressed as the fluorescence intensity ratio of mCitrine (λem =527 nm) and
cerulean (λem =478 nm) after excitation at 458 nm. Ratios were measured in buffer alone
(Rapo), or 10 min after the addition of 20 μM TPEN (Rmax) or 400 μM zinc (Rmin) (final
concentrations). The measurements using a multiphoton laser scanning microscope (Zeiss
LSM510-META-NLO, Germany) were conducted as described above, but after multiphoton
excitation (810 nm) using a tunable IR-laser (λem (cerulean)=478 nm, λem(mCitrine)=532 nm).
The concentration of free zinc was determined using the following equation [11,18] and a
dissociation constant for the zinc-eCalwy-5-complex of 1.85 nM [9]: [Zinc]=Kd ×
[(Rapo−Rmax)/(Rmin−Rapo) × (Sf2/Sb2)]. The proportionality coefficients Sf2 and Sb2 are
corresponding to the emission intensities of the free and bound forms of the sensor at 532
nm.
4.2.11 Fluorescence Lifetime Imaging Microscopy (FLIM)-FRET
FLIM-measurements were performed with Caco-2-eCalwy cells using a multiphoton LSM510-
META microscope equipped with a time resolved LSM upgrade setup (Becker&Hickl,
Germany). FLIM of the donor-domain cerulean was measured in buffer and in the presence
of 20 μM TPEN or 400 μM zinc (40×/1.3 oil objective, λex =810 nm, 450–490 nm band pass
filter). To analyze FLIM of cerulean in the absence of the acceptor domain mCitrine, Caco-2-
WT clones were transfected with a cerulean-construct. FLIM data were analyzed using the
SPC Image software from Becker&Hickl and FRET-efficiency was calculated using the
following equation: E(%)=(1−(τDA/τD)) × 100, where τDA is the fluorescence lifetime of the
donor-domain cerulean in intact eCalwy-protein and τD in the absence of mCitrine.
4.2.12 Statistical Analysis
Statistical significance was analyzed by Student’s t-test (for paired samples), or one- or two-
way analysis of variance (ANOVA) (for multiple comparisons), followed by Bonferroni or
Dunnett’s multiple comparison post hoc tests, as indicated in the respective figure legends,
using GraphPad Prism software version 5.01 (GraphPad Software Inc., CA, USA). Error bars
represent standard deviation of three independent biological replicates.
4.3 Results
4.3.1 Characteristic Cellular Features
To ensure the presence of characteristic features of the intestinal cell line Caco-2 after
introduction of eCalwy-plasmids, cell differentiation, morphology, as well as barrier integrity
were investigated. First, activity and expression of the differentiation marker alkaline
phosphatase were compared. Both cells expressed large amounts of functional ALP;
![Page 61: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/61.jpg)
Characterization of Caco-2 cells Stably Expressing the Protein-based Zinc Probe eCalwy-5 as a Model System for Investigating Intestinal Zinc Transport
45
however, ALP-activity and -expression by Caco-2-eCalwy were significantly lower (each p <
0.001, Figure 4.1) compared to wild type cells.
Figure 4.1: Alkaline phosphatase (ALP) in Caco-2-WT and Caco-2-eCalwy cells.
(A) Enzyme activity in differentiated cells was measured using an ALP-assay and is displayed relative to cellular protein. (B) Relative alp expression in differentiated cells was analyzed using qPCR. Data are shown as means + SD of three independent experiments. Means of each cell clone are significantly different as indicated (***p < 0.001, Student’s t-test).
Ultrastructure comparison by TEM detected no remarkable differences in brush border
formation. Figure 4.2 shows the distribution of mitochondria, lysosomes, desmosomes,
nexus and tight junctions, and microvilli of about 500–1000 nm length in differentiated cells.
Notably, TEM images revealed the presence of more lysosomal structures in Caco-2-eCalwy.
SEM images show the characteristic columnar shape of differentiated Caco-2 cells and
evenly distributed microvilli on the surface of both cell clones (Figure 4.3).
![Page 62: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/62.jpg)
Characterization of Caco-2 cells Stably Expressing the Protein-based Zinc Probe eCalwy-5 as a Model System for Investigating Intestinal Zinc Transport
46
Figure 4.2: Transmission electron micrographs.
Differentiated Caco-2-WT clones (A) and Caco-2-eCalwy (B) were analyzed for typical features of the brush border (BB) of intestinal cells, showing microvilli (MV) of 500–1000 nm length. Tight junctions (TJ), desmosomes (D), nexus (Nx), mitochondria (M), lysosomes (L) and nuclei (N) are indicated. Scale bar 1000 nm.
![Page 63: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/63.jpg)
Characterization of Caco-2 cells Stably Expressing the Protein-based Zinc Probe eCalwy-5 as a Model System for Investigating Intestinal Zinc Transport
47
Figure 4.3: Scanning electron microscope images.
Shown are the apical surface of Caco-2-WT (A, B) and Caco-2-eCalwy clones (C, D). Both cells display characteristic columnar shape (A, C) and microvilli formation (B, D). Scale bars 2 μm (B, D) and 10 μm (A, C).
Barrier integrity, measured as TEER, did not differ between the two cell clones
(Supplemental Figure S4.1). Tight junction formation was analyzed using immunofluorescent
staining of selected proteins: claudin-2, occludin, ZO-1 and E-cadherin (Figure 4.4 and
Supplemental Figure S4.2) to investigate whether stable transfection with eCalwy-5 had
affected their distribution.
![Page 64: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/64.jpg)
Characterization of Caco-2 cells Stably Expressing the Protein-based Zinc Probe eCalwy-5 as a Model System for Investigating Intestinal Zinc Transport
48
Figure 4.4: Localization of tight junction proteins.
Fluorescence imaging was conducted using a confocal laser scanning microscope, showing results for differentiated Caco-2-WT (upper panel) and Caco-2-eCalwy (lower panel) cells. Shown are selected images of Caco-2-WT and -eCalwy clones after immunofluorescent staining of claudin-2 (A, E), occludin (B, F), zonola occludens-1 (ZO-1) (C, G) and E-cadherin (D, H) of two independent experiments. Scale bar 5 μm.
Immunofluorescent images in Figure 4.4 show the intracellular distribution of the tight
junction proteins as x-y-scans and Supplemental Figure S4.2 additionally depicts tight
junction localization as z-scans together with stained nuclei. Localization and generation of
claudin-2 and ZO-1 were not altered. Staining of claudin-2 revealed a membranous and
cytoplasmic localization as well as a nuclear enrichment in Caco-2-WT and -eCalwy cells. In
both cases, the peripheral protein ZO-1 displayed a homogenous localization in the
cytoplasmic membrane. In contrast, immunofluorescent images of occludin and E-cadherin
revealed slight differences. Occludin is located in the plasma membrane of Caco-2-WT,
whereas it shows tendencies of a lateral staining, with decreasing sensitivity from apical to
basolateral membrane, in Caco-2-eCalwy (Figure 4.4B,F and Supplemental Figure S4.2B,F).
Imaging of E-cadherin revealed membranous distribution and vesicular accumulation of this
protein in Caco-2-WT, whilst in eCalwy transfected cells E-cadherin was mostly found in the
apical cell membrane with only a slight vesicular localization (Figure 4.4D,H and
Supplemental Figure S4.2D,H).
![Page 65: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/65.jpg)
Characterization of Caco-2 cells Stably Expressing the Protein-based Zinc Probe eCalwy-5 as a Model System for Investigating Intestinal Zinc Transport
49
4.3.2 Zinc Homeostasis
The introduction of an additional zinc binding protein into Caco-2 cells might change zinc
homeostasis in the stably transfected cell clone, potentially enhancing the resistance against
elevated zinc concentrations, or increasing the requirement for zinc during growth and
differentiation. Thus, viabilities of differentiated Caco-2-WT and -eCalwy after incubation
with 0–1000 μM zinc for 24 h were compared by measuring mitochondrial activity (Figure
4.5A,B). In contrast to Caco-2-WT, the Caco-2-eCalwy cells had higher LC50 values in MTT
(865 μM vs. 394 μM for wildtype) and WST assays (803 μM vs. 427 μM for wildtype).
Figure 4.5: Zinc-toxicity on differentiated Caco-2-WT and -eCalwy.
Cells were treated with different zinc concentrations for 24 h and mitochondrial activity was analyzed using two different assays based on the tetrazolium salts MTT (A) and WST-8 (B). A total of 0.01% Triton X-100 was used as positive control. Data are shown as means ± SD of three independent experiments. Sigmoidal dose-response curves were fitted by nonlinear regression and means significantly different from the untreated controls are indicated (**p < 0.01; ***p < 0.001; one-way ANOVA with Dunnett’s multiple comparison test).
![Page 66: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/66.jpg)
Characterization of Caco-2 cells Stably Expressing the Protein-based Zinc Probe eCalwy-5 as a Model System for Investigating Intestinal Zinc Transport
50
Furthermore, cellular protein content after differentiation in the presence of different zinc
concentrations was analyzed (Figure 4.6). The amounts did not change in Caco-2-WT,
whereas addition of 5 and 10 μM zinc to the culture media led to a slight but significant
increase in Caco-2-eCalwy.
Figure 4.6: Effect of zinc on cellular protein levels.
Caco-2-WT and -eCalwy cells were cultivated for 21 d with different concentrations of zinc added to
the culture medium, and protein content was analyzed using the SRB assay. Data are shown as
means + SD of three independent experiments. Significant differences are indicated (*p < 0.05; **p <
0.01; two-way ANOVA with Bonferroni post hoc test).
The expression of proteins important for zinc homeostasis in enterocytes, such as
metallothionein 1a (mt1a) and the zinc transporters zip4, zip5, znt-1 and znt-5, were
examined (Figure 4.7). eCalwy-5 did not affect mRNA expression of zinc transporters, but
significantly elevated mt1a-expression (p < 0.05) by 20%. In contrast, there were no
significant differences in basal cellular zinc levels between Caco-2-WT and -eCalwy cells
(Figure 4.7B).
![Page 67: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/67.jpg)
Characterization of Caco-2 cells Stably Expressing the Protein-based Zinc Probe eCalwy-5 as a Model System for Investigating Intestinal Zinc Transport
51
Figure 4.7: Zinc homeostasis in Caco-2-WT and -eCalwy.
(A) Gene expression of proteins involved in zinc-homeostasis in differentiated Caco-2-WT and Caco-2-eCalwy clones was analyzed by qPCR. (B) Basal zinc content of differentiated Caco-2-WT and Caco-2-eCalwy clones was analyzed using FAAS. Data are shown as means + SD of three independent experiments. Significant differences between the two cell clones are indicated (*p < 0.05; Student’s t-test).
4.3.3 Functionality and Application
Cellular distribution of the sensor-protein in Caco-2-eCalwy cells was analyzed by live cell
fluorescent imaging, using a confocal laser scanning microscope. Fluorescence images show
the cytoplasmic localization of the two fluorescent domains cerulean (Figure 4.8A) and
mCitrine (Figure 4.8B), as well as the occurrence of FRET (Figure 4.8C) in resting Caco-2-
eCalwy cells. Notably, there is considerable intercellular heterogeneity in biosensor-
expression. This was also confirmed by frequency distribution analysis of the mCitrine-
concentration in different Caco-2-eCalwy cells. Because fluorescence of the acceptor-domain
mCitrine after direct excitation at 514 nm is independent of zinc binding [19], its
fluorescence signal is directly proportional to the sensor-concentration. mCitrine
measurements revealed a wide range of sensor-expression within different cells of the same
clone (Figure 4.8D).
![Page 68: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/68.jpg)
Characterization of Caco-2 cells Stably Expressing the Protein-based Zinc Probe eCalwy-5 as a Model System for Investigating Intestinal Zinc Transport
52
Figure 4.8: Life cell imaging.
(A–C) Cellular distribution of sensor-protein in Caco-2-eCalwy cells was analyzed by fluorescence live cell imaging using a confocal laser scanning microscope. Shown are fluorescence images of (A) cerulean emission (λex=458 nm; λem=462 nm–496 nm), (B) mCitrine emission (λex=514 nm; λem=526 nm–590 nm) and (C) FRET, not corrected for spectral bleed-trough (λex=458 nm; λem=526 nm–590 nm). Scale bar 50 μm. (D) Frequency distribution of eCalwy-sensor concentration in Caco-2-eCalwy cells, analyzed by direct excitation of mCitrine (λex=458 nm; λem=527 nm).
Due to high background fluorescence and light scattering, the sensitivity of confocal
microscopy was insufficient for quantification of free zinc in the stably transfected Caco-2-
eCalwy clone. As this was not the case with multiphoton laser scanning microscopy, further
FRET-measurements were performed using two photon excitation.
![Page 69: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/69.jpg)
Characterization of Caco-2 cells Stably Expressing the Protein-based Zinc Probe eCalwy-5 as a Model System for Investigating Intestinal Zinc Transport
53
Figure 4.9: Two photon microscopy.
(A) Emission spectra of Caco-2-eCalwy in the presence of TPEN (20 μM) or zinc (400 μM). (B) Fluorescence lifetime of FRET-donor domain cerulean of eCalwy-biosensor in Caco-2-eCalwy. Fluorescence halftime is shown for the donor in the absence of the acceptor-domain (cerulean), in resting states (buffer) and after addition of zinc. Data are shown as means + SD of three independent experiments. Significant differences between the fluorophore-lifetimes under the different conditions are indicated (***p < 0.001; ANOVA followed by Bonferroni’s multiple comparison test). (C) FRET-efficiency of eCalwy-5 in Caco-2-eCalwy cells based on FLIM-FRET-data compared to theoretical calculations using fluorescence intensities. (D) Impact of cellular sensor-expression level on zinc-saturation of the sensor. Shown is the correlation of fluorescence emission ratio (mCitrine/cerulean) and eCalwy-sensor expression, depicted as mCitrine fluorescence when directly excited at 514 nm (λem=532 nm) using a multiphoton laser scanning microscope.
Figure 4.9A compares normalized FRET-emission spectra of Caco-2-eCalwy cells after zinc-
depletion by TPEN or addition of excess zinc, showing a twofold decrease in fluorescence of
mCitrine in response to saturation with zinc. Next, sensor-efficiency after stable transfection
and performance of the eCalwy sensor after two photon excitation were investigated using
two different approaches: FLIM-FRET based on lifetimes of the donor fluorophore, and
theoretical photobleaching using fluorescence intensities. FLIM-FRET analysis confirmed
proper function of the eCalwy probe after stable transfection into Caco-2-eCalwy (Figure
4.9B). Fluorescence lifetime of the donor-domain (τDA) cerulean increased significantly after
zinc addition (one-way ANOVA, p < 0.001). Besides, a significant difference between τD
(fluorescence lifetime of the donor in the absence of the acceptor-domain mCitrine) and in
![Page 70: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/70.jpg)
Characterization of Caco-2 cells Stably Expressing the Protein-based Zinc Probe eCalwy-5 as a Model System for Investigating Intestinal Zinc Transport
54
τDA was observed. FRET-efficiency is defined as the amount of energy that is transferred from
donor to acceptor-domain after excitation [20]. Calculated FRET-efficiencies based on
fluorescence lifetime and the actual fluorescence intensities are in good agreement (Figure
4.9C), with an energy transfer of about 60% in the resting state (buffer) and 40% after
addition of zinc. Finally, the correlation of sensor-concentration and FRET-ratio was
examined with multiphoton microscopy. Despite differences in sensor concentrations of
more than one order of magnitude (measured by directly exciting the mCitrine-domain),
there was no correlation with the FRET-emission ratio (Figure 4.9D). Linear regression
analysis of these data provided additional confirmation that the slope is not significantly
different from zero. This demonstrates that the expression level of the eCalwy-biosensor had
no effect on fractional probe-saturation with zinc.
4.4 Discussion and Conclusion
Several zinc-FRET-biosensors, such as eCalwy, eZinch, and ZapCy2, have been created and
were used in various different cell types, but until now only after transient transfection
[19,21–24]. This study describes a Caco-2 cell clone stably expressing the zinc-biosensor
eCalwy- 5. Several approaches were applied to reassure enterocyte specific properties,
including morphological characterization as well as investigating the maintenance of the
intestinal barrier integrity, especially tight junction formation and epithelial resistance,
which need to be considered when using intestinal cell models [25]. ALP-activity is a marker
for intestinal cell differentiation and its increasing activity during differentiation of Caco-2
cells was demonstrated before [12]. Moreover, the dependence of intestinal ALP-activity on
zinc availability is well known [26] and might be reflected in Caco-2-eCalwy. Differences in
ALP-expression and -activity were observed in the present study, with the ALP-activity of
Caco-2-eCalwy being only 50% of that measured in Caco-2-WT. Yet, the activity in Caco-2-
eCalwy is still one order of magnitude higher than levels observed in other differentiated
intestinal cell lines [27], indicating successful differentiation.
A morphology characteristic for the intestinal brush border membrane was still present after
stable transfection of the FRET-biosensor into Caco-2 cells, and is comparable to previous
studies with Caco-2-WT cells [27–29]. Comparison of Caco-2-WT and Caco-2-eCalwy clones
revealed only slight differences regarding subcellular localization of the tight junction protein
occludin, which did not affect basic integrity of the intestinal barrier. Tight junction proteins
play a key role in creating a selective transport barrier and maintain cell polarity, while
guaranteeing a certain permeability [30]. Claudin-2 is important for paracellular ion
permeability and was reported to decrease tightness of the epithelial barrier [31] and to be
localized in plasma membrane and cytoplasm of Caco-2-WT cells [32]. The peripheral tight
junction protein ZO-1 is crucial for assembly of tight junctions and binds to the
transmembrane protein occludin [33]. While both cell clones show typical localization of ZO-
1 [33], distribution of occludin in Caco-2-eCalwy differs from Caco-2-WT and observations in
previous studies [32,33]. An increase in occludin-expression might elevate TEER and thus
could affect the tightness of epithelium [34]. However, no differences in TEER between the
![Page 71: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/71.jpg)
Characterization of Caco-2 cells Stably Expressing the Protein-based Zinc Probe eCalwy-5 as a Model System for Investigating Intestinal Zinc Transport
55
two cell clones were observed. The vesicular distribution of E-cadherin in Caco-2-WT clones
is no artifact caused by the experimental conditions, because it was not observed in Caco-2-
eCalwy cells incubated in parallel. Possibly, excess E-cadherin is internalized in Caco-2-WT
cells and E-cadherin-expression in Caco-2-eCalwy is lower as a result of the transfection.
Nevertheless, localization and expression of E-cadherin and occludin were shown to be zinc-
dependent [33], thus the differences between the two cell clones could also be explained by
the introduction of the additional zinc binding eCalwy-protein. However, E-cadherin is still
evenly distributed at the cell-cell junction membrane of both cell clones, where it plays an
important role in cell-cell adhesion during Caco-2 cell differentiation [35]. Taken together,
important features of the intestinal cell line Caco-2 were largely preserved during stable
transfection.
Intracellular free zinc is regulated by zinc binding proteins, such as MT, maintaining free zinc
concentrations in the low or even sub-nanomolar range [36]. Thus, the expression of an
additional zinc binding protein, such as eCalwy-5, might interfere with cellular zinc
homeostasis, possibly by buffering zinc. Accordingly, investigations of acute zinc toxicity
revealed that Caco-2-eCalwy cells were more resistant to high zinc concentrations. We also
analyzed the effect of long term administration of sub-toxic concentrations of zinc in
addition to the basal content of cell culture medium of 3 μM. Caco-2-WT cells were
unaffected, whereas Caco-2-eCalwy seem to require more zinc during differentiation, since
the protein level was higher after cultivation in the presence of additional zinc. This indicates
that the development of Caco-2-eCalwy cells is already significantly enhanced when
cultivated with a 2.7-fold higher zinc concentration. However, the transfection of eCalwy-
protein showed only slight effects on intracellular zinc homeostasis, as expression of major
intestinal zinc transporters was not impaired, the basal cellular zinc content did not differ,
and only mt1a-expression was elevated in Caco-2-eCalwy. More precisely, the zinc
transporters ZIP4, ZIP5, ZnT-5 and ZnT-1 play a key role in intestinal zinc resorption and
together with proteins of the MT-family these transporters are important for maintaining
intracellular zinc homeostasis [37]. The slightly elevated mt1a-expression in Caco-2-eCalwy
clones might therefore also be a reason for the increased resistance against acute zinc
toxicity.
Finally, performance of the zinc-biosensor in Caco-2-eCalwy clones and cellular distribution
as well as the effect of its expression-level was investigated. Beforehand, sensor-activity had
to be scrutinized, since it is well known that the use of multi photon microscopy for sensors
created for one photon approaches is not always working properly [38]. FLIM-FRET-
measurements confirmed a proper and efficient function of the stably transfected eCalwy-
protein. Due to the off-FRET, τDA increases after zinc-addition, because of the decreased
energy transfer to the acceptor-domain. Notably, τDA in the presence of zinc did not reach
the full amount of τD. This is not surprising, as some remaining energy transfer to the
acceptor-domain is always present in the FRET-sensor, even after conformational change
due to zinc binding [9]. In this manner, correct functionality of the eCalwy-sensor after stable
transfection into Caco-2 and by two-photon excitation was confirmed as well.
![Page 72: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/72.jpg)
Characterization of Caco-2 cells Stably Expressing the Protein-based Zinc Probe eCalwy-5 as a Model System for Investigating Intestinal Zinc Transport
56
Fluorescence cell imaging showed no organelle-specific distribution of the eCalwy-protein
but indicated considerable intercellular heterogeneity in expression of the FRET-biosensor.
Quantification of free zinc in the resting state yielded a concentration of ∼2 nM, which is in
line with previous studies analyzing free zinc with low molecular weight sensors in the
intestinal cell line HT29 [39] and other cell lines [40]. It is well known that the introduction of
a zinc binding molecule into cells can perturb cellular zinc homeostasis, which might lead to
a disturbance of the cellular equilibria of free and bound zinc [39,41]. Thus the intracellular
sensor-concentration must be as low as possible, particularly when analyzing cellular free
zinc using synthetic probes, where sensor-concentration was shown to be critical for zinc-
quantification [39,42]. However, it remains to be fully understood inasmuch the expression
of genetically encoded zinc-sensors impacts zinc-quantification. The expression-level of the
eCalwy-biosensor in stably transfected Caco-2-eCalwy cells had no effect on the FRET-ratio.
A comparable observation was also reported by Qin et al., where different concentrations of
the transiently transfected FRET-biosensor ZapCY2 had no influence on percental saturation
of the sensor molecule in Hela cells [24]. Furthermore, in that study, the ZapCY2-sensor was
expressed in nucleus and cytoplasm of Hela cells, while Caco-2-eCalwy revealed an even
cytoplasmic distribution of the biosensor. In fact, intracellular biosensor-concentrations
were estimated to be 1–10 μM [24], which is considerably lower compared to the reported
millimolar concentrations of low molecular weight-sensors in cells [41]. Certainly, final low
molecular weight sensor-concentration is dependent on its subcellular distribution and
volume of the cellular compartment where it accumulates [40], whereas biosensor-
concentrations are controlled by their expression and the effect of different expression-
levels on their subcellular concentration is yet unknown. Thus, it might be that because both
biosensors are localized in the cytoplasm of the cells and not in a smaller organelle, the
sensor-concentration was not sufficiently high to influence cellular labile zinc. However,
there are several zinc biosensors with organelle-specific targeting [19,21–23]. Therefore it is
certainly necessary to further investigate the effect of cellular expression of those organelle-
specific biosensors on the quantification of free zinc.
This study describes a well characterized stable Caco-2 cell clone expressing the eCalwy-5
FRET-sensor, which can be used to investigate intestinal zinc resorption. It also highlights the
importance of reassuring characteristic features of wildtype cells in the transfected cell
clones, as well as the investigation of possible changes in zinc-homeostasis when stably
transfecting zinc-biosensors. Furthermore, it is not only crucial to characterize subcellular
distribution of the biosensor but also to check the impact of sensor-expression on its zinc-
saturation.
4.5 Conflict of Interest
The authors declare they have no conflict of interest.
![Page 73: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/73.jpg)
Characterization of Caco-2 cells Stably Expressing the Protein-based Zinc Probe eCalwy-5 as a Model System for Investigating Intestinal Zinc Transport
57
4.6 Funding
The work of HH is supported by the Deutsche Forschungsgemeinschaft (TraceAge – DFG
Research Unit on Interactions of essential trace elements in healthy and diseased elderly,
Potsdam-Berlin-Jena, FOR 2558/1, HA 4318/4-1).
4.7 References
1. Maares, M.; Haase, H. Zinc and immunity: An essential interrelation. Arch. Biochem.
Biophys. 2016, 611, 58-65.
2. Ford, D. Intestinal and placental zinc transport pathways. Proc. Nutr. Soc. 2004, 63,
21-29.
3. Cousins, R.J.; Liuzzi, J.P.; Lichten, L.A. Mammalian zinc transport, trafficking, and
signals. J. Biol. Chem. 2006, 281, 24085-24089.
4. Maret, W.; Sandstead, H.H. Zinc requirements and the risks and benefits of zinc
supplementation. J. Trace Elem. Med. Biol. 2006, 20, 3-18.
5. Wang, X.; Zhou, B. Dietary zinc absorption: A play of ZIPs and ZnTs in the gut. IUBMB
life 2010, 62, 176-182.
6. Cerchiaro, G.; Manieri, T.M.; Bertuchi, F.R. Analytical methods for copper, zinc and
iron quantification in mammalian cells. Metallomics 2013, 5, 1336-1345.
7. Carter, K.P.; Young, A.M.; Palmer, A.E. Fluorescent sensors for measuring metal ions
in living systems. Chem. Rev. 2014, 114, 4564-4601.
8. Huang, Z.; Lippard, S.J. Illuminating mobile zinc with fluorescence: From cuvettes to
live cells and tissues. Methods Enzymol. 2012, 505, 445-468.
9. Vinkenborg, J.L.; Nicolson, T.J.; Bellomo, E.A.; Koay, M.S.; Rutter, G.A.; Merkx, M.
Genetically encoded FRET sensors to monitor intracellular Zn2+ homeostasis. Nat.
Methods 2009, 6, 737-740.
10. Hessels, A.M.; Merkx, M. Genetically-encoded FRET-based sensors for monitoring
Zn2+ in living cells. Metallomics 2014, 7, 258-266.
11. Carpenter, M.C.; Lo, M.N.; Palmer, A.E. Techniques for measuring cellular zinc. Arch.
Biochem. Biophys. 2016, 611, 20-29.
12. Ferruzza, S.; Rossi, C.; Scarino, M.L.; Sambuy, Y. A protocol for in situ enzyme assays
to assess the differentiation of human intestinal Caco-2 cells. Toxicol. In Vitro 2012,
26, 1247-1251.
13. Smith, P.K.; Krohn, R.I.; Hermanson, G.T.; Mallia, A.K.; Gartner, F.H.; Provenzano,
M.D.; Fujimoto, E.K.; Goeke, N.M.; Olson, B.J.; Klenk, D.C. Measurement of protein
using bicinchoninic acid. Anal. Biochem. 1985, 150, 76-85.
14. Vichai, V.; Kirtikara, K. Sulforhodamine b colorimetric assay for cytotoxicity screening.
Nat. Protocols 2006, 1, 1112-1116.
15. Leung, K.W.; Liu, M.; Xu, X.; Seiler, M.J.; Barnstable, C.J.; Tombran-Tink, J. Expression
of ZnT and ZIP zinc transporters in the human RPE and their regulation by
neurotrophic factors. Invest. Ophthalmol. Vis. Sci.2008, 49, 1221-1231.
![Page 74: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/74.jpg)
Characterization of Caco-2 cells Stably Expressing the Protein-based Zinc Probe eCalwy-5 as a Model System for Investigating Intestinal Zinc Transport
58
16. Overbeck, S.; Uciechowski, P.; Ackland, M.L.; Ford, D.; Rink, L. Intracellular zinc
homeostasis in leukocyte subsets is regulated by different expression of zinc
exporters ZnT-1 to ZnT-9. J. Leukoc. Biol. 2008, 83, 368-380.
17. Wolf, K.; Schulz, C.; Riegger, G.A.J.; Pfeifer, M. Tumour necrosis factor‐α induced
CD70 and interleukin‐7R mRNA expression in beas‐2b cells. Eur. Respir. J.2002, 20,
369-375.
18. Grynkiewicz, G.; Poenie, M.; Tsien, R.Y. A new generation of Ca2+ indicators with
greatly improved fluorescence properties. J. Biol. Chem. 1985, 260, 3440-3450.
19. Dittmer, P.J.; Miranda, J.G.; Gorski, J.A.; Palmer, A.E. Genetically encoded sensors to
elucidate spatial distribution of cellular zinc. J. Biol. Chem. 2009, 284, 16289-16297.
20. Wallrabe, H.; Periasamy, A. Imaging protein molecules using FRET and FLIM
microscopy. Curr. Opin. Chem. Biol. 2005, 16, 19-27.
21. Chabosseau, P.; Tuncay, E.; Meur, G.; Bellomo, E.A.; Hessels, A.; Hughes, S.; Johnson,
P.R.; Bugliani, M.; Marchetti, P.; Turan, B.; Lyon, A.R.; Merkx, M.; Rutter, G.A.
Mitochondrial and ER-targeted eCalwy probes reveal high levels of free Zn2+. ACS
Chem. Biol. 2014, 9, 2111-2120.
22. Hessels, A.M.; Chabosseau, P.; Bakker, M.H.; Engelen, W.; Rutter, G.A.; Taylor, K.M.;
Merkx, M. eZinch-2: A versatile, genetically encoded FRET sensor for cytosolic and
intraorganelle Zn2+ imaging. ACS Chem. Biol. 2015, 10, 2126-2134.
23. Qin, Y.; Dittmer, P.J.; Park, J.G.; Jansen, K.B.; Palmer, A.E. Measuring steady-state and
dynamic endoplasmic reticulum and Golgi Zn2+ with genetically encoded sensors.
Proc. Natl. Acad. Sci. USA 2011, 108, 7351-7356.
24. Qin, Y.; Miranda, J.G.; Stoddard, C.I.; Dean, K.M.; Galati, D.F.; Palmer, A.E. Direct
comparison of a genetically encoded sensor and small molecule indicator:
Implications for quantification of cytosolic Zn2+. ACS Chem. Biol. 2013, 8, 2366-2371.
25. Le Ferrec, E.; Chesne, C.; Artusson, P.; Brayden, D.; Fabre, G.; Gires, P.; Guillou, F.;
Rousset, M.; Rubas, W.; Scarino, M.L. In vitro models of the intestinal barrier. The
report and recommendations of ecvam workshop 46. European centre for the
validation of alternative methods. Altern. Lab. Anim.2001, 29, 649-668.
26. Williams, R.B. Intestinal alkaline phosphatase and inorganic pyrophosphatase
activities in the zinc-deficient rat. Br. J. Nutr. 1972, 27, 121-130.
27. Pinto, M.; Robineleon, S.; Appay, M.D.; Kedinger, M.; Triadou, N.; Dussaulx, E.;
Lacroix, B.; Simonassmann, P.; Haffen, K.; Fogh, J.; Zweigbaum, A. Enterocyte-like
differentiation and polarization of the human-colon carcinoma cell-line Caco-2 in
culture. Biol.Cell 1983, 47, 323-330.
28. Schimpel, C.; Werzer, O.; Frohlich, E.; Leitinger, G.; Absenger-Novak, M.; Teubl, B.;
Zimmer, A.; Roblegg, E. Atomic force microscopy as analytical tool to study physico-
mechanical properties of intestinal cells. Beilstein J. Nanotechnol. 2015, 6, 1457-1466.
29. Biazik, J.M.; Jahn, K.A.; Su, Y.; Wu, Y.-N.; Braet, F. Unlocking the ultrastructure of
colorectal cancer cells in vitro using selective staining. World J. Gastroenterol. 2010,
16, 2743-2753.
![Page 75: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/75.jpg)
Characterization of Caco-2 cells Stably Expressing the Protein-based Zinc Probe eCalwy-5 as a Model System for Investigating Intestinal Zinc Transport
59
30. Günzel, D.; Yu, A.S.L. Claudins and the modulation of tight junction permeability.
Physiol. Rev. 2013, 93, 525-569.
31. Amasheh, S.; Fromm, M.; Günzel, D. Claudins of intestine and nephron – a correlation
of molecular tight junction structure and barrier function. Acta Physiol. 2011, 201,
133-140.
32. Fischer, A.; Gluth, M.; Weege, F.; Pape, U.-F.; Wiedenmann, B.; Baumgart, D.C.;
Theuring, F. Glucocorticoids regulate barrier function and claudin expression in
intestinal epithelial cells via mkp-1. Am. J. Physiol. Gastrointest. Liver Physiol. 2014,
306, G218-G228.
33. Finamore, A.; Massimi, M.; Conti Devirgiliis, L.; Mengheri, E. Zinc deficiency induces
membrane barrier damage and increases neutrophil transmigration in Caco-2 cells. J.
Nutr. 2008, 138, 1664-1670
34. McCarthy, K.M.; Skare, I.B.; Stankewich, M.C.; Furuse, M.; Tsukita, S.; Rogers, R.A.;
Lynch, R.D.; Schneeberger, E.E. Occludin is a functional component of the tight
junction. J. Cell Sci. 1996, 109, 2287-2298.
35. Schreider, C.; Peignon, G.; Thenet, S.; Chambaz, J.; Pinçon-Raymond, M. Integrin-
mediated functional polarization of caco-2 cells through e-cadherin-actin
complexes. J. Cell Sci. 2002, 115, 543-552.
36. Maret, W. Molecular aspects of human cellular zinc homeostasis: Redox control of
zinc potentials and zinc signals. BioMetals 2009, 22, 149 - 157.
37. Murakami, M.; Hirano, T. Intracellular zinc homeostasis and zinc signaling. Cancer Sci.
2008, 99, 1515-1522.
38. Day, R.N.; Tao, W.; Dunn, K.W. A simple approach for measuring FRET in fluorescent
biosensors using two-photon microscopy. Nat. Protocols 2016, 11, 2066-2080.
39. Krężel, A.; Maret, W. Zinc-buffering capacity of a eukaryotic cell at physiological pZn.
J. Biol. Inorg. Chem. 2006, 11, 1049-1062.
40. Maret, W. Analyzing free zinc(II) ion concentrations in cell biology with fluorescent
chelating molecules. Metallomics 2015, 7, 202-211.
41. Dineley, K.E.; Malaiyandi, L.M.; Reynolds, I.J. A reevaluation of neuronal zinc
measurements: Artifacts associated with high intracellular dye concentration. Mol.
Pharmacol. 2002, 62, 618-627.
42. Haase, H.; Hebel, S.; Engelhardt, G.; Rink, L. Flow cytometric measurement of labile
zinc in peripheral blood mononuclear cells. Anal. Biochem. 2006, 352, 222-230.
![Page 76: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/76.jpg)
60
![Page 77: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/77.jpg)
The Impact of Apical and Basolateral Albumin on Intestinal Zinc Resorption in the Caco-2/HT-29-MTX Co-culture Model,
61
Chapter 5. The Impact of Apical and Basolateral Albumin on
Intestinal Zinc Resorption in the Caco-2/HT-29-MTX Co-culture
Model3,4
Abstract
The molecular mechanisms of intestinal zinc resorption and its regulation are still topic of
ongoing research. To this end, the application of suitable in vitro intestinal models, optimized
with regard to their cellular composition and medium constituents, is of crucial importance.
As one vital aspect, the impact of cell culture media or buffer compounds, respectively, on the
speciation and cellular availability of zinc has to be considered when investigating zinc
resorption. Thus, the present study aims to investigate the impact of serum, and in particular
its main constituent serum albumin, on zinc uptake and toxicity in the intestinal cell line
Caco-2. Furthermore, the impact of serum albumin on zinc resorption is analyzed using a co-
culture of Caco-2 cells and the mucin-producing goblet cell line HT-29-MTX. Apically added
albumin significantly impaired zinc uptake into enterocytes and buffered its cytotoxicity. Yet,
undigested albumin does not occur in the intestinal lumen in vivo and impairment of zinc
uptake was abrogated by digestion of albumin. Interestingly, zinc uptake, as well as gene
expression studies of mt1a and selected intestinal zinc transporters after zinc incubation for
24 h, did not show significant differences between 0 and 10% serum. Importantly, the
basolateral application of serum in a transport study significantly enhanced fractional apical
zinc resorption, suggesting that the occurrence of a zinc acceptor in the plasma considerably
affects intestinal zinc resorption. This study demonstrates that the apical and basolateral
medium composition is crucial when investigating zinc, particularly its intestinal resorption,
using in vitro cell culture.
3 The following article is the accepted version and appears as journal version in:
Maria Maares, Ayşe Duman, Claudia Keil, Tanja Schwerdtle, Hajo Haase. "The impact of apical and basolateral albumin on intestinal zinc resorption in the Caco-2/HT-29-MTX co-culture model." Metallomics 2018. 10(7): 979-991, DOI: 10.1039/C8MT00064F. 4 Reproduced by permission of The Royal Society of Chemistry;
https://doi.org/10.1039/C8MT00064F https://pubs.rsc.org/en/Content/ArticleLanding/2018/MT/C8MT00064F#!divAbstract
![Page 78: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/78.jpg)
The Impact of Apical and Basolateral Albumin on Intestinal Zinc Resorption in the Caco-2/HT-29-MTX Co-culture Model,
62
5.1 Introduction
Human zinc homeostasis is tightly regulated, mainly by the resorption and excretion of zinc
[1]. Zinc is resorbed from food in the small intestine, where it is transported into enterocytes
mainly by the Zrt-, Irt-like protein (ZIP)-4 (SLC39A4) and exported into the blood via zinc
transporter (ZnT)-1 (SLC30A1) at the basolateral enterocyte membrane. Further important
intestinal zinc transporters are ZIP-5 (SLC39A5), transporting zinc from the blood back into
the enterocytes, and ZnT-5 (SLC30A5), which is localized at the apical membrane and
mediates zinc efflux back into the intestinal lumen [2]. In spite of recent advances in
investigating regulatory parameters of intestinal zinc resorption, particularly the role of the
intestinal zinc transporters and the zinc binding protein metallothionein in maintaining
enterocyte zinc homoeostasis, the distinct molecular mechanisms that regulate intestinal
zinc transport remain to be fully understood [3].
Thus, suitable in vitro intestinal models are needed to further scrutinize distinct parameters
of zinc resorption. More precisely, these in vitro models need to be as close to the in vivo
situation as possible, with respect to their cellular composition as well as the apical and
basolateral matrix [4,5]. The human intestinal epithelium is composed of several different
cell types, among which enterocytes and goblet cells are the most abundant [6]. Caco-2 is
widely used as an in vitro cell model to mimic the intestinal epithelium [5]. The cells
differentiate after some time in confluent culture into a phenotype that, morphologically
and functionally, resembles that of human enterocytes [7,8]. Monocultures of Caco-2 cells
were used previously to investigate zinc resorption kinetics in the intestines [9,10], the
impact of food components on fractional zinc resorption [11,12] and enterocyte zinc
homeostasis [13–15]. In contrast, the co-culture of Caco-2 and the mucin-producing cell line
HT-29-MTX has never been used to study zinc resorption before, but has been shown to
offer various benefits compared to conventional Caco-2 monocultures [16,17]. Co-cultures
with HT-29-MTX were reported to particularly modify the permeability of the cell
monolayers [17,18], especially with respect to the Pgp-protein, which is highly expressed in
conventional Caco-2 monocultures [17]. More importantly, Caco-2 monocultures lack the
presence of an intestinal mucus layer [19], which covers the intestinal epithelium in vivo and
is constituted of about 1-5% mucins [20]. In fact, these mucins are secreted by the goblet cell
line HT-29-MTX in the co-cultures and were shown to play an important role in the
resorption of other trace elements such as iron [19].
Although some studies used special assay buffers for the apical application of zinc, the
basolateral composition in transport studies was rarely acknowledged. With respect to the
media composition, it is particularly relevant to consider the occurrence of macromolecules
with high zinc binding affinities, which tremendously decrease the actual free zinc
concentration. In this context, it has to be noted that there is no such thing as actual free
zinc in biological systems, but the terms ‘‘free’’, ‘‘mobile’’ or ‘‘loosely bound’’ zinc are
frequently employed to describe the zinc pool of non-protein bound zinc that is complexed
by small molecule ligands [21,22]. Hence, in the following the term ‘‘free’’ zinc will be used
![Page 79: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/79.jpg)
The Impact of Apical and Basolateral Albumin on Intestinal Zinc Resorption in the Caco-2/HT-29-MTX Co-culture Model,
63
for this exchangeable pool, which was defined as being in ‘‘transit during re-distribution’’
[21]. Notably, free zinc was suggested to be the biologically active form [23] and the
speciation of zinc was shown to be crucial when analyzing zinc uptake in several cell lines in
the presence of albumin [24]. Albumin is the main zinc binding protein in human plasma,
buffering the actual free zinc concentration to a narrow nanomolar range [24]. In detail, the
zinc binding ability of albumin is mediated by two binding sites (yielding a 2:1 stoichiometry
of the zinc–albumin-complex), of which site A was reported to bind zinc with an approximate
dissociation constant of 100 nM [25]. This 64 kDa protein is also the main component of
serum, which is a commonly used additive in cell culture media [26]. While this might be
suitable for some cell types, such as immune or epithelial cells [24,27], the application of
high albumin concentrations might constitute a significant distortion when investigating
intestinal zinc resorption.
Thus, this study aims to investigate the role of apical and basolateral addition of albumin in
zinc uptake of in vitro intestinal cells and resorption studies, using a Caco-2/HT-29-MTX co-
culture to further elucidate its role in zinc buffering in in vitro cell culture.
![Page 80: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/80.jpg)
The Impact of Apical and Basolateral Albumin on Intestinal Zinc Resorption in the Caco-2/HT-29-MTX Co-culture Model,
64
5.2 Methods
5.2.1 Materials
Bovine Serum Albumin (BSA) (Sigma Aldrich, Munich, Germany), Cell Counting Kit-8/water
soluble tetrazolium (WST)-8 (Sigma Aldrich, Munich, Germany), Dulbecco’s Modified Eagles
Medium (DMEM) (PAN-Biotech, Aidenbach, Germany), Element mix (SPETEC, Erding,
Germany), fetal calf serum (FCS) (CCPro, Oberdorla, Germany), 4-(2-hydroxyethyl)-1-
piperazine-ethanesulfonic acid (HEPES) (Carl Roth, Karlsruhe, Germany), iScript cDNA
Synthesis Kits (Quantabio, Beverly, USA), 3-(4,5-dimethylthiazol-2-yl)- 2,5-
diphenyltetrazolium bromide (MTT) (Carl Roth, Karlsruhe, Germany), a Nanosep centrifugal
device (Pall Life Sciences, Michigan, USA), Neutral red (Sigma Aldrich, Munich, Germany),
non-essential amino acids (NEAA) (Sigma Aldrich, Munich, Germany), NucleoSpin II
(Macherey-Nagel GmbH & Co. KG, Berlin, Germany), 4-(2-pyridylazo)resorcinol (PAR) (Sigma
Aldrich, Munich, Germany), Rotiphorese Gel 40 (Carl Roth, Karlsruhe, Germany),
sulforhodamine B (SRB) (Sigma Aldrich, Munich, Germany), SYBR™-Green (Quantabio,
Beverly, USA), Transwell inserts (Corning, New York, USA), N,N,N’,N’- tetrakis(2-
pyridylmethyl)ethylenediamine (TPEN) (Sigma Aldrich, Munich, Germany), powdered trypsin
1:250 (AppliChem, Darmstadt, Germany), Zinpyr-1 (Santa Cruz Biotechnology, Dallas, USA),
and ZnSO4·7H2O (Sigma Aldrich, Munich, Germany) were used. All other chemicals were
purchased from standard sources.
5.2.2 Cell Culture
The cell lines Caco-2 and HT-29-MTX-E12 were obtained from the European Collection of
Authenticated Cell Cultures (ECACC, Porton Down, UK). Cells were cultured at 37°C, in a 5%
CO2 and humidified atmosphere in DMEM, containing 10% FCS (zinc content of 100% FCS: 30
µM as determined by ICP-MS), 100 U ml-1 penicillin and 100 µg ml-1 streptomycin. The
medium for HT-29-MTX cells additionally contained 1% NEAA. The medium was changed
every other day. Caco-2 cells (initially seeding in 96-well plates: 5000 cells per well; 6-well
plates: 120,000 cells per well) were cultured for 21 d to fully differentiate into an enterocyte-
like phenotype and to form a monolayer, as shown before [7,8]. Analysis of the proper
differentiation, morphology and barrier integrity of the Caco-2 cells cultured in our lab was
reported previously [28].
5.2.3 Tryptic Digestion of BSA
300 mg mL-1 BSA (containing traces of 1.3 ng zinc per mg BSA) was incubated with 150 mg
mL-1 trypsin in tris(hydroxylmethyl)-aminomethan (tris)-buffered saline (TBS-buffer) (50 mM
Tris, 110 mM NaCl, pH 7.5) at 37°C for 72 h on a thermoshaker. Successful in vitro digestion
of BSA was checked by electrophoresis, which was performed using polyacrylamide gels (4%
stacking and 20% resolving gel) and denaturing conditions [29]. Prior to zinc-uptake assays
using Zinpyr-1, trypsin was removed from the samples by ultracentrifugation using 10 kDa
membrane filters.
![Page 81: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/81.jpg)
The Impact of Apical and Basolateral Albumin on Intestinal Zinc Resorption in the Caco-2/HT-29-MTX Co-culture Model,
65
5.2.4 Zinc Uptake Assay using Zinpyr-1
Cellular zinc uptake was analyzed using the fluorescent zinc probe Zinpyr-1. To this end, zinc
resorption was measured as the increase of the cellular free zinc concentration [nM] using
the equation by Grynkiewicz et al. [Zinc] = Kd × [(F - Fmin) / (Fmax - F)] [30] and a dissociation
constant for the zinc-Zinpyr-1-complex of 0.7 nM.[31] Caco-2 cells grown in 96-well plates
were loaded with 2.5 µM Zinpyr-1 in incubation buffer (120 mM NaCl, 5.4 mM KCl, 5 mM
glucose, 1 mM CaCl2, 1 mM MgCl2, 1 mM NaH2PO4, 10 mM HEPES, 0.3% BSA, pH 7.35) for 30
min. Afterwards, the supernatants were removed and the adherent cell monolayers were
washed twice with assay buffer (incubation buffer w/o BSA) to remove extracellular Zinpyr-
1. To determine the minimal (Fmin) or maximal (Fmax) fluorescence signal, 100 µL of assay
buffer containing either 20 µM TPEN, a zinc chelator, or 600 µM ZnSO4·7H2O, respectively,
were added to a subset of wells used for calibration. All other wells were filled with 100 µL
of assay buffer. After incubation for 20 min at 37°C, baseline Zinpyr-1 fluorescence (λex = 508
nm and λem = 527 nm) was measured using a fluorescence plate reader (SPARK, Tecan
Switzerland). Subsequently, 25 µL of 5-fold concentrated zinc-solutions containing either BSA
(digested or undigested) or FCS, respectively, were added to the cells in order to measure
zinc uptake (equal volumes of 20 µM TPEN (Fmin) and 600 µM ZnSO4·7H2O (Fmax) were added
to the respective wells used for calibration in order to yield comparable buffer volumes in all
wells). Fluorescence was measured again after incubation for an additional 20 min at 37°C.
5.2.5 Zinc Binding Properties of Digested BSA
The zinc binding properties of BSA after tryptic digestion were measured using the chelating
chromophore PAR. To this end, 20 µM PAR (stock solution 25 mM in H2O) and 15 mg mL-1 of
BSA or digested BSA, respectively, were titrated with 0–1000 µM ZnSO4·7H2O in 50 mM
HEPES-buffer at pH 7.4 and the absorption of the zinc-(PAR)2-complex was measured at 492
nm using a well plate reader (M200, Tecan, Switzerland) [32]. Data were analyzed with
GraphPad Prism software version 5.01 (GraphPad Software Inc., CA, USA) and a non-linear
regression assuming a one site specific binding with Hill slope as a function of the zinc-
concentration was applied.
5.2.6 Viability Assays
Caco-2 cells grown in 96-well plates were incubated with 0–1000 µM ZnSO4·7H2O in DMEM
without phenol red with 0 or 10% FCS, respectively, for 24 h. A total of 0.01% Triton-X-100
was used as a positive control. Cell viability was analyzed using three different endpoints:
dehydrogenase activity with MTT and WST, respectively, lysosomal cytotoxicity by neutral
red uptake (NRU-assay), and the amount of cellular protein using the SRB-assay. MTT, WST
and SRB were performed as previously described [28,33]. A final concentration of 40 mg L-1
neutral red was used and the cells were incubated for 3 h followed by washing with PBS and
lysis with 50% ethanol in H2O. The absorbance was measured at 540 nm [34]. Data were
analyzed with GraphPad Prism software version 5.01 (GraphPad Software Inc., CA, USA) and
a non-linear regression using a sigmoidal dose–response curve with variable slope as a
function of the logarithm of concentration was applied.
![Page 82: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/82.jpg)
The Impact of Apical and Basolateral Albumin on Intestinal Zinc Resorption in the Caco-2/HT-29-MTX Co-culture Model,
66
5.2.7 Zinc Uptake Assay using Atomic Absorption Spectrometry
Cells were cultured in 6-well plates and incubated with 0-100 µM ZnSO4·7H2O in DMEM
without phenol red for 24 h. Finally, the cells were washed with ice-cold PBS and harvested
with a cell scraper on ice. The cell pellets were dissolved in a mixture of equal volumes of
67% ultrapure HNO3 and 30% H2O2 and dried at 92°C overnight using a thermoshaker. The
residues were dissolved in 0.67% HNO3 and the samples were analyzed by flame atomic
absorption spectrometry (FAAS) using a Perkin Elmer AAnalyst800 (Perkin Elmer, Germany).
5.2.8 Quantitative Real Time PCR (qPCR)
Cells were cultured in 6-well plates. After harvesting the differentiated cells on ice with PBS,
RNA was isolated using the Nucleo Spin II Kit and cDNA was synthesized using the iScript
cDNA Synthesis Kit according to the manufacturers’ protocols. Finally, mRNA-levels were
quantified by qPCR with SYBR™Green Super Mix, using the primers listed in Table 5.1.
Relative quantification of mRNA was realized using the 2δδCt-method [35] with Ct-values
normalized to β-actin and referred to non-treated control cells.
Table 5.1. Oligonucleotide sequences used for qPCR
Primer NCBI Reference
Sequence
Sequence fwd 5'-3' Sequence rev 5'-3' Ref.
zip-4 NM_017767 AGACTGAGCCCAGAGTTGAGGCTA TGTCGCAGAGTGCTACGTAGAGGA [36]
zip-5 NM_173596 GAGCAGGAGCAGAACCATTACCTG CAATGAGTGGTCCAGCAACAGAAG [36]
znt-1 NM_021194 GGCCAATACCAGCAACTCCAA TGCAGAAAAACTCCACGCATGT [37]
znt-5 NM_024055 AAGGACATCATGACAGTGCTCTAACTC CCAACTTTACAACACAAAGCCAGTAC [37]
mt1a NM_005946.2 CTCCTGCAAGAAGAGCTGCTG CAGCCCTGGGCACACTT
alp NM_001631.4 CCGCTTTAACCAGTGCAACA CCCATGAGATGGGTCACAGA [38]
β-actin NG_007992.1 CGCCCCAGGCACCAGGGC GCTGGGGTGTTGAAGGT [36]
5.2.9 Zinc Transport Studies
Zinc transport studies were performed using a Caco-2/HT-29-MTX co-culture. The cell ratio
of Caco-2 and HT-29-MTX cells was slightly modified after Nollevaux et al. [39], with an initial
cell ratio of 75% Caco-2 and 25% HT-29-MTX cells and alternated cell seeding. For this
purpose, 60,000 Caco-2 cells were transferred onto polycarbonate transwell membranes
(pore size 0.4 µm, culture area 1.12 cm2). 2 d after seeding of Caco-2, 20,000 HT-29-MTX
cells were added and co-cultured for an additional 18 d in DMEM with 10% FCS, 100 U ml-1
penicillin and 100 µg ml-1 streptomycin and 1% NEAA. After 21 d, the cells were incubated
with 0 µM, 25 µM, 50 µM or 100 µM ZnSO4·7H2O in transport buffer (Hanks’ Balanced Salt
Solution (HBSS)-buffer (130 mM NaCl, 10 mM KCl, 1 mM MgSO4, 50 mM HEPES, pH 7.5, 5
mM Glucose, mix of amino acids (398 µM L-arginine, 322 µM L-cysteine, 3.9 µM L-glutamine,
399 µM glycine, 115 µM L-histidine, 798 µM L-isoleucine, 798 µM L-leucine, 800 µM L-lysine;
201 µM L-methionine, 399 µM L-phenylalanine, 399 µM L-serine, 799 µM L-threonine, 78
µM L-tryptophan, 508 µM L-tyrosine, 798 µM L-valine))) on the apical side of the transport
![Page 83: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/83.jpg)
The Impact of Apical and Basolateral Albumin on Intestinal Zinc Resorption in the Caco-2/HT-29-MTX Co-culture Model,
67
chamber for 8 h. The basolateral compartment consisted of a cell culture medium with 0 or
30 mg mL-1 BSA. Membrane integrity was monitored by measuring TEER (transepithelial
electrical resistance) prior to and after the experiment with the epithelial volt-ohm meter
Millicell®ERS-2 (Millipore, USA). Additionally, the permeability of the cell monolayer was
determined by examining the basolateral concentrations of Fluorescein isothiocyanate
(FITC)-Dextran-20 (FD-20; 20,000 MWCO), which was used before to characterize Caco-2/HT-
29-MTX co-cultures [39] during the experiment. To this end, a final concentration of 0.25 mg
mL-1 FD-20 was added with the incubation buffer in the apical transwell chamber at the start
of the experiment and the amount of FD-20 in the basolateral and apical compartments at
the end of the experiment was analyzed by fluorescence measurements (λex = 485 nm, λem =
520 nm). Permeability for FD-20 was then calculated as the apparent permeability using the
following equation: Papp = (dQ/dt) × (1/A x c0), with dQ/dt FD-20 transport in mg s-1; A is the
area of the transwell (1.12 cm2) and c0 is the initial FD-20-concentration [40].
At the end of the experiment, the media of the apical and basolateral compartments were
collected and cells were harvested on ice in PBS, homogenized and centrifuged (800g). An
aliquot of cell homogenates was collected for protein quantification using the bicinchoninic
acid (BCA)-assay as described [41]. Subsequently, the cells were dried at 92°C overnight as
described above and dissolved in 0.67% HNO3. Zinc quantification in the apical, basolateral
and cellular compartments was conducted by inductively-coupled plasma mass
spectrometry (ICP-MS), after dilution (1:10 and 1:200) in 2% HNO3 containing 5 µg L-1
rhodium, using an Agilent 8800 ICP-QQQ (Agilent Technologies Deutschland GmbH,
Böblingen, Germany) in the single quadmode.
5.2.10 Statistical Analysis
Statistical significance was analyzed by one- or two-way analysis of variance (ANOVA),
followed by Bonferroni or Dunnett’s multiple comparison post hoc tests, as indicated in the
respective figure legends, using GraphPad Prism software version 5.01 (GraphPad Software
Inc., CA, USA). Error bars represent standard deviation or standard error of the mean, as
indicated, of three independent biological replicates.
![Page 84: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/84.jpg)
The Impact of Apical and Basolateral Albumin on Intestinal Zinc Resorption in the Caco-2/HT-29-MTX Co-culture Model,
68
5.3 Results
5.3.1 Influence of Apical Serum on Zinc Uptake
Zinc resorption was analyzed as the increase of free zinc, measured with the zinc probe
Zinpyr-1. The effect of the apical serum concentration on the initial zinc uptake into Caco-2
cells was analyzed in the presence of 0 or 10% FCS. Notably, no effect of FCS on intracellular
free zinc was detected in control cells (0 µM zinc), but the presence of 10% FCS led to a
significantly lower increase of free zinc after incubation with 25 and 50 µM zinc (Figure 5.1).
In contrast, short-term zinc uptake measured with FAAS showed no statistically significant
change in the total cellular zinc content after addition of 50 µM extracellular zinc,
irrespective of the presence or absence of FCS (Figure 5.1B). Furthermore, to examine a
possible enhancement of zinc absorption due to the intracellular zinc sensor Zinpyr-1,
cellular zinc uptake was compared between controls and cells loaded with 2.5 µM Zinpyr-1,
showing that the probe had no significant impact on cellular zinc uptake (Figure 5.1C).
Figure 5.1: Impact of serum and Zinpyr-1 on short-term zinc uptake.
Zinc uptake into differentiated Caco-2 cells in the presence of 0 or 10% FCS, respectively, was investigated after 20 min by measuring the increase of intracellular free zinc with the low molecular weight probe Zinpyr-1 (A) or total cellular zinc with FAAS (B). (C) The impact of Zinpyr-1 on cellular zinc uptake was analyzed in differentiated Caco-2 cells loaded with 0 µM or 2.5 µM of the probe for 30 min, followed by incubation with zinc for 20 min and measurement of total cellular zinc by FAAS. Data are shown as means + SD of three independent experiments. Significant differences between 0 and 10% FCS are indicated (**p < 0.01; ***p < 0.001; two-way ANOVA with Bonferroni post hoc test).
Because albumin is the major protein in FCS [26], zinc resorption was also studied with
purified albumin, yielding similar results. In Figure 5.2A, zinc uptake into Caco-2 cells in the
presence of 15 mg ml-1 BSA is shown. Without BSA, free zinc increased proportional to the
added zinc concentration, but no noteworthy zinc uptake was observed in the presence of
albumin. Zinc uptake was partly restored by tryptic digestion of albumin. Moreover, cell free
measurements with the zinc chelating chromophore PAR confirmed the altered zinc binding
properties of BSA after tryptic digestion (Figure 5.2B). Here, 15 mg ml-1 BSA, corresponding
to 234.4 µM albumin, were saturated by addition of approximately 500 µM zinc,
corresponding well to the reported 1:2 stoichiometry of the albumin-zinc-complex [25]. The
digestion of albumin, however, diminished its zinc binding affinity, leading to a partial
![Page 85: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/85.jpg)
The Impact of Apical and Basolateral Albumin on Intestinal Zinc Resorption in the Caco-2/HT-29-MTX Co-culture Model,
69
recovery of zinc uptake. Gel electrophoresis of BSA before and after in vitro digestion shows
the typical band at 64 kDa, which vanishes after tryptic digestion, indicating a successful
degradation of the protein (Figure 5.2C). Besides, the band with an apparent molecular mass
of 20 kDa can be correlated with bovine trypsin, which has a molecular mass of 24 kDa [42].
Figure 5.2: Effect of albumin digestion on intestinal zinc resorption.
(A) Zinc resorption is shown as increase of cellular free zinc measured with Zinpyr-1 in differentiated Caco-2 cells. Cells were incubated for 10 min with 0–50 µM ZnSO4·7H2O alone and in the presence of either 15 mg mL-1 undigested BSA or after tryptic digestion. Additionally, blank digestion without BSA was analyzed as a control (CTR). Data are displayed as means ± SEM of three independent experiments. Significant differences between the incubated zinc concentrations are indicated (*p < 0.05; ***p < 0.001; two-way ANOVA with Bonferroni post hoc test). (B) Comparison of the zinc binding properties of 15 mg mL-1 BSA before and after tryptic digestion analyzed with the colorimetric zinc chelator 4-(2-pyridylazo)resorcinol (PAR). Shown is the absorption of the zinc-(PAR)2-complex relative to the maximal absorption at 492 nm. Data are displayed as means ± SD of three independent experiments. (C) Verification of successful tryptic digestion of albumin with either 0 or 150 mg mL-1 trypsin by gel electrophoresis.
![Page 86: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/86.jpg)
The Impact of Apical and Basolateral Albumin on Intestinal Zinc Resorption in the Caco-2/HT-29-MTX Co-culture Model,
70
5.3.2 Impact of Serum on Zinc Cytotoxicity
The impact of apically added FCS was investigated with four different cell viability assays. All
showed a trend of reduced cytotoxicity in the presence of serum (Figure 5.3 and
Supplemental Table S5.2). This was statistically significant for the cellular retention of
neutral red, based on the 95% confidence intervals of the lethal concentration (LC50) values
(Supplemental Table S5.2), indicating that zinc cytotoxicity is buffered by high serum
concentrations.
Figure 5.3: Impact of serum on zinc cytotoxicity.
Differentiated Caco-2 cells were incubated with 0–1000 µM ZnSO4·7H2O for 24 h and cell viability was analyzed using several assays with different endpoints. Mitochondrial activity was assayed using WST (A) and MTT (B) and lysosomal activity using NRU (C). Moreover, the effect of zinc on cellular protein content was analyzed with SRB (D). Data are shown as means ± SD of three independent experiments. Significant differences are indicated (*,# p < 0.05; **,## p < 0.01; ***,### p < 0.001; one-way ANOVA with Dunnett’s multiple comparison test).
![Page 87: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/87.jpg)
The Impact of Apical and Basolateral Albumin on Intestinal Zinc Resorption in the Caco-2/HT-29-MTX Co-culture Model,
71
5.3.3 Effect of Serum on Zinc Uptake after Long-term Incubation
In addition to short-term zinc uptake in the presence of FCS, zinc absorption after long-term
incubation was investigated using FAAS. Remarkably, no statistically significant difference in
zinc uptake after 24 h incubation of 0–100 µM zinc was observed (Figure 5.4). Regardless of
the FCS concentration, the relative zinc uptake decreased with increased added zinc
concentration, showing a regulated zinc absorption into Caco-2 cells (Figure 5.4A). The
fractional zinc absorption shown in this figure depends on the apically added volume, as it
affects the total amount of zinc that is added. Yet, the values are comparable within the
experiment, as the same volume was added to all samples. When the data were normalized
to the cellular protein content, they showed an increase of cellular zinc after treatment with
zinc both in the presence and absence of FCS, and displayed a general trend to higher values
in the absence of FCS (Figure 5.4B).
Figure 5.4: Influence of serum on zinc uptake in Caco-2 cells after incubation for 24 h.
Differentiated Caco-2 cells were incubated with 0–100 µM zinc with 0% or 10% FCS, respectively, and cellular zinc uptake was quantified using FAAS. The cellular zinc uptake is shown relative to the initially added zinc concentration (A) as well as relative to the protein content of the cells (B). Data are displayed as means + SD of three independent experiments.
Moreover, gene expression of important proteins for cellular zinc homeostasis was analyzed,
yielding only a slight but not statistically significant difference for mt1a, and no effect for the
zinc transporters zip4, zip5, znt-1 and znt-5 after incubation with 50 µM or 100 µM zinc in
the presence of 0 or 10% FCS (Figure 5.5). However, within the same serum concentrations
mt1a and znt-1 were slightly upregulated by 50 µM and 100 µM zinc, while the other zinc
transporters showed no zinc-dependent changes of expression at all.
![Page 88: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/88.jpg)
The Impact of Apical and Basolateral Albumin on Intestinal Zinc Resorption in the Caco-2/HT-29-MTX Co-culture Model,
72
Figure 5.5: Impact of zinc concentration and serum on gene expression of proteins involved in cellular zinc homeostasis.
Differentiated Caco-2 cells were cultivated for 24 h with 0–100 µM ZnSO4·7H2O with 0% and 10% FCS, respectively. Subsequently, gene expression of selected proteins of intestinal zinc homeostasis was analyzed using qPCR and is depicted relative to cells incubated with 0 µM zinc. Data are shown as means + SD of three independent experiments.
![Page 89: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/89.jpg)
The Impact of Apical and Basolateral Albumin on Intestinal Zinc Resorption in the Caco-2/HT-29-MTX Co-culture Model,
73
5.3.4 Effect of the Basolateral Albumin Concentration on Zinc Resorption
Zinc transport studies were performed using the transwell system and a co-culture of the
intestinal cell line Caco-2 and mucin producing goblet cells HT-29-MTX. Before performing
the transport studies, the co-culture of Caco-2 and HT-29-MTX was characterized concerning
the suitable cellular ratio by investigating the mucin secretion using alcianblue- and periodic
acid-Schiff (PAS)-staining (Supplemental Figure S5.1) and adequate differentiation of
enterocytes by monitoring the activity of the differentiation marker alkaline phosphatase
(Supplemental Figure S5.2) and the expression of alp and muc5ac (Supplemental Figure S5.3
and Supplemental Figure Table S5.1) as shown previously [39].
Next, the impact of serum albumin on zinc resorption was analyzed by comparing zinc
transport in the presence or absence of 30 mg mL-1 albumin (BSA) in the basolateral
compartment. The integrity of the cell monolayer was monitored at the beginning and end
of the experiments by measuring TEER and during the experiments by determining the
paracellular permeability for FD-20, revealing no impairment of both parameters during the
transport assay (Supplemental Figure S5.4). In Figure 5.6, the zinc uptake from the apical
compartment and the fractional resorption after 8 h of zinc incubation, relative to the
amount of added zinc, and the zinc transport rates in nmol per cm2 resorption area, are
shown. Of note, the apical and basolateral volumes added to the cells are important factors
affecting relative zinc uptake, as they determine the total amount of added zinc.
Consequently, this study reports the resorption in the presence or absence of BSA using
identical volumes for all samples, in order to obtain comparable results. Nevertheless,
absolute numbers for fractional resorption will vary if experiments are conducted under
different conditions. Figure 5.7 depicts detailed quantitative data of zinc uptake into the
cells, the cellular zinc content and the amount of zinc transported into the basolateral
compartment, each in ng cm-2. After zinc supplementation, the decrease of apical zinc
concentration was more pronounced in the transport system with albumin, while cellular
zinc levels were even slightly lower than those in the absence of albumin, resulting from a
higher zinc export to the basolateral side in the presence of albumin (Figure 5.7C).
Zinc transport is increasing with added zinc, resulting in higher zinc transport rates in the
presence of albumin on the basolateral side of the transwell chamber (1.8–3.6 nmol zinc cm-
2, Figure 5.6C and D). The fractional zinc resorption, which represents the amount of finally
resorbed (basolateral) zinc relative to the luminal zinc concentration, shows an inversely
proportional relation to the initially added zinc (Figure 5.6E and F). While zinc uptake from
the apical site is slightly higher in the transport system with albumin (Figure 5.6A and B),
there is increased zinc transport into the basolateral chamber in the presence of BSA,
leading to a zinc resorption of 2.5–6% added zinc. According to a two-way ANOVA followed
by a Bonferroni posttest, there are significant differences in fractional zinc resorption
between the two assays after adding 25 µM zinc (p < 0.001) and 50 µM zinc (p < 0.05) to the
apical chamber.
![Page 90: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/90.jpg)
The Impact of Apical and Basolateral Albumin on Intestinal Zinc Resorption in the Caco-2/HT-29-MTX Co-culture Model,
74
Figure 5.6: Effect of serum albumin as a basolateral zinc acceptor on intestinal zinc resorption
in a Caco-2/HT-29-MTX co-culture.
Shown are the amounts of zinc that disappeared from the apical side (apical zinc uptake) (A and B) and the fractional zinc resorption (E and F) relative to the added zinc concentration of the transport-assay without (A and E) and with 30 mg mL-1 albumin (B and F) in the basolateral compartment. Moreover, zinc transport rates in nmol zinc per cm2 resorption area in the absence (C) and presence of albumin (D) are displayed. Data are presented as means + SD of three independent experiments. Significant differences to control cells (0 µM zinc) are indicated (*p < 0.05; ***p < 0.001; one-way ANOVA with Dunnett’s multiple comparison test). According to a two-way ANOVA with a Bonferroni post hoc test comparing the results within one added zinc concentration, there are significant differences between the apical zinc concentration (25 µM: p < 0.001) and the fractional zinc-resorption (25 µM: p < 0.001; 50 µM: p < 0.05) with or without albumin in the basolateral compartment.
Additionally, cellular zinc uptake normalized to basal zinc levels (0 µM zinc) increases
significantly with the extracellular added zinc concentration. Interestingly, the amount of
apically absorbed zinc that stays in the cell seems to be higher when there is no BSA present
![Page 91: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/91.jpg)
The Impact of Apical and Basolateral Albumin on Intestinal Zinc Resorption in the Caco-2/HT-29-MTX Co-culture Model,
75
in the basolateral compartment (Figure 5.7). These findings support the abovementioned
observation of an increased zinc resorption in the presence of higher basolateral albumin
concentrations.
Figure 5.7: Impact of basolateral albumin concentration on cellular zinc uptake and transport.
(A and B) The cellular zinc uptake of the Caco-2/HT-29-MTX co-culture is shown relative to cellular protein content after subtracting basal cellular zinc content. Data are displayed as means + SD of three independent experiments. Significant differences to control cells (0 µM zinc) are indicated (*p < 0.05; **p < 0.01; ***p < 0.001; one-way ANOVA with Dunnett’s multiple comparison test). (C) Shown are the amounts of zinc that disappeared from the apical compartment (zinc uptake), the cellular zinc content, and the amounts resorbed into the basolateral compartment, all in ng zinc per resorption area (in cm2). Data are presented as means + SD of three independent experiments.
![Page 92: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/92.jpg)
The Impact of Apical and Basolateral Albumin on Intestinal Zinc Resorption in the Caco-2/HT-29-MTX Co-culture Model,
76
5.4 Discussion
In vitro cell culture models in general, and especially when investigating intestinal resorption
of food components, notably trace elements, always need to reflect the in vivo situation as
close as possible. The speciation of zinc in a cell culture medium has a strong impact on its
availability and cellular uptake [4,24]. Thus, the composition of the incubation medium has
to be considered when analyzing zinc resorption with intestinal cell models. FCS is commonly
used in the cell culture medium and contains essential components for cell growth and
proliferation [43]. Furthermore, albumin accounts for about 60% of the total FCS protein
concentration [26], is well known for its high zinc binding affinity [25], and is the major zinc
transport protein in blood serum in vivo [44]. Previous studies of our group already
demonstrated that FCS buffers the free zinc concentration in cell culture medium, resulting
in a considerably smaller available zinc concentration for immune cells [24]. The present
study investigates the impact of FCS on zinc uptake of enterocytes. First, short-term zinc
uptake of enterocytes in the presence of 10% FCS was analyzed, resulting in a decrease of
zinc absorption (Figure 5.1). A concentration of 10% FCS results in an albumin content of
1.55 mg mL-1 albumin [45] (corresponding to 24.2 µM). Based on studies demonstrating that
albumin has, at least under in vitro conditions, two zinc binding sites [25], this should be
sufficient for complexing a twofold molar excess of zinc. Accordingly, 10% FCS was sufficient
to reduce the short-term uptake of 50 µM zinc into enterocytes. Similar observations were
made when analyzing the effect of 15 mg mL-1 purified albumin, representing physiological
but low serum concentrations, on zinc uptake in the intestinal cell line Caco-2 (Figure 5.2). In
accordance with the present results, our previous studies showed that even smaller
concentrations bind zinc, reducing the cellular zinc availability for an intracellular zinc probe
[24]. However, it has to be considered that in some cases, like for immune cells, the
application of 100% FCS is more realistic compared to their environment in vivo [24]. In
contrast, for intestinal cells the apical occurrence of serum or albumin, respectively, is not
realistic considering the digestion process throughout the whole gastrointestinal tract. For
this reason, the observed negative effect of albumin on zinc bioavailability cannot be
transferred to the in vivo situation in the intestinal lumen. Consequently, the effect of
digested albumin on intestinal zinc uptake was investigated resulting in a significant increase
of intracellular free zinc compared to the zinc uptake in the presence of undigested protein
(Figure 5.2A). However, digested albumin still binds zinc, impairing its uptake into
enterocytes (Figure 5.2A and B), which is in agreement with the effect of albumin on zinc
resorption in vivo [46].
Next, the impact of apically added high serum concentrations on zinc cytotoxicity after long-
term incubation was analyzed, indicating that albumin buffers zinc cytotoxicity in
enterocytes, starting at 250 µM extracellular added zinc (Figure 5.3). It was shown that
already narrow changes in free zinc can determine its toxicity [23] and that cells could be
protected against zinc cytotoxicity by albumin [24], suggesting that zinc is toxic for Caco-2
cells as soon as the buffer capacity of albumin is exceeded. The investigation of zinc uptake
after long-term incubation (Figure 5.4) revealed a regulated and concentration-dependent
![Page 93: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/93.jpg)
The Impact of Apical and Basolateral Albumin on Intestinal Zinc Resorption in the Caco-2/HT-29-MTX Co-culture Model,
77
cellular zinc uptake that is comparable to previous studies obtained with Caco-2 cells after
24 h [47,48] and consistent with the kinetics of zinc resorption [9,10,49]. In contrast to the
short-term zinc uptake in Caco-2 cells, no impact of the extracellular albumin concentration
on long-term zinc absorption was observed. However, these results are not contradictory to
those of the cytotoxicity studies, because the uptake assays were performed for non-toxic
zinc concentrations (0-100 µM) and the serum-dependent impairment of cell viability is only
observed starting at 250 µM zinc. Moreover, studies with endothelial cells reported a
facilitated zinc resorption in the presence of albumin [27], thus the Caco-2 cells might have
resorbed albumin-bound zinc after 24 h incubation. Besides, the phenomenon of zinc uptake
together with albumin was already observed 30 min after incubation of peripheral blood
mononuclear cells (PBMC) with zinc and BSA [24]. In contrast, no significant change in
cellular zinc was determined using FAAS (Figure 5.1B and C) after 20 min as well as in the
first 6 h [48] of incubating zinc together with albumin in Caco-2 cells. These observations
indicate that zinc uptake in Caco-2 cells is not detectable using FAAS after short-term
incubation, probably because the resulting changes are too small compared to the total
amount of cellular zinc, which is measured by FAAS. This underlines the importance of low
molecular weight sensors to conduct initial zinc uptake measurements and detect small
changes in the intracellular free zinc pool. Yet again, these observations cannot be
transferred to the situation in the intestinal lumen in vivo and are only valid for in vitro
experiments with Caco-2 cells. Additionally, gene expression after 24 h incubation showed
no significant differences in the expression of mt1a and selected zinc transporters with or
without serum (Figure 5.5). Consistent with previous findings in Caco-2 cells [14,15,48] there
is a concentration-dependent trend for upregulation of mt1a and znt-1 after treatment with
zinc for 24 h (Figure 5.5A and D). According to earlier studies, the reason for the increase of
metallothionein and znt-1, both regulated via zinc-dependent transcription factor MTF-1
[50], after zinc incubation, is mainly to maintain intracellular zinc homeostasis [15,51].
Furthermore, no zinc-dependent expression of the other zinc transporters was observed,
which is comparable to previous studies with Caco-2 cells [14,15].
Finally, the effect of the basolateral albumin concentration on zinc resorption was examined
with zinc transport studies using a co-culture of Caco-2 cells and the goblet cell line HT-29-
MTX. Intestinal zinc resorption is mainly controlled by internalization or expression of
enterocyte zinc transporters [2], but the definite molecular mechanisms for regulating zinc
resorption must be further investigated [52]. Notably the basolateral zinc export into the
blood stream is mediated by the expression of the basolateral exporter ZnT-1, which is
upregulated at high zinc concentrations to enhance zinc transport and to maintain
intracellular homeostasis in enterocytes [2]. According to the present study, a basolateral
zinc acceptor, such as serum albumin, might also play an important role in the regulation of
zinc resorption. The fractional zinc resorption is significantly augmented when adding
albumin on the basolateral side (Figure 5.6), indicating that basolateral serum albumin
enhances zinc resorption and acts as a basolateral zinc acceptor. Furthermore, a basolateral
acceptor seems to increase the cellular release to the basolateral compartment, as the
![Page 94: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/94.jpg)
The Impact of Apical and Basolateral Albumin on Intestinal Zinc Resorption in the Caco-2/HT-29-MTX Co-culture Model,
78
cellular zinc concentration tends to be higher in the absence of albumin (Figure 5.7). Hence,
apically absorbed zinc does not remain inside the cells in the presence of albumin, but is
transported to the basolateral compartment (Figure 5.7C). This was observed before,
suggesting that plasma albumin is not only involved in zinc transport but also acts as a zinc-
carrier by removing zinc from intestinal-mucosal cells [53]. Besides, the albumin
concentration in this study (30 mg mL-1) is in the vicinity of the physiological human plasma
albumin (HSA) concentration (typically 35–50 mg mL-1) [24]. Yet, it has to be noted that this
study aims to clarify the impact of albumin in in vitro models of intestinal absorption, which
typically involve BSA, while the function of albumin as an acceptor in humans would have to
be confirmed with HSA instead of BSA. In contrast to the human plasma zinc concentrations
of 12–16 µM [54], the basolateral medium contains only 3 µM zinc, resulting in a 110-fold
molar excess of albumin compared to a molar albumin : zinc-ratio of 30 in vivo [24].
However, the fractional resorption of zinc in vivo was reported to be around 20–30%, but
highly dependent on the amount of consumed zinc [55,56]. The fractional absorption in this
study shows the same concentration-dependency as observed in vivo and is comparable to
studies conducted with Caco-2 monocultures [57] regarding the results without BSA.
Additionally, results obtained for the zinc resorption in the presence of albumin in this study
are even higher than those observed before [58,59]. In fact, the applied zinc concentrations
in this experimental setting represent luminal zinc concentrations in vivo after consumption
of a meal containing normal amounts of zinc [13]. As the digested food components offer
various possibilities for zinc buffering, it has to be considered that these estimated
concentrations differ from free and available zinc concentrations. This factor though could
be easily incorporated into the intestinal model by combining it with an in vitro digestion
model [60]. Furthermore, while zinc transport was conducted using a co-culture of
enterocytes and mucin producing goblet cells, there are still several factors missing
compared to the in vivo situation, particularly concerning the basolateral side of the
intestinal epithelium. Among them, the transport and distribution of zinc into the other
organs and most importantly humoral factors, which are still topics of current investigations
[61]. Nevertheless, these outcomes underline the crucial character of distinct apical and
basolateral media composition for enterocytes in zinc resorption studies: the apical buffer
has to be as close to the luminal fluid in vivo as possible and the basal media must resemble
the serum in vivo.
![Page 95: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/95.jpg)
The Impact of Apical and Basolateral Albumin on Intestinal Zinc Resorption in the Caco-2/HT-29-MTX Co-culture Model,
79
5.5 Conclusion
In summary, our work clearly demonstrates the impact of the zinc binding protein albumin
on zinc resorption using in vitro cell models. Albumin reduces the amount of cellular
available zinc and has a severe impact on initial zinc uptake in enterocytes when applied
apically. Yet, it plays an important role as a basolateral zinc acceptor enhancing fractional
zinc resorption and augmenting the cellular release of zinc into the blood stream. Thus, it is
not only important to reduce the amount of FCS to a minimum in the apical medium when
using in vitro intestinal models to investigate zinc uptake, but it is also essential to adapt the
basolateral matrix to the in vivo situation when analyzing zinc resorption in the future.
5.6 Conflict of Interest
There are no conflicts to declare.
5.7 Acknowledgements
The work of HH and TS was supported by the Deutsche Forschungsgemeinschaft (TraceAge –
DFG Research Unit on Interactions of essential trace elements in healthy and diseased
elderly, Potsdam-Berlin-Jena, FOR 2558/1, HA 4318/4-1, SCHW903/16-1).
5.8 References
1. Hambidge, K.M.; Miller, L.V.; Westcott, J.E.; Sheng, X.; Krebs, N.F. Zinc bioavailability
and homeostasis. Am. J. Clin. Nutr. 2010, 91, 1478S-1483S.
2. Wang, X.; Zhou, B. Dietary zinc absorption: A play of ZIPs and ZnTs in the gut. IUBMB
life 2010, 62, 176-182.
3. King, J.C. Zinc: An essential but elusive nutrient. Am. J. Clin. Nutr. 2011, 94, 6795-
6845.
4. Ollig, J.; Kloubert, V.; Weßels, I.; Haase, H.; Rink, L. Parameters influencing zinc in
experimental systems in vivo and in vitro. Metals 2016, 6, 71.
5. Langerholc, T.; Maragkoudakis, P.A.; Wollgast, J.; Gradisnik, L.; Cencic, A. Novel and
established intestinal cell line models – an indispensable tool in food science and
nutrition. Trends Food Sci. Tech. 2011, 22, S11-S20.
6. Madara, J. L. Functional Morphology of Epithelium of the Small Intestine. In
Comprehensive Physiology; Terjung, R., Ed.; JohnWiley & Sons, Inc.: Hoboken, NJ, USA,
2011.
7. Pinto, M.; Robineleon, S.; Appay, M.D.; Kedinger, M.; Triadou, N.; Dussaulx, E.;
Lacroix, B.; Simonassmann, P.; Haffen, K.; Fogh, J., et al. Enterocyte-like differentiation
and polarization of the human-colon carcinoma cell-line Caco-2 in culture. Biol. Cel.
1983, 47, 323-330.
![Page 96: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/96.jpg)
The Impact of Apical and Basolateral Albumin on Intestinal Zinc Resorption in the Caco-2/HT-29-MTX Co-culture Model,
80
8. Sambuy, Y.; de Angelis, M.; Ranaldi, G.; Scarino, M.L.; Stammati, A.; Zucco, F. The
Caco-2 cell line as a model for the intestinal barrier: Influence of cell and culture-
related factors on Caco-2 cell functional characteristics. Cell Biol. Toxicol. 2005, 21, 1-
26.
9. Yasuno, T.; Okamoto, H.; Nagai, M.; Kimura, S.; Yamamoto, T.; Nagano, K.;
Furubayashi, T.; Yoshikawa, Y.; Yasui, H.; Katsumi, H.; Sakane, T.; Yamamoto, A. In
vitro study on the transport of zinc across intestinal epithelial cells using Caco-2
monolayers and isolated rat intestinal membranes. Biol. Pharm. Bull. 2012, 35, 588-
593.
10. Raffaniello, R.D.; Shih-Yu Lee; Teichberc, S.; Wapnir, R.A. Distinct mechanisms of zinc
uptake at the apical and basolateral membranes of Caco-2 cells. J. Cell. Physiol. 1992,
152, 356-361.
11. Jovanı, M.; Barbera, R.; Farre, R.; de Aguilera, E.M. Calcium, iron, and zinc uptake from
digests of infant formulas by Caco-2 cells. J. Agric. Food Chem.2001, 49, 3480−3485.
12. Jou, M.-Y.; Du, X.; Hotz, C.; Lönnerdal, B. Biofortification of rice with zinc: Assessment
of the relative bioavailability of zinc in a Caco-2 cell model and suckling rat pups. J.
Agric. Food Chem. 2012, 60, 3650-3657.
13. Cragg, R.A.; Phillips, S.R.; Piper, J.M.; Varma, J.S.; Campbell, F.C.; Mathers, J.C.; Ford,
D. Homeostatic regulation of zinc transporters in the human small intestine by dietary
zinc supplementation. Gut 2005, 54, 469-478.
14. Zemann, N.; Zemann, A.; Klein, P.; Elmadfa, I.; Huettinger, M. Differentiation- and
polarization-dependent zinc tolerance in Caco-2 cells. Eur. J. Nutr. 2011, 50, 379-386.
15. Shen, H.; Qin, H.; Guo, J. Cooperation of metallothionein and zinc transporters for
regulating zinc homeostasis in human intestinal Caco-2 cells. Nutr. Res. 2008, 28, 406-
413.
16. Lozoya-Agullo, I.; Araújo, F.; González-Álvarez, I.; Merino-Sanjuán, M.; González-
Álvarez, M.; Bermejo, M.; Sarmento, B. Usefulness of Caco-2/HT29-MTX and Caco-
2/HT29-MTX/Raji b coculture models to predict intestinal and colonic permeability
compared to Caco-2 monoculture. Mol. Pharm. 2017, 14, 1264-1270.
17. Hilgendorf, C.; Spahn-Langguth, H.; Regardh, C.G.; Lipka, E.; Amidon, G.L.; Langguth, P.
Caco-2 versus Caco-2/HT29-MTX co-cultured cell lines: Permeabilities via diffusion,
inside- and outside-directed carrier-mediated transport. J. Pharm. Sci. 2000, 89, 63-
75.
18. Beduneau, A.; Tempesta, C.; Fimbel, S.; Pellequer, Y.; Jannin, V.; Demarne, F.;
Lamprecht, A. A tunable Caco-2/Ht29-MTX co-culture model mimicking variable
permeabilities of the human intestine obtained by an original seeding procedure. Eur.
J. Pharm. Biopharm. 2014, 87, 290-298.
19. Mahler, G.J.; Shuler, M.L.; Glahn, R.P. Characterization of Caco-2 and HT29-MTX
cocultures in an in vitro digestion/cell culture model used to predict iron
bioavailability. J. Nutr. Biochem. 2009, 20, 494-502.
20. Bansil, R.; Turner, B.S. The biology of mucus: Composition, synthesis and organization.
Adv. Drug Deliv. Rev. 2018, 124, 3-15.
![Page 97: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/97.jpg)
The Impact of Apical and Basolateral Albumin on Intestinal Zinc Resorption in the Caco-2/HT-29-MTX Co-culture Model,
81
21. Maret, W. Analyzing free zinc(II) ion concentrations in cell biology with fluorescent
chelating molecules. Metallomics 2015, 7, 202-211.
22. Carpenter, M.C.; Lo, M.N.; Palmer, A.E. Techniques for measuring cellular zinc. Arch.
Biochem. Biophys. 2016, 611, 20-29.
23. Bozym, R.A.; Chimienti, F.; Giblin, L.J.; Gross, G.W.; Korichneva, I.; Li, Y.; Libert, S.;
Maret, W.; Parviz, M.; Frederickson, C.J., et al. Free zinc ions outside a narrow
concentration range are toxic to a variety of cells in vitro. Exp. Biol. Med. (Maywood)
2010, 235, 741-750.
24. Haase, H.; Hebel, S.; Engelhardt, G.; Rink, L. The biochemical effects of extracellular
Zn2+ and other metal ions are severely affected by their speciation in cell culture
media. Metallomics 2015, 7, 102-111.
25. Bal, W.; Sokołowska, M.; Kurowskaa, E.; Faller, P. Binding of transition metal ions to
albumin: Sites, affinities and rates Biochim. Biophys. Acta 2013, 1830, 5444–5455.
26. Zheng, X.; Baker, H.; Hancock, W.S.; Fawaz, F.; McCaman, M.; Pungor, E. Proteomic
analysis for the assessment of different lots of fetal bovine serum as a raw material
for cell culture. Part IV. Application of proteomics to the manufacture of biological
drugs. Biotechnol. Prog. 2006, 22, 1294-1300.
27. Tibaduiza, E.C.; Bobilya, D.J. Zinc transport across an endothelium includes vesicular
cotransport with albumin. J. Cell. Physiol. 1996, 167, 539-547.
28. Maares, M.; Keil, C.; Thomsen, S.; Gunzel, D.; Wiesner, B.; Haase, H. Characterization
of Caco-2 cells stably expressing the protein-based zinc probe eCalwy-5 as a model
system for investigating intestinal zinc transport. J. Trace Elem. Med. Biol. 2018, 49,
296-304.
29. Laemmli, U.K. Cleavage of structural proteins during the assembly of the head of
bacteriophage T4. Nature 1970, 227, 680-685.
30. Grynkiewicz, G.; Poenie, M.; Tsien, R.Y. A new generation of Ca2+ indicators with
greatly improved fluorescence properties. J. Biol. Chem. 1985, 260, 3440-3450.
31. Burdette, S.C.; Walkup, G.K.; Spingler, B.; Tsien, R.Y.; Lippard, S.J. Fluorescent sensors
for Zn2+ based on a fluorescein platform: Synthesis, properties and intracellular
distribution. J. Am. Chem. Soc. 2001, 123, 7831-7841.
32. Kocyła, A.; Pomorski, A.; Krężel, A. Molar absorption coefficients and stability
constants of metal complexes of 4-(2-pyridylazo)resorcinol (par): Revisiting common
chelating probe for the study of metalloproteins. J. Inorg. Biochem. 2015, 152, 82-92.
33. Vichai, V.; Kirtikara, K. Sulforhodamine b colorimetric assay for cytotoxicity screening.
Nat. Protoc. 2006, 1, 1112-1116.
34. Repetto, G.; del Peso, A.; Zurita, J.L. Neutral red uptake assay for the estimation of
cell viability/cytotoxicity. Nat. Protoc. 2008, 3, 1125-1131.
35. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time
quantitative pcr and the 2(-delta delta C(t)) method. Methods 2001, 25, 402-408.
36. Leung, K.W.; Liu, M.; Xu, X.; Seiler, M.J.; Barnstable, C.J.; Tombran-Tink, J. Expression
of ZnT and ZIP zinc transporters in the human RPE and their regulation by
neurotrophic factors. Invest. Ophthalmol. Vis. Sci. 2008, 49, 1221-1231.
![Page 98: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/98.jpg)
The Impact of Apical and Basolateral Albumin on Intestinal Zinc Resorption in the Caco-2/HT-29-MTX Co-culture Model,
82
37. Overbeck, S.; Uciechowski, P.; Ackland, M.L.; Ford, D.; Rink, L. Intracellular zinc
homeostasis in leukocyte subsets is regulated by different expression of zinc
exporters ZnT-1 to ZnT-9. J. Leukoc. Biol. 2008, 83, 368-380.
38. Wolf, K.; Schulz, C.; Riegger, G.A.J.; Pfeifer, M. Tumour necrosis factor‐α induced
CD70 and interleukin‐7R mRNA expression in BEAS‐2B cells. Eur. Respir. J. 2002, 20,
369-375.
39. Nollevaux, G.; Deville, C.; El Moualij, B.; Zorzi, W.; Deloyer, P.; Schneider, Y.J.; Peulen,
O.; Dandrifosse, G. Development of a serum-free co-culture of human intestinal
epithelium cell-lines (Caco-2/HT29-5M21). BMC Cell Biol. 2006, 7, 20.
40. Artursson, P.; Magnusson, C. Epithelial transport of drugs in cell culture. Ii: Effect of
extracellular calcium concentration on the paracellular transport of drugs of different
lipophilicities across monolayers of intestinal epithelial (Caco-2) cells. J. Pharm. Sci.
1990, 79, 595-600.
41. Smith, P.K.; Krohn, R.I.; Hermanson, G.T.; Mallia, A.K.; Gartner, F.H.; Provenzano,
M.D.; Fujimoto, E.K.; Goeke, N.M.; Olson, B.J.; Klenk, D.C. Measurement of protein
using bicinchoninic acid. Anal. Biochem. 1985, 150, 76-85.
42. Walsh, K.A. Trypsinogens and trypsins of various species. Meth. Enzymol. 1970; Vol.
19, pp 41-63.
43. Gstraunthaler, G. Alternatives to the use of fetal bovine serum: Serum-free cell
culture. Altex 2003, 20, 275-281.
44. Scott, B.J.; Bradwell, A.R. Identification of the serum binding proteins for iron, zinc,
cadmium, nickel, and calcium. Clin. Chem. 1983, 29, 629-633.
45. Kenneth, V.H.; John, A.S.; Walter, C. Fetal bovine serum: A multivariate standard.
Proc. Soc. Exp. Biol. Med. 1975, 149, 344-347.
46. Davidsson, L.; Almgren, A.; SandströM, B.; Juillerat, M.E.-A.; Hurrell, R.F. Zinc
absorption in adult humans: The effect of protein sources added to liquid test meals.
Br. J. Nutr. 2007, 75, 607-613.
47. Cheng, Z.; Tako, E.; Yeung, A.; Welch, R.M.; Glahn, R.P. Evaluation of metallothionein
formation as a proxy for zinc absorption in an in vitro digestion/Caco-2 cell culture
model. Food Funct. 2012, 3, 732-736.
48. Gefeller, E.M.; Bondzio, A.; Aschenbach, J.R.; Martens, H.; Einspanier, R.; Scharfen, F.;
Zentek, J.; Pieper, R.; Lodemann, U. Regulation of intracellular Zn homeostasis in two
intestinal epithelial cell models at various maturation time points. J. Physiol. Sci.
2015, 65, 317-328.
49. Reeves, P.G.; Briske-Anderson, M.; Johnson, L. Pre-treatment of Caco-2 cells with zinc
during the differentiation phase alters the kinetics of zinc uptake and transport. J.
Nutr. Biochem. 2001, 12, 674–684.
50. Langmade, S.J.; Ravindra, R.; Daniels, P.J.; Andrews, G.K. The transcription factor
MTF-1 mediates metal regulation of the mouse ZnT1 gene. J. Biol. Chem.2000, 275,
34803- 34809.
![Page 99: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/99.jpg)
The Impact of Apical and Basolateral Albumin on Intestinal Zinc Resorption in the Caco-2/HT-29-MTX Co-culture Model,
83
51. McMahon, R.J.; Cousins, R.J. Regulation of the zinc transporter ZnT-1 by dietary zinc.
Proc. Natl. Acad. Sci. U.S.A. 1998, 95, 4841-4846.
52. Krebs, N.F.; Hambidge, K.M. Zinc metabolism and homeostasis: The application of
tracer techniques. BioMetals 2001, 14, 397-412.
53. Smith, K.T.; Failla, M.L.; Cousins, R.J. Identification of albumin as the plasma carrier
for zinc absorption by perfused rat intestine. Biochem. J. 1979, 184, 627-633.
54. Maares, M.; Haase, H. Zinc and immunity: An essential interrelation. Arch. Biochem.
Biophys. 2016, 611, 58-65.
55. Kristensen, M.B.; Hels, O.; Morberg, C.M.; Marving, J.; Bugel, S.; Tetens, I. Total zinc
absorption in young women, but not fractional zinc absorption, differs between
vegetarian and meat-based diets with equal phytic acid content. Br. J. Nutr. 2006, 95,
963-967.
56. King, J.C.; Shames, D.M.; Woodhouse, L.R. Zinc homeostasis in humans. J. Nutr. 2000,
130, 1360S-1366S.
57. Jou, M.Y.; Du, X.; Hotz, C.; Lönnerdal, B. Biofortification of rice with zinc: Assessment
of the relative bioavailability of zinc in a Caco-2 cell model and suckling rat pups. J.
Agric. Food Chem. 2012, 60, 3650-3657.
58. Moltedo, O.; Verde, C.; Capasso, A.; Parisi, E.; Remondelli, P.; Bonatti, S.; Alvarez-
Hernandez, X.; Glass, J.; Alvino, C.G.; Leone, A. Zinc transport and metallothionein
secretion in the intestinal human cell line Caco-2. J. Biol. Chem. 2000, 275, 31819-
31825.
59. Finley, J.W.; Briske-Anderson, M.; Reeves, P.G.; Johnson, L.K. Zinc uptake and
transcellular movement by Caco-2 cells: Studies with media containing fetal bovine
serum. J. Nutr. Biochem. 1995, 6, 137-144.
60. Lichtenstein, D.; Ebmeyer, J.; Knappe, P.; Juling, S.; Bohmert, L.; Selve, S.; Niemann,
B.; Braeuning, A.; Thunemann, A.F.; Lampen, A. Impact of food components during in
vitro digestion of silver nanoparticles on cellular uptake and cytotoxicity in intestinal
cells. Biol. Chem. 2015, 396, 1255-1264.
61. Hennigar, S.R.; McClung, J.P. Hepcidin attenuates zinc efflux in Caco-2 cells. FASEB J.
2016, 30, 292.293.
![Page 100: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/100.jpg)
84
![Page 101: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/101.jpg)
In vitro Studies on Zinc Binding and Buffering by Intestinal Mucins
85
Chapter 6. In vitro Studies on Zinc Binding and Buffering by
Intestinal Mucins5
Abstract
The investigation of luminal factors influencing zinc availability and accessibility in the
intestine is of great interest when analyzing parameters regulating intestinal zinc resorption.
Of note, intestinal mucins were suggested to play a beneficial role in the luminal availability
of zinc. Their exact zinc binding properties, however, remain unknown and the impact of
these glycoproteins on human intestinal zinc resorption has not been investigated in detail.
Thus, the aim of this study is to elucidate the impact of intestinal mucins on luminal uptake of
zinc into enterocytes and its transfer into the blood. In the present study, in vitro zinc binding
properties of mucins were analyzed using commercially available porcine mucins and
secreted mucins of the goblet cell line HT-29-MTX. The molecular zinc binding capacity and
average zinc binding affinity of these glycoproteins demonstrates that mucins contain
multiple zinc binding sites with biologically relevant affinity within one mucin molecule. Zinc
uptake into the enterocyte cell line Caco-2 was impaired by zinc-depleted mucins. Yet this
does not represent their form in the intestinal lumen in vivo under zinc adequate conditions.
In fact, zinc uptake studies into enterocytes in the presence of mucins with differing degree of
zinc saturation revealed zinc buffering by these glycoproteins, indicating that mucin-bound
zinc is still available for the cells. Finally, the impact of mucins on zinc resorption using three-
dimensional cultures was studied comparing the zinc transfer of a Caco-2/HT-29-MTX co-
culture and conventional Caco-2 monoculture. Here, the mucin secreting co-cultures yielded
higher fractional zinc resorption and elevated zinc transport rates, suggesting that intestinal
mucins facilitate the zinc uptake into enterocytes and act as a zinc delivery system for the
intestinal epithelium.
5 The following article is the accepted version and appears as journal version in:
Maria Maares, Claudia Keil, Jenny Koza, Sophia Straubing, Tanja Schwerdtle, Hajo Haase. "In vitro Studies on Zinc Binding and Buffering by Intestinal Mucins." International Journal of Molecular Science 2018. 19(9): 2662, DOI: 10.3390/ijms19092662, https://doi.org/10.3390/ijms19092662 https://www.mdpi.com/1422-0067/19/9/2662
![Page 102: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/102.jpg)
In vitro Studies on Zinc Binding and Buffering by Intestinal Mucins
86
6.1 Introduction
The essential trace element zinc is predominantly resorbed in the small intestine, where it is
absorbed by enterocytes and transported into the blood stream, primarily mediated by the
apically located Zrt-, Irt-like transporter (ZIP)-4 and the basolateral zinc exporter (ZnT)-1 [1].
These two transporters are complemented by the basolateral transporter ZIP-5, importing
zinc from the blood into the enterocytes, and the apical transporter ZnT-5, which exports
zinc back into the intestinal lumen [1]. However, despite ongoing research, the molecular
mechanisms regulating zinc absorption are not yet fully elucidated. Human intestinal zinc
resorption was shown to be a regulated process, as the fractional zinc resorption varies
between 20–60%, generally decreasing with elevated zinc intake [2]. The amount of
absorbed zinc is not only influenced by oral zinc intake, but particularly depends on its
accessibility in the intestine, which is strongly influenced by food components such as
phytate, impairing the intestinal zinc availability. Additionally, amino acids and several trace
elements were reported to impact enterocytes’ zinc uptake [3]. Notably, the intestinal
availability of trace elements in general does not exclusively depend on food components,
but is also influenced by the intestinal mucus layer. Specifically, the mucus was shown to
bind ions such as iron, lead, and zinc preventing their hydroxypolymerisation at intestinal pH
and increasing their solubility and availability for the intestinal epithelium [4–6]. It has been
suggested that the affinity of mucins for metals increases from M+ < M2+ < M3+ leading to a
competitive binding to the glycoproteins and consequentially influencing their bioavailability
[5,7,8]. In fact, while the impact of mucins for iron resorption was investigated in detail,
there is evidence that the mucus layer might also be important for zinc uptake by the human
intestinal mucosa, as zinc binding by mucins was observed in animal studies [4,5,9,10].
Nevertheless, the detailed role of the intestinal mucus on human zinc absorption has not yet
been investigated.
Mucus, synthesized and secreted by goblet cells, covers the entire gastrointestinal tract
protecting the underlying epithelium against the luminal content, and plays an essential role
in nutrition and health [11]. While a single loosely bound mucus layer supports the
resorption of nutrients in the small intestine, this physical barrier is extended by an
additional adherent mucus layer in the stomach and colon [11]. The gastrointestinal mucus is
mainly constituted of water, ions, lipids and 5–10% highly glycosylated proteins: the mucins.
These proteins maintain their macromolecular network-like structure by being largely
composed of Serine, Threonine and Proline tandem-repeats and O-linked oligosaccharides as
well as of fewer O-glycosylated cysteine-rich regions (recently reviewed in [12,13]). Thus, the
intestinal epithelium does not only consist of enterocytes, absorbing the nutrients from the
luminal content, but contains a variety of other cell types of which goblet cells are the most
abundant, constantly secreting mucins into the lumen [14].
In vitro intestinal models provide a standardized and easy platform to analyze the
bioavailability of nutrients, such as trace elements, as well as transport kinetics [15], offering
a promising tool to illuminate distinct molecular aspects of intestinal zinc resorption. Not
![Page 103: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/103.jpg)
In vitro Studies on Zinc Binding and Buffering by Intestinal Mucins
87
only are changes in cellular zinc tracked by using inductively-coupled plasma mass
spectrometry (ICP-MS) and flame atomic absorption spectrometry (FAAS), but the
application of low molecular weight sensors as an approach to measure zinc uptake [16–18]
gained importance to determine small changes in the intracellular zinc pool [19]. These
models always need to resemble the in vivo situation, not only concerning buffer and
medium constituents, but also cellular composition. Until now, in vitro studies on intestinal
zinc uptake were mainly conducted using the Caco-2 model, which was already shown to
express the main intestinal zinc transporters [17]. This cell line is very well characterized and
differentiates into a cell monolayer morphologically and functionally representing the
enterocytes in vivo [20]. Some disadvantages of this in vitro cell model concerning
overexpression of the Pgp-protein and lack of a mucus layer were improved by introducing
the Caco-2/HT-29-MTX co-culture [21,22]. This well characterized co-culture of Caco-2 cells
and the goblet cell line HT-29-MTX [22,23] was shown to be covered by mucus with a
thickness of at least 2–10 µm after fixation [21] and has already been used to investigate the
role of mucins on bacterial adhesion [24] as well as on the resorption of nutrients [21,25,26].
Furthermore, this co-culture was recently applied by our group to study the impact of a
basolateral zinc acceptor on zinc resorption [17].
The aim of this study is to examine the role of intestinal mucins for zinc resorption. Herein,
zinc binding properties of these glycoproteins and their zinc affinity are investigated in cell-
free measurements as well as in the presence of intestinal cells to clarify the role of the
mucus layer on zinc uptake. Finally, zinc transport was measured comparing a conventional
Caco-2 monoculture and the Caco-2/HT-29-MTX co-culture to investigate the impact of
mucins on the actual zinc transfer.
![Page 104: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/104.jpg)
In vitro Studies on Zinc Binding and Buffering by Intestinal Mucins
88
6.2 Results
6.2.1 Zinc Binding by Intestinal Mucins
First, the property of mucins to bind and release zinc was investigated using the zinc-
chelating chromophore 4-(2-pyridylazo)resorcinol (PAR) (additional spectrophotometric
titration of the zinc-(PAR)2-complex in Supplementary Figure S6.1). Figure 6.1 shows a
significant decrease of the free zinc concentration after applying 2.5–10 mg mL-1 zinc-
depleted mucins (one-way analysis of variance (ANOVA) with Dunnett’s multiple comparison
test; p < 0.001), indicating zinc binding by the gastrointestinal glycoproteins.
Figure 6.1: Effect of mucins on zinc availability for 4-(2-pyridylazo)resorcinol (PAR).
Effect of mucins on zinc availability for PAR is shown as free zinc relative to the initially added zinc concentration. Different concentrations of zinc-depleted porcine mucin were incubated with 8 µM zinc and free zinc was analyzed using the colorimetric zinc chelator PAR. Data are presented as means + standard deviation (SD) of at least three independent experiments. Significant differences to the control are indicated (*** p < 0.001; one-way analysis of variance (ANOVA) with Dunnett’s multiple comparison test).
Subsequently, the binding capacity of these mucins was further investigated after dialysis of
porcine mucins with different zinc concentrations for 12 h against Tris(hydroxymethyl)-
aminomethane (Tris)-buffered saline (TBS) (selection of the appropriate dialysis time in
Supplementary Figure S6.2). Here, the zinc content of zinc-loaded mucins increased
significantly compared to mucins without added zinc (Figure 6.2).
![Page 105: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/105.jpg)
In vitro Studies on Zinc Binding and Buffering by Intestinal Mucins
89
Figure 6.2: Zinc binding properties of gastrointestinal mucins.
Different zinc concentrations were added to 25 mg mL-1 zinc-depleted porcine mucins and dialyzed against (Tris)-buffered saline (TBS) for 12 h. Subsequently the amount of zinc retained by binding to mucins was measured using flame atomic absorption spectrometry (FAAS) (A). Moreover, the zinc content of mucins after zinc loading is shown relative to the glycoprotein content measured by quantitative periodic acid Schiff (PAS)-assay (B), and relative to protein content of mucins measured by bicinchoninic acid (BCA)-assay (C). Data are shown as means + SD of at least three independent experiments. Significant differences to the control are indicated (** p < 0.01; *** p < 0.001; one-way ANOVA with Dunnett’s multiple comparison test).
The addition of 10,000 µM zinc before dialysis resulted in a beginning zinc-saturation of the
glycoproteins (Figure 6.2A). These samples were defined as high zinc-loaded mucins. In total,
three different degrees of zinc-loaded mucins were selected for further analysis: in addition
to the high zinc-loaded mucins, also medium and low zinc-loaded mucins were dialyzed in
the presence of 5000 µM or 2500 µM zinc, respectively. Next, zinc values were normalized to
the total glycoprotein and protein content of the mucin samples after dialysis. These also
depended on the amount of zinc present during dialysis, and maximum amounts of 5.7 mg
zinc per g glycoprotein (Figure 6.2B) and of 94.2 mg per g protein (Figure 6.2C) were
determined for the high zinc-loaded mucins.
Finally, the zinc binding affinity of zinc-depleted porcine mucin was analyzed using the
colorimetric reagent 2-carboxy-20-hydroxy-50-sulfoformazylbenzene monosodium salt
(zincon) (additional spectrophotometric titration in Supplementary Figure S6.3) and
compared to the affinity of zinc-depleted mucins harvested from the goblet cell line HT-29-
MTX (Figure 6.3A,B). This analysis yielded similar dissociation constants for the zinc-mucin-
complexes with 6.8 µM for porcine and 5 µM for HT-29-MTX mucin.
![Page 106: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/106.jpg)
In vitro Studies on Zinc Binding and Buffering by Intestinal Mucins
90
Figure 6.3: Zinc binding affinity of gastrointestinal mucins.
Shown are zinc binding affinities of two different zinc-depleted mucins analyzed with the chromophore Zincon. For this, 1 mg mL-1 porcine mucins (A) and mucins harvested from HT-29-MTX (B) were used. Data were analyzed with GraphPad Prism software version 5.01 (GraphPad Software Inc., San Diego, CA, USA) and a non-linear regression assuming a one site-specific binding with Hill slope as a function of the zinc concentration was applied to calculate the dissociation constants of the mucin-zinc-complex as indicated. Data are presented as means ± SD of three independent experiments.
![Page 107: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/107.jpg)
In vitro Studies on Zinc Binding and Buffering by Intestinal Mucins
91
6.2.2 Role of Zinc Buffering by Mucins on Zinc Uptake into Goblet Cells
Next, the impact of mucins on zinc uptake by goblet cells was investigated. Zinc absorption
of mucin-producing HT-29-MTX cells with or without mucin removal as well as the
enterocyte cell line HT-29 was analyzed with the fluorescent low molecular weight zinc
probe Zinpyr-1 and is depicted as the increase of intracellular free zinc (Figure 6.4A–C). Of
note, the term “free” zinc is frequently used to describe the zinc pool that is complexed by
small molecule ligands [27], which was already employed to investigate short-term zinc
uptake in intestinal cells [16,17]. In detail, HT-29 showed a concentration-dependent zinc
absorption (Figure 6.4A), while zinc uptake of the mucin-producing HT-29-MTX cells was very
slight and concentration-independent (Figure 6.4B). When extracellular mucins were
depleted with N-acetylcysteine (NAC), zinc uptake of HT-29-MTX cells increased (Figure
6.4C). Notably, analysis of the intracellular distribution of the fluorescent zinc sensor
revealed a vesicular accumulation in both cell lines (Figure 6.4D). Extracellular mucins were
visualized with the high molecular fluorescein isothiocyanate (FITC)-dextran 20 kDa (FD-20).
It intercalates in the mucus layer due to its high molecular weight [28], and was analyzed
using confocal laser scanning microscopy (CLSM) together with staining of the cell
membrane (Figure 6.4E). Z-scans showed differences in the mucin thickness of HT-29 and
HT-29-MTX, with HT-29 showing only slight FD-20-staining, whereas the HT-29-MTX goblet
cells produced a thick extracellular mucin layer, which decreased visibly after mucin
depletion. Moreover, mucin secretion of HT-29-MTX cells and its successful depletion with
NAC was further investigated by immunofluorescent staining of the MUC5AC-apoprotein
together with nuclear staining using Hoechst (Figure 6.4F). It shows a diffuse distribution of
the MUC5AC-apoprotein over the cell layer of HT-29-MTX, whereas no MUC5AC-staining
was observed for mucin-depleted HT-29-MTX and HT-29 cells.
![Page 108: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/108.jpg)
In vitro Studies on Zinc Binding and Buffering by Intestinal Mucins
92
Figure 6.4: Effect of mucin depletion on zinc-resorption in HT-29-MTX.
(A–C) Zinc uptake of the enterocytes HT-29 was analyzed with the fluorescent probe Zinpyr-1 (A) and compared to the zinc-uptake of the goblet cell line HT-29-MTX (B). Additionally, the effect of mucin depletion on zinc absorption of HT-29-MTX was analyzed after removing extracellular mucins using 10 mM N-acetylcysteine (C). Data are presented as means ± standard error of the mean (SEM) of three independent experiments. (D) Cellular distribution of Zinpyr-1 in HT-29 and HT-29-MTX cells together with nuclear staining using Hoechst was analyzed by fluorescence microscopy. Scale bar 20 µm. (E) Visualization of extracellular mucins with fluorescein isothiocyanate (FITC)-dextran was conducted using confocal laser scanning microscopy. Shown are z-stacks of HT-29, HT-29-MTX and HT-29-MTX without mucins after incubation with FITC dextran (green). The cell layer is stained with a cell membrane-tracker (red). Scale bar 50 µm. (F) Immunochemical detection of MUC5AC and nuclear staining using Hoechst using fluorescence microscopy in HT-29, regular HT-29-MTX and HT-29-MTX after removal of mucins. Scale bar 20 µm.
![Page 109: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/109.jpg)
In vitro Studies on Zinc Binding and Buffering by Intestinal Mucins
93
6.2.3 Impact of Extracellular Mucins on Zinc Uptake into Enterocytes
The impact of different mucin concentrations on short-term zinc uptake into the intestinal
cell line Caco-2 was investigated with Zinpyr-1 (Figure 6.5A). Cellular free zinc is increasing
after adding 25 and 50 µM zinc, respectively, but decreases significantly with added zinc-
depleted porcine mucin (one-way ANOVA with the Bonferroni post hoc test: 1.25 mg mL-1
(25 µM): p < 0.05; 2.5 mg mL-1 (25 µM and 50 µM): p < 0.05; 5 mg mL-1 (25 µM and 50 µM): p
< 0.05). Moreover, Figure 6.5B presents imaging of the cellular localization of Zinpyr-1
fluorescence in Caco-2 cells unveiling a predominantly vesicular distribution of the
fluorescence.
Figure 6.5: Impact of zinc-depleted mucins on zinc uptake by enterocytes.
(A) Zinc uptake in Caco-2 cells after zinc incubation for 40 min in the presence of different concentrations of zinc-depleted porcine mucin is shown as the increase of free zinc using the fluorescent zinc probe Zinpyr-1. Data are shown as means + SD of at least three independent experiments. Significant differences from 0 mg mL-1 zinc-depleted porcine gastric mucin within one
zinc concentration are indicated (*, #, •p < 0.05; **p < 0.01; ***p < 0.001, one-way ANOVA with
Dunnett’s multiple comparison test). (B) Fluorescence microscopy showing the intracellular distribution of the zinc-dependent signal of the fluorescent probe Zinpyr-1 in Caco-2 cells together with nuclear staining using Hoechst. Scale bar 20 µm.
Short-term zinc uptake in the presence of 5 mg mL-1 zinc-depleted porcine mucins was also
investigated by FAAS, yielding no significant change of the cellular zinc content either with or
without zinc-depleted mucins (Figure 6.6A). In comparison, long-term zinc absorption in the
presence of 0 and 5 mg mL-1 zinc-depleted mucins, also conducted with FAAS, resulted in a
significant increase of the cellular zinc content of Caco-2 cells after applying zinc without
mucins (Figure 6.6B; one-way ANOVA with Dunnett’s multiple comparison test; 25 µM: p <
0.001; 50 µM: p < 0.01). The incubation of zinc together with 5 mg mL-1 mucins did not
significantly change the cellular zinc content.
![Page 110: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/110.jpg)
In vitro Studies on Zinc Binding and Buffering by Intestinal Mucins
94
Figure 6.6: Impact of extracellular mucins on zinc uptake in Caco-2 cells measured with FAAS.
The influence of extracellular addition of zinc-depleted mucins on the uptake of different zinc concentrations in enterocytes was investigated after incubation for 30 min (A) and 24 h (B). Cellular zinc content was analyzed using FAAS and is shown relative to cellular protein. Data are shown as means + SD of three independent experiments. Means significantly different from the untreated controls are indicated (* p < 0.05; ** p < 0.01; one-way ANOVA with Dunnett’s multiple comparison test).
Next, the zinc buffering capacity of mucins and their zinc release into enterocytes was
investigated in an experimental setting closer to the in vivo situation by using the
aforementioned low, medium and high zinc-loaded porcine mucins. First, cellular zinc uptake
from zinc-loaded mucins diluted to a final zinc concentration of 25 µM was compared to the
absorption of 25 µM zinc without mucins (Figure 6.7A). While low and medium zinc-loaded
mucins resulted in a comparable rise of intracellular free zinc, high zinc-loaded mucins
caused a significant increase. However, they did not reach the levels of cellular zinc that
were observed without mucins (Figure 6.7A).
![Page 111: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/111.jpg)
In vitro Studies on Zinc Binding and Buffering by Intestinal Mucins
95
Figure 6.7: Effect of mucin zinc saturation on zinc uptake by enterocytes.
The impact of the degree of zinc saturation of extracellular added mucins on zinc uptake in Caco-2 cells is shown by measuring the increase of free zinc using the fluorescent zinc probe Zinpyr-1. Porcine mucins were incubated with 2500 µM, 5000 µM and 10,000 µM zinc, resulting in mucins with differing zinc content (low, medium, high) and degree of zinc saturation. (A) Zinc absorption of Caco-2 cells after 40 min of treatment with 25 µM zinc alone or with zinc-loaded mucins, diluted to a final zinc concentration of 25 µM zinc (final mucin concentration: 1 mg mL-1 low zinc mucin, 0.46 mg mL-1 medium zinc mucin, 0.31 mg mL-1 high zinc mucin). (B) Zinc uptake after 40 min incubation with 0 µM or 25 µM zinc in the presence of 0 mg mL-1 or 0.25 mg mL-1 zinc-loaded or zinc-depleted mucins, respectively. Data are presented as means + SEM of at least three independent experiments. Significant differences were analyzed by repeated-measures ANOVA with the Bonferroni post hoc test. Bars sharing a letter (a, b, c, d) are not significantly different.
To elaborate the influence of the zinc buffering capacity of mucins on cellular zinc uptake,
the absorption of 25 µM zinc in the presence of 0.25 mg mL-1 zinc-loaded or zinc-depleted
mucins was analyzed (Figure 6.7B). This was then compared to the uptake of 25 µM zinc
without mucins. Here, intracellular free zinc increased significantly, whereas the presence of
![Page 112: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/112.jpg)
In vitro Studies on Zinc Binding and Buffering by Intestinal Mucins
96
zinc-depleted mucins diminished the zinc uptake comparable to the results shown in Figure
6.5. Incubating the cells with 0.25 mg mL-1 zinc-loaded mucins (w/o additional zinc), a similar
slight increase of free zinc regardless of the mucins’ remaining zinc binding capacity and zinc
content was detected. Adding zinc-loaded mucins and 25 µM zinc simultaneously to the cells
yielded a significant rise of free zinc in the presence of high zinc-loaded mucins (repeated-
measures ANOVA; high zinc-loaded mucins with 25 µM zinc compared to high zinc mucins
with 0 µM: p < 0.05). This increase was similar to the absorption of 25 µM zinc in the
absence of mucins. In contrast, low and medium zinc mucins, still not completely saturated
with zinc, showed no additional zinc absorption in the presence of 25 µM zinc.
6.2.4 Comparison of Zinc Resorption in Different Intestinal Cell Culture Models:
The Role of Mucins
Finally, the role of intestinal mucins on zinc resorption was analyzed comparing zinc
transport by a Caco-2/HT-29-MTX co-culture with a Caco-2 monoculture. The integrity of the
cell monolayers was monitored during the experiments by measuring the paracellular
permeability for FD-20 and by detecting transepithelial electrical resistance (TEER) at the
beginning and end of the experiments, revealing no impairment of both parameters during
the resorption study (Supplementary Figure S6.4). The presence of goblet cells in the co-
culture did not influence the permeability of the cell monolayer, as the transepithelial
resistance of the co-cultures and Caco-2 monocultures did not differ significantly (co-
cultures: 1146.7 ± 25.5 Ω cm2; monocultures: 1288.9 ± 239.2 Ω cm2) and the paracellular
permeability was comparable to those measured in the absence of goblet cells
(Supplementary Figure S6.4).
Apical zinc uptake by the monoculture, relative to the initially applied zinc concentrations,
was declining with increasing amounts of zinc. In contrast, the Caco-2/HT-29-MTX co-culture
absorbed comparable amounts between 12.8% and 14.2% of all added zinc concentrations
(Figure 6.8A,B). Regardless of the differences in the apical zinc uptake, the fractional zinc
resorption into the basolateral compartment of both intestinal models declined inversely
related to the initially added zinc. Yet, the fractional resorption was significantly higher in
Caco-2/HT-29-MTX co-cultures (Figure 6.8C,D; two-way ANOVA with the Bonferroni post hoc
test comparing the mono- and co-cultures: 25 µM: p < 0.001; 50 µM: p < 0.05). More
precisely, fractional resorption by monocultures dropped from 1.6% to 0.9%, showing only
slight concentration dependence, whereas resorption by co-cultures declined from 4.2% to
1.9% of the initially added zinc.
Additionally, in both intestinal models the cellular zinc uptake increased with added zinc,
yielding a significantly higher uptake after addition of 50 µM zinc by the co-culture (Figure
6.8E,F; two-way ANOVA with the Bonferroni post hoc test, p < 0.05).
![Page 113: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/113.jpg)
In vitro Studies on Zinc Binding and Buffering by Intestinal Mucins
97
Figure 6.8: Comparison of zinc resorption in Caco-2 monocultures and Caco-2/HT-29-MTX co- cultures.
Zinc transport studies were conducted using the enterocytes Caco-2 (A,C,E) and a co-culture of Caco-2 with the mucus-producing goblet cell line HT-29-MTX (B,D,F). Shown are the decrease of apical zinc (apical zinc uptake) (A,B) and fractional zinc resorption after 4 h incubation relative to the initially added amount of zinc (C,D). Moreover, cellular zinc uptake is shown relative to cellular protein content (E,F). Data are shown as means + SD of three independent experiments and means significantly different from the untreated controls are indicated (* p < 0.05; ** p < 0.01; *** p < 0.001; one-way ANOVA with Dunnett’s multiple comparison test). According to a two-way ANOVA with the Bonferroni post hoc test comparing the results within one added zinc concentration of the mono- and co-cultures there are significant differences regarding the fractional zinc resorption (25 µM: p < 0.001; 50 µM: p < 0.05), and zinc uptake (50 µM: p < 0.05).
![Page 114: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/114.jpg)
In vitro Studies on Zinc Binding and Buffering by Intestinal Mucins
98
Supplementary Table S6.1 summarizes detailed quantitative data of zinc uptake into the
cells, cellular zinc content, and the amount of zinc transported to the basolateral
compartment. Over all, the zinc transport study resulted in higher zinc transport rates for
the mucin-producing co-culture (Figure 6.9A,B; monoculture: 0.3–1.29 nmol zinc cm-2; co-
culture: 1.1–2.3 nmol zinc cm-2). In detail, according to a two-way ANOVA with the
Bonferroni post hoc test comparing the results of the two intestinal models within one
added zinc concentration, the co-culture resulted in a significantly higher zinc transport rate
of initially added 100 µM (p < 0.05).
Figure 6.9: Zinc transport rates in Caco-2 monocultures and Caco-2/HT-29-MTX co-cultures.
Zinc transport rates in nmol zinc per cm2 resorption area in mono- and co-cultures are displayed. Data are presented as means + SD of three independent experiments. Significant differences to control cells (0 µM zinc) are indicated (** p < 0.01; one-way ANOVA with Dunnett’s multiple comparison test). According to a two-way ANOVA with the Bonferroni post hoc test comparing the results within one added zinc concentration of the mono- and co-cultures, there is a significant difference between the zinc transport rate at 100 µM (p < 0.001).
![Page 115: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/115.jpg)
In vitro Studies on Zinc Binding and Buffering by Intestinal Mucins
99
6.3 Discussion
Zinc binding by the mucus layer was already observed in animal studies [4,5,9,10],
suggesting that mucins could play a role in human intestinal zinc absorption. However, little
was known about the distinct zinc binding properties of these glycoproteins. The present
study demonstrated that zinc binding is not only dependent on the amount of the available,
or rather, free zinc concentration, but also on the zinc : mucin ratio. Assuming an
approximate molecular mass of intestinal mucins of 2.5 MDa [29,30], the employed mucin
concentrations between 2.5–10 mg mL-1 correspond to 1 µM–4 µM mucin, resulting in a 2–
8-fold molar excess of zinc in the assay. When applying an 8-fold molar zinc excess, 50% of
zinc was retained by the glycoproteins, declining to almost no free zinc at a molar zinc :
mucin ratio of 2 (Figure 6.1). This suggests multiple zinc-binding sites within one mucin
molecule with biologically relevant affinity.
Notably, gastrointestinal mucins were able to decrease the amount of available zinc for the
high affinity colorimetric reagent PAR (dissociation constant of the zinc-(PAR)2-complex
7.08·10-13 M2 [31]), indicating that at least some of the binding sites have high affinity for
zinc. The coordination of metals by proteins strongly depends on the metal ion preference
for particular electron donors [32]. Zinc tends to form stronger covalent binding to nitrogen
and sulfur and weak complexes with oxygen [32]. The latter are highly present in mucins by
carboxylate groups of the O-glycans [13]. Nitrogen and Sulfur are part of both human and
porcine intestinal mucins containing N-acetyl groups (N-acetyl-galactosamine (GalNac), N-
acetylneuraminic acid (NeuAc)) [33,34] and on average about 8–14% free thiols [35,36],
possibly playing an important role in the zinc binding affinity of mucins.
The zinc binding capacity of mucins was further investigated by dialysis of pig gastric mucins
against different zinc concentrations, resulting in low, medium and high zinc-loaded mucins
(Figure 6.2). According to the present study, mucins have an average molar zinc binding
capacity of about 200, indicating a multiplicity of zinc-binding sites within one mucin
molecule, possibly providing a broad spectrum of different binding affinities. Mucins are
highly glycosylated proteins, consisting of approximately 80% carbohydrates [11,13]. Thus,
the total amount of zinc bound per g protein is one order of magnitude higher than per g
glycoprotein (Figure 6.2B,C). These results are comparable to those obtained by Quarterman
et al. analyzing zinc binding of porcine mucins at different pH levels, which led to a zinc
content of 10 mg zinc per g mucin at pH 7.5 [4]. Furthermore, the binding constants of
porcine gastric mucin and mucins obtained from the cell line HT-29-MTX are in good
agreement with each other (Figure 6.3), and additionally are of the same magnitude as
luminal zinc levels [37,38]. Given the high number of binding sites, they probably represent
an average dissociation constant of the zinc-mucin-complex, constituting a mixture of
several binding sites with varying affinities.
Diet-derived luminal factors influence intestinal zinc bioavailability [39]. Together with
physiological factors such as luminal fluid and mucus layer, these components represent the
luminal matrix, which influences zinc speciation, consequently affecting its availability for
![Page 116: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/116.jpg)
In vitro Studies on Zinc Binding and Buffering by Intestinal Mucins
100
enterocytes [4,18]. To illuminate the impact of apically present zinc binding proteins on zinc
uptake into enterocytes, a recent study of our group investigated the effect of albumin on
zinc absorption. Albumin significantly reduced short-term zinc uptake measured with the
low molecular weight sensor Zinpyr-1 [17]. By the same technique, the role of mucins in
short-term zinc absorption was analyzed in the present study. The goblet cell line HT-29-MTX
produces and secretes mucins covering the cell surface, as shown by qualitative analysis
using immunochemical staining of the MUC5AC-apoprotein (Figure 6.4E), which is
comparable to previous MUC5AC-stainings of HT-29-MTX mucins [40]. Yet, the impact of the
mucus layer on their zinc uptake has not been investigated before. Zinc uptake of HT-29-
MTX before and after mucin depletion was analyzed and compared to the intestinal
absorptive cells HT-29. Overall, mucin depletion caused a FD-20- and MUC5AC staining
almost similar to that of HT-29 cells, confirming a successful removal of extracellular mucins
by N-acetylcysteine. Notably, short-term zinc uptake of HT-29-MTX was impaired by
extracellular mucins, which indicates zinc binding and buffering by the glycoproteins
produced by these cells. In Caco-2 cells, cellular zinc absorption also decreased significantly
with elevated concentrations of zinc-depleted porcine mucins (Figure 6.5A), comparable to
the impairment by albumin [17]. In addition to the analysis with the low molecular weight
sensor Zinpyr-1, short-term zinc uptake by Caco-2 cells was also measured with FAAS
resulting in no significant change of cellular zinc, either with or without mucins (Figure 6.6A).
Only long-term zinc incubation of Caco-2 cells resulted in a significant increase of cellular
zinc in the absence of mucins (Figure 6.6B). Consistent with previous findings, changes in
intracellular zinc after short-term incubation of Caco-2 cells are probably too small
compared to the cellular zinc content to be detected by FAAS [17].
From the uptake studies shown in Figure 6.5A and Figure 6.6 it could be concluded that
mucins impair intestinal zinc availability. However, these porcine mucins were zinc-depleted,
which is compulsory for investigating zinc binding capacity and affinity, but does not
represent the in vivo situation in the intestinal lumen under zinc adequate conditions
[38,41]. This is corroborated by the fact that the commercially available porcine mucins
contained considerable amounts of zinc before zinc-depletion with Chelex® 100 Resin.
Accordingly, the impact of zinc-loaded mucins on zinc uptake into enterocytes was examined
using zinc-containing mucins (low, medium and high zinc-loaded mucins; Figure 6.7). Here,
all three types of mucins seemed to release part of their zinc, resulting in an increase of
cellular free zinc compared to control cells (Figure 6.7A). Interestingly, this release appeared
to be largely independent of the mucins’ zinc content and their remaining zinc binding
capacity, adding the same concentration of differentially loaded mucins to the cells resulted
in similar zinc uptake (Figure 6.7B). These observations suggest that mucins buffer the
cellular available zinc concentration in the lumen, still keeping it available for enterocytes. In
animal studies, intestinal mucins were discussed to absorb zinc from the luminal content
transferring it to the mucosa [9,10]. Zinc transfer to the intestinal cells occurred slower than
the initial zinc binding by mucins [9]. In this manner, the intestinal mucus layer might lead to
retention of luminal available zinc, possibly providing intestinal cells with zinc for extended
![Page 117: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/117.jpg)
In vitro Studies on Zinc Binding and Buffering by Intestinal Mucins
101
periods of time after food intake. This implies that mucins act as a zinc delivery system from
the lumen to the intestinal epithelium, which was already postulated for iron [5], and led to
our hypothesis that zinc-saturated mucins might facilitate zinc delivery to enterocytes. In the
present study, however, cellular zinc uptake in the presence of zinc-saturated mucins was
similar, but not augmented, compared to the absence of mucins (Figure 6.7B). This
discrepancy might be due to insufficient equivalence to the in vivo situation: first, the
basolateral compartment, where the absorbed zinc can be exported, is lacking. Second, the
mucins applied in this study were commercially available isolated porcine mucins, which
might not be entirely comparable to the native mucins produced by goblet cells [42].
Although these mucins are often used as a standard model for the mucus layer to investigate
characteristics of gastrointestinal mucins [43] and their role in intestinal metal uptake [28],
they are also known to have weaker gel-forming abilities [44], possibly due to protease
treatment during the isolation and purification process [42].
To overcome both issues, the impact of chemically unprocessed mucins on intestinal zinc
resorption in a three-dimensional culture was investigated by transport studies in the mucin-
producing Caco-2/HT-29-MTX co-culture, which were then compared to zinc transport in the
absence of a mucus layer using conventional Caco-2 monocultures. Herein, the mucin-
producing co-culture clearly yielded higher zinc absorption than the mucus-lacking
monoculture (Figure 6.8). The Caco-2/HT-29-MTX model resulted in a stronger decrease of
the apical zinc concentration, varying around 12.7–14.1% independent of the initially added
zinc, as well as an elevated cellular zinc uptake (Figure 6.8E,F), indicating that the cellular
zinc uptake is facilitated by the mucus layer. Indeed, this supports the aforementioned
hypothesis that the mucus layer might act as a zinc delivery system for the intestinal
epithelium. Moreover, the glycoproteins seemed to assist the zinc transfer across the
intestinal epithelium as the fractional zinc resorption was significantly higher (1.8–2.4-fold
higher) in the presence of mucin-producing goblet cells. Likewise, the zinc transport rate was
elevated using co-cultures. Here, the basal zinc transport rate without the addition of
exogenous zinc was already 3.8-fold higher (1.13 ng zinc cm-2 resorption area) than that of
monocultures (0.3 ng zinc cm-2) (Figure 6.9), possibly due to resorption of the basal zinc
levels of mucins. These basal zinc levels might originate from the cell culture medium
(containing 3 µM zinc), and were incorporated by the mucins during the 21 days of
cultivation of the cell model. Thus, the mucus-secreting co-culture not only absorbed more
zinc from the apical compartment, but showed augmented zinc export to the basolateral
side, supporting previous observations that intestinal mucins represent an important factor
for intestinal zinc resorption [4,9,10].
The beneficial role of mucins for the resorption of other trace elements, such as iron, is
already well documented [21,28,45]. Concerning the essential nutrient iron, the mucus layer
not only mediates its availability for the intestinal epithelium by maintaining its solubility [5],
but was also proposed to provide its delivery to the absorptive cells by the mucin-integrin
mobilferrin pathway [45,46]. A similar mechanism might also be effective for zinc, as the
present study indicates that mucins not only influence zinc uptake by increasing its luminal
![Page 118: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/118.jpg)
In vitro Studies on Zinc Binding and Buffering by Intestinal Mucins
102
solubility, as discussed before [4], but rather promote zinc absorption by additionally acting
as a zinc delivery system for the mucosa, which would be in good agreement with
observations from animal studies [9,10].
Metal ion binding by mucins might have further implications for metal ion homeostasis. The
impact of other trace elements on zinc resorption was previously investigated and is still a
topic of ongoing research [3,47]. Mucins are not only involved in the mucosal uptake of
single trace elements, but were also suggested to influence their bioavailability by
competitively binding different metals [5]. Thus, in addition to competing for transport
proteins, competition for binding sites in mucins could be another factor for the mutual
interferences observed in intestinal trace element absorption. Furthermore, mucins not only
support intestinal zinc absorption, but might also be involved in fecal zinc loss. A
considerable amount of endogenous zinc is excreted with feces [2,48]. Even during extreme
zinc deficiency, the fecal excretion of zinc can be observed, which is defined as the
“obligatory fecal loss” [2]. The intestinal epithelium and the overlying mucus layer undergo
cycles of renewal [49,50] resulting in a complete turnover of the mucins, which is said to
occur much faster than that of the underlying mucosa [51]. Considering the amount of zinc
bound to mucins, the fast renewal of the intestinal mucus layer might play an important role
in the fecal zinc loss as the mucins are possibly excreted together with a remainder of tightly
bound zinc.
On the one hand, gastrointestinal mucins are important for zinc absorption in the intestinal
tract. On the other hand, zinc was also reported to be important for mucin synthesis, as the
gene expression profile of different mucin proteins was shown to depend on zinc supply
[52], and abdominal production as well as secretion of mucins were also decreased in zinc-
deficient animals [53,54]. Thus, further investigations of the interplay of zinc with intestinal
mucins and distinct molecular mechanisms of the mucosal delivery system are needed for a
better understanding of their role in intestinal zinc uptake as well as gastrointestinal
disorders.
![Page 119: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/119.jpg)
In vitro Studies on Zinc Binding and Buffering by Intestinal Mucins
103
6.4 Materials and Methods
6.4.1 Materials
CellMask™DeepRed (ThermoFisher Scientific,Waltham, MA, USA); Cy3® goat anti rabbit IgG
(Jackson ImmunoResearch, Dianova, Hamburg, Germany); Chelex® 100 Resin (Bio-Rad,
Hercules, CA, USA); Dulbecco’s modified Eagles medium (DMEM) (PAN-Biotech, Aidenbach,
Germany); Hoechst 33258 (Sigma Aldrich, Munich, Germany); fluorescein isothiocyanate
(FITC)-dextran 20 (TdB, Uppsala, Sweden); fetal calf serum (FCS) (CCPro, Oberdorla,
Germany); mucin from porcine stomach Type II (Sigma Aldrich, Munich, Germany); PAR
(Sigma Aldrich, Munich, Germany); Transwell inserts (Corning, New York, NY, USA);
N,N,N’,N’-Tetrakis(2-pyridylmethyl)ethylenediamine (TPEN) (Sigma Aldrich, Munich,
Germany); WillCo-dish® glass bottom dish (WillCo, Amsterdam, The Netherlands); Zincon
(Sigma Aldrich, Munich, Germany); ZnSO4·7H2O (Sigma Aldrich, Munich, Germany). All other
chemicals were purchased from standard sources.
6.4.2 Cell Culture
Caco-2, HT-29-MTX and HT-29 cells were cultured at 37°C, 5% CO2 and in a humidified
atmosphere in DMEM, containing 10% FCS, 100 U mL-1 penicillin and 100 µg mL-1
streptomycin. Additionally, medium for HT-29-MTX contained 1% non-essential amino acids
(NEAA). Media were changed every other day. Analysis of proper differentiation,
morphology and barrier integrity of Caco-2 cells cultured in our lab into an enterocyte-like
phenotype after 21 days, as shown before [20,55], was reported previously [56]. Caco-2, HT-
29-MTX and HT-29 cells were obtained from European Collection of Cell Cultures (ECACC,
Porton Down, UK).
6.4.3 4-(2-Pyridylazo)Resorcinol (PAR) Assay
Zinc binding by mucins was investigated with the colorimetric reagent PAR. The assay was
performed in TBS, containing 50 mM Tris(hydroxylmethyl)aminomethan and 150 mM NaCl,
at pH 7.5. Stock solutions of 25 mg mL-1 porcine mucins were prepared in TBS and zinc-
depleted using Chelex® 100 Resin according to the manufacturer’s protocol (zinc content
before depletion: 436 µg g-1 mucin; zinc content after depletion: 16.2 µg g-1 mucin). Different
mucin concentrations were incubated with 8 µM ZnSO4·7H2O and 20 µM PAR (stock solution
25 mM in H2O) was added. Absorption of the zinc-(PAR)2-complex was measured at 485 nm
using a well plate reader (M200, Tecan, Switzerland) and the effect of mucins on the
availability of zinc for PAR was analyzed using an external calibration of 0–10 µM zinc
obtained by spectrophotometric titrations followed by linear regression analysis.
6.4.4 Zinc Binding Capacity
The zinc binding capacity of gastrointestinal mucins was investigated by dialysis. 25 mg mL
mL-1 mucins were incubated with 0–100 mM ZnSO4·7H2O overnight and dialyzed against 1.5
L TBS for 6, 12 and 24 h. Finally, zinc concentrations were determined with FAAS using a
Perkin Elmer AAnalyst800 (Perkin Elmer, Rodgau, Germany) and zinc binding capacity was
![Page 120: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/120.jpg)
In vitro Studies on Zinc Binding and Buffering by Intestinal Mucins
104
calculated relative to the zinc concentrations before dialysis. Furthermore, the amount of
protein in the mucin samples after dialysis was analyzed using BCA-assay as described [57]
and the glycoprotein content in the mucin samples was detected using the quantitative PAS-
assay from Schömig et al. [44].
6.4.5 Zinc Binding Affinity of Mucins
The binding affinity of commercially available porcine gastric mucins and mucins produced
by the cell line HT-29-MTX were investigated with the chelating chromophore zincon [31].
Secreted mucins from HT-29-MTX were collected after culturing the cells for 13 days,
washing with phosphate buffered saline (PBS) and additional incubation in DMEM without
phenol red (with 100 U mL-1 penicillin and 100 µg mL-1 streptomycin, w/o FCS) for 24 h.
Subsequently, the cell supernatant was collected and secreted mucins were concentrated to
an 8-fold increase after desalting and washing with TBS using ultrafiltration (molecular
weight cut-off: 50 kDA) followed by zinc depletion using Chelex® 100 Resin (zinc content
before depletion: 59.2 µg g-1 protein; zinc content after depletion: 4.1 µg g-1 protein). Protein
content was analyzed using BCA assay as described [57]. Finally, zincon in TBS pH 7.5 (final
concentration 50 µM) was added to either 1 mg mL-1 commercially available porcine mucin
or the equivalent protein amount of secreted mucins from HT-29-MTX, respectively, and
titrated with 0–60 µM ZnSO4·7H2O. Subsequently, the absorption was determined on a well
plate reader (M200, Tecan, Switzerland) at 620 nm. The amount of mucin-bound zinc was
calculated using an external calibration. Data were analyzed with GraphPad Prism software
version 5.01 (GraphPad Software Inc., San Diego, CA, USA) and a non-linear regression
assuming a one site-specific binding with Hill slope as a function of the zinc concentration
was applied.
6.4.6 Cellular Zinc Uptake Measured by Zinpyr-1
Short-term zinc uptake in Caco-2, HT-29 and HT-29-MTX was quantified as the increase of
free zinc [nM] using the low molecular zinc probe Zinpyr-1. The concentration of free zinc
was determined using the following equation of Grynkiewicz et al. [Zinc] = Kd × [(F - Fmin) /
(Fmax - F)] [58] and a dissociation constant for the zinc-Zinpyr-1-complex of 0.7 nM [59]. Cells
were transferred to 96-well plate and cultured for 21 days (Caco-2; initial cell number per
well: 5000) or 7 days (HT-29 and HT-29-MTX; initial cell number per well: 10,000),
respectively. On the day of the experiment, cells were incubated with 2.5 µM Zinpyr-1 and
the uptake of zinc, in the presence or absence of mucins as indicated in the respective figure
legends, was measured as the increase of free zinc on a fluorescence well plate reader
(Spark, Tecan, Switzerland; Zinpyr-1 fluorescence: λex = 508 nm and λem = 527 nm) as
described [17].
6.4.7 Removal of Extracellular Mucins by N-Acetylcysteine
Extracellular mucins of the goblet cell line HT-29-MTX were removed by reducing the intra-
and intermolecular disulfide bounds in the glycoproteins using NAC [21,60]. Before analyzing
zinc uptake of HT-29-MTX, cells were treated twice with 10 mM NAC in PBS for 10 min.
![Page 121: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/121.jpg)
In vitro Studies on Zinc Binding and Buffering by Intestinal Mucins
105
Between treatments, cells were incubated in DMEM for 1 h. Successful removal of
extracellular mucins was examined using immunochemical staining of the main glycoprotein
of HT-29-MTX, MUC5AC, and fluorescence microscopic visualization with FD-20.
6.4.8 Immunochemical Staining of the MUC5AC Glycoprotein
Immunochemical staining of MUC5AC was performed using the mucin-specific antiserum
MAN-5ACI for the polypeptides of MUC5AC [61,62]. Therefore, HT-29-MTX and HT-29 cells
were seeded on glass slides and cultivated for 7 days. Depletion of extracellular mucins of
HT-29-MTX prior to immunochemical staining was performed as described above. Cells were
fixed on ice with a final concentration of 3.7% formaldehyde directly added to the cell
medium, washed with cold PBS and permeabilized using 0.5% Triton-X-100 in PBS for 20 min
on ice. After washing with PBS, cells were blocked with 10% FCS in TBS for 1 h, incubated
with MAN-5ACI antiserum (1:500 in TBS with 20% Tween (TBST)) overnight, followed by
additional washing and blocking. Subsequently, Cy3® goat anti rabbit IgG (indocarbocyanin
goat-anti rabbit immunoglobulin G) (1:500 in TBST) was incubated for 1 h at 37°C.
Additionally cellular nuclei were stained with Hoechst 33258. Finally, cells were washed with
TBST and evaluated by fluorescence microscopy (Axio Imager M1, Zeiss, Germany) at
excitation wavelengths of 546 nm (Cy-3) and 358 nm (Hoechst).
6.4.9 Visualizing Extracellular Mucins with Fluorescein Isothiocyanate (FITC)-
Dextran
Extracellular mucins produced by HT-29-MTX were visualized using high molecular dextran
labeled with fluorescein isothiocyanate (FD-20). Due to its size, FD-20 is trapped in the high
molecular glycoproteins, possibly due to steric hindrance [63]. To this end, HT-29 and HT-29-
MTX cells were cultured in glass bottom dishes for 14 d. Prior to the experiment, medium
was carefully removed and 100 µM FD-20 together with cell membrane tracker
CellMask™DeepRed (3.3 ng mL-1) in assay buffer (120 mM NaCl, 5.4 mM KCl, 5 mM Glucose,
1 mM CaCl2, 1 mM MgCl2, 1 mM NaH2PO4, 10 mM HEPES, pH 7.35) was incubated for 15 min
at 37°C. Subsequently, cells were washed with assay buffer and live cell imaging of
fluorescently labeled extracellular mucins was performed with a CLSM (Leica TCS SP8; λex
(FITC) = 488 nm, λem (FITC) = 510 nm; λex (CellMask™DeepRed) = 552 nm, λem
(CellMask™DeepRed) = 695 nm).
6.4.10 Total Cellular Zinc Content Measured by Flame Atomic Absorption
Spectrometry (FAAS)
For the determination of long-term zinc uptake with FAAS, 1.2·105 Caco-2 cells were seeded
in 6 well plates and cultured for 21 days. Fully differentiated cells were incubated with
different zinc concentrations with 0 or 5 mg mL-1 porcine mucin in DMEM w/o phenol red
and incubated for 24 h. Short-term uptake was conducted after 30 min incubation using 0 or
5 mg mL-1 mucin in assay buffer. Finally, cells were harvested on ice with a cell scraper, and
an aliquot was collected for protein quantification as described [57]. Subsequently, cells
![Page 122: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/122.jpg)
In vitro Studies on Zinc Binding and Buffering by Intestinal Mucins
106
were dissolved in a mixture of 67% ultrapure HNO3 and 30% H2O2 (50/50; v/v) and dried at
92°C overnight using a thermoshaker. Residues were dissolved in 0.67% HNO3 and samples
were analyzed by FAAS.
6.4.11 Zinc Transport Assay
Zinc transport studies were performed using monocultures of Caco-2 and Caco-2/HT-29-MTX
co-cultures. Co-cultures were realized with an initial cell ratio of 75% Caco-2 and 25% HT-29-
MTX cells and alternated cell seeding, modified after Nollevaux et al. [64]. Herein, the co-
culture of Caco-2 and HT-29-MTX cells in our lab was characterized concerning the proper
cellular ratio by investigating the mucin secretion and adequate differentiation of the
enterocytes as reported before [17].
Eighty thousand cells were transferred onto polycarbonate transwell membranes (pore size
0.4 µm, culture area 1.12 cm2) and cultured for 21 days in DMEM with 10% FCS, 100 U mL-1
penicillin, 100 µg mL-1 streptomycin and 1% NEAA. For the co-cultures, 25% 20,000 HT-29-
MTX cells were added 2 days after seeding of Caco-2. After 21 days, the cells were incubated
with 0 µM, 25 µM, 50 µM and 100 µM ZnSO4·7H2O in 0.5 mL transport buffer [17] on the
apical side of the transport chamber for 4 h. The basolateral compartment constituted 1.5
mL cell culture medium with 30 mg mL-1 BSA. Prior and after the experiment, barrier
integrity was monitored by measuring TEER with the epithelial volt-ohm meter Millicell®
ERS-2 (Millipore, Burlington, MA, USA). Additionally, permeability of cell monolayers during
the experiment was determined using FD-20 [64] as reported before [17]. At the end of the
experiment, the media of the apical and basolateral compartments were collected, and cells
were harvested on ice in PBS, homogenized and centrifuged (800g). An aliquot of cell
homogenates was collected for protein quantification using BCA [57]. Subsequently, cells
were dried at 92°C overnight as described above and dissolved in 0.67% HNO3. Zinc
quantification in apical, basolateral and cellular compartment was conducted by ICP-MS
after dilution (1:10 and 1:200) in 2% HNO3 containing 5 µg L-1 rhodium, using an Agilent 8800
ICP-QQQ (Agilent Technologies Deutschland GmbH, Böblingen, Germany) in the single quad-
mode [17].
6.4.12 Statistical Analysis
Statistical significance was analyzed by one- or two-way ANOVA (for multiple comparisons),
followed by Bonferroni or Dunnett’s multiple comparison post hoc tests, as indicated in the
respective figure legends, using GraphPad Prism software version 5.01 (GraphPad Software
Inc., San Diego, CA, USA). Error bars represent standard deviation or standard error of the
mean, as indicated, of at least three independent biological replicates.
6.5 Conclusion
This study provides the first comprehensive assessment of the zinc binding properties of
mucins and their impact on in vitro intestinal zinc resorption. By clarifying the molecular zinc
binding capacity of these glycoproteins and their average affinity for the bivalent cation, we
![Page 123: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/123.jpg)
In vitro Studies on Zinc Binding and Buffering by Intestinal Mucins
107
could demonstrate that mucins bind multiple zinc ions with physiologically relevant affinity.
Hereby, zinc-free mucins impair zinc uptake, but this is not the form in which they are
present in the gastrointestinal tract. 2D-experiments with isolated porcine mucins show that
mucin-bound zinc is still available for cellular uptake, but not superior to free zinc. In
contrast, the 3D co-culture of enterocytes and mucin-secreting goblet cells suggests that
mucins even facilitate zinc uptake by enterocytes, making them an integral part of intestinal
zinc resorption.
6.6 Author Contributions
Conceptualization, M.M., C.K. and H.H.; Data curation, M.M.; Formal analysis, M.M. and
H.H.; Funding acquisition, T.S. and H.H.; Investigation, M.M., J.K. and S.S.; Methodology, T.S.;
Project administration, H.H.; Resources, T.S. and H.H.; Supervision, M.M., C.K. and H.H.;
Writing-original draft, M.M.; Writing-review and editing, C.K., T.S. and H.H.
6.7 Funding
The work of H.H. and T.S. is funded by the Deutsche Forschungsgemeinschaft (TraceAge–
DFG Research Unit on Interactions of essential trace elements in healthy and diseased
elderly, Potsdam-Berlin-Jena, FOR 2558/1, HA 4318/4-1, SCHW903/16-1).
6.8 Acknowledgements
The authors would like to thank Vera Meyer from the Department of Applied and Molecular
Microbiology (Berlin Institute of Technology) for their kind support with the CLSM
measurements, David J. Thornton (University of Manchester) for generously providing the
mucin-specific antiserum MAN-5ACI, and Ayşe Duman for her excellent technical work.
6.9 Conflicts of Interest
The authors declare no conflict of interest.
6.10 References
1. Lichten, L.A.; Cousins, R.J. Cousins. Mammalian zinc transporters: Nutritional and
physiologic regulation. Annu Rev. Nutr. 2009, 29, 153–176.
2. King, J.C.; Shames, D.M.; Woodhouse, L.R. Zinc homeostasis in humans. J. Nutr. 2000,
130, 1360S–1366S.
3. Lönnerdal, B. Dietary factors influencing zinc absorption. J. Nutr. 2000, 130, 1378S–
1383S.
4. Powell, J.J.; Jugdaohsingh, R.; Thompson, R.P. The regulation of mineral absorption in
the gastrointestinal tract. Proc. Nutr. Soc. 1999, 58, 147–153.
5. Conrad, M.E.; Umbreit, J.N.; Moore, E.G. A role for mucin in the absorption of
inorganic iron and other metal cations. A study in rats. Gastroenterology 1991, 100,
129–136.
![Page 124: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/124.jpg)
In vitro Studies on Zinc Binding and Buffering by Intestinal Mucins
108
6. Powell, J.J.; Whitehead, M.W.; Ainley, C.C.; Kendall, M.D.; Nicholson, J.K.; Thompson,
R.P.H. Dietary minerals in the gastrointestinal tract: Hydroxypolymerisation of
aluminium is regulated by luminal mucins. J. Inorg. Biochem. 1999, 75, 167–180.
7. Whitehead, M.W.; Thompson, R.P.; Powell, J.J. Regulation of metal absorption in the
gastrointestinal tract. Gut 1996, 39, 625–628.
8. Powell, J.J.; Whitehead, M.W.; Lee, S.; Thompson, R.P.H. Mechanisms of
gastrointestinal absorption—Dietary minerals and the influence of beverage
ingestion. Food Chem. 1994, 51, 381–388.
9. Quarterman, J. Metal absorption and the intestinal mucus layer. Digestion 1987, 37,
1–9.
10. Glover, C.N.; Hogstrand, C. In vivo characterization of intestinal zinc uptake in
freshwater rainbow trout. J. Exp. Biol. 2002, 205, 141–150.
11. Johansson, M.E.; Sjovall, H.; Hansson, G.C. The gastrointestinal mucus system in
health and disease. Nat. Rev. Gastroenterol. 2013, 10, 352–361.
12. Birchenough, G.M.; Johansson, M.E.; Gustafsson, J.K.; Bergstrom, J.H.; Hansson, G.C.
New developments in goblet cell mucus secretion and function. Mucosal Immunol.
2015, 8, 712–719.
13. Bansil, R.; Turner, B.S. The biology of mucus: Composition, synthesis and
organization. Adv. Drug Deliv. Rev. 2018, 124, 3–15.
14. Madara, J. L. Functional Morphology of Epithelium of the Small Intestine. In
Comprehensive Physiology; Terjung, R., Ed.; JohnWiley & Sons, Inc.: Hoboken, NJ,
USA, 2011.
15. Langerholc, T.; Maragkoudakis, P.A.; Wollgast, J.; Gradisnik, L.; Cencic, A. Novel and
established intestinal cell line models - An indispensable tool in food science and
nutrition. Trends Food Sci. Tech. 2011, 22, S11–S20.
16. Sauer, A.K.; Pfaender, S.; Hagmeyer, S.; Tarana, L.; Mattes, A.K.; Briel, F.; Kury, S.;
Boeckers, T.M.; Grabrucker, A.M. Characterization of zinc amino acid complexes for
zinc delivery in vitro using Caco-2 cells and enterocytes from hiPSC. Biometals 2017,
30, 643–661.
17. Maares, M.; Duman, A.; Keil, C.; Schwerdtle, T.; Haase, H. The impact of apical and
basolateral albumin on intestinal zinc resorption in the Caco-2/HT-29-MTX co-culture
model. Metallomics 2018, 10, 979–991.
18. Haase, H.; Hebel, S.; Engelhardt, G.; Rink, L. The biochemical effects of extracellular
Zn2+ and other metal ions are severely affected by their speciation in cell culture
media. Metallomics 2015, 7, 102–111.
19. Carter, K.P.; Young, A.M.; Palmer, A.E. Fluorescent sensors for measuring metal ions
in living systems. Chem. Rev. 2014, 114, 4564–4601.
20. Pinto, M.; Robineleon, S.; Appay, M.D.; Kedinger, M.; Triadou, N.; Dussaulx, E.;
Lacroix, B.; Simonassmann, P.; Haffen, K.; Fogh, J.; et al. Enterocyte-like
differentiation and polarization of the human-colon carcinoma cell-line Caco-2 in
culture. Biol. Cell 1983, 47, 323–330.
![Page 125: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/125.jpg)
In vitro Studies on Zinc Binding and Buffering by Intestinal Mucins
109
21. Mahler, G.J.; Shuler, M.L.; Glahn, R.P. Characterization of Caco-2 and HT29-MTX
cocultures in an in vitro digestion/cell culture model used to predict iron
bioavailability. J. Nutr. Biochem. 2009, 20, 494–502.
22. Hilgendorf, C.; Spahn-Langguth, H.; Regardh, C.G.; Lipka, E.; Amidon, G.L.; Langguth,
P. Caco-2 versus Caco-2/HT29-MTX co-cultured cell lines: Permeabilities via diffusion,
inside- and outside-directed carrier-mediated transport. J. Pharm. Sci. 2000, 89, 63–
75.
23. Walter, E.; Janich, S.; Roessler, B.J.; Hilfiger, J.M.; Amidon, G.L. HT29-MTX/Caco-2
cocultures as an in vitro model for the intestinal epithelium: In vitro−in vivo
correlation with permeability data from rats and humans. J. Pharm. Sci. Exp.
Pharmacol. 1996, 85, 1070–1076.
24. Laparra, J.M.; Sanz, Y. Comparison of in vitro models to study bacterial adhesion to
the intestinal epithelium. Lett. Appl. Microbiol. 2009, 49, 695–701.
25. Calatayud, M.; Vazquez, M.; Devesa, V.; Velez, D. In vitro study of intestinal transport
of inorganic and methylated arsenic species by Caco-2/HT29-MTX cocultures. Chem.
Res. Toxicol. 2012, 25, 2654–2662.
26. Vazquez, M.; Calatayud, M.; Velez, D.; Devesa, V. Intestinal transport of
methylmercury and inorganic mercury in various models of Caco-2 and HT29-MTX
cells. Toxicology 2013, 311, 147–153.
27. Maret, W. Analyzing free zinc(II) ion concentrations in cell biology with fluorescent
chelating molecules. Metallomics 2015, 7, 202–211.
28. Jin, F.; Welch, R.; Glahn, R. Moving toward a more physiological model: Application of
mucin to refine the in vitro digestion/Caco-2 cell culture system. J. Agric. Food Chem.
2006, 54, 8962–8967.
29. Johansson, M.E.; Hansson, G.C. Mucus and the goblet cell. Dig. Dis. 2013, 31, 305–
309.
30. Holmen Larsson, J.M.; Thomsson, K.A.; Rodriguez-Pineiro, A.M.; Karlsson, H.;
Hansson, G.C. Studies of mucus in mouse stomach, small intestine, and colon. III.
Gastrointestinal MUC5AC and MUC2 mucin o-glycan patterns reveal a regiospecific
distribution. Am. J. Physiol. Gastrointest. Liver Physiol. 2013, 305, G357–G363.
31. Kocyła, A.; Pomorski, A.; Krężel, A. Molar absorption coefficients and stability
constants of metal complexes of 4-(2-pyridylazo)resorcinol (par): Revisiting common
chelating probe for the study of metalloproteins. J. Inorg. Biochem. 2015, 152, 82–92.
32. Krężel, A.; Maret, W. The biological inorganic chemistry of zinc ions. Arch. Biochem.
Biophys. 2016, 611, 3–19.
33. Song, X.; Ju, H.; Lasanajak, Y.; Kudelka, M.R.; Smith, D.F.; Cummings, R.D. Oxidative
release of natural glycans for functional glycomics. Nat. Methods 2016, 13, 528–534.
34. Hennebicq-Reig, S.; Lesuffleur, T.; Capon, C.; De Bolos, C.; Kim, I.; Moreau, O.; Richet,
C.; Hemon, B.; Recchi, M.A.; Maes, E.; et al. Permanent exposure of mucin-secreting
HT-29 cells to benzyl-n-acetyl-alpha-d-galactosaminide induces abnormal O-
glycosylation of mucins and inhibits constitutive and stimulated MUC5AC secretion.
Biochem. J. 1998, 334, 283–295.
![Page 126: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/126.jpg)
In vitro Studies on Zinc Binding and Buffering by Intestinal Mucins
110
35. Mantle, M.; Stewart, G.; Zayas, G.; King, M. The disulphide-bond content and
rheological properties of intestinal mucins from normal subjects and patients with
cystic fibrosis. Biochem. J. 1990, 266, 597–604.
36. Fogg, F.J.; Hutton, D.A.; Jumel, K.; Pearson, J.P.; Harding, S.E.; Allen, A.
Characterization of pig colonic mucins. Biochem. J. 1996, 316, 937–942.
37. Cragg, R.A.; Christie, G.R.; Phillips, S.R.; Russi, R.M.; Kury, S.; Mathers, J.C.; Taylor,
P.M.; Ford, D. A novel zinc-regulated human zinc transporter, hZTL1, is localized to
the enterocyte apical membrane. J. Biol. Chem. 2002, 277, 22789–22797.
38. Casey, C.E.; Walravens, P.A.; Hambidge, K.M.; Silverman, A. The zinc content of
human duodenal secretions. Nutr. Res. 1986, 6, 725–728.
39. Cousins, R.J. Gastrointestinal factors influencing zinc absorption and homeostasis. Int.
J. Vitam. Nutr. Res. 2010, 80, 243–248.
40. Navabi, N.; McGuckin, M.A.; Linden, S.K. Gastrointestinal cell lines form polarized
epithelia with an adherent mucus layer when cultured in semi-wet interfaces with
mechanical stimulation. PLoS ONE 2013, 8, e68761.
41. Matseshe, J.W.; Phillips, S.F.; Malagelada, J.R.; McCall, J.T. Recovery of dietary iron
and zinc from the proximal intestine of healthy man: Studies of different meals and
supplements. Am. J. Clin. Nutr. 1980, 33, 1946–1953.
42. Svensson, O.; Arnebrant, T. Mucin layers and multilayers - Physicochemical properties
and applications. Curr. Opin. Colloid Interface Sci. 2010, 15, 395–405.
43. Sumarokova, M.; Iturri, J.; Weber, A.; Maares, M.; Keil, C.; Luis Toca-Herrera, J.
Influencing the adhesion properties and wettability of mucin protein films by
variation of the environmental pH. Sci. Rep. 2018, 8, 9660.
44. Schömig, V.J.; Kasdorf, B.T.; Scholz, C.; Bidmon, K.; Lieleg, O.; Berensmeier, S. An
optimized purification process for porcine gastric mucin with preservation of its
native functional properties. RSC Adv. 2016, 6, 44932–44943.
45. Conrad, M.E.; Umbreit, J.N.; Moore, E.G. Regulation of iron absorption: Proteins
involved in duodenal mucosal uptake and transport. J. Am. Coll. Nutr. 1993, 12, 720–
728.
46. Simovich, M.; Hainsworth, L.N.; Fields, P.A.; Umbreit, J.N.; Conrad, M.E. Localization
of the iron transport proteins mobilferrin and dmt-1 in the duodenum: The surprising
role of mucin. Am. J. Hematol. 2003, 74, 32–45.
47. Iyengar, V.; Pullakhandam, R.; Nair, K.M. Coordinate expression and localization of
iron and zinc transporters explain iron-zinc interactions during uptake in Caco-2 cells:
Implications for iron uptake at the enterocyte. J. Nutr. Biochem. 2012, 23, 1146–
1154.
48. McCance, R.A.; Widdowson, E.M. The absorption and excretion of zinc. Biochem. J.
1942, 36, 692–696.
49. Van der Flier, L.G.; Clevers, H. Stem cells, self-renewal, and differentiation in the
intestinal epithelium. Annu. Rev. Physiol. 2009, 71, 241–260.
50. Schneider, H.; Pelaseyed, T.; Svensson, F.; Johansson, M.E.V. Study of mucin turnover
in the small intestine by in vivo labeling. Sci. Rep. 2018, 8, 5760.
![Page 127: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/127.jpg)
In vitro Studies on Zinc Binding and Buffering by Intestinal Mucins
111
51. Johansson, M.E. Fast renewal of the distal colonic mucus layers by the surface goblet
cells as measured by in vivo labeling of mucin glycoproteins. PLoS ONE 2012, 7,
e41009.
52. Liu, P.; Pieper, R.; Rieger, J.; Vahjen, W.; Davin, R.; Plendl, J.; Meyer, W.; Zentek, J.
Effect of dietary zinc oxide on morphological characteristics, mucin composition and
gene expression in the colon of weaned piglets. PLoS ONE 2014, 9, e91091.
53. Quarterman, J.; Humphries, W.R.; Morrison, J.; Jackson, F.A. The effect of zinc
deficiency on intestinal and salivary mucins. Biochem. Soc. Trans. 1973, 1, 101.
54. Quarterman, J.; Jackson, F.A.; Morrison, J.N. The effect of zinc deficiency on sheep
intestinal mucin. Life Sci. J. 1976, 19, 979–986.
55. Sambuy, Y.; de Angelis, M.; Ranaldi, G.; Scarino, M.L.; Stammati, A.; Zucco, F. The
Caco-2 cell line as a model for the intestinal barrier: Influence of cell and culture-
related factors on Caco-2 cell functional characteristics. Cell Biol. Toxicol. 2005, 21, 1–
26.
56. Maares, M.; Keil, C.; Thomsen, S.; Gunzel, D.; Wiesner, B.; Haase, H. Characterization
of Caco-2 cells stably expressing the protein-based zinc probe eCalwy-5 as a model
system for investigating intestinal zinc transport. J. Trace Elem. Med. Biol. 2018, 49,
296–304.
57. Smith, P.K.; Krohn, R.I.; Hermanson, G.T.; Mallia, A.K.; Gartner, F.H.; Provenzano,
M.D.; Fujimoto, E.K.; Goeke, N.M.; Olson, B.J.; Klenk, D.C. Measurement of protein
using bicinchoninic acid. Anal. Biochem. 1985, 150, 76–85.
58. Grynkiewicz, G.; Poenie, M.; Tsien, R.Y. A new generation of Ca2+ indicators with
greatly improved fluorescence properties. J. Biol. Chem. 1985, 260, 3440–3450.
59. Burdette, S.C.; Walkup, G.K.; Spingler, B.; Tsien, R.Y.; Lippard, S.J. Fluorescent sensors
for Zn2+ based on a fluorescein platform: Synthesis, properties and intracellular
distribution. J. Am. Chem. Soc. 2001, 123, 7831–7841.
60. Behrens, I.; Pena, A.I.; Alonso, M.J.; Kissel, T. Comparative uptake studies of
bioadhesive and non-bioadhesive nanoparticles in human intestinal cell lines and
rats: The effect of mucus on particle adsorption and transport. Pharm. Res. 2002, 19,
1185–1193.
61. Kirkham, S.; Sheehan, J.K.; Knight, D.; Richardson, P.S.; Thornton, D.J. Heterogeneity
of airways mucus: Variations in the amounts and glycoforms of the major oligomeric
mucins MUC5aC and MUC5B. Biochem. J. 2002, 361, 537–546.
62. Thornton, D.J.; Carlstedt, I.; Howard, M.; Devine, P.L.; Price, M.R.; Sheehan, J.K.
Respiratory mucins: Identification of core proteins and glycoforms. Biochem. J. 1996,
316, 967–975.
63. Leal, J.; Smyth, H.D.C.; Ghosh, D. Physicochemical properties of mucus and their
impact on transmucosal drug delivery. Int. J. Pharm. 2017, 532, 555–572.
64. Nollevaux, G.; Deville, C.; El Moualij, B.; Zorzi, W.; Deloyer, P.; Schneider, Y.J.; Peulen,
O.; Dandrifosse, G. Development of a serum-free co-culture of human intestinal
epithelium cell-lines (Caco-2/HT29-5M21). BMC Cell Biol. 2006, 7, 20.
![Page 128: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/128.jpg)
In vitro Studies on Zinc Binding and Buffering by Intestinal Mucins
112
![Page 129: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/129.jpg)
General Discussion
113
Chapter 7. General Discussion
Zinc resorption mainly occurs in the small intestine. Here, zinc is transported into
enterocytes and excreted into the blood stream. In the past four decades, the zinc
resorption site and kinetic parameters of zinc uptake into the intestinal epithelium as well as
the fractional resorption and bioavailability of this micronutrient were investigated mainly
using in vivo or in vitro animal models. The investigation of metallothionein as an important
zinc binding protein whose expression is dependent on dietary zinc intake as well as the
discovery of the main intestinal zinc transporters ZIP-4, ZIP-5, ZnT-1, and ZnT-5 profoundly
contributed to the understanding of regulatory processes of intestinal zinc resorption.
However, there are still many questions to be answered, particularly considering molecular
parameters that regulate the uptake of zinc into enterocytes and its release into blood
circulation as well as dietary factors affecting its luminal availability for the intestinal
epithelium.
For this purpose, the application of in vitro intestinal models provides a standardized and
versatile platform to analyze zinc resorption across the intestinal epithelium as well as to
elucidate its cellular disposition and transfer after its absorption into enterocytes. In this
way, sensitive regulatory parameters of zinc resorption as well as bioavailability of zinc
species can be scrutinized. One of the biggest challenges of in vitro cell models, however, is
the difficulty to resemble the in vivo situation as close as possible.
Therefore, the scope of this thesis was to investigate zinc resorption using in vitro intestinal
models. What is more, the aim was to apply an in vitro model closer to the in vivo situation
to analyze zinc transport, as well as fluorescent sensors to study enterocytes’ zinc uptake in
more detail. First, an improved three-dimensional co-culture of Caco-2 and the mucin-
producing goblet cell line HT-29-MTX was established, critically addressing luminal factors
(Chapter 5 and 6) as well as the basolateral medium composition simulating the intestinal
blood side in vivo (Chapter 5). Moreover, the LMW sensor Zinpyr-1 was used to analyze the
bioavailability of different zinc species and short-time zinc uptake (Chapter 5-6) and,
moreover, a stable Caco-2 clone expressing the genetically encoded zinc sensor eCalwy-5
was produced and characterized providing a promising intestinal model system to study
enterocytes’ zinc resorption (Chapter 4).
On the following pages the main results of this thesis, composed of the findings presented in
Chapters 4-6, are related and consequently discussed in the light of current knowledge.
![Page 130: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/130.jpg)
General Discussion
114
7.1 Application of fluorescent sensors to study intestinal zinc uptake
Aside of determining changes of total cellular zinc with conventional analytical approaches,
using inductively-coupled plasma mass spectrometry (ICP-MS) or flame atomic absorption
spectrometry (FAAS), respectively, the investigation of intracellular free zinc upon zinc
absorption provides a fruitful approach to elucidate already considerably small fluctuations
of intracellular zinc and its spatial distribution. For this, a wide range of low molecular weight
(LMW) or genetically encoded fluorescent zinc sensors can be used to quantify intracellular
free zinc and depict its intracellular localization (for details refer to Chapter 2, p. 33 ff.).
In this thesis, LMW zinc sensor Zinpyr-1 was used to measure zinc uptake into enterocytes
and goblet cells. The cellular free zinc pool is strictly regulated by zinc binding proteins like
metallothionein and zinc transporters, maintaining the intracellular free zinc concentration
in the nanomolar range in both cell lines (Chapter 5 and Chapter 6). More specifically, basal
free zinc concentration in Caco-2 cells in these studies was determined to be ~0.2 nM,
whereas free levels in the goblet cell line HT-29-MTX varied around~0.5 nM. Incubation of
both cell lines with zinc immediately increased this zinc pool depending on the luminal
available zinc concentration. Hence due to its high bioavailability and mobility, free zinc
served as an interesting zinc species to analyze intestinal zinc transport. Consequently,
already small changes of free zinc upon uptake of apical zinc into enterocytes and goblet
cells could be measured. This is particularly of interest when analyzing samples with very low
zinc content or short-time zinc uptake into enterocytes Caco-2. The latter was observed in
studies of Chapter 5 and Chapter 6 of this thesis, where changes of the intracellular free zinc
pool after short-term incubation of enterocytes seem to be too small compared to the total
cellular zinc content to be detected with conventional analytical methods, such as FAAS,
whereas the uptake was determined using low molecular weight sensor Zinpyr-1 (Chapter 5
and Chapter 6).
The application of genetically encoded biosensors offers various advantages compared to
low molecular weight sensors, as already discussed in Chapter 2 on p. 33 ff. Nevertheless,
these protein zinc sensors have never been applied in intestinal cells before. To generate the
first Caco-2 cell clone expressing a zinc biosensor, Caco-2 cells were stably transfected with
the protein sensor eCalwy-5 (Kd (eCalwy-5) = 1.85 nM [332]) (Chapter 4). Since future
research aims to use Caco-2-eCalwy clones as a cell model representing the intestinal
epithelium, the development of enterocyte specific properties in Caco-2-eCalwy was
reassured (Chapter 4). Hence, Caco-2-eCalwy clones provide a well characterized intestinal
model to analyze intestinal zinc uptake in addition to LMW sensors. The functionality of the
sensor and its zinc-dependent FRET signal in these stable Caco-2 clones was measured using
different techniques: laser scanning and two photon microscopy as well as detection of
FLIM-FRET (Chapter 4). These analytical approaches are all quite elaborate and in contrast to
BRET-based biosensors, change of FRET-ratio upon zinc uptake cannot be measured with
plate reader assays [333,339].
Conversely to genetically encoded sensors, spatial distribution and accumulation of LMW
sensors inside cells is not easy to control [100] and is often different between cell lines. This
![Page 131: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/131.jpg)
General Discussion
115
has to be considered, particularly when comparing free zinc concentrations between cell
lines or sensors. Moreover, subcellular zinc concentrations were reported to be different
between organelles [74,342,343], hence prior characterization of intracellular sensor
distribution is quite important [343]. Zinpyr-1, for example, was described to co-localize with
staining of the endoplasmic reticulum, Golgi and mitochondria in Hela cells [349]. In the
neuronal cell line SH-SY5Y Zinpyr-1 showed cytoplasmic distribution [350], whereas in COS-7
cells the sensor was suggested to stain Golgi-associated vesicles [351,352]. In this thesis, the
low molecular weight sensor accumulated in cytoplasmic vesicles in Caco-2, HT-29-MTX as
well as HT-29 cells (Chapter 5 and Chapter 6). The eCalwy-5-sensor, on the other hand, is
distributed in the cytoplasm of Caco-2-eCalwy clones (Chapter 4) similar to the distribution
eCalwy-4 in transient transfected INS-1(832/13)-cells [332].
When comparing the basal free zinc levels of HT-29 cells determined with Zinpyr-1 in this
thesis (~0.8 nM) to a study where the less affine sensor Fluozin-3 (Kd (Fluozin-3) = 8.9 nM
[348], Kd (Zinpyr-1) = 0.7 nM [352]) was used to measure free zinc in HT-29 (0.4-0.7 nM)
[348], the correlation is actually quite good. In fact, LMW sensor concentration was shown
to be more critical for quantification of intracellular free zinc [348,353,354] than its actual
binding affinity, as the intracellular quantity of LMW sensors probably varies in several
hundred micromolar and deranges the steady state of the intracellular free zinc pool more
severely [354]. In contrast, intracellular concentration of biosensors depends on their
expression levels and was reported to be at least one order of magnitude smaller than that
of chemical probes [335]. Likewise, this applies also for cytoplasmic eCalwy sensor
concentration, as the heterogenic sensor expression between Caco-2-eCalwy cells did not
affect zinc-saturation of the biosensor.
The examination of free zinc (pools) in Caco-2 cells with eCalwy biosensor (Chapter 4) and
LMW sensor Zinpyr-1 (Chapter 5 and Chapter 6) documents that enterocytes comprise at
least two different zinc pools: cytoplasmic free zinc and vesicular stored zinc, both
containing nanomolar traces of the metal in basal states. Zinc uptake by enterocytes
increased the vesicular stored zinc pool as already mentioned above (Chapter 5 and Chapter
6) yet zinc treatment of Caco-2-eCalwy also augmented the cytoplasmic free zinc level
(Chapter 4). In the light of the suggested regulatory mechanism of enterocytes’ zinc
homeostasis during the resorption process (Chapter 2, p. 17 ff.), these findings indicate that
free zinc in cytoplasm increases to a certain level after entering the cell but is subsequently
sequestered into cellular zinc storages to maintain the intracellular zinc pool. These
processes have to be further scrutinized; in particular the chronology of the zinc transfer
through the enterocytes upon its absorption and its subsequent basolateral release into the
blood circulation needs to be unraveled in more detail.
![Page 132: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/132.jpg)
General Discussion
116
7.2 Role of Luminal and Basolateral Factors in in vitro Zinc Resorption
As already discussed in Chapter 2, only free zinc that is not complexed by macromolecules is
available for the intestinal epithelium. Dependent on their affinity for zinc, these complexes
can critically impact zinc bioavailability. This is also discussed in Chapter 5 and Chapter 6,
where two different proteins with high zinc binding capacity, albumin and zinc-depleted
gastrointestinal mucin, decreased apical availability of the cation for enterocytes.
Consequently, medium and buffer composition has to be considered when analyzing zinc
with in vitro models, as they could affect zinc speciation and its actual available
concentration for cells [20]. Since the aim of this thesis was to analyze zinc resorption in an
experimental setting close to the in vivo situation in the intestine, these constituents have to
both simulate the physiological environment in vivo, while guaranteeing suitable in vitro
vicinity for the cells as well.
A particular problem in this context is fetal calf serum (FCS), which proves to be an
unpredictable factor due to its variability [355] and contains about 60% albumin [356].
Notably, FCS is commonly used in cell culture [357], just as 10% FCS is used to culture cells in
the present thesis, resulting in a final albumin concentration of 1.55 mg mL-1 [355]
(corresponding to 24.2 µM) in the medium. Albumin is the main zinc transporting protein in
blood serum in vivo [84] and binds the metal with high affinity [358]. Consequently, zinc
binding to apically added FCS or bovine serum albumin (BSA) severely impacts its
bioavailability for enterocyte Caco-2 cells as shown in decreased cytotoxicity and short-time
zinc uptake in presence of these proteins in Chapter 5.
However adding albumin to the luminal side of enterocytes certainly does not represent the
in vivo situation in the intestinal lumen and is consequently not included in apical medium
composition of the in vitro intestinal models in this thesis. Nevertheless, this protein was
used as an apical component in previous in vitro zinc transport studies using three-
dimensional Caco-2 models (as shown in Chapter 2, Table 2.5, p. 30 ff.). Notably,
enterocytes’ zinc transport in three-dimensional models is strongly altered by the apical
medium composition. This becomes obvious in comparison to a previous zinc resorption
study where zinc together with 10% FCS was apically applied in a Caco-2 monoculture [128]
in contrast to the Caco-2 monocultures from this thesis, where no FCS was added to the
apical side and no BSA was added basolaterally (Appendix E). The presence of 10% FCS alters
cellular available zinc, as the zinc transport rate was certainly smaller with apical FCS than in
the absence of apical albumin (Caco-2 monocultures + apical 10% FCS: transport rate of 50
µM after 8h: 0.05 nmol cm-2 [128]; Caco-2 monoculture without basolateral albumin
addition: transport rate of 50 µM zinc after 8 h: 1.16 nmol cm-2, Appendix E, Figure S1, Table
S4).
Actually, the authors of this previous study [128] purposely applied 10% FCS on the apical
side of their intestinal model to mimic luminal protein matrix during transport studies. The
occurrence of such protein concentrations, however, does not reflect the luminal
environment in vivo, as the protein would have already been degraded into smaller
molecules (peptides or amino acids) due to the digestion process in the gastrointestinal
![Page 133: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/133.jpg)
General Discussion
117
tract. In fact in the present thesis, in vitro digestion led to degradation of BSA and increased
the zinc bioavailability for Caco-2 cells compared to undigested protein (Chapter 5).
Interestingly, comparable to in vivo studies [239], digested BSA still binds luminal zinc
diminishing its bioavailability compared to protein free controls. Nevertheless, the protein
content itself has a positive effect on zinc resorption in the intestinal lumen mainly because
of its release of amino acids and peptides upon its degradation, possibly increasing luminal
solubility of the metal and consequently enhancing its availability into enterocytes [12,245].
Figure 7.1 The role of the intestinal mucus layer as a luminal factor of intestinal zinc resorption
The intestinal mucus layer prevents hydroxypolymerization of zinc in intestinal lumen by binding the metal. Subsequently mucins buffer zinc that is available for enterocytes for the intestinal epithelium making them an integral part of intestinal zinc resorption. Zinc that is transported to the basolateral side of enterocytes is bound to albumin, which is the main zinc transporter protein in the blood. Basolateral albumin levels were shown to influence zinc resorption in three-dimensional intestinal model in this thesis by acting as a basolateral zinc acceptor.
At intestinal pH zinc naturally forms zinc hydroxide, which is highly insoluble [265] and thus
lowers its availability for enterocytes (Figure 7.1). This precipitation, however, is prevented
by the intestinal mucus layer, which binds the trace element and subsequently plays a
beneficial role for its resorption [24]. In the present study, discussed in Chapter 6, the
binding properties of gastrointestinal mucins are investigated in detail, showing that these
glycoproteins contain multiple zinc binding sites with physiologically relevant affinity.
Keeping in mind that the mucus layer is not static but represents a dynamic and viscoelastic
gel [43,64], these glycoproteins might assist zinc transport via this physical barrier to the
![Page 134: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/134.jpg)
General Discussion
118
underlying epithelium. In fact, their ability to bind the cation and buffer its free levels that
subsequently would be available for intestinal cells was also observed in short-term zinc
uptake studies of goblet cells and enterocytes in this thesis (Chapter 6). This indicates that
this process might even lead to retention of luminal available zinc and was already discussed
in animal studies [23,266] but was neither investigated in detail nor included in previous in
vitro intestinal models to investigate intestinal zinc transport. Our findings in Chapter 6
comparing the mucin-producing Caco-2/HT-29-MTX model with mucus-lacking Caco-2
monocultures in the presence of basolateral albumin, supports the hypothesis of a beneficial
role of mucins for intestinal zinc absorption. In this study enhanced apical zinc uptake and
higher fractional resorption was observed when a mucus layer was present (for detailed
results of this study refer to Table 7.1, p. 121). Consequently, the application of a mucus
layer or mucin-producing cells in in vitro models to study intestinal zinc resorption must not
be neglected.
Simulation of the mucus layer by adding isolated (porcine) mucins on top of three-
dimensional Caco-2 monocultures was already critically discussed in connection with iron
transport studies [44,312]. These mucins do not display similar viscoelastic and gel forming
properties of gastrointestinal mucus layer in vivo, possibly because of their isolation and
purification process [359,360] as already discussed in detail in Chapter 6. Moreover, these
isolated mucins do not simulate transmembrane mucins which, however, represent an
important fraction of the mucus layer in vivo (for details refer to Chapter 2, p.7). In this
context it is also worth noticing that the Caco-2/HT-29-MTX model is discussed to provide a
more physiological in vitro model than Caco-2 monocultures [361]. In fact, introducing HT-
29-MTX to Caco-2 monocultures does not only improve this intestinal model regarding the
presence of a mucus layer, but was also reported to optimize cellular permeability of
conventional Caco-2 cultures [313,362].
In contrast to the apical side, where FCS addition has to be excluded to resemble the in vivo
situation in lumen, the blood serum in vivo contains about 30–50 mg mL-1 human serum
albumin (HSA) [20], the main zinc binding protein in serum [84] buffering the total zinc level
of 12–16 µM [81-83] on the serosal side of enterocytes to the nanomolar range [363-365];
hence 30 mg mL-1 BSA was added to the basolateral medium of the intestinal model
(Chapter 5 and Chapter 6). In fact, transport studies with and without basolateral albumin in
this thesis (Chapter 5) clearly demonstrate that albumin acts as a basolateral zinc acceptor
and enhances serosal zinc export in vitro, while its role as a zinc acceptor in human
resorption has to be confirmed with HSA. Regardless, in vivo basolateral applied BSA was
shown to enhance fractional zinc resorption in vascular perfusion experiments of rat small
intestine [366]. These findings emphasize the relevance of basolateral constituents,
representing the blood side of the intestinal epithelium, when investigating zinc resorption.
It has to be noted, that the basolateral medium in our study contained only 3 µM zinc at the
beginning of experiments leading to a 110-fold molar excess of albumin which does not
reflect the molar albumin : zinc-ratio of 30 in vivo [20]. Due to its high zinc binding affinity
[358], the elevated basolateral albumin level provides indeed an additional thermodynamic
![Page 135: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/135.jpg)
General Discussion
119
sink for the metal. However, only basolateral zinc excretion of the cells is enhanced by this
zinc acceptor, whereas cellular zinc uptake seems to be unaffected by the albumin level
(Chapter 5). Hence, higher zinc transport in the presence of albumin is not based on a simple
diffusion process, following a zinc concentration gradient from apical to basolateral side as
apical zinc uptake into the cell is not perturbed by basolateral albumin. This also reiterates
previous knowledge on intestinal zinc uptake and transport kinetics (in detail described in
Chapter 2, p. 15 ff.). In vivo apical to basolateral zinc transport is a saturable and carrier-
mediated process [125], where apical zinc uptake is suggested to be the rate limiting step
[131]. This transport process is mainly mediated by the apical zinc importer ZIP-4 and
basolateral zinc exporter ZnT-1 [367], which are both regulated by dietary zinc (for details
refer to Chapter 2, p. 17 ff.). Recent findings demonstrate that basolateral zinc export by
ZnT-1 in Caco-2 cells into the basolateral compartment are attenuated by the humoral factor
hepcidin [190] (for details refer to Chapter 2, p. 26 ff.). The underlying regulatory
parameters, however, that enhance the basolateral release of zinc in presence of albumin
need to be further investigated.
Some of the previous in vitro zinc transport studies using Caco-2 models (Chapter 2, Table
2.5, p. 30) used cell culture medium with 10% FCS for the basolateral compartment
[125,128,129,323]. Since FCS contains about 15.5 mg mL-1 albumin [355], this FCS
concentration corresponds to only 3–5% of the serum albumin concentration in vivo (10%
FCS: 1.55 mg mL-1 albumin; blood serum in vivo: 30-50 mg mL-1 HSA [20]). Although these in
vitro studies applied zinc to the basolateral compartment mainly to investigate the serosal
zinc uptake into the intestinal epithelium [127-129,323], the apical zinc transport in the
presence of physiologic zinc and albumin concentrations on the basolateral side has not yet
been investigated. Until now, zinc content on the basolateral side of three-dimensional
intestinal models only originated from FCS [125,128,129,323], which generally contains
higher amounts of zinc than cell culture medium [368]. The exact basolateral zinc
concentration in these studies though are unknown, as FCS’ zinc content highly varies
leading to final zinc concentrations between 3 [137] and 14 µM [369]. The addition of
albumin apart from the amount already present in FCS, to the basolateral side of the in vitro
model as done in this thesis, however, was only performed in two in vitro transport studies
with Caco-2 monocultures before, applying very low (2.5 mg mL-1) [322] and physiologic
albumin concentrations (5% BSA; corresponding to 50 mg mL-1 albumin) [125]. Regardless,
the effect of serum albumin on zinc resorption by in vitro intestinal models has not been
discussed in these studies.
![Page 136: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/136.jpg)
General Discussion
120
7.3 Comparison of Zinc Transport in the Three-Dimensional in vitro Intestinal Model Caco-
2/HT-29-MTX with Specific in vitro Caco-2 Models and in vivo Zinc Resorption
In this thesis the conventional Caco-2 model was expanded regarding its cellular composition
as well as luminal and basolateral factors including mucin-producing HT-29-MTX cells and
physiological serum concentrations. Yet, it has to be noted that the impact of basolateral
albumin on zinc transport, discussed in Chapter 5, was studied already using the mucin-
producing Caco-2/HT-29-MTX co-cultures, whereas the effect of mucins on zinc resorption
from Chapter 6 was obtained using mono- and co-cultures in presence of basolateral
albumin (for details refer to Table 7.1, p. 121). Hence, the influence of basolateral albumin
(Chapter 5) and apical mucin (Chapter 6) on zinc transport by three-dimensional cell models
was not investigated separately. In the following, the role of mucins and basolateral albumin
on zinc transport, after apical zinc treatment for 8 h, is discussed separately and compared
to findings from Chapter 5 and Chapter 6. For this, Table S3 and S4 as well as Figure S1 in
Appendix E summarize the results of the zinc transport studies from Chapter 5 and Chapter
6 together with additional data of zinc transport in Caco-2 mono- and co-cultures with and
without basolaterally added albumin after incubation for 4 h and 8 h.
Comparison of our findings with previous in vitro transport studies is challenging, as
incubation time and unit of reported results differ. Regardless, Moltedo et al. reported zinc
transport rates of 2.0 nmol zinc per cm² after treatment of Caco-2 monocultures with 100
µM zinc for 6 h. They used serum free medium on apical and basolateral side. Likewise,
apical addition of 100 µM zinc to Caco-2 monocultures without basolateral albumin from this
thesis for 8 h, yielded zinc transport rates of 1.6 nmol zinc per cm² resorption area (Appendix
E, Figure S1). Basolateral addition of albumin increased zinc transport of this model to 1.6-
fold, leading to transport rates of 2.6 nmol zinc per cm² (Appendix E, Figure S1). This is
additionally augmented in the presence of mucins as Caco-2/HT-29-MTX reached zinc
transport of 3.6 nmol zinc per cm2 resorption area (Chapter 5, Appendix E, Figure S1).
In general, the introduction of basolateral albumin to Caco-2 monocultures and to Caco-
2/HT-29-MTX co-cultures increased serosal zinc export of cell monolayers after 8 h, as
cellular zinc content seems to be lower (for details refer to Chapter 5 and Appendix E, Figure
S1A-B, Table S3) and the resorbed amount of zinc was elevated in both in vitro models in the
presence of this protein, whereas apical zinc uptake was not different with or without
albumin (for details refer to Appendix E, Table S3, Table S4).
When implementing the mucus layer in Caco-2 monocultures by way of the co-culture with
mucin-producing HT-29-MTX cells, the beneficial impact of mucins on cellular zinc
absorption, described in Chapter 6, occurs also without basolateral albumin. More precisely,
zinc uptake into Caco-2/HT-29-MTX in absence of basolateral albumin was elevated (Chapter
5, Figure 7A and Appendix E, Figure S1A, two-way ANOVA with Bonferroni post hoc test
comparing mono-and co-culture without basolateral BSA: 100 µM: p < 0.01), whereas zinc
transport rates and fractional zinc resorption of conventional Caco-2 monocultures and co-
cultures were comparable (Appendix E, Figure S1C). After adding albumin to the basolateral
side of these models, the fractional zinc resorption as well as zinc transport rate were
![Page 137: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/137.jpg)
General Discussion
121
increasing (for detailed results refer to Chapter 5 and Appendix E, Figure S1B, D, F, Table S4).
Interestingly, the basolateral zinc acceptor shows a stronger effect on the fractional zinc
resorption of mucin-producing co-cultures than on the mucus-lacking Caco-2 model, as net
absorption of Caco-2/HT-29-MTX is significantly elevated in the presence of albumin
(Appendix E, Table S4; Figure S1; two-way ANOVA with Bonferroni post hoc test comparing
co-cultures without and with basolateral BSA: 25 µM: p < 0.001; 50 µM: p < 0.05).
Comparable to observations from Chapter 6, investigating zinc transport in the presence of
albumin after 4 h, net resorption of co-cultures with basolateral BSA after 8 h is 1.4–1.8-fold
higher than that of Caco-2 models without apical mucus layer (Appendix E, Figure S1F, Table
S4).
All in all, these findings indicate that mucins assist apical zinc uptake and basolateral albumin
increases enterocytes’ zinc excretion to the blood side; this also holds true when examined
separately. Consequently, fractional zinc resorption of apically applied zinc (25–100 µM)
increased from 0.9–1.6% in the absence of mucins, to 1.9–4.2% in the presence of mucins
(Chapter 6) and from 2% in the absence of basolateral albumin to 2.9–5.8% with albumin
(Chapter 5). Table 7.1 summarizes the main results of zinc transport studies of the present
work which are discussed in detail in Chapter 5 and 6.
Table 7.1 Main Results of in vitro zinc transport studies from this thesis
Cell model Incubation parameter
Zinc Quantification
Main Outcome
Chapter 5 Caco-2/HT-29-MTX co-culture Differentiation time: 21 d 3D Transwell (PC)
ZnSO4 0 –100 µM (apical: serum free transport buffer, basolateral: DMEM +10% FCS + 0 or 30 mg mL
-1 BSA)
for 8 h
ICP-MS
- albumin has a role in in vitro zinc resorption as a basolateral zinc acceptor
- cellular uptake is not significantly different with or w/o basolateral added albumin
- basolateral serum albumin enhances cellular zinc export to the basolateral side
- fractional resorption (25 -100 µM): w/o BSA: ~ 2% with BSA: 5.8 - 2.9%
- zinc transport rates (0-100 µM): w/o BSA: 0.1 - 2.2 nmol cm
-2
with BSA: 1.1 - 3.6 nmol cm-2
Chapter 6 Caco-2/HT-29-MTX co-culture and Caco-2 monoculture Differentiation time: 21 d 3D Transwell (PC)
ZnSO4 0 –100 µM (apical: serum free transport buffer, basolateral: DMEM +10% FCS + 30 mg mL
-1 BSA)
for 4 h
ICP-MS
- intestinal mucins influence cellular zinc uptake and zinc transport
- results suggest that mucins facilitate zinc uptake into enterocytes and act as a zinc delivery system
- mucins are an integral part of intestinal zinc resorption
- fractional resorption (25 -100 µM): monoculture: 1.6 - 0.9% co-culture: 4.2 - 1.9%
- zinc transport rates (0-100 µM): monoculture: 0.3 - 1.3 nmol cm
-2
co-culture: 1.1 - 2.3 nmol cm-2
BSA = bovine serum albumin; DMEM = Dulbecco’s Modified Eagles Medium; FCS = fetal calf serum; ICP-MS = inductively-
coupled plasma mass spectrometry; PC = Polycarbonate membrane.
![Page 138: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/138.jpg)
General Discussion
122
The in vitro intestinal model Caco-2/HT-29-MTX established in the present thesis provides a
suitable platform to investigate zinc resorption in an experimental setting closer to the in
vivo situation than conventional Caco-2 monocultures. Nevertheless, comparing the
determined fractional resorption of the in vitro model (Table 7.1) with estimated net
resorption of 16–50% for humans in vivo [15,88,138-141], these results appear really low.
The mentioned human fractional resorption was observed in several in vivo resorption
studies investigating the net resorption and bioavailability of the micronutrient (for details
refer to Chapter 2, p. 15 ff.), generally reporting an inverse relation to the luminal available
zinc level. Likewise zinc resorption in in vitro intestinal model Caco-2/HT-29-MTX illustrated
the same concentration-dependency. Notably, most of these in vivo studies investigated
fractional zinc absorption from meals containing dietary ligands that additionally affect its
bioavailability in the intestinal lumen [11], whereas in the present in vitro studies, zinc was
added as liquid solutions and without food matrix. However, in vivo studies estimating the
fractional zinc resorption from liquid solutions with comparable zinc concentrations to those
applied in the in vitro studies from this thesis are scarce [5,119]. Hence in the following,
findings of studies from Chapter 5 and 6 are compared to data from a human in vivo study
were comparable zinc concentrations were applied with a meal.
In an in vivo study by Hunt et al. intake of a meal containing 17 mg zinc yielded fractional
zinc resorption of 24% [15], whereas 49% were absorbed when 4.3 mg zinc was
administered [15]. Assuming an average intestinal resorption area of 30.000 m² [33] and
intestinal liquid of 3 L [28], oral zinc intake of 17 mg zinc would correspond to a luminal
concentration of maximum 86 µM, while 4.3 mg zinc would result in 22 µM luminal zinc. Net
absorption of the intestinal model Caco-2/HT-29-MTX in Chapter 5 yielded 5.8 ± 0.9% or 2.9
± 1.1% after treatment with 25 or 100 µM in aqueous solutions for 8 h. This is certainly
lower than the fractional absorption of comparable luminal zinc concentrations in vivo from
the abovementioned study by Hunt et al. and yet it represents 1/10 of fractional zinc
resorption in vivo.
Applying in vitro models to mimic processes in vivo always needs a critical discussion of their
limitations. Even though the in vitro intestinal model Caco-2/HT-29-MTX in this thesis
represents an improved and more physiological model than conventional monocultures
[285] that were used before to study zinc transport, there are certain differences to the in
vivo intestinal epithelium that have to be critically examined.
Two important physical factors in the intestine in vivo are lacking in this in vitro model:
intestinal and blood fluid flow as well as peristaltic motions. Intestinal peristalsis enables
movement of chyme along the intestine and increases mechanical degradation of food
components [28], which is important for the digestion process and availability of nutrients
for absorption. Furthermore, the present in vitro model did not include the intestinal
digestion process, which might also influence the luminal bioaccessibility of the metal. Even
though a combination of the in vitro intestinal model with in vitro digestion is principally
possible [312], this was not applied on purpose, because at first the resorption of liquid zinc
samples had to be investigated solely.
![Page 139: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/139.jpg)
General Discussion
123
In vivo, resorbed zinc is bound to albumin and continuously transported within the blood
circulation distributing the cation in the whole body [84]. This sink is missing in vitro and
resorbed zinc accumulates in the basolateral compartment of the three-dimensional cell
models. It seems that the addition of physiological albumin concentrations, although not yet
completely saturated with zinc, is not enough to fulfill this task. This insinuates the
involvement of another parameter in enterocytes’ zinc release into the blood, probably a yet
unidentified humoral factor, similar to hepcidin, but with converse impact on zinc
resorption.
Moreover, the ratio of intestinal liquid per resorption area has to be taken into account
when comparing in vitro and in vivo fractional resorption. The resorption area in vitro (1.12
cm2) is certainly smaller compared to the size of the intestinal epithelium in vivo (~30.000
cm2) [33]. It has to be noted that this estimation does not include the actual amount of
absorptive enterocytes to the resorption area of the intestinal epithelium in vivo and
disregards the factor that microvilli of Caco-2 cells would incorporate into the actual
resorption area in vitro. The volume of intestinal liquid in lumen in vivo amounts to around 3
L [28] (corresponding to 0.1 mL cm-2), whereas in the in vitro model the volume to area ratio
is 0.45 ml per cm2, leading to a 4.5-fold higher apically applied liquid volume per cm2
resorption area in vitro. Hence the total amount of zinc that has to be transported per
resorption area in vitro is greater than in vivo, which consequently influences the estimation
of fractional resorption. It is well known, that fractional zinc resorption declines with
increased zinc concentration and that zinc uptake into enterocytes is a saturable process.
Accordingly, assuming that expression and activity of the main zinc transporters in Caco-2
cells in vitro correspond to the expression in vivo which we certainly not know yet, the
higher ratio of zinc per cm2 resorption area in the in vitro model could be one explanation
for the smaller fractional resorption. Nevertheless, adjusting the liquid volume that is
applied into apical chambers of in vitro intestinal models to the volume per cm2 ratio in vivo
(0.1 mL cm-2) would attenuate cellular viability and consequently negatively affect the zinc
resorption process.
In addition to net absorption, it would be interesting to compare the final amounts of zinc
that are resorbed into the blood circulation in vivo with zinc levels that were transported to
the basolateral side of the three-dimensional in vitro model. For this, Table 7.2 depicts
estimated amounts of actual transported zinc per cm2 resorption area in vitro and in vivo,
using data of a study from Hunt et al. [15].
![Page 140: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/140.jpg)
General Discussion
124
Table 7.2 Total amounts of resorbed zinc in vivo and in the Caco-2/HT-29-MTX model of this thesis
In vitro (A = 1.12 cm2, Volume: 500 µL)
Apical zinc Fractional resorption
[%]
Resorbed zinc [µg/total resorption
area] Resorbed zinc [µg cm
-2]
100 µM = 3.23 µg/1.12 cm2
2.9 0.09 0.08
25 µM = 0.82 µg/1.12 cm2
5.8 0.05 0.04
In vivo [15] (A = 30-40 m2~30 m2, Volume: 3-6 L ~3 L)
17 mg/30 m2 = 86 µM
24 4080 0.14
4.3 mg/30 m2 = 21 µM
49 2100 0.07
According to the above calculation, the amounts of actually transported zinc with the
optimized in vitro model of this thesis are by all means quite similar to the estimated
amounts transported in vivo. Compared to conventional Caco-2 monocultures, not only is
the fractional resorption enhanced when using the mucin-producing Caco-2/HT-29-MTX
model from this thesis, but the amount of transported zinc to the basolateral side of the
model is also higher than reported before after 8 h [128] (detailed data in Chapter 2, Table
2.5, p.30). Hence, this model provides a suitable platform for future investigation of human
zinc transport kinetics, bioavailability of different zinc species as well as molecular regulatory
parameters of intestinal zinc resorption.
7.4 Conclusion
All in all, the work of this thesis demonstrates that the luminal and basolateral medium
composition is crucial when studying zinc resorption and that the intestinal mucus layer
plays a beneficial role in zinc resorption. These factors are all combined in the three-
dimensional in vitro model Caco-2/HT-29-MTX which provides a standardized
microenvironment to investigate intestinal zinc transport and resorption in an experimental
setting closer to the in vivo situation. Even though fractional zinc resorption obtained with
this model represents only ~10% of that reported in in vivo studies, when applying zinc
levels comparable to the ones typically found in the intestinal lumen after a meal, the total
amount of transported zinc in this in vitro model resembles those estimated in vivo after zinc
resorption. With this model the zinc resorption process can be further elucidated measuring
zinc uptake into the intestinal epithelium as well as its transport to the basolateral chamber,
consequently providing information about zinc transport kinetics and net resorption of the
apically applied zinc species.
By applying low molecular weight sensor Zinpyr-1 in Caco-2 cells and Caco-2-eCalwy clones
the cellular distribution of the essential metal upon its absorption into enterocytes and
![Page 141: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/141.jpg)
General Discussion
125
throughout the resorption process can be additionally examined. What is more, using these
two sensors already small changes of the intracellular zinc pool were investigated, which is
of particular interest for short-term zinc uptake and samples with low zinc content. To this
end, involvement of two different cellular free zinc pools in the maintenance of enterocytes’
zinc homeostasis during zinc resorption could be illuminated. Moreover, Caco-2-eCalwy
clones offer a well characterized intestinal model system to investigate enterocyte free zinc
levels in addition to LMW sensors, which might be worth to be investigated in combination
with goblet cells to study enterocytes’ zinc homeostasis in co-culture.
Finally, by applying these three-dimensional and two-dimensional intestinal models the
impact of albumin as a basolateral zinc acceptor and the role of the mucus layer as an apical
zinc transfer system to the underlying brush border membrane were elucidated. These
findings contribute to the closer understanding of the in vitro and in vivo zinc uptake and
transport process on the apical mucosal membrane as well as on the basolateral side of
enterocytes.
7.5 Future Perspectives
As far as the in vitro intestinal model of this thesis is concerned, further work needs to be
done to investigate whether basolateral addition of zinc closer to the serum concentrations
in vivo will impact zinc transport kinetics of the three-dimensional Caco-2/HT-29-MTX model
and if the model has to be optimized accordingly. Besides, to validate the role of albumin as
a basolateral zinc acceptor in human zinc resorption, zinc transport has to be investigated in
the presence of human serum albumin. Moreover, future implementation of the in vitro
intestinal model of this thesis should consider a combination of the in vitro model with an in
vitro digestion model to study zinc bioavailability from complex food samples.
In the course of this thesis the involvement of humoral factors in regulating zinc resorption,
particularly the basolateral zinc export into the blood circulation were suggested. It was
already shown that hepcidin, a humoral factor produced by hepatocytes, affects basolateral
zinc transport [190]. Hence, similar to its involvement in iron resorption [270], the liver
might play an important role in secreting humoral factors to regulate zinc resorption.
Therefore, a triple culture of Caco-2 mono- or co-cultures with basolateral seeded
hepatocytes would provide a suitable platform to tackle this question and to elucidate the
role of the liver in this process.
The findings in this study demonstrate that mucins bind zinc with biologically relevant
affinity. It was already suggested that intestinal mucins influence bioavailability of trace
elements by competitively binding them. Hence, it would be valuable to scrutinize zinc
binding to mucins in the presence of other metals in in vitro cell free analysis. Together with
the determination of zinc resorption and transport kinetics in the presence of other trace
elements with the mucin-producing Caco-2/HT-29-MTX model, these measurements could
provide further insights into the mutual interference of their absorption in the intestine.
Furthermore, stably transfected cells such as Caco-2-eCalwy offer the great opportunity to
be co-cultured with other cell lines, like HT-29-MTX for example. With this intestinal model
zinc can be analyzed specifically in this cell type, tracking the micronutrient after its
![Page 142: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/142.jpg)
General Discussion
126
absorption into the enterocytes, in the presence of goblet cells and a mucus layer, while
LMW probes would always stain the entire model. In addition to the above discussed impact
of mucins on zinc resorption, this could contribute to further understanding about the
regulatory role of mucins in enterocytes’ zinc absorption and help characterize zinc
homoeostasis of enterocytes in presence of goblet cells.
With respect to the complex analytical techniques to measure FRET in transfected cell
clones, the application of BRET-sensors is quite promising. Herein, Caco-2 clones stably
expressing BRET-sensor Zinch-3 from the Merkx group [333] was already produced in our
group. With these means, free zinc of Caco-2-Zinch clones in monoculture as well as in co-
culture with HT-29-MTX cells, can be measured using plate readers. Moreover, future
research should aim to produce stably transfected Caco-2 clones with organelle-specific
biosensors, as presented in Chapter 2, to contribute to the knowledge of subcellular
distribution of zinc after its absorption into enterocytes.
All in all, these future perspectives show that there are several points that await to be
answered. Their investigation would not only enhance the current knowledge on zinc
resorption and molecular regulatory parameters of its luminal absorption and transport into
the blood circulation, but also contribute to the overall understanding of enterocytes’ zinc
homeostasis in addition to the results of this thesis.
![Page 143: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/143.jpg)
References
127
Chapter 8. References
1. Maret, W. Zinc in cellular regulation: The nature and significance of "zinc signals". International Journal of Molecular Sciences 2017, 18, 2285-2297.
2. Rink, L.; Gabriel, P. Zinc and the immune system. Proceedings of the Nutrition Society 2000, 59, 541-552.
3. Krebs, N.F. Overview of zinc absorption and excretion in the human gastrointestinal tract. The Journal of Nutrition 2000, 130, 1374S-1377S.
4. Steinhardt, H.J.; Adibi, S.A. Interaction between transport of zinc and other solutes in human intestine. The American Journal of Physiology 1984, 247, G176-182.
5. Lee, H.H.; Prasad, A.S.; Brewer, G.J.; Owyang, C. Zinc absorption in human small intestine. The American Journal of Physiology 1989, 256, G87-91.
6. Ford, D. Intestinal and placental zinc transport pathways. The Proceedings of the Nutrition Society 2004, 63, 21-29.
7. King, J.C. Zinc: An essential but elusive nutrient. The American Journal of Clinical Nutrition 2011, 94, 6795-6845.
8. Maywald, M.; Wessels, I.; Rink, L. Zinc signals and immunity. International Journal of Molecular Sciences 2017, 18, 2222-2256.
9. Alker, W.; Haase, H. Zinc and sepsis. Nutrients 2018, 10, 976. 10. World Health Organization. The World Health Report: 2002: Reducing Risks,
Promoting Healthy Life. World Health Organization: Geneva, Switzerland, 2002. 11. Lönnerdal, B. Dietary factors influencing zinc absorption. The Journal of Nutrition
2000, 130, 1378S-1383S. 12. Wapnir, R.A. Zinc deficiency, malnutrition and the gastrointestinal tract. The Journal
of Nutrition 2000, 130, 13885-13925. 13. World Health Organization / Food and Agricultural Organization. Vitamin and Mineral
Requirements in Human Nutrition. 2 ed.; World Health Organization: Geneva, Switzerland, 2004.
14. Trame, S.; Wessels, I.; Haase, H.; Rink, L. A short 18 items food frequency questionnaire biochemically validated to estimate zinc status in humans. Journal of Trace Elements in Medicine and Biology 2018, 49, 285-295.
15. Hunt, J.R.; Beiseigel, J.M.; Johnson, L.K. Adaptation in human zinc absorption as influenced by dietary zinc and bioavailability. The American Journal of Clinical Nutrition 2008, 87, 1336-1345.
16. Hambidge, K.M.; Miller, L.V.; Westcott, J.E.; Sheng, X.; Krebs, N.F. Zinc bioavailability and homeostasis. The American Journal of Clinical Nutrition 2010, 91, 1478S-1483S.
17. Dosh, R.H.; Essa, A.; Jordan-Mahy, N.; Sammon, C.; Le Maitre, C.L. Use of hydrogel scaffolds to develop an in vitro 3D culture model of human intestinal epithelium. Acta Biomaterialia 2017, 62, 128-143.
18. Langerholc, T.; Maragkoudakis, P.A.; Wollgast, J.; Gradisnik, L.; Cencic, A. Novel and established intestinal cell line models – an indispensable tool in food science and nutrition. Trends in Food Science & Technology 2011, 22, S11-S20.
19. Ollig, J.; Kloubert, V.; Weßels, I.; Haase, H.; Rink, L. Parameters influencing zinc in experimental systems in vivo and in vitro. Metals 2016, 6, 71.
20. Haase, H.; Hebel, S.; Engelhardt, G.; Rink, L. The biochemical effects of extracellular Zn2+ and other metal ions are severely affected by their speciation in cell culture media. Metallomics 2015, 7, 102-111.
![Page 144: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/144.jpg)
References
128
21. Bansil, R.; Turner, B.S. The biology of mucus: Composition, synthesis and organization. Advanced Drug Delivery Reviews 2018, 124, 3-15.
22. Johansson, M.E.; Sjovall, H.; Hansson, G.C. The gastrointestinal mucus system in health and disease. Nature Reviews. Gastroenterology & Hepatology 2013, 10, 352-361.
23. Glover, C.N.; Hogstrand, C. In vivo characterisation of intestinal zinc uptake in freshwater rainbow trout. Journal of Experimental Biology 2002, 205, 141-150.
24. Powell, J.J.; Jugdaohsingh, R.; Thompson, R.P. The regulation of mineral absorption in the gastrointestinal tract. The Proceedings of the Nutrition Society 1999, 58, 147-153.
25. DeSesso, J.M.; Jacobson, C.F. Anatomical and physiological parameters affecting gastrointestinal absorption in humans and rats. Food and Chemical Toxicology 2001, 39, 209-228.
26. Madara, J.L. Functional morphology of epithelium of the small intestine. In Comprehensive Physiology; Terjung, R., Ed.; JohnWiley & Sons, Inc.: Hoboken, NJ, USA, 2011.
27. Van der Flier, L.G.; Clevers, H. Stem cells, self-renewal, and differentiation in the intestinal epithelium. Annual Review of Physiology 2009, 71, 241-260.
28. Welcome, M.O. Gastrointestinal Physiology - Development, Principles and Mechanisms of Regulation. Springer International Publishing: Switzerland, 2018.
29. Shen, L. Functional morphology of the gastrointestinal tract. Current Topics in Microbiology and Immunology 2009, 337, 1-35.
30. Kiela, P.R.; Ghishan, F.K. Physiology of intestinal absorption and secretion. Best Practice & Research Clinical Gastroenterology 2016, 30, 145-159.
31. Fallingborg, J. Intraluminal ph of the human gastrointestinal tract. Danish Medical Bulletin 1999, 46, 183-196.
32. Schaal, S.; Kunsch, K.; Kunsch, S. Der Mensch in Zahlen. Springer Spektrum: Berlin, Heidelberg, 2016.
33. Helander, H.F.; Fandriks, L. Surface area of the digestive tract - revisited. Scandinavian Journal of Gastroenterology 2014, 49, 681-689.
34. Günzel, D.; Fromm, M. Claudins and other tight junction proteins. Comprehensive Physiology 2012, 2, 1819-1852.
35. Lee, S.H. Intestinal permeability regulation by tight junction: Implication on inflammatory bowel diseases. Intestinal Research 2015, 13, 11-18.
36. Stewart, A.S.; Pratt-Phillips, S.; Gonzalez, L.M. Alterations in intestinal permeability: The role of the “leaky gut” in health and disease. Journal of Equine Veterinary Science 2017, 52, 10-22.
37. Van Roy, F.; Berx, G. The cell-cell adhesion molecule E-cadherin. Cellular and Molecular Life Sciences 2008, 65, 3756-3788.
38. Sjoberg, A.; Lutz, M.; Tannergren, C.; Wingolf, C.; Borde, A.; Ungell, A.L. Comprehensive study on regional human intestinal permeability and prediction of fraction absorbed of drugs using the ussing chamber technique. European Journal of Pharmaceutical Sciences 2013, 48, 166-180.
39. Peterson, L.W.; Artis, D. Intestinal epithelial cells: Regulators of barrier function and immune homeostasis. Nature Reviews. Immunology 2014, 14, 141-153.
40. Gassler, N.; Newrzella, D.; Böhm, C.; Lyer, S.; Li, L.; Sorgenfrei, O.; van Laer, L.; Sido, B.; Mollenhauer, J.; Poustka, A., et al. Molecular characterisation of non-absorptive and absorptive enterocytes in human small intestine. Gut 2006, 55, 1084-1089.
![Page 145: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/145.jpg)
References
129
41. Allaire, J.M.; Crowley, S.M.; Law, H.T.; Chang, S.Y.; Ko, H.J.; Vallance, B.A. The intestinal epithelium: Central coordinator of mucosal immunity. Trends in Immunology 2018, 39, 677-696.
42. Kucharzik, T.; Lugering, N.; Rautenberg, K.; Lugering, A.; Schmidt, M.A.; Stoll, R.; Domschke, W. Role of M cells in intestinal barrier function. Annals of the New York Academy of Sciences 2000, 915, 171-183.
43. Leal, J.; Smyth, H.D.C.; Ghosh, D. Physicochemical properties of mucus and their impact on transmucosal drug delivery. International Journal of Pharmaceutics 2017, 532, 555-572.
44. Jin, F.; Welch, R.; Glahn, R. Moving toward a more physiological model: Application of mucin to refine the in vitro digestion/Caco-2 cell culture system. Journal of Agriculture and Food Chemistry 2006, 54, 8962-8967.
45. Johansson, M.E.; Ambort, D.; Pelaseyed, T.; Schutte, A.; Gustafsson, J.K.; Ermund, A.; Subramani, D.B.; Holmen-Larsson, J.M.; Thomsson, K.A.; Bergstrom, J.H., et al. Composition and functional role of the mucus layers in the intestine. Cellular and Molecular Life Sciences 2011, 68, 3635-3641.
46. Conrad, M.E.; Umbreit, J.N.; Moore, E.G. A role for mucin in the absorption of inorganic iron and other metal cations. A study in rats. Gastroenterology 1991, 100, 129-136.
47. Powell, J.J.; Whitehead, M.W.; Ainley, C.C.; Kendall, M.D.; Nicholson, J.K.; Thompson, R.P.H. Dietary minerals in the gastrointestinal tract: Hydroxypolymerisation of aluminium is regulated by luminal mucins. Journal of Inorganic Biochemistry 1999, 75, 167-180.
48. Johansson, M.E.; Larsson, J.M.; Hansson, G.C. The two mucus layers of colon are organized by the MUC2 mucin, whereas the outer layer is a legislator of host-microbial interactions. Proceedings of the National Academy of Sciences of the United States of America 2010, 108 Suppl 1, 4659-4665.
49. Allen, A.; Flemström, G. Gastroduodenal mucus bicarbonate barrier: Protection against acid and pepsin. American Journal of Physiology-Cell Physiology 2005, 288, C1-C19.
50. Atuma, C.; Strugala, V.; Allen, A.; Holm, L. The adherent gastrointestinal mucus gel layer: Thickness and physical state in vivo. American Journal of Physiology- Gastrointestinal and Liver Physiology 2001, 280, G922-G929.
51. Johansson, M.E.; Phillipson, M.; Petersson, J.; Velcich, A.; Holm, L.; Hansson, G.C. The inner of the two MUC2 mucin-dependent mucus layers in colon is devoid of bacteria. Proceedings of the National Academy of Sciences of the United States of America 2008, 105, 15064-15069.
52. Cone, R.A. Barrier properties of mucus. Advanced Drug Delivery Reviews 2009, 61, 75-85.
53. Johansson, M.E. Fast renewal of the distal colonic mucus layers by the surface goblet cells as measured by in vivo labeling of mucin glycoproteins. PLoS One 2012, 7, e41009.
54. Schneider, H.; Pelaseyed, T.; Svensson, F.; Johansson, M.E.V. Study of mucin turnover in the small intestine by in vivo labeling. Scientific Reports 2018, 8, 5760-5771.
55. Tailford, L.; Crost, E.; Kavanaugh, D.; Juge, N. Mucin glycan foraging in the human gut microbiome. Frontiers in Genetics 2015, 6, 81-99.
56. Johansson, M.E.; Hansson, G.C. Mucus and the goblet cell. Digestive Diseases 2013, 31, 305-309.
![Page 146: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/146.jpg)
References
130
57. Holmen Larsson, J.M.; Thomsson, K.A.; Rodriguez-Pineiro, A.M.; Karlsson, H.; Hansson, G.C. Studies of mucus in mouse stomach, small intestine, and colon. III. Gastrointestinal MUC5AC and MUC2 mucin O-glycan patterns reveal a regiospecific distribution. American Journal of Physiology-Gastrointestinal and Liver Physiology 2013, 305, G357-363.
58. Rama Bansil, B.S.T. Mucin structure, aggregation, physiological functions and biomedical applications. Current Opinion in Colloid & Interface Science 2006, 11, 164–170.
59. Bell, S.L.; Xu, G.; Forstner, J.F. Role of the cystine-knot motif at the c-terminus of rat mucin protein MUC2 in dimer formation and secretion. Biochemical Journal 2001, 357, 203-209.
60. Podolsky, D.K. Oligosaccharide structures of human colonic mucin. The Journal of Biological Chemistry 1985, 260, 8262-8271.
61. Bergstrom, K.S.; Xia, L. Mucin-type o-glycans and their roles in intestinal homeostasis. Glycobiology 2013, 23, 1026-1037.
62. Jin, C.; Kenny, D.T.; Skoog, E.C.; Padra, M.; Adamczyk, B.; Vitizeva, V.; Thorell, A.; Venkatakrishnan, V.; Lindén, S.K.; Karlsson, N.G. Structural diversity of human gastric mucin glycans. Molecular & Cellular Proteomics 2017, 16, 743-758.
63. Sheng, Y.H.; Hasnain, S.Z.; Florin, T.H.J.; McGuckin, M.A. Mucins in inflammatory bowel diseases and colorectal cancer. Journal of Gastroenterology and Hepatology 2012, 27, 28-38.
64. McGuckin, M.A.; Linden, S.K.; Sutton, P.; Florin, T.H. Mucin dynamics and enteric pathogens. Nature Reviews. Microbiology 2011, 9, 265-278.
65. Singh, P.K.; Hollingsworth, M.A. Cell surface-associated mucins in signal transduction. Trends in Cell Biology 2006, 16, 467-476.
66. Corfield, A.P. Mucins: A biologically relevant glycan barrier in mucosal protection. Biochimica et Biophysica Acta 2015, 1850, 236-252.
67. Robbe, C.; Capon, C.; Coddeville, B.; Michalski, J.-C. Structural diversity and specific distribution of O-glycans in normal human mucins along the intestinal tract. The Biochemical journal 2004, 384, 307-316.
68. Turner, J.R. Intestinal mucosal barrier function in health and disease. Nature Reviews. Immunology 2009, 9, 799-809.
69. Asker, N.; Axelsson, M.A.; Olofsson, S.O.; Hansson, G.C. Dimerization of the humanMUC2 mucin in the endoplasmic reticulum is followed by a N-glycosylation-dependent transfer of the mono- and dimers to the golgi apparatus. The Journal of Biological Chemistry 1998, 273, 18857-18863.
70. Theodoropoulos, G.; Carraway, K.L. Molecular signaling in the regulation of mucins. Journal of Cellular Biochemistry 2007, 102, 1103-1116.
71. Kim, J.J.; Khan, W.I. Goblet cells and mucins: Role in innate defense in enteric infections. Pathogens 2013, 2, 55-70.
72. Maret, W. The metals in the biological periodic system of the elements: Concepts and conjectures. International Journal of Molecular Sciences 2016, 17.
73. Lim, K.H.; Riddell, L.J.; Nowson, C.A.; Booth, A.O.; Szymlek-Gay, E.A. Iron and zinc nutrition in the economically-developed world: A review. Nutrients 2013, 5, 3184-3211.
74. Hara, T.; Takeda, T.A.; Takagishi, T.; Fukue, K.; Kambe, T.; Fukada, T. Physiological roles of zinc transporters: Molecular and genetic importance in zinc homeostasis. The Journal of Physiological Sciences 2017, 67, 283-301.
![Page 147: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/147.jpg)
References
131
75. Matthews, J.M.; Bhati, M.; Lehtomaki, E.; Mansfield, R.E.; Cubeddu, L.; Mackay, J.P. It takes two to tango: The structure and function of LIM, RING, PHD and MYND domains. Current Pharmaceutical Design 2009, 15, 3681-3696.
76. Maret, W.; Sandstead, H.H. Zinc requirements and the risks and benefits of zinc supplementation. Journal of Trace Elements in Medicine and Biology 2006, 20, 3-18.
77. Fukada, T.; Yamasaki, S.; Nishida, K.; Murakami, M.; Hirano, T. Zinc homeostasis and signaling in health and diseases: Zinc signaling. Journal of Biological Inorganic Chemistry 2011, 16, 1123-1134.
78. Frederickson, C.J.; Koh, J.Y.; Bush, A.I. The neurobiology of zinc in health and disease. Nature Reviews. Neuroscience 2005, 6, 449-462.
79. Sandstead, H.H.; Frederickson, C.J.; Penland, J.G. History of zinc as related to brain function. The Journal of Nutrition 2000, 130, 496S-502S.
80. Jackson, M.J. Physiology of zinc: General aspects. In Zinc in Human Biology, Mills, C.F., Ed. Springer London: London, 1989; pp 1-14.
81. Driessen, C.; Hirv, K.; Kirchner, H.; Rink, L. Zinc regulates cytokine induction by superantigens and lipopolysaccharide. Immunology 1995, 84, 272-277.
82. Wessells, K.R.; Jorgensen, J.M.; Hess, S.Y.; Woodhouse, L.R.; Peerson, J.M.; Brown, K.H. Plasma zinc concentration responds rapidly to the initiation and discontinuation of short-term zinc supplementation in healthy men. The Journal of Nutrition 2010, 140, 2128-2133.
83. Hess, S.Y.; Peerson, J.M.; King, J.C.; Brown, K.H. Use of serum zinc concentration as an indicator of population zinc status. Food and Nutrition Bulletin 2007, 28, S403-429.
84. Scott, B.J.; Bradwell, A.R. Identification of the serum binding proteins for iron, zinc, cadmium, nickel, and calcium. Clinical Chemistry 1983, 29, 629-633.
85. Brown, K.H.; Wuehler, S.E.; Peerson, J.M. The importance of zinc in human nutrition and estimation of the global prevalence of zinc deficiency. Food and Nutrition Bulletin 2001, 22, 113-125.
86. King, J.C.; Shames, D.M.; Lowe, N.M.; Woodhouse, L.R.; Sutherland, B.; Abrams, S.A.; Turnlund, J.R.; Jackson, M.J. Effect of acute zinc depletion on zinc homeostasis and plasma zinc kinetics in men. The American Journal of Clinical Nutrition 2001, 74, 116-124.
87. Lowe, N.M.; Woodhouse, L.R.; Sutherland, B.; Shames, D.M.; Burri, B.J.; Abrams, S.A.; Turnlund, J.R.; Jackson, M.J.; King, J.C. Kinetic parameters and plasma zinc concentration correlate well with net loss and gain of zinc from men. The Journal of Nutrition 2004, 134, 2178-2181.
88. Hunt, J.R.; Matthys, L.A.; Johnson, L.K. Zinc absorption, mineral balance, and blood lipids in women consuming controlled lactoovovegetarian and omnivorous diets for 8 wk. The American Journal of Clinical Nutrition 1998, 67, 421-430.
89. Taylor, C.M.; Bacon, J.R.; Aggett, P.J.; Bremner, I. Homeostatic regulation of zinc absorption and endogenous losses in zinc-deprived men. The American Journal of Clinical Nutrition 1991, 53, 755-763.
90. Johnson, P.E.; Hunt, C.D.; Milne, D.B.; Mullen, L.K. Homeostatic control of zinc metabolism in men: Zinc excretion and balance in men fed diets low in zinc. The American Journal of Clinical Nutrition 1993, 57, 557-565.
91. Jackson, M.J.; Jones, D.A.; Edwards, R.H.; Swainbank, I.G.; Coleman, M.L. Zinc homeostasis in man: Studies using a new stable isotope-dilution technique. The British Journal of Nutrition 1984, 51, 199-208.
![Page 148: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/148.jpg)
References
132
92. Hoadley, J.E.; Leinart, A.S.; Cousins, R.J. Kinetic analysis of zinc uptake and serosal transfer by vascularly perfused rat intestine. The American Journal of Physiology 1987, 252, G825-831.
93. Ziegler, E.E.; Serfass, R.E.; Nelson, S.E.; Figueroa-Colon, R.; Edwards, B.B.; Houk, R.S.; Thompson, J.J. Effect of low zinc intake on absorption and excretion of zinc by infants studied with 70Zn as extrinsic tag. The Journal of Nutrition 1989, 119, 1647-1653.
94. Baer, M.T.; King, J.C. Tissue zinc levels and zinc excretion during experimental zinc depletion in young men. The American Journal of Clinical Nutrition 1984, 39, 556-570.
95. Jackson, M.J.; Jones, D.A.; Edwards, R.H. Tissue zinc levels as an index of body zinc status. Clinical Physiology 1982, 2, 333-343.
96. Wellenreuther, G.; Cianci, M.; Tucoulou, R.; Meyer-Klaucke, W.; Haase, H. The ligand environment of zinc stored in vesicles. Biochemical and Biophysical Research Communications 2009, 380, 198-203.
97. Maret, W. Analyzing free zinc(II) ion concentrations in cell biology with fluorescent chelating molecules. Metallomics 2015, 7, 202-211.
98. Bozym, R.A.; Chimienti, F.; Giblin, L.J.; Gross, G.W.; Korichneva, I.; Li, Y.; Libert, S.; Maret, W.; Parviz, M.; Frederickson, C.J., et al. Free zinc ions outside a narrow concentration range are toxic to a variety of cells in vitro. Experimental Biology and Medicine 2010, 235, 741-750.
99. Maret, W. Molecular aspects of human cellular zinc homeostasis: Redox control of zinc potentials and zinc signals. BioMetals 2009, 22, 149 - 157.
100. Chabosseau, P.; Woodier, J.; Cheung, R.; Rutter, G.A. Sensors for measuring subcellular zinc pools. Metallomics 2018.
101. Colvin, R.A.; Holmes, W.R.; Fontaine, C.P.; Maret, W. Cytosolic zinc buffering and muffling: Their role in intracellular zinc homeostasis. Metallomics 2010, 2, 306-317.
102. Huang, L.; Tepaamorndech, S. The SLC30 family of zinc transporters - a review of current understanding of their biological and pathophysiological roles. Molecular Aspects of Medicine 2013, 34, 548-560.
103. Jeong, J.; Eide, D.J. The SLC39 family of zinc transporters. Molecular Aspects of Medicine 2013, 34, 612-619.
104. Palmiter, R.D. Protection against zinc toxicity by metallothionein and zinc transporter 1. Proceedings of the National Academy of Sciences of the United States of America 2004, 101, 4918-4923.
105. Maret, W. Redox biochemistry of mammalian metallothioneins. Journal of Biological Inorganic Chemistry 2011, 16, 1079-1086.
106. Kimura, T.; Kambe, T. The functions of metallothionein and ZIP and ZnT transporters: An overview and perspective. International Journal of Molecular Sciences 2016, 17, 336.
107. Krȩżel, A.; Maret, W. Dual nanomolar and picomolar Zn(II) binding properties of metallothionein. Journal of the American Chemical Society 2007, 129, 10911-10921.
108. Bell, S.G.; Vallee, B.L. The metallothionein/thionein system: An oxidoreductive metabolic zinc link. Chembiochem 2008, 10, 55-62.
109. Coyle, P.; Philcox, J.C.; Carey, L.C.; Rofe, A.M. Metallothionein: The multipurpose protein. Cellular and Molecular Life Sciences 2002, 59, 627-647.
110. Maret, W. The function of zinc metallothionein: A link between cellular zinc and redox state. The Journal of Nutrition 2000, 130, 1455S-1458S.
![Page 149: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/149.jpg)
References
133
111. Krȩżel, A.; Hao, Q.; Maret, W. The zinc/thiolate redox biochemistry of metallothionein and the control of zinc ion fluctuations in cell signaling. Archives of Biochemistry and Biophysics 2007, 463, 188-200.
112. Maret, W.; Li, Y. Coordination dynamics of zinc in proteins. Chemical Reviews 2009, 109, 4682-4707.
113. Maret, W. Zinc coordination environments in proteins as redox sensors and signal transducers. Antioxidants & Redox Signaling 2006, 8, 1419-1441.
114. Heuchel, R.; Radtke, F.; Georgiev, O.; Stark, G.; Aguet, M.; Schaffner, W. The transcription factor MTF-1 is essential for basal and heavy metal-induced metallothionein gene expression. The EMBO Journal 1994, 13, 2870-2875.
115. Tapiero, H.; Tew, K.D. Trace elements in human physiology and pathology: Zinc and metallothioneins. Biomedicine & Pharmacotherapy 2003, 57, 399-411.
116. Kelly, E.J.; Quaife, C.J.; Froelick, G.J.; Palmiter, R.D. Metallothionein I and II protect against zinc deficiency and zinc toxicity in mice. The Journal of Nutrition 1996, 126, 1782-1790.
117. Davis, S.R.; McMahon, R.J.; Cousins, R.J. Metallothionein knockout and transgenic mice exhibit altered intestinal processing of zinc with uniform zinc-dependent zinc transporter-1 expression. The Journal of Nutrition 1998, 128, 825-831.
118. Colvin, R.A.; Bush, A.I.; Volitakis, I.; Fontaine, C.P.; Thomas, D.; Kikuchi, K.; Holmes, W.R. Insights into Zn2+ homeostasis in neurons from experimental and modeling studies. American Journal of Physiology-Cell Physiology 2008, 294, C726-742.
119. Sandström, B. Dose dependence of zinc and manganese absorption in man. Proceedings of the Nutrition Society 1992, 51, 211-218.
120. Davies, N.T. Studies on the absorption of zinc by rat intestine. The British Journal of Nutrition 1980, 43, 189-203.
121. Seal, C.J.; Heaton, F.W. Chemical factors affecting the intestinal absorption of zinc in vitro and in vivo. The British Journal of Nutrition 1983, 50, 317-324.
122. Seal, C.J.; Mathers, J.C. Intestinal zinc transfer by everted gut sacs from rats given diets containing different amounts and types of dietary fibre. The British Journal of Nutrition 1989, 62, 151-163.
123. Antonson, D.L.; Barak, A.J.; Vanderhoof, J.A. Determination of the site of zinc absorption in rat small intestine. The Journal of Nutrition 1979, 109, 142-147.
124. Wang, S.C.; Chen, Y.S.; Chen, S.M.; Young, T.K. Possible site of decreased intestinal zinc absorption in chronic uremic rats. Nephron 2001, 89, 208-214.
125. Yasuno, T.; Okamoto, H.; Nagai, M.; Kimura, S.; Yamamoto, T.; Nagano, K.; Furubayashi, T.; Yoshikawa, Y.; Yasui, H.; Katsumi, H., et al. In vitro study on the transport of zinc across intestinal epithelial cells using Caco-2 monolayers and isolated rat intestinal membranes. Biological & Pharmaceutical Bulletin 2012, 35, 588-593.
126. Reyes, J.G. Zinc transport in mammalian cells. The American Journal of Physiology 1996, 270, C401-410.
127. Raffaniello, R.D.; Shih-Yu Lee; Teichberc, S.; Wapnir, R.A. Distinct mechanisms of zinc uptake at the apical and basolateral membranes of Caco-2 cells. Journal of Cellular Physiology 1992, 152, 356-361.
128. Finley, J.W.; Briske-Anderson, M.; Reeves, P.G.; Johnson, L.K. Zinc uptake and transcellular movement by Caco-2 cells: Studies with media containing fetal bovine serum. The Journal of Nutritional Biochemistry 1995, 6, 137-144.
![Page 150: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/150.jpg)
References
134
129. Rossi, A.; PoveriniI, R.; Di Lullo, G.; Modesti, A.; Modica, A.; Scarinos, M.L. Heavy metal toxicity following apical and basolateral exposure in the human intestinal cell line Caco-2. Toxicology in Vitro 1996, 10, 27-36.
130. Lönnerdal, B. Intestinal absorption of zinc. In Zinc in Human Biology, Mills, C.F., Ed. Springer London: London, 1989; pp 33-55.
131. Steel, L.; Cousins, R.J. Kinetics of zinc absorption by luminally and vascularly perfused rat intestine. The American Journal of Physiology 1985, 248, G46-53.
132. Cragg, R.A.; Phillips, S.R.; Piper, J.M.; Varma, J.S.; Campbell, F.C.; Mathers, J.C.; Ford, D. Homeostatic regulation of zinc transporters in the human small intestine by dietary zinc supplementation. Gut 2005, 54, 469-478.
133. Jackson, K.A.; Helston, R.M.; McKay, J.A.; O'Neill, E.D.; Mathers, J.C.; Ford, D. Splice variants of the human zinc transporter ZnT5 (SLC30A5) are differentially localized and regulated by zinc through transcription and mrna stability. The Journal of Biological Chemistry 2007, 282, 10423-10431.
134. Valentine, R.A.; Jackson, K.A.; Christie, G.R.; Mathers, J.C.; Taylor, P.M.; Ford, D. Znt5 variant b is a bidirectional zinc transporter and mediates zinc uptake in human intestinal Caco-2 cells. The Journal of Biological Chemistry 2007, 282, 14389-14393.
135. Menard, M.P.; Cousins, R.J. Zinc transport by brush border membrane vesicles from rat intestine. The Journal of Nutrition 1983, 113, 1434-1442.
136. Ghishan, F.K.; Sobo, G. Intestinal maturation: In vivo zinc transport. Pediatric Research 1983, 17, 148-151.
137. Cragg, R.A.; Christie, G.R.; Phillips, S.R.; Russi, R.M.; Kury, S.; Mathers, J.C.; Taylor, P.M.; Ford, D. A novel zinc-regulated human zinc transporter, hZTL1, is localized to the enterocyte apical membrane. The Journal of Biological Chemistry 2002, 277, 22789-22797.
138. International Zinc Nutrition Consultative Group; Brown, K.H.; Rivera, J.A.; Bhutta, Z.; Gibson, R.S.; King, J.C.; Lönnerdal, B.; Ruel, M.T.; Sandtrom, B.; Wasantwisut, E., et al. International zinc nutrition consultative group (IZiNCG) technical document #1. Assessment of the risk of zinc deficiency in populations and options for its control. Food and Nutrition Bulletin 2004, 25, S99-203.
139. Sandström, B. Dietary pattern and zinc supply. In Zinc in Human Biology, Mills, C.F., Ed. Springer, London: London, 1989; pp 351-363.
140. Scholmerich, J.; Freudemann, A.; Kottgen, E.; Wietholtz, H.; Steiert, B.; Lohle, E.; Haussinger, D.; Gerok, W. Bioavailability of zinc from zinc-histidine complexes. I. Comparison with zinc sulfate in healthy men. The American Journal of Clinical Nutrition 1987, 45, 1480-1486.
141. Sandström, B.; Arvidsson, B.; Cederblad, A.; Björn-Rasmussen, E. Zinc absorption from composite meals. I. The significance of whest extraction rate, zinc, calcium, and protein content in meals based on bread. The American Journal of Clinical Nutrition 1980, 33, 739-745.
142. Wada, L.; Turnlund, J.R.; King, J.C. Zinc utilization in young men fed adequate and low zinc intakes. The Journal of Nutrition 1985, 115, 1345-1354.
143. Yasuno, T.; Okamoto, H.; Nagai, M.; Kimura, S.; Yamamoto, T.; Nagano, K.; Furubayashi, T.; Yoshikawa, Y.; Yasui, H.; Katsumi, H., et al. The disposition and intestinal absorption of zinc in rats. European Journal of Pharmaceutical Sciences 2011, 44, 410-415.
![Page 151: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/151.jpg)
References
135
144. Istfan, N.W.; Janghorbani, M.; Young, V.R. Absorption of stable 70Zn in healthy young men in relation to zinc intake. The American Journal of Clinical Nutrition 1983, 38, 187-194.
145. Kury, S.; Dreno, B.; Bezieau, S.; Giraudet, S.; Kharfi, M.; Kamoun, R.; Moisan, J.P. Identification of SLC39A4, a gene involved in acrodermatitis enteropathica. Nature genetics 2002, 31, 239-240.
146. Wang, K.; Zhou, B.; Kuo, Y.M.; Zemansky, J.; Gitschier, J. A novel member of a zinc transporter family is defective in acrodermatitis enteropathica. American Journal of Human Genetics 2002, 71, 66-73.
147. McMahon, R.J.; Cousins, R.J. Regulation of the zinc transporter Znt-1 by dietary zinc. Proceedings of the National Academy of Sciences of the United States of America 1998, 95, 4841-4846.
148. Wang, F.; Kim, B.E.; Petris, M.J.; Eide, D.J. The mammalian zip5 protein is a zinc transporter that localizes to the basolateral surface of polarized cells. The Journal of Biological Chemistry 2004, 279, 51433-51441.
149. Guthrie, G.J.; Aydemir, T.B.; Troche, C.; Martin, A.B.; Chang, S.M.; Cousins, R.J. Influence of ZIP14 (SLC39A14) on intestinal zinc processing and barrier function. American Journal of Physiology-Gastrointestinal and Liver Physiology 2015, 308, G171-178.
150. Gunshin, H.; Mackenzie, B.; Berger, U.V.; Gunshin, Y.; Romero, M.F.; Boron, W.F.; Nussberger, S.; Gollan, J.L.; Hediger, M.A. Cloning and characterization of a mammalian proton-coupled metal-ion transporter. Nature 1997, 388, 482-488.
151. Tandy, S.; Williams, M.; Leggett, A.; Lopez-Jimenez, M.; Dedes, M.; Ramesh, B.; Srai, S.K.; Sharp, P. Nramp2 expression is associated with ph-dependent iron uptake across the apical membrane of human intestinal Caco-2 cells. The Journal of Biological Chemistry 2000, 275, 1023-1029.
152. Kordas, K.; Stoltzfus, R.J. New evidence of iron and zinc interplay at the enterocyte and neural tissues. The Journal of Nutrition 2004, 134, 1295-1298.
153. Ferguson, C.J.; Wareing, M.; Ward, D.T.; Green, R.; Smith, C.P.; Riccardi, D. Cellular localization of divalent metal transporter DMT-1 in rat kidney. American Journal of Physiology-Renal Physiology 2001, 280, F803-814.
154. Garrick, M.D.; Dolan, K.G.; Horbinski, C.; Ghio, A.J.; Higgins, D.; Porubcin, M.; Moore, E.G.; Hainsworth, L.N.; Umbreit, J.N.; Conrad, M.E., et al. DMT1: A mammalian transporter for multiple metals. BioMetals 2003, 16, 41-54.
155. Yamaji, S.; Tennant, J.; Tandy, S.; Williams, M.; Singh Srai, S.K.; Sharp, P. Zinc regulates the function and expression of the iron transporters DMT1 and IREG1 in human intestinal Caco-2 cells. FEBS Letters 2001, 507, 137-141.
156. Fukada, T.; Kambe, T. Molecular and genetic features of zinc transporters in physiology and pathogenesis. Metallomics 2011, 3, 662-674.
157. Sauer, A.K.; Pfaender, S.; Hagmeyer, S.; Tarana, L.; Mattes, A.K.; Briel, F.; Kury, S.; Boeckers, T.M.; Grabrucker, A.M. Characterization of zinc amino acid complexes for zinc delivery in vitro using Caco-2 cells and enterocytes from hiPSC. BioMetals 2017, 30, 643-661.
158. Hennigar, S.R.; McClung, J.P. Zinc transport in the mammalian intestine. Comprehensive Physiology 2018, 9, 59-74.
159. Richards, M.P.; Cousins, R.J. Mammalian zinc homeostasis: Requirement for RNA and metallothionein synthesis. Biochemical and Biophysical Research Communications 1975, 64, 1215-1223.
![Page 152: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/152.jpg)
References
136
160. Menard, M.P.; McCormick, C.C.; Cousins, R.J. Regulation of intestinal metallothionein biosynthesis in rats by dietary zinc. The Journal of Nutrition 1981, 111, 1353-1361.
161. Reeves, P.G. Adaptation responses in rats to long-term feeding of high-zinc diets: Emphasis on intestinal metallothionein. The Journal of Nutritional Biochemistry 1995, 6, 48-54.
162. Liuzzi, J.P.; Blanchard, R.K.; Cousins, R.J. Differential regulation of zinc transporter 1, 2, and 4 mRNA expression by dietary zinc in rats. The Journal of Nutrition 2001, 131, 46-52.
163. Liuzzi, J.P.; Bobo, J.A.; Lichten, L.A.; Samuelson, D.A.; Cousins, R.J. Responsive transporter genes within the murine intestinal-pancreatic axis form a basis of zinc homeostasis. Proceedings of the National Academy of Sciences of the United States of America 2004, 101, 14355-14360.
164. Mao, X.; Kim, B.E.; Wang, F.; Eide, D.J.; Petris, M.J. A histidine-rich cluster mediates the ubiquitination and degradation of the human zinc transporter, hZIP4, and protects against zinc cytotoxicity. The Journal of Biological Chemistry 2007, 282, 6992-7000.
165. Huang, Z.L.; Dufner-Beattie, J.; Andrews, G.K. Expression and regulation of SLC39A family zinc transporters in the developing mouse intestine. Developmental Biology 2006, 295, 571-579.
166. Kim, B.E.; Wang, F.; Dufner-Beattie, J.; Andrews, G.K.; Eide, D.J.; Petris, M.J. Zn2+-stimulated endocytosis of the mZIP4 zinc transporter regulates its location at the plasma membrane. The Journal of Biological Chemistry 2004, 279, 4523-4530.
167. Hashimoto, A.; Nakagawa, M.; Tsujimura, N.; Miyazaki, S.; Kizu, K.; Goto, T.; Komatsu, Y.; Matsunaga, A.; Shirakawa, H.; Narita, H., et al. Properties of ZIP4 accumulation during zinc deficiency and its usefulness to evaluate zinc status: A study of the effects of zinc deficiency during lactation. American Journal of Physiology-Regulatory, Integrative and Comparative Physiology 2016, 310, R459-468.
168. Jou, M.Y.; Hall, A.G.; Philipps, A.F.; Kelleher, S.L.; Lönnerdal, B. Tissue-specific alterations in zinc transporter expression in intestine and liver reflect a threshold for homeostatic compensation during dietary zinc deficiency in weanling rats. The Journal of Nutrition 2009, 139, 835-841.
169. Davis, S.R.; Cousins, R.J. Metallothionein expression in animals: A physiological perspective on function. The Journal of Nutrition 2000, 130, 1085-1088.
170. Cousins, R.J.; Liuzzi, J.P.; Lichten, L.A. Mammalian zinc transport, trafficking, and signals. Journal of Biological Chemistry 2006, 281, 24085-24089.
171. Andrews, G.K. Regulation of metallothionein gene expression by oxidative stress and metal ions. Biochemical Pharmacology 1999, 59, 95-104.
172. Smith, K.T.; Cousins, R.J. Quantitative aspects of zinc absorption by isolated, vascularly perfused rat intestine. The Journal of Nutrition 1980, 110, 316-323.
173. Hinskens, B.; Philcox, J.C.; Coyle, P.; Rofe, A.M. Increased zinc absorption but not secretion in the small intestine of metallothionein-null mice. Biological Trace Element Research 2000, 78, 231-240.
174. Hoadley, J.E.; Leinart, A.S.; Cousins, R.J. Relationship of 65Zn absorption kinetics to intestinal metallothionein in rats: Effects of zinc depletion and fasting. The Journal of Nutrition 1988, 118, 497-502.
175. Coppen, D.E.; Davies, N.T. Studies on the effects of dietary zinc dose on 65Zn absorption in vivo and on the effects of Zn status on 65Zn absorption and body loss in young rats. The British Journal of Nutrition 1987, 57, 35-44.
![Page 153: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/153.jpg)
References
137
176. Moltedo, O.; Verde, C.; Capasso, A.; Parisi, E.; Remondelli, P.; Bonatti, S.; Alvarez-Hernandez, X.; Glass, J.; Alvino, C.G.; Leone, A. Zinc transport and metallothionein secretion in the intestinal human cell line Caco-2. The Journal of Biological Chemistry 2000, 275, 31819-31825.
177. Hempe, J.M.; Cousins, R.J. Cysteine-rich intestinal protein and intestinal metallothionein: An inverse relationship as a conceptual model for zinc absorption in rats. The Journal of Nutrition 1992, 122, 89-95.
178. Chai, F.; Truong-Tran, A.Q.; Ho, L.H.; Zalewski, P.D. Regulation of caspase activation and apoptosis by cellular zinc fluxes and zinc deprivation: A review. Immunology and Cell Biology 1999, 77, 272-278.
179. O'Dell, B.L. Cysteine-rich intestinal protein (CRIP): A new intestinal zinc transport protein. Nutrition Reviews 1992, 50, 232-233.
180. Lanningham-Foster, L.; Green, C.L.; Langkamp-Henken, B.; Davis, B.A.; Nguyen, K.T.; Bender, B.S.; Cousins, R.J. Overexpression of crip in transgenic mice alters cytokine patterns and the immune response. American Journal of Physiology-Endocrinology and Metabolism 2002, 282, E1197-E1203.
181. Nishito, Y.; Kambe, T. Absorption mechanisms of iron, copper, and zinc: An overview. Journal of Nutritional Science and Vitaminology 2018, 64, 1-7.
182. Kasana, S.; Din, J.; Maret, W. Genetic causes and gene-nutrient interactions in mammalian zinc deficiencies: Acrodermatitis enteropathica and transient neonatal zinc deficiency as examples. Journal of Trace Elements in Medicine and Biology 2015, 29, 47-62.
183. Andrews, G.K. Regulation and function of ZIP4, the acrodermatitis enteropathica gene. Biochemical Society Transactions 2008, 36, 1242-1246.
184. Dufner-Beattie, J.; Wang, F.; Kuo, Y.-M.; Gitschier, J.; Eide, D.; Andrews, G.K. The acrodermatitis enteropathica gene ZIP4 encodes a tissue-specific, zinc-regulated zinc transporter in mice. Journal of Biological Chemistry 2003, 278, 33474-33481.
185. Weaver, B.P.; Dufner-Beattie, J.; Kambe, T.; Andrews, G.K. Novel zinc-responsive post-transcriptional mechanisms reciprocally regulate expression of the mouse SLC39A4 and SLC39A5 zinc transporters (ZIP4 and ZIP5). Biological Chemistry 2007, 388, 1301-1312.
186. Dufner-Beattie, J.; Kuo, Y.M.; Gitschier, J.; Andrews, G.K. The adaptive response to dietary zinc in mice involves the differential cellular localization and zinc regulation of the zinc transporters ZIP4 and ZIP5. The Journal of Biological Chemistry 2004, 279, 49082-49090.
187. Lichten, L.A.; Cousins, R.J. Mammalian zinc transporters: Nutritional and physiologic regulation. Annual Review of Nutrition 2009, 29, 153-176.
188. Andrews, G.K.; Wang, H.; Dey, S.K.; Palmiter, R.D. Mouse zinc transporter 1 gene provides an essential function during early embryonic development. Genesis 2004, 40, 74-81.
189. Inoue, K.; Matsuda, K.; Itoh, M.; Kawaguchi, H.; Tomoike, H.; Aoyagi, T.; Nagai, R.; Hori, M.; Nakamura, Y.; Tanaka, T. Osteopenia and male-specific sudden cardiac death in mice lacking a zinc transporter gene, ZnT5. Human Molecular Genetics 2002, 11, 1775-1784.
190. Hennigar, S.R.; McClung, J.P. Hepcidin attenuates zinc efflux in Caco-2 cells. The FASEB Journal 2016, 30, 292.293.
191. Gibson, R.S.; King, J.C.; Lowe, N. A review of dietary zinc recommendations. Food and Nutrition Bulletin 2016, 37, 443-460.
![Page 154: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/154.jpg)
References
138
192. EFSA Panel on Dietetic Products, Nutrition and Allergies (NDA). Scientific opinion on dietary reference values for zinc. EFSA Journal 2014 2014, 12.
193. King, J.C.; Shames, D.M.; Woodhouse, L.R. Zinc homeostasis in humans. The Journal of Nutrition 2000, 130, 1360S-1366S.
194. Miller, L.V.; Krebs, N.F.; Hambidge, K.M. A mathematical model of zinc absorption in humans as a function of dietary zinc and phytate. The Journal of Nutrition 2007, 137, 135-141.
195. Deutsche Gesellschaft für Ernährung; Österreichische Gesellschaft für Ernährung; Schweizerische Gesellschaft für Ernährung. Referenzwerte für die Nährstoffzufuhr. 2 ed.; Neuer Umschau Buchverlag: Bonn, Germany, 2015; Vol. 1.
196. Carter, J.P.; Grivetti, L.E.; Davis, J.T.; Nasiff, S.; Mansour, A.; Mousa, W.A.; Atta, A.E.; Patwardhan, V.N.; Abdel Moneim, M.; Abdou, I.A., et al. Growth and sexual development of adolescent egyptian village boys. Effects of zinc, iron, and placebo supplementation. The American Journal of Clinical Nutrition 1969, 22, 59-78.
197. Prasad, A.S.; Miale, A., Jr.; Farid, Z.; Sandstead, H.H.; Schulert, A.R. Zinc metabolism in patients with the syndrome of iron deficiency anemia, hepatosplenomegaly, dwarfism, and hypognadism. The Journal of Laboratory and Clinical Medicine 1963, 61, 537-549.
198. Plum, L.M.; Rink, L.; Haase, H. The essential toxin: Impact of zinc on human health. International Journal of Environmental Research and Public Health 2010, 7, 1342-1365.
199. Walker, C.L.; Black, R.E. Zinc for the treatment of diarrhoea: Effect on diarrhoea morbidity, mortality and incidence of future episodes. International Journal of Epidemiology 2010, 39 Suppl 1, i63-i69.
200. Walker, C.F.; Black, R.E. Zinc and the risk for infectious disease. Annual Review of Nutrition 2004, 24, 255-275.
201. King, J.C.; Brown, K.H.; Gibson, R.S.; Krebs, N.F.; Lowe, N.M.; Siekmann, J.H.; Raiten, D.J. Biomarkers of nutrition for development (BOND)-zinc review. The Journal of Nutrition 2016.
202. Oberleas, D.; Harland, B.F. Phytate content of foods: Effect on dietary zinc bioavailability. Journal of the American Dietetic Association 1981, 79, 433-436.
203. Davies, N.T.; Olpin, S.E. Studies on the phytate: Zinc molar contents in diets as a determinant of Zn availability to young rats. The British Journal of Nutrition 1979, 41, 590-603.
204. Foster, M.; Samman, S. Vegetarian diets across the lifecycle: Impact on zinc intake and status. Advances in Food and Nutrition Research 2015, 74, 93-131.
205. Kristensen, M.B.; Hels, O.; Morberg, C.M.; Marving, J.; Bugel, S.; Tetens, I. Total zinc absorption in young women, but not fractional zinc absorption, differs between vegetarian and meat-based diets with equal phytic acid content. The British Journal of Nutrition 2006, 95, 963-967.
206. Broadley, D.B.K.; Edward, J.M.J.; Ander, E.L.; Michael, J.W.; Scott, D.Y.; Sue, W.; Martin, R. Dietary calcium and zinc deficiency risks are decreasing but remain prevalent. Scientific Reports 2015, 5.
207. Turnlund, J.R.; Durkin, N.; Costa, F.; Margen, S. Stable isotope studies of zinc absorption and retention in young and elderly men. The Journal of Nutrition 1986, 116, 1239-1247.
208. McClain, C.J. Zinc metabolism in malabsorption syndromes. Journal of the American College of Nutrition 1985, 4, 49-64.
![Page 155: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/155.jpg)
References
139
209. Solomons, N.W.; Rosenberg, I.H.; Sandstead, H.H.; Vo-Khactu, K.P. Zinc deficiency in Crohn's disease. Digestion 1977, 16, 87-95.
210. Valberg, L.S.; Flanagan, P.R.; Kertesz, A.; Bondy, D.C. Zinc absorption in inflammatory bowel disease. Digestive Diseases and Sciences 1986, 31, 724-731.
211. Prasad, A.S.; Beck, F.W.; Bao, B.; Fitzgerald, J.T.; Snell, D.C.; Steinberg, J.D.; Cardozo, L.J. Zinc supplementation decreases incidence of infections in the elderly: Effect of zinc on generation of cytokines and oxidative stress. The American Journal of Clinical Nutrition 2007, 85, 837-844.
212. Haase, H.; Overbeck, S.; Rink, L. Zinc supplementation for the treatment or prevention of disease: Current status and future perspectives. Experimental Gerontology 2008, 43, 394-408.
213. Liberatoa, S.C.; Singha, G.; Mulhollanda, K. Zinc supplementation in young children: A review of the literature focusing on diarrhoea prevention and treatment. Clinical Nutrition 2015, 34, 181–188.
214. Scientific Panel on Food Additives and Nutrient Sources added to food (ANS). Magnesium aspartate, potassium aspartate, magnesium potassium aspartate, calcium aspartate, zinc aspartate, and copper aspartate as sources for magnesium, potassium, calcium, zinc, and copper added for nutritional purposes to food supplements. EFSA Journal 2008, 6, 883.
215. Holst, B.; Williamson, G. Nutrients and phytochemicals: From bioavailability to bioefficacy beyond antioxidants. Current Opinion in Biotechnology 2008, 19, 73-82.
216. Carbonell-Capella, J.M.; Buniowska, M.; Barba, F.J.; Esteve, M.J.; Frígola, A. Analytical methods for determining bioavailability and bioaccessibility of bioactive compounds from fruits and vegetables: A review. Comprehensive Reviews in Food Science and Food Safety 2014, 13, 155-171.
217. Hotz, C.; DeHaene, J.; Woodhouse, L.R.; Villalpando, S.; Rivera, J.A.; King, J.C. Zinc absorption from zinc oxide, zinc sulfate, zinc oxide + EDTA, or sodium-zinc EDTA does not differ when added as fortificants to maize tortillas. The Journal of Nutrition 2005, 135, 1102-1105.
218. Lopez de Romana, D.; Lönnerdal, B.; Brown, K.H. Absorption of zinc from wheat products fortified with iron and either zinc sulfate or zinc oxide. The American Journal of Clinical Nutrition 2003, 78, 279-283.
219. Wegmuller, R.; Tay, F.; Zeder, C.; Brnic, M.; Hurrell, R.F. Zinc absorption by young adults from supplemental zinc citrate is comparable with that from zinc gluconate and higher than from zinc oxide. The Journal of Nutrition 2014, 144, 132-136.
220. Zhang, S.Q.; Yu, X.F.; Zhang, H.B.; Peng, N.; Chen, Z.X.; Cheng, Q.; Zhang, X.L.; Cheng, S.H.; Zhang, Y. Comparison of the oral absorption, distribution, excretion, and bioavailability of zinc sulfate, zinc gluconate, and zinc-enriched yeast in rats. Molecular Nutrition & Food Research 2018, 62, e1700981.
221. Lönnerdal, B. Phytic acid–trace element (Zn, Cu, Mn) interactions. International Journal of Food Science & Technology 2002, 37, 749-758.
222. Sandström, B.; Sandberg, A.S. Inhibitory effects of isolated inositol phosphates on zinc absorption in humans. Journal of Trace Elements and Electrolytes in Health and Disease 1992, 6, 99-103.
223. Lönnerdal, B.; Sandberg, A.-S.; Sandström, B.; Kunz, C. Inhibitory effects of phytic acid and other inositol phosphates on zinc and calcium absorption in suckling rats. The Journal of Nutrition 1989, 119, 211-214.
![Page 156: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/156.jpg)
References
140
224. Sandberg, A.; Andlid, T. Phytogenic and microbial phytases in human nutrition. International Journal of Food Science and Technology 2002, 37, 823-833.
225. Nävert, B.; Sandström, B.; Cederblad, A. Reduction of the phytate content of bran by leavening in bread and its effect on zinc absorption in man. The British Journal of Nutrition 1985, 53, 47-53.
226. Kemme, P.A.; Schlemmer, U.; Mroz, Z.; Jongbloed, A.W. Monitoring the stepwise phytate degradation in the upper gastrointestinal tract of pigs. Journal of the Science of Food and Agriculture 2006, 86, 612-622.
227. Iqbal, T.H.; Lewis, K.O.; Cooper, B.T. Phytase activity in the human and rat small intestine. Gut 1994, 35, 1233-1236.
228. Turk, M.; Sandberg, A.S. Phytate degradation during breadmaking: Effect of phytase addition. Journal of Cereal Science 1992, 15, 281-294.
229. Vasca, E.; Materazzi, S.; Caruso, T.; Milano, O.; Fontanella, C.; Manfredi, C. Complex formation between phytic acid and divalent metal ions: A solution equilibria and solid state investigation. Analytical and Bioanalytical Chemistry 2002, 374, 173-178.
230. Tang, N.; Skibsted, L.H. Zinc bioavailability from phytate-rich foods and zinc supplements. Modeling the effects of food components with oxygen, nitrogen, and sulfur donor ligands. Journal of Agricultural and Food Chemistry 2017, 65, 8727-8743.
231. Lönnerdal, B.; Cederblad, A.; Davidson, L.; Sandström, B. The effect of individual components of soy formula and cows’ milk formula on zinc bioavailability. The American Journal of Clinical Nutrition 1984, 40, 1064-1070.
232. Khouzam, R.B.; Pohl, P.; Lobinski, R. Bioaccessibility of essential elements from white cheese, bread, fruit and vegetables. Talanta 2011, 86, 425-428.
233. Simpson, C.J.; Wise, A. Binding of zinc and calcium to inositol phosphates (phytate) in vitro. British Journal of Nutrition 1990, 64, 225-232.
234. Turnlund, J.R.; King, J.C.; Keyes, W.R.; Gong, B.; Michel, M.C. A stable isotope study of zinc absorption in young men: Effects of phytate and alpha-cellulose. The American Journal of Clinical Nutrition 1984, 40, 1071-1077.
235. Fredlund, K.; Isaksson, M.; Rossander-Hulthén, L.; Almgren, A.; Sandberg, A.-S. Absorption of zinc and retention of calcium: Dose-dependent inhibition by phytate. Journal of Trace Elements in Medicine and Biology 2006, 20, 49-57.
236. Hunt, J.R.; Beiseigel, J.M. Dietary calcium does not exacerbate phytate inhibition of zinc absorption by women from conventional diets. The American Journal of Clinical Nutrition 2009, 89, 839-843.
237. Sandström, B.; Cederblad, A. Zinc absorption from composite meals. Ii. Influence of the main protein source. The American Journal of Clinical Nutrition 1980, 33, 1778-1783.
238. Sandström, B.; Almgren, A.; Kivisto, B.; Cederblad, A. Effect of protein level and protein source on zinc absorption in humans. The Journal of Nutrition 1989, 119, 48-53.
239. Davidsson, L.; Almgren, A.; SandströM, B.; Juillerat, M.E.-A.; Hurrell, R.F. Zinc absorption in adult humans: The effect of protein sources added to liquid test meals. British Journal of Nutrition 1996, 75, 607-613.
240. Lönnerdal, B.; Bell, J.G.; Hendrickx, A.G.; Burns, R.A.; Keen, C.L. Effect of phytate removal on zinc absorption from soy formula. American Journal of Clinical Nutrition 1988, 48, 1301-1306.
![Page 157: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/157.jpg)
References
141
241. Sandström, B.; Cederblad, A.; Lönnerdal, B. Zinc absorption from human milk, cow's milk, and infant formulas. American Journal of Diseases of Children (1960) 1983, 137, 726-729.
242. Sandström, B.; Davidsson, L.; Cederblad, A.; Lönnerdal, B. Oral iron, dietary ligands and zinc absorption. The Journal of Nutrition 1985, 115, 411-414.
243. Sandstead, H.H.; Smith, J.C., Jr. Deliberations and evaluations of approaches, endpoints and paradigms for determining zinc dietary recommendations. The Journal of Nutrition 1996, 126, 2410s-2418s.
244. Wapnir, R.A.; Stiel, L. Zinc intestinal absorption in rats: Specificity of amino acids as ligands. The Journal of Nutrition 1986, 116, 2171-2179.
245. Raffaniello, R.D.; Wapnir, R.A. Zinc uptake by isolated rat enterocytes: Effect of low molecular weight ligands. Proceedings of the Society for Experimental Biology and Medicine 1989, 192, 219-224.
246. Hempe, J.M.; Cousins, R.J. Effect of EDTA and zinc-methionine complex on zinc absorption by rat intestine. The Journal of Nutrition 1989, 119, 1179-1187.
247. Davidsson, L.; Kastenmayer, P.; Hurrell, R.F. Sodium iron EDTA [NaFe (III)EDTA] as a food fortificant: The effect on the absorption and retention of zinc and calcium in women. The American Journal of Clinical Nutrition 1994, 60, 231-237.
248. Davidsson, L.; Almgren, A.; Sandström, B.; Hurrell, R.F. Zinc absorption in adult humans: The effect of iron fortification. The British Journal of Nutrition 1995, 74, 417-425.
249. Turnlund, J.R.; Keyes, W.R.; Hudson, C.A.; Betschart, A.A.; Kretsch, M.J.; Sauberlich, H.E. A stable-isotope study of zinc, copper, and iron absorption and retention by young women fed vitamin B-6-deficient diets. The American Journal of Clinical Nutrition 1991, 54, 1059-1064.
250. Solomons, N.W.; Jacob, R.A. Studies on the bioavailability of zinc in humans: Effects of heme and nonheme iron on the absorption of zinc. The American Journal of Clinical Nutrition 1981, 34, 475-482.
251. Sandström, B. Micronutrient interactions: Effects on absorption and bioavailability. The British Journal of Nutrition 2001, 85 Suppl 2, S181-185.
252. August, D.; Janghorbani, M.; Young, V.R. Determination of zinc and copper absorption at three dietary Zn-Cu ratios by using stable isotope methods in young adult and elderly subjects. The American Journal of Clinical Nutrition 1989, 50, 1457-1463.
253. Sandstead, H.H. Requirements and toxicity of essential trace elements, illustrated by zinc and copper. The American Journal of Clinical Nutrition 1995, 61, 621s-624s.
254. Blakeborough, P.; Salter, D.N. The intestinal transport of zinc studied using brush-border-membrane vesicles from the piglet. The British Journal of Nutrition 1987, 57, 45-55.
255. Valberg, L.S.; Flanagan, P.R.; Chamberlain, M.J. Effects of iron, tin, and copper on zinc absorption in humans. The American Journal of Clinical Nutrition 1984, 40, 536-541.
256. Johnson, M.A.; Baier, M.J.; Greger, J.L. Effects of dietary tin on zinc, copper, iron, manganese, and magnesium metabolism of adult males. The American Journal of Clinical Nutrition 1982, 35, 1332-1338.
257. Solomons, N.W.; Jacob, R.A.; Pineda, O.; Viteri, F.E. Studies on the bioavailability of zinc in man. III. Effects of ascorbic acid on zinc absorption. The American Journal of Clinical Nutrition 1979, 32, 2495-2499.
![Page 158: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/158.jpg)
References
142
258. Nair, K.M.; Brahmam, G.N.; Radhika, M.S.; Dripta, R.C.; Ravinder, P.; Balakrishna, N.; Chen, Z.; Hawthorne, K.M.; Abrams, S.A. Inclusion of guava enhances non-heme iron bioavailability but not fractional zinc absorption from a rice-based meal in adolescents. The Journal of Nutrition 2013, 143, 852-858.
259. Pabón, M.L.; Lönnerdal, B. Effect of citrate on zinc bioavailability from milk, milk fractions and infant formulas. Nutrition Research 1993, 13, 103-111.
260. Lönnerdal, B.; Stanislowski, A.G.; Hurley, L.S. Isolation of a low molecular weight zinc binding ligand from human milk. Journal of Inorganic Biochemistry 1980, 12, 71-78.
261. Gharibzahedi, S.M.T.; Jafari, S.M. The importance of minerals in human nutrition: Bioavailability, food fortification, processing effects and nanoencapsulation. Trends in Food Science & Technology 2017, 62, 119-132.
262. Furniss, D.E.; Vuichoud, J.; Finot, P.A.; Hurrell, R.F. The effect of Maillard reaction products on zinc metabolism in the rat. The British Journal of Nutrition 1989, 62, 739-749.
263. O'Brien, J.; Morrissey, P.A. Metal ion complexation by products of the Maillard reaction. Food Chemistry 1997, 58, 17-27.
264. Kumar, V.; Sinha, A.K.; Makkar, H.P.S.; Becker, K. Dietary roles of phytate and phytase in human nutrition: A review. Food Chemistry 2010, 120, 945-959.
265. Krȩżel, A.; Maret, W. The biological inorganic chemistry of zinc ions. Archives of Biochemistry and Biophysics 2016, 611, 3-19.
266. Quarterman, J. Metal absorption and the intestinal mucus layer. Digestion 1987, 37, 1-9.
267. Whitehead, M.W.; Thompson, R.P.; Powell, J.J. Regulation of metal absorption in the gastrointestinal tract. Gut 1996, 39, 625-628.
268. Rudzki, Z.; Baker, R.J.; Deller, D.J. The iron-binding glycoprotein of human gastric juice. II. Nature of the interaction of the glycoprotein with iron. Digestion 1973, 8, 53-67.
269. Crowther, R.S.; Marriott, C. Counter-ion binding to mucus glycoproteins. The Journal of Pharmacy and Pharmacology 1984, 36, 21-26.
270. De Domenico, I.; Ward, D.M.; Kaplan, J. Hepcidin regulation: Ironing out the details. Journal of Clinical Investigation 2007, 117, 1755-1758.
271. Smith, K.T.; cousins, R.J.; Silbon, B.L.; Failla, M.L. Zinc absorption and metabolism by isolated, vascularly perfused rat intestine. The Journal of Nutrition 1978, 108, 1849-1857.
272. Tacnet, F.; Watkins, D.W.; Ripoche, P. Studies of zinc transport into brush-border membrane-vesicles isolated from pig small-intestine. Biochimica et Biophysica Acta 1990, 1024, 323-330.
273. Tacnet, F.; Watkins, D.W.; Ripoche, P. Zinc binding in intestinal brush-border membrane isolated from pig. Biochimica et Biophysica Acta 1991, 1063, 51-59.
274. Russel, M.W.S.; Burch, R.L. The Principles of Humane Experimental Technique. Methuen: London, Great Britian, 1959.
275. Flecknell, P. Replacement, reduction and refinement. Altex 2002, 19, 73-78. 276. Shah, P.; Jogani, V.; Bagchi, T.; Misra, A. Role of Caco-2 cell monolayers in prediction
of intestinal drug absorption. Biotechnology Progress 2006, 22, 186-198. 277. Laparra, J.M.; Barbera, R.; Alegria, A.; Glahn, R.P.; Miller, D.D. Purified
glycosaminoglycans from cooked haddock may enhance Fe uptake via endocytosis in a Caco-2 cell culture model. Journal of Food Science 2009, 74, H168-173.
![Page 159: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/159.jpg)
References
143
278. Reeves, P.G.; Briske-Anderson, M.; Johnson, L. Physiologic concentrations of zinc affect the kinetics of copper uptake and transport in the human intestinal cell model, Caco-2. Journal of Nutrition 1998, 1794-1801.
279. Jovani, M.; Barbera, R.; Farre, R.; Aguilera, E.M.d. Calcium, iron, and zinc uptake from digests of infant formulas by Caco-2 cells. Journal of Agricultural and Food Chemistry 2001, 49, 3480−3485.
280. Delie, F.; Werner, R. A human colonic cell line sharing similarities with enterocytes as a model to examine oral absorption: Advantages and limitations of the Caco-2 model. Critical Reviews in Therapeutic Drug Carrier Systems 1997, 14, 221-286.
281. Pinto, M.; Robineleon, S.; Appay, M.D.; Kedinger, M.; Triadou, N.; Dussaulx, E.; Lacroix, B.; Simonassmann, P.; Haffen, K.; Fogh, J., et al. Enterocyte-like differentiation and polarization of the human colon carcinoma cell-line Caco-2 in culture. Biology of the Cell 1983, 47, 323-330.
282. Sambuy, Y.; de Angelis, M.; Ranaldi, G.; Scarino, M.L.; Stammati, A.; Zucco, F. The Caco-2 cell line as a model for the intestinal barrier: Influence of cell and culture-related factors on Caco-2 cell functional characteristics. Cell Biology and Toxicology 2005, 21, 1-26.
283. Hayeshi, R.; Hilgendorf, C.; Artursson, P.; Augustijns, P.; Brodin, B.; Dehertogh, P.; Fisher, K.; Fossati, L.; Hovenkamp, E.; Korjamo, T., et al. Comparison of drug transporter gene expression and functionality in Caco-2 cells from 10 different laboratories. European Journal of Pharmaceutical Sciences 2008, 35, 383-396.
284. Corti, G.; Maestrelli, F.; Cirri, M.; Zerrouk, N.; Mura, P. Development and evaluation of an in vitro method for prediction of human drug absorption II. Demonstration of the method suitability. European Journal of Pharmaceutical Sciences 2006, 27, 354-362.
285. Lozoya-Agullo, I.; Araújo, F.; González-Álvarez, I.; Merino-Sanjuán, M.; González-Álvarez, M.; Bermejo, M.; Sarmento, B. Usefulness of Caco-2/HT29-MTX and Caco-2/HT29-MTX/Raji b coculture models to predict intestinal and colonic permeability compared to Caco-2 monoculture. Molecular Pharmaceutics 2017, 14, 1264-1270.
286. Chen, Q.; Guo, L.; Du, F.; Chen, T.; Hou, H.; Li, B. The chelating peptide (gpagphgppg) derived from alaska pollock skin enhances calcium, zinc and iron transport in Caco-2 cells. International Journal of Food Science & Technology 2017, 52, 1283-1290.
287. Sreenivasulu, K.; Raghu, P.; Nair, K.M. Polyphenol-rich beverages enhance zinc uptake and metallothionein expression in Caco-2 cells. Journal of Food Science 2010, 75, H123-128.
288. Sreenivasulu, K.; Raghu, P.; Ravinder, P.; Nair, K.M. Effect of dietary ligands and food matrices on zinc uptake in Caco-2 cells: Implications in assessing zinc bioavailability. Journal of Agricultural and Food Chemistry 2008, 56, 10967-10972.
289. Cheng, Z.; Tako, E.; Yeung, A.; Welch, R.M.; Glahn, R.P. Evaluation of metallothionein formation as a proxy for zinc absorption in an in vitro digestion/Caco-2 cell culture model. Food & function 2012, 3, 732-736.
290. García-Nebot, M.J.; Alegría, A.; Barberá, R.; Clemente, G.; Romero, F. Does the addition of caseinophosphopeptides or milk improve zinc in vitro bioavailability in fruit beverages? Food Research International 2009, 42, 1475-1482.
291. Cámara, F.; Barberá, R.; Amaro, M.A.; Farré, R. Calcium, iron, zinc and copper transport and uptake by Caco-2 cells in school meals: Influence of protein and mineral interactions. Food Chemistry 2007, 100, 1085-1092.
![Page 160: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/160.jpg)
References
144
292. Iyengar, V.; Pullakhandam, R.; Nair, K.M. Dietary ligands as determinants of iron-zinc interactions at the absorptive enterocyte. Journal of Food Science 2010, 75, H260-264.
293. Tupe, R.S.; Agte, V.V. Effect of water soluble vitamins on Zn transport of Caco-2 cells and their implications under oxidative stress conditions. European Journal of Nutrition 2009, 49, 53-61.
294. Kim, E.-Y.; Pai, T.-K.; Han, O. Effect of bioactive dietary polyphenols on zinc transport across the intestinal Caco-2 cell monolayers. Journal of Agricultural and Food Chemistry 2011, 59, 3606-3612.
295. Viadel, B.; Barberá, R.; Farré, R. Uptake and retention of calcium, iron, and zinc from raw legumes and the effect of cooking on lentils in Caco-2 cells. Nutrition Research 2006, 26, 591-596.
296. Salunke, R.; Rawat, N.; Tiwari, V.K.; Neelam, K.; Randhawa, G.S.; Dhaliwal, H.S.; Roy, P. Determination of bioavailable-zinc from biofortified wheat using a coupled in vitro digestion/Caco-2 reporter-gene based assay. Journal of Food Composition and Analysis 2012, 25, 149-159.
297. Kruger, J.; Taylor, J.R.N.; Du, X.; De Moura, F.F.; Lönnerdal, B.; Oelofse, A. Effect of phytate reduction of sorghum, through genetic modification, on iron and zinc availability as assessed by an in vitro dialysability bioaccessibility assay, Caco-2 cell uptake assay, and suckling rat pup absorption model. Food Chemistry 2013, 141, 1019-1025.
298. Han, O.; Failla, M.L.; Hill, A.D.; Morris, E.R.; Smith, J.C., Jr. Inositol phosphates inhibit uptake and transport of iron and zinc by a human intestinal cell line. The Journal of Nutrition 1994, 124, 580-587.
299. Frontela, C. Effect of dephytinization on bioavailability of iron, calcium and zinc from infant cereals assessed in the Caco-2 cell model. World Journal of Gastroenterology 2009, 15, 1977.
300. Frontela, C.; Ros, G.; Martínez, C. Phytic acid content and “in vitro” iron, calcium and zinc bioavailability in bakery products: The effect of processing. Journal of Cereal Science 2011, 54, 173-179.
301. Jou, M.-Y.; Du, X.; Hotz, C.; Lönnerdal, B. Biofortification of rice with zinc: Assessment of the relative bioavailability of zinc in a Caco-2 cell model and suckling rat pups. Journal of Agricultural and Food Chemistry 2012, 60, 3650-3657.
302. Zemann, N.; Zemann, A.; Klein, P.; Elmadfa, I.; Huettinger, M. Differentiation- and polarization-dependent zinc tolerance in Caco-2 cells. European Journal of Nutrition 2011, 50, 379-386.
303. Jackson, K.A.; Valentine, R.A.; McKay, J.A.; Swan, D.C.; Mathers, J.C.; Ford, D. Analysis of differential gene-regulatory responses to zinc in human intestinal and placental cell lines. The British Journal of Nutrition 2009, 101, 1474-1483.
304. Gefeller, E.M.; Bondzio, A.; Aschenbach, J.R.; Martens, H.; Einspanier, R.; Scharfen, F.; Zentek, J.; Pieper, R.; Lodemann, U. Regulation of intracellular zn homeostasis in two intestinal epithelial cell models at various maturation time points. The Journal of Physiological Sciences 2015, 65, 317-328.
305. Lodemann, U.; Gefeller, E.M.; Aschenbach, J.R.; Martens, H.; Einspanier, R.; Bondzio, A. Dose effects of apical versus basolateral zinc supplementation on epithelial resistance, viability, and metallothionein expression in two intestinal epithelial cell lines. Journal of Biochemical and Molecular Toxicology 2015.
![Page 161: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/161.jpg)
References
145
306. Shen, H.; Qin, H.; Guo, J. Cooperation of metallothionein and zinc transporters for regulating zinc homeostasis in human intestinal Caco-2 cells. Nutrition Research 2008, 28, 406-413.
307. Wang, X.; Valenzano, M.C.; Mercado, J.M.; Zurbach, E.P.; Mullin, J.M. Zinc supplementation modifies tight junctions and alters barrier function of Caco-2 human intestinal epithelial layers. Digestive Diseases and Sciences 2012, 58, 77-87.
308. Jou, M.Y.; Philipps, A.F.; Kelleher, S.L.; Lönnerdal, B. Effects of zinc exposure on zinc transporter expression in human intestinal cells of varying maturity. Journal of Pediatric Gastroenterology and Nutrition 2010, 50, 587-595.
309. Pieri, M.; Christian, H.C.; Wilkins, R.J.; Boyd, C.A.; Meredith, D. The apical (hPepT1) and basolateral peptide transport systems of caco-2 cells are regulated by AMP-activated protein kinase. American Journal of Physiology-Gastrointestinal and Liver Physiology 2010, 299, G136-143.
310. Hardyman, J.E.; Tyson, J.; Jackson, K.A.; Aldridge, C.; Cockell, S.J.; Wakeling, L.A.; Valentine, R.A.; Ford, D. Zinc sensing by metal-responsive transcription factor 1 (MTF1) controls metallothionein and ZnT1 expression to buffer the sensitivity of the transcriptome response to zinc. Metallomics 2016, 8, 337-343.
311. Oestreicher, P.; Cousins, R.J. Zinc uptake by basolateral membrane vesicles from rat small intestine. The Journal of Nutrition 1989, 119, 639-646.
312. Mahler, G.J.; Shuler, M.L.; Glahn, R.P. Characterization of Caco-2 and HT29-MTX cocultures in an in vitro digestion/cell culture model used to predict iron bioavailability. The Journal of Nutritional Biochemistry 2009, 20, 494-502.
313. Hilgendorf, C.; Spahn-Langguth, H.; Regardh, C.G.; Lipka, E.; Amidon, G.L.; Langguth, P. Caco-2 versus Caco-2/HT29-MTX co-cultured cell lines: Permeabilities via diffusion, inside- and outside-directed carrier-mediated transport. Journal of Pharmaceutical Sciences 2000, 89, 63-75.
314. Walter, E.; Janich, S.; Roessler, B.J.; Hilfiger, J.M.; Amidon, G.L. HT29-MTX/Caco-2 cocultures as an in vitro model for the intestinal epithelium: In vitro−in vivo correlation with permeability data from rats and humans. Journal of Pharmaceutical Sciences 1996, 85, 1070-1076.
315. Pontier, C.; Pachot, J.; Botham, R.; Lenfant, B.; Arnaud, P. HT29-MTX and Caco-2/TC7 monolayers as predictive models for human intestinal absorption: Role of the mucus layer. Journal of Pharmaceutical Sciences 2001, 90, 1608-1619.
316. Ferraretto, A.; Bottani, M.; De Luca, P.; Cornaghi, L.; Arnaboldi, F.; Maggioni, M.; Fiorilli, A.; Donetti, E. Morphofunctional properties of a differentiated Caco2/HT-29 co-culture as an in vitro model of human intestinal epithelium. Bioscience Reports 2018, 38.
317. Calatayud, M.; Vazquez, M.; Devesa, V.; Velez, D. In vitro study of intestinal transport of inorganic and methylated arsenic species by Caco-2/HT29-MTX cocultures. Chemical Research in Toxicology 2012, 25, 2654-2662.
318. Vazquez, M.; Calatayud, M.; Velez, D.; Devesa, V. Intestinal transport of methylmercury and inorganic mercury in various models of Caco-2 and HT-29-MTX cells. Toxicology 2013, 311, 147-153.
319. Laparra, J.M.; Glahn, R.P.; Miller, D.D. Different responses of Fe transporters in Caco-2/HT29-MTX cocultures than in independent Caco-2 cell cultures. Cell Biology International 2009, 33, 971-977.
320. Moreno-Olivas, F.; Tako, E.; Mahler, G.J. ZnO nanoparticles affect nutrient transport in an in vitro model of the small intestine. Food and Chemical Toxicology 2018.
![Page 162: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/162.jpg)
References
146
321. Laparra, J.M.; Sanz, Y. Comparison of in vitro models to study bacterial adhesion to the intestinal epithelium. Letters in Applied Microbiology 2009, 49, 695-701.
322. Fleet, J.C.; Turnbull, A.J.; Bourcier, M.; Wood, R.J. Vitamine D-sensitive and quinacrine-sensitive zinc transport in human intestinal cell line Caco-2. American Journal of Physiology 1993, 264, G1037-1045.
323. Reeves, P.G.; Briske-Anderson, M.; Johnson, L. Pre-treatment of Caco-2 cells with zinc during the differentiation phase alters the kinetics of zinc uptake and transport. Journal of Nutritional Biochemistry 2001, 12, 674–684.
324. Krebs, N.F.; Hambidge, K.M. Zinc metabolism and homeostasis: The application of tracer techniques. BioMetals 2001, 14, 397-412.
325. Wastney, M.E.; Aamodt, R.L.; Rumble, W.F.; Henkin, R.I. Kinetic analysis of zinc metabolism and its regulation in normal humans. The American Journal of Physiology 1986, 251, R398-408.
326. Sandström, B.; Lönnerdal, B. Promoters and antagonists of zinc absorption. In Zinc in Human Biology, Mills, C.F., Ed. Springer London: London, 1989; pp 57-78.
327. Tran, C.D.; Gopalsamy, G.L.; Mortimer, E.K.; Young, G.P. The potential for zinc stable isotope techniques and modelling to determine optimal zinc supplementation. Nutrients 2015, 7, 4271-4295.
328. Cerchiaro, G.; Manieri, T.M.; Bertuchi, F.R. Analytical methods for copper, zinc and iron quantification in mammalian cells. Metallomics 2013, 5, 1336-1345.
329. Haase, H.; Rink, L. Zinc signals and immune function. BioFactors 2014, 40, 27-40. 330. Carter, K.P.; Young, A.M.; Palmer, A.E. Fluorescent sensors for measuring metal ions
in living systems. Chemical Reviews 2014, 114, 4564-4601. 331. Ackerman, C.M.; Lee, S.; Chang, C.J. Analytical methods for imaging metals in biology:
From transition metal metabolism to transition metal signaling. Analytical Chemistry 2017, 89, 22-41.
332. Vinkenborg, J.L.; Nicolson, T.J.; Bellomo, E.A.; Koay, M.S.; Rutter, G.A.; Merkx, M. Genetically encoded fret sensors to monitor intracellular Zn2+ homeostasis. Nature Methods 2009, 6, 737-740.
333. Aper, S.J.; Dierickx, P.; Merkx, M. Dual readout BRET/FRET sensors for measuring intracellular zinc. ACS Chemical Biology 2016, 11, 2854-2864.
334. Hessels, A.M.; Chabosseau, P.; Bakker, M.H.; Engelen, W.; Rutter, G.A.; Taylor, K.M.; Merkx, M. eZinch-2: A versatile, genetically encoded fret sensor for cytosolic and intraorganelle Zn2+ imaging. ACS Chemical Biology 2015, 10, 2126-2134.
335. Qin, Y.; Miranda, J.G.; Stoddard, C.I.; Dean, K.M.; Galati, D.F.; Palmer, A.E. Direct comparison of a genetically encoded sensor and small molecule indicator: Implications for quantification of cytosolic Zn2+. ACS Chemical Biology 2013, 8, 2366-2371.
336. Park, J.G.; Qin, Y.; Galati, D.F.; Palmer, A.E. New sensors for quantitative measurement of mitochondrial Zn2+. ACS Chemical Biology 2012, 7, 1636-1640.
337. Qin, Y.; Sammond, D.W.; Braselmann, E.; Carpenter, M.C.; Palmer, A.E. Development of an optical Zn2+ probe based on a single fluorescent protein. ACS Chemical Biology 2016, 11, 2744-2751.
338. Wallrabe, H.; Periasamy, A. Imaging protein molecules using FRET and FLIM microscopy. Current Opinion in Biotechnology 2005, 16, 19-27.
339. Boute, N.; Jockers, R.; Issad, T. The use of resonance energy transfer in high-throughput screening: BRET versus FRET. Trends in Pharmacological Sciences 2002, 23, 351-354.
![Page 163: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/163.jpg)
References
147
340. Pfleger, K.D.G.; Seeber, R.M.; Eidne, K.A. Bioluminescence resonance energy transfer (BRET) for the real-time detection of protein-protein interactions. Nature Protocols 2006, 1, 337-345.
341. Dittmer, P.J.; Miranda, J.G.; Gorski, J.A.; Palmer, A.E. Genetically encoded sensors to elucidate spatial distribution of cellular zinc. The Journal of Biological Chemistry 2009, 284, 16289-16297.
342. Chabosseau, P.; Tuncay, E.; Meur, G.; Bellomo, E.A.; Hessels, A.; Hughes, S.; Johnson, P.R.; Bugliani, M.; Marchetti, P.; Turan, B., et al. Mitochondrial and er-targeted ecalwy probes reveal high levels of free Zn2+. ACS Chemical Biology 2014, 9, 2111-2120.
343. Qin, Y.; Dittmer, P.J.; Park, J.G.; Jansen, K.B.; Palmer, A.E. Measuring steady-state and dynamic endoplasmic reticulum and golgi Zn2+ with genetically encoded sensors. Proceedings of the National Academy of Sciences of the United States of America 2011, 108, 7351-7356.
344. Pancholi, J.; Hodson, D.J.; Jobe, K.; Rutter, G.A.; Goldup, S.M.; Watkinson, M. Biologically targeted probes for Zn2+: A diversity oriented modular "click-snar-click" approach. Chemical Science 2014, 5, 3528-3535.
345. Li, D.; Chen, S.; Bellomo, E.A.; Tarasov, A.I.; Kaut, C.; Rutter, G.A.; Li, W.-h. Imaging dynamic insulin release using a fluorescent zinc indicator for monitoring induced exocytotic release (ZIMIR). Proceedings of the National Academy of Sciences of the United States of America 2011, 108, 21063-21068.
346. Radford, R.J.; Chyan, W.; Lippard, S.J. Peptide-based targeting of fluorescent zinc sensors to the plasma membrane of live cells. Chemical Science 2013, 4, 3080-3084.
347. Ranaldi, G.; Ferruzza, S.; Canali, R.; Leoni, G.; Zalewski, P.D.; Sambuy, Y.; Perozzi, G.; Murgia, C. Intracellular zinc is required for intestinal cell survival signals triggered by the inflammatory cytokine TNF-alpha. The Journal of Nutritional Biochemistry 2013, 24, 967-976.
348. Krȩżel, A.; Maret, W. Zinc-buffering capacity of a eukaryotic cell at physiological pZn. Journal of Biological Inorganic Chemistry 2006, 11, 1049-1062.
349. Lu, Q.; Haragopal, H.; Slepchenko, K.G.; Stork, C.; Li, Y.V. Intracellular zinc distribution in mitochondria, er and the golgi apparatus. International Journal of Physiology, Pathophysiology and Pharmacology 2016, 8, 35-43.
350. Lee, S.R. Cellular toxicity of zinc can be attenuated by sodium hydrogen sulfide in neuronal SH-SY5Y cell. Molecular & Cellular Toxicology 2018, 14, 425-436.
351. Walkup, G.K.; Burdette, S.C.; Lippard, S.J.; Tsien, R.Y. A new cell-permeable fluorescent probe for Zn2+. Journal of the American Chemical Society 2000, 122, 5644-5645.
352. Burdette, S.C.; Walkup, G.K.; Spingler, B.; Tsien, R.Y.; Lippard, S.J. Fluorescent sensors for Zn2+ based on a fluorescein platform: Synthesis, properties and intracellular distribution. Journal of the American Chemical Society 2001, 123, 7831-7841.
353. Haase, H.; Hebel, S.; Engelhardt, G.; Rink, L. Flow cytometric measurement of labile zinc in peripheral blood mononuclear cells. Analytical Biochemistry 2006, 352, 222-230.
354. Dineley, K.E.; Malaiyandi, L.M.; Reynolds, I.J. A reevaluation of neuronal zinc measurements: Artifacts associated with high intracellular dye concentration. Molecular Pharmacology 2002, 62, 618-627.
![Page 164: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/164.jpg)
References
148
355. Kenneth, V.H.; John, A.S.; Walter, C. Fetal bovine serum: A multivariate standard. Proceedings of the Society for Experimental Biology and Medicine 1975, 149, 344-347.
356. Zheng, X.; Baker, H.; Hancock, W.S.; Fawaz, F.; McCaman, M.; Pungor, E. Proteomic analysis for the assessment of different lots of fetal bovine serum as a raw material for cell culture. Part IV. Application of proteomics to the manufacture of biological drugs. Biotechnology Progress 2006, 22, 1294-1300.
357. Gstraunthaler, G. Alternatives to the use of fetal bovine serum: Serum-free cell culture. Altex 2003, 20, 275-281.
358. Bal, W.; Sokołowska, M.; Kurowskaa, E.; Faller, P. Binding of transition metal ions to albumin: Sites, affinities and rates Biochimica et Biophysica Acta 2013, 1830, 5444–5455.
359. Schömig, V.J.; Kasdorf, B.T.; Scholz, C.; Bidmon, K.; Lieleg, O.; Berensmeier, S. An optimized purification process for porcine gastric mucin with preservation of its native functional properties. RSC Advances 2016, 6, 44932-44943.
360. Svensson, O.; Arnebrant, T. Mucin layers and multilayers - physicochemical properties and applications. Current Opinion in Colloid & Interface Science 2010, 15, 395-405.
361. Araujo, F.; Sarmento, B. Towards the characterization of an in vitro triple co-culture intestine cell model for permeability studies. International Journal of Pharmaceutics 2013, 458, 128-134.
362. Beduneau, A.; Tempesta, C.; Fimbel, S.; Pellequer, Y.; Jannin, V.; Demarne, F.; Lamprecht, A. A tunable Caco-2/HT29-MTX co-culture model mimicking variable permeabilities of the human intestine obtained by an original seeding procedure. European Journal of Pharmaceutics and Biopharmaceutics 2014, 87, 290-298.
363. Hoeger, J.; Simon, T.-P.; Doemming, S.; Thiele, C.; Marx, G.; Schuerholz, T.; Haase, H. Alterations in zinc binding capacity, free zinc levels and total serum zinc in a porcine model of sepsis. BioMetals 2015, 1-8.
364. Bloxam, D.L.; Tan, J.C.; Parkinson, C.E. Non-protein bound zinc concentration in human plasma and amniotic fluid measured by ultrafiltration. Clinica Chimica Acta 1984, 144, 81-93.
365. Magneson, G.R.; Puvathingal, J.M.; Ray, W.J., Jr. The concentrations of free Mg2+ and free Zn2+ in equine blood plasma. The Journal of Biological Chemistry 1987, 262, 11140-11148.
366. Smith, K.T.; Failla, M.L.; Cousins, R.J. Identification of albumin as the plasma carrier for zinc absorption by perfused rat intestine. Biochemical Journal 1979, 184, 627-633.
367. Wang, X.; Zhou, B. Dietary zinc absorption: A play of ZIPs and ZnTs in the gut. IUBMB life 2010, 62, 176-182.
368. Messer, H.H.; Murray, E.J.; Goebel, N.K. Removal of trace metals from culture media and sera for in vitro deficiency studies. The Journal of Nutrition 1982, 112, 652-657.
369. Finamore, A.; Massimi, M.; Conti Devirgiliis, L.; Mengheri, E. Zinc deficiency induces membrane barrier damage and increases neutrophil transmigration in Caco-2 cells. The Journal of Nutrition 2008, 138, 1664-1670.
![Page 165: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/165.jpg)
Appendix
VIII
Appendix
A. Supplemental Material of Chapter 4
Figure S4.1: Transepithelial electrical resistance (TEER) during differentiation of Caco-2 and
Caco-2-eCalwy.
Cells were grown on transwell membranes for 21d and integrity of the cell layer was monitored by measuring TEER during differentiation. Data are shown as means + SD of three independent measurements.
![Page 166: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/166.jpg)
Appendix
IX
Figure S4.2: Localization of tight junction proteins in differentiated Caco-2 cells.
Caco2-WT (upper panel) and Caco-2-eCalwy (lower panel) were analyzed by confocal laser scanning immunofluorescence microscopy. False colored images of Caco-2-WT and -eCalwy clones after immunofluorescent staining of claudin-2 (A, E), occludin (B, F), zonola occludens-1 (ZO-1) (C, G) and E-cadherin (D, H) are shown. X-y-Sections depict an overview on the stained cell-layers, whereas x-z-scans visualize the cellular distribution of tight junction proteins together with stained nuclei (blue). Scale bars correspond to 5µm. Sections are the same as the ones shown in Figure 4.4.
![Page 167: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/167.jpg)
Appendix
X
B. Supplemental Material of Chapter 5
Supplemental Methods
Real time PCR
qPCR-analysis for ALP and MUC5AC was performed as described in the main text, using the
primer listed in Suppl. Table S4.1.
Table S5.1: Oligonucleotide sequences used for qPCR
Primer NCBI Reference
Sequence
Sequence fwd 5'-3' Sequence rev 5'-3' Ref
ALP NM_001631.4 CCGCTTTAACCAGTGCAACA CCCATGAGATGGGTCACAGA [S1]
MUC5AC NM_001304359.1 CATCAACGGGACCCTGTACC ACAGGTCGACTGGTTCTGGT
β-actin NG_007992.1 CGCCCCAGGCACCAGGGC GCTGGGGTGTTGAAGGT [S2]
Histological staining of mucins
The mucin-secretion of Caco-2/HT-29-MTX co-cultures was investigated by histological
staining of anionic mucins, using alcianblue, and neutral mucins with the PAS (periodic acid-
Schiff)-staining. Therefore, a total of 120.000 cells was cultivated in 6-well plates for 21 d,
whereas several ratios of Caco-2 and HT-29-MTX were co-cultivated (Caco-2/HT-29-MTX:
100/0, 90/10, 75/25, 50/50, 0/100). The protocols for the alcianblue- and PAS-staining were
adapted after [S3]. Prior to the staining, cells were washed carefully with PBS and fixed using
3.7% formaldehyde in PBS. For the alcianblue-staining, cells were washed again with PBS,
incubated with 3% acetic acid for 3 min cells and directly treated with 1% alcianblue 8GX (in
3% acetic acid) for 30min. Subsequently, the staining reagent was carefully removed, cells
were washed with H2O and macroscopic pictures were taken. Prior to the PAS-staining, cells
were incubated with 5% periodic acid for 5 min, washed carefully with PBS and incubated
with Schiff-reagents for 15min. The Schiff reagent was generated following the method from
Graumann [S4] using 5% pararosanilin. After successful incubation, Schiff-reagent was
removed from the cells and pictures were taken instantly.
Alkaline phosphatase activity
The effect of cellular ratio on the activity of alkaline phosphatase (ALP) in co-cultures of
Caco-2 and HT-29-MTX was investigated, examining several Caco-2/HT-29-MTX ratios:
100/0, 90/10, 75/25, 50/50 and 0/100. Therefore, two days prior to the HT29-MTX cells,
Caco-2 cells were transferred to 96-well plates (a total of 5000 cells) and ALP-activity after 21
d of cultivation was analyzed as described [S1].
![Page 168: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/168.jpg)
Appendix
XI
Supplemental Figures
Figure S5.1: Histological analysis of secreted mucins by Caco-2/HT-29-MTX co-cultures.
Co-cultures of various ratios of Caco-2 and HT-29-MTX cells were cultured for 21 d and mucin secretion was investigated using alcianblue- (A) and PAS-staining (B).
100 90 75 50 00
50
100
150
200
Caco-2 [%] in co-culture
Alk
alin
e p
ho
sp
hata
se
acti
vit
y [
mU
/mg
pro
tein
]
Figure S5.2: Activity of alkaline phosphatase (ALP) in Caco-2 and HT-29-MTX co-cultures.
Shown is the ALP-activity in Caco-2/HT-29-MTX co-cultures with different cellular ratios depicted as the relative amount of Caco-2 cells. Enzyme activity was measured after 21 d of cultivation using the ALP-assay and is displayed relative to cellular protein. Data are displayed as means + SD of three independent experiments.
![Page 169: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/169.jpg)
Appendix
XII
90 75 50 00.0
0.2
0.4
0.6
0.8
Caco-2 [%] in co-culture
alp
gen
e e
xp
ressio
n
[rela
tive t
o 1
00%
Caco
-2 c
ell
s]
90 75 50 00
1000
2000
3000
4000
5000
Caco-2 [%] in co-culture
muc5ac
gen
e e
xp
ressio
n
[rela
tive t
o 1
00%
Caco
-2 c
ell
s]A B
Figure S5.3: Expression of characteristic genes for Caco-2 and HT-29-MTX in the co-cultures.
Gene expression of differentiation marker alp [S1] and muc5ac, which is one of the characteristic mucins secreted by HT-29-MTX [S5], was analyzed in Caco-2/HT-29-MTX co-cultures after 21d of cultivation using qPCR (A) Alp-expression is shown relative to Caco-2 monocultures. (B) Muc5ac-expression is depicted relative to Caco-2 monocultures. Data are shown as means + SD of three replicates.
0 25 50 1000
50
100
150
200
Added zinc [µM]
TE
ER
[%
rel. t
o t
0]
0 25 50 1000
50
100
150
200
Added zinc [µM]
TE
ER
[%
rel. t
o t
0]
0 25 50 100
1.010 -08
1.010 -06
1.010 -04
1.010 -02
1.01000
Added zinc [µM]
Pap
p [
cm
/sec]
0 25 50 100
1.010 -08
1.010 -06
1.010 -04
1.010 -02
1.01000
Added zinc [µM]
Pap
p [
cm
/sec]
Without BSA With BSA
A B
C D
Figure S5.4: Integrity of Caco-2/HT-29-MTX cell monolayers used for the transport studies
depicted in Figure 5.6 measured as TEER (A, C) and paracellular permeability (C,
D).
Shown is the TEER of cell-monolayers after the transport-experiment relative to TEER measured before incubation with zinc and 0mg mL-1 (A) or 30mg mL-1 albumin, respectively. The permeability of the cell monolayer during the transport assay without (C) or with albumin (D) is depicted as the apparent permeability (Papp) of a 20kDa FITC-Dextran. Data are shown as means + SD of three replicates.
![Page 170: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/170.jpg)
Appendix
XIII
Table S5.2: Parameters of the non-linear regression analysis applied in the zinc cytotoxicity
study in Figure 5.3.
WST MTT NRU SRB
0% FCS 10% FCS 0% FCS 10% FCS 0% FCS 10% FCS 0% FCS 10% FCS
Best-fit values
Bottom 21,97 33,95 9,525 -42,44 0.0 0.0 3,663 1,599
Top 97,04 87,61 109,7 104,1 111,6 105,1 108,6 103,3
Hill slope -2,315 -4,216 2,473 2,881 -4,163 -4,165 -5,034 -5,012
95% Confidence Interval of LC50
162.5 to 567.7
315.4 to 761.2
247.4 to 356.3
214.1 to 2694
397.7 to 486.8
648.2 to 741.6
239.1 to 306.4
451.2 to 506.9
Goodness of Fit
Degree of Freedom
17 17 17 17 18 18 17 17
R² 0.7939 0.6740 0.9664 0.9453 0.9601 0.9761 0.9719 0.9860
Absolute Sum of Squares
4,033 3,543 1,094 1,294 1,294 456.2 1,219 402.1
Standard deviation of residuals
15.40 14.44 8.023 8.723 8.479 5.034 8.467 4.863
Shown are parameters of the applied non-linear regression using a sigmoidal dose-response curve with variable slope as a function of the logarithm of zinc concentration. Data were obtained in three independent experiments and analyzed with GraphPad Prism software version 5.01 (GraphPad Software Inc., CA, USA).
![Page 171: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/171.jpg)
Appendix
XIV
References
[S1] M. Maares, C. Keil, S. Thomsen, D. Günzel, B. Wiesner, H. Haase, Characterization of
Caco-2 cells stably expressing the protein-based zinc probe eCalwy-5 as a model
system for investigating intestinal zinc transport, Journal of Trace Elements in
Medicine and Biology (2018).
[S2] K. Wolf, C. Schulz, G.A.J. Riegger, M. Pfeifer, Tumour necrosis factor‐α induced CD70
and interleukin‐7R mRNA expression in BEAS‐2B cells, European Respiratory Journal
20(2) (2002) 369-375.
[S3] H. Denk, H. Künzele, H. Plenk, J. Rüschoff, W. Seller, Romeis Mikroskopische Technik.
17., neubearbeitete Auflage, Urban und Schwarzenberg, München-Wien. Baltimore,
1989, pp. 439-50.
[S4] W. Graumann, Zur Standardisierung des Schiffschen Reagens, S HIRZEL VERLAG
Stuttgart, 1953, pp. 225-226.
[S5] G. Nollevaux, C. Deville, B. El Moualij, W. Zorzi, P. Deloyer, Y.J. Schneider, O. Peulen,
G. Dandrifosse, Development of a serum-free co-culture of human intestinal
epithelium cell-lines (Caco-2/HT29-5M21), BMC Cell Biology 7 (2006) 20.
![Page 172: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/172.jpg)
Appendix
XV
C. Supplemental Material of Chapter 6
400 500 6000.0
0.1
0.2
0.3
0.4
0.5 0 µM
2 µM
4 µM
6 µM
8 µM
10 µM
12 µM
14 µM
16 µM
18 µM
20 µM
24 µM
28 µM
32 µM
36 µM
40 µM
Zn2+
[nm]
Ab
so
rpti
on
(
=4
85
nm
)
0 5 10 15 20 250.0
0.1
0.2
0.3
0.4
0.5
Added zinc [µM]
Ab
so
rpti
on
(
=485 n
m)
A) Absorptionspectra PAR-zinc complex
B) Spectrophotometric titration of PAR with zinc
Figure S6.1: Spectrophotometric titration with 4-(2-pyridylazo)resorcinol (PAR) and zinc.
Shown are absorption spectra (A) and spectrophotometric titrations (B) of 20 µM PAR with different zinc concentrations in Tris(hydroxylmethyl)aminomethan buffered saline (TBS), pH 7.4. Data are presented as means ± SD of three independent experiments.
![Page 173: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/173.jpg)
Appendix
XVI
103 104 105 106
100
1000
100006 h
12 h
24 h
Added zinc [µM]
Reta
ined
zin
c [
µM
]
Figure S6.2: Zinc binding capacity of mucins using dialysis for different time intervals.
The zinc binding capacity was investigated after dialysis against TBS after different time intervals. Therefore, 25 mg mL-1 porcine mucin was incubated overnight with different zinc concentrations and dialysis was performed for 6 h, 12 h and 24 h. The amount of zinc retained by binding to mucins was measured using flame atomic absorption spectrometry (FAAS). Data are presented as means ± SD of three independent experiments.
![Page 174: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/174.jpg)
Appendix
XVII
400 500 600 700 8000.0
0.1
0.2
0.3
0.4
0.5 0 µM
10 µM
20 µM
30 µM
40 µM
50 µM
60 µM
70 µM
80 µM
90 µM
100 µM
Zn2+
[nm]
Ab
so
rpti
on
(
=6
20
nm
)
400 500 600 700 8000.0
0.1
0.2
0.3
0.4
0.50 µM
5 µM
10 µM
12.5 µM
15 µM
17.5 µM
20 µM
22.5 µM
25 µM
27.5 µM
30 µM
32 µM
34 µM
35 µM
40 µM
45 µM
50 µM
55 µM
60 µM
Zn2+
[nm]
Ab
so
rpti
on
(
=6
20
nm
)
A) Absorptionspectra of Zincon-zinc-complex
B) Absorptionspectra of Zincon-zinc-complex in the presence of mucins
0 20 40 60 80 1000.0
0.1
0.2
0.3
0.4
Added zinc [µM]
Ab
so
rpti
on
(
=620 n
m)
C) Spectrophotometric titration of Zincon with zinc
Figure S6.3: Spectrophotometric titration with 2-carboxy-2′-hydroxy-5′-sulfoformazylbenzene
monosodium salt (zincon) and zinc.
Shown are the absorption spectra (A, B) and spectrophotometric titrations (C) of 50 µM zincon with different zinc concentrations in TBS, pH 7.4. Moreover, the absorption spectrum was conducted in the presence of 0 mg mL-1 (A) and 1 mg mL-1 porcine mucins (B). Data are presented as means ± SD of three independent experiments.
![Page 175: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/175.jpg)
Appendix
XVIII
0 25 50 1000
50
100
150
200
Added zinc [µM]
TE
ER
[%
rel. t
o t
0]
0 25 50 1000
50
100
150
200
Added zinc [µM]
TE
ER
[%
rel. t
o t
0]
0 25 50 1001.010 -09
1.010 -07
1.010 -05
1.010 -03
1.010 -01
Added zinc [µM]
Pap
p [
cm
/sec]
0 25 50 1001.010 -09
1.010 -07
1.010 -05
1.010 -03
1.010 -01
Added zinc [µM]
Pap
p [
cm
/sec]
Caco-2 monoculture Caco-2/HT-29-MTX co-culture
A B
C D
Figure S6.4: Integrity of Caco-2 and Caco-2/HT-29-MTX cell monolayers used for the transport
studies measured as transepithelial electrical resistance (TEER) and paracellular
permeability.
Shown is the TEER of Caco-2 (A) or Caco-2/HT-29-MTX monolayers (B) after the transport experiment relative to TEER measured prior to incubation with zinc. The permeability of the cell monolayer during the transport assay using the monoculture (C) or the co-culture (D) is depicted as the apparent permeability (Papp) of a 20 kDa fluorescein isothiocyanate (FITC)-Dextran. Data are presented as means + SD of three independent experiments.
![Page 176: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/176.jpg)
Appendix
XIX
Table S6.1: Exact amounts of zinc [ng cm-2] transported by Caco-2/HT-29-MTX co-cultures and
Caco-2 monocultures.
Caco-2 monocultures Caco-2/HT-29-MTX co-cultures
Added zinc [µM]
0 25 50 100 0 25 50 100
Apical zinc uptake
[ng/cm²]
- 93.8±45.4 168.8±52.7 198.4±88.5 - 89.2±18.5 193.4±16.5 332.2±137.4
Cellular zinc [ng/cm²]
59.6±14.5 76.8±21.2 86.9±23.6 95.6±25.9 37.6±2.6 67.7±13.5 101.4±31.8 130.8±38.1
Resorbed zinc [ng/cm²]
29.9±14.5 48.8±6.5 70.8±8.9 93.3±12.5 47.0±7.5 83.7±6.4 105.1±24.7 149.6±35.1
Shown are the amounts of zinc which are absorbed into the cells (zinc uptake), the cellular zinc content and which are resorbed into the basolateral compartment in ng zinc per resorption area (in cm²). Data are presented as means ± SD of three independent experiments.
![Page 177: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/177.jpg)
Appendix
XX
D. Experimental conditions for Instrumental Zinc Quantification
Table S1: Experimental conditions for ICP-MS (Agilent 8800 ICP-QQQ)
Forward power 1550 W
Cool gas flow 15 L min-1
Auxiliary gas flow 0.9 L min-1
Nebulizer gas flow Argon, 1 L min-1
Nebulizer type MicroMist
Mode Single Quad
Collision gas flow Helium, 3 mL min-1
Quadrupole (m/z) 66 (Zn)
Limit of quantitation 0.2 µg L-1
Calibration range 1-100 µg L-1
Table S2: Experimental conditions for FAAS (Perkin Elmer AAnalyst800)
Gas flow Acetylen, 2.0 L min
-1
Oxygen 17 L min-1
Lamp Hollow Cathode Lamp
Wavelength [nm] 213.19 nm
Slit [nm] 0.7 nm
Lamp Current 18 mA
Limit of quantitation 0.02 mg L-1
Calibration range 0.05-1 mg L-1
![Page 178: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/178.jpg)
Appendix
XXI
E. Supplemental Results of Zinc Resorption Studies with in vitro Intestinal
Models
In addition to findings of the zinc transport studies using three-dimensional in vitro intestinal
models in Chapter 5 and 6, Figure S1, Table S3 and Table S4 include supplemental results of
zinc transport studies. For a better understanding of the impact of mucins and basolateral
albumin on zinc resorption, zinc transport of Caco-2 monocultures and Caco-2/HT-29-MTX
co-cultures in presence and absence of basolateral albumin after 8 h is shown in Figure S1.
For this, data of Caco-2/HT-29-MTX was extracted from Chapter 5. To give an overview on
zinc transport using mono- or co-cultures with and without basolateral albumin, Table S3
additionally summarizes detailed quantitative data of zinc uptake into the cells, cellular zinc
content, and the amount of transported zinc to the basolateral side in Caco-2 monocultures
and Caco-2/HT-29-MTX co-cultures after incubation with zinc for 4 h and 8 h. Moreover,
fractional zinc resorption as well as zinc transport rates of mono- and co-cultures are
summarized in Table S4.
![Page 179: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/179.jpg)
Appendix
XXII
25 50 1000
100
200
300
400
co-culture
monoculture
****
***
***
***
**
*
Added zinc [µM]
Cellu
lar
zin
c u
pta
ke
[ng
/mg
pro
tein
]
25 50 1000
100
200
300
400
co-culture
monoculture
**
**
Added zinc [µM]
Cellu
lar
zin
c u
pta
ke
[ng
/mg
pro
tein
]
0 25 50 1000
2
4
6
8
****
**
Added zinc [µM]
Zin
c t
ran
sp
ort
rate
[n
mo
l/cm
²]
0 25 50 1000
2
4
6
*
*
*****
***
Added zinc [µM]
Zin
c t
ran
sp
ort
rate
[n
mo
l/cm
²]
25 50 1000
2
4
6
8
* **
Added zinc [µM]
Fra
cti
on
al zin
c r
eso
rpti
on
[%
]
rel. t
o in
cu
bate
d z
inc
25 50 1000
2
4
6
8 *
*****
****
*****
Added zinc [µM]
Fra
cti
on
al zin
c r
eso
rpti
on
[%
]
rel. t
o in
cu
bate
d z
inc
Without BSA With BSA
A
C
E
B
D
F
Figure S1: Zinc resorption of Caco-2 mono- and Caco-2/HT-29-MTX co-cultures in the
presence or absence of albumin (after incubation for 8 h).
Shown are the cellular zinc uptake (A and B) of Caco-2 monocultures and Caco-2/HT-29-MTX co-
cultures relative to cellular protein content after subtracting basal cellular zinc content without (A)
and with 30 mg mL-1 albumin (B) in the basolateral compartment. The zinc transport rates in nmol
zinc per cm2 resorption area of mono- and co-cultures (E and F) are shown. Moreover, fractional zinc
resorption relative to the added zinc concentration of the transport-assay in the absence (E) and
presence of albumin (F) are displayed. Data are presented as means + SD of three independent
experiments. Significant differences to control cells (0 µM zinc) are indicated (*p < 0.05; **p < 0.01;
***p < 0.001; one-way ANOVA with Dunnett’s multiple comparison test). Moreover, significant
differences between Caco-2 monocultures and co-cultures within one zinc and albumin
concentration are indicated (*p < 0.05; **p < 0.01; two-way ANOVA with a Bonferroni post hoc test).
According to a two-way ANOVA with a Bonferroni post hoc test comparing the results within one
added zinc concentration and incubation time, there are significant differences between the zinc
transport rate (100 µM: p < 0.01) of Caco-2 monocultures and the fractional resorption of Caco-2 co-
cultures after zinc treatment for 8 h (25 µM: p < 0.001; 50 µM: p<0.05) with or without albumin in
the basolateral compartment.
![Page 180: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/180.jpg)
Appendix
XXIII
Table S3: Exact amounts of zinc [ng cm-2] transported by Caco-2 monocultures and Caco-
2/HT-29-MTX co-cultures
Caco-2 monoculture
Without BSA With BSA
Added zinc [µM]
0 25 50 100 0 25 50 100
Incubation for 4 h
Data used in Chapter 6
Apical zinc uptake
[ng/cm²] - 73.4±6.6 50.6±152.8 335.9±379.4 - 93.8±45.4 168.8±52.7 198.4±88.5
Cellular zinc
[ng/cm²] 39.4±24.5 51.1±17.1 73.8±24.8 82.9±20.5 59.6±14.5 76.8±21.2 86.9±23.6 95.6±25.9
Resorbed zinc
[ng/cm²] 14.3±20.7 32.2±22.4 59.7±43.1 86.5±29.4 29.9±14.5 48.8±6.5 70.8±8.9 93.3±12.5
Incubation for 8 h
Apical zinc uptake
[ng/cm²] - 134±38.7 106.4±95.3 387.4±532.5 - 98.9±124.6 160.2±133.0 296.1±182.4
Cellular zinc
[ng/cm²] 43.9±19.4 52.9±16.6 64.5±16.7 86.2±17.1 43.6±5.4 45.1±2.1 63.0±18.7 91.6±1.8
Resorbed zinc
[ng/cm²] 35.3±20.0 44.9±16.0 75.4±7.4 100.5±29.1 33.3±14.2 74.2±19.0 128.0±12.7 180.6±2.2
Caco-2/HT-29-MTX co-culture
Incubation for 4 h
Data used in Chapter 6
Apical zinc uptake
[ng/cm²] - 14.1±27.9 150.7±9.6 220.4±52.0 - 89.2±18.5 193.4±16.5 332.2±137.4
Cellular zinc
[ng/cm²] 38.1±11.5 59.7±7.7 87.8±9.8 108.3±6.9 37.6±2.6 67.7±13.5 101.4±31.8 130.8±38.1
Resorbed zinc
[ng/cm²] 10.3±10.9 17.5±10.0 30.7±16.5 71.8±4.8 47.0±7.5 83.7±6.4 105.1±24.7 149.6±35.1
Incubation for 8 h
Data used in Chapter 5 Data used in Chapter 5
Apical zinc uptake
[ng/cm²] - 43.7±14.0 205.6±47.9 383.9±34.6 - 116.7±27.2 270.8±35.9 471.6±112.4
Cellular zinc
[ng/cm²] 35.8±5.8 65.9±6.6 84.5±11.9 121.5±25.1 36.3±0.3 48.6±7.2 60.4±20.3 117.9±33.4
Resorbed zinc
[ng/cm²] 10.9±7.6 36.1±10.6 84.2±9.5 146.1±35.9 72.0±1.8 113.7±14.3 175.1±50.1 231.6±67.2
Shown are the amounts of zinc that are absorbed into the cells (zinc uptake), the cellular zinc content and the amount resorbed into the basolateral compartment in ng zinc per resorption area (in cm²). Data are presented as means ± SD of three independent experiments. Additionally, it is indicated, which data were already shown in Chapter 5 and Chapter 6 of this thesis.
![Page 181: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/181.jpg)
Appendix
XXIV
Table S.4 Fractional zinc resorption [%] and zinc transport rate [nmol cm-2] of Caco-2
monocultures and Caco-2/HT-29-MTX co-cultures with and without basolateral albumin
In vitro model, Incubation time
Without BSA With BSA
Fractional resorption [%] (25 -100 µM apical added zinc)
Caco-2, 4 h 1.6 ± 0.96 – 1.05 ± 0.46 1.8 ± 0.67 – 1.07 ± 0.16
Caco-2, 8 h 2.48 ± 1.12 – 1.35 ± 0.59 3.2 ± 1.2 – 2.2 ± 0.04
Caco-2/HT-29-MTX, 4 h 0.88 ± 0.6 – 0.92 ± 0.2 4.2 ± 0.44 – 1.9 ± 0.5
Caco-2/HT-29-MTX, 8 h 1.8 ± 0.7 – 1.9 ± 0.7 5.8 ± 0.97 – 2.98 ± 1.1
Zinc transport rate [nmol cm-2 ] (0 - 100 µM apical added zinc)
Caco-2, 4 h 0.29 ± 0.3 – 1.2 ± 0.43 0.3 ± 0.3 – 1.29 ± 0.2
Caco-2, 8 h 0.6 ± 0.4 – 1.59 ± 0.58 0.37 ± 0.37 – 2.62 ± 0.19
Caco-2/HT-29-MTX, 4 h 0.15 ± 0.2 – 1.09 ± 0.09 1.13 ± 0.14 – 2.28 ± 0.65
Caco-2/HT-29-MTX, 8 h 0.16 ± 0.14 – 2.2 ± 0.6 1.1 ± 0.03 – 3.54 ± 1.25
Shown is the fractional zinc resorption [%] relative to apical added zinc concentration and zinc
transport rate [nmol cm-2] of Caco-2 monocultures and Caco-2/HT-29-MTX co-cultures of this thesis. Data are presented as means ± SD of three independent experiments.
![Page 182: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/182.jpg)
Appendix
XXV
F. Application of in vitro Caco-2 Monocultures
Table S.5 Application of in vitro Caco-2 monocultures to study zinc-dependent gene expression in enterocytes
Cell model Incubation parameter Analysis Main Outcome Reference
Caco-2 Differentiation time: 14 d 2D
Recombinant expression of myc-tagged hZnT-5B in Caco-2 cells
Addition of ZnCl2 to growth medium: Stepwise increase from 20, 50 and 100 µM each for 7d
Recombinant transfection
Gene expression: RT-PCR
Immunochemical staining
- highest expression of ZTL1 in mouse kidney, brain, duodenum and jejunum
- apical localization of hZTL1 at apical membrane of Caco-2
- hZTL1 (later named ZnT-5B) and MT expression increased in Caco-2-WT cells after prolonged zinc treatment
Cragg et al. 2002 [137]
Caco-2 Cultivation time: 14 d 2D
Human study: 25 mg ZnSO4 /d (placebo Na SO4); duration: 14 d Caco-2: 100 µM or 200 µM ZnCl2
(in DMEM + 10% FCS) for 3 d
Gene expression: RT-PCR
Protein quantification: Immunocytochemistry
- mRNA expression and protein of ZnT-1, ZnT-5, ZnT-5, ZIP-4 in enterocytes (biopsies of ileal mucosa) ↓
- znt-1 ↓ - MT mRNA increased ↑ - mRNA and protein expression in Caco-2 cells was in
agreement of human study - localization of ZnT-5 at apical membrane of human
enterocytes and Caco-2 cells
Cragg et al. 2005 [132]
Caco-2 Cultivation time: 24 h 2D
0-100 µM Zn (in serum-free DMEM) Transient transfection of Caco-2 cells with pEGFP-ZnT5B
- ZnT-5 variant b is a bidirectional zinc transporter and can operate in an efflux mode, increasing cytoplasmic zinc concentration of Caco-2 cells
- upregulation of MT-2 indicates increase of intracellular zinc content in transfected Caco-2 cells
Valentine et al. 2007 [134]
Caco-2 Cultivation time: 24 h, pre-confluent 2D
0-300 µM ZnSO4 or 0-10 µM TPEN (in n.a.) for 6 or 12 h
Gene expression: qPCR
- zinc-dependent mRNA expression of mt-1, dmt-1, zip-4 and znt-1 regulates zinc homeostasis in Caco-2 cells
- zip4 ↑ after zinc depletion with TPEN - mt1 ↑ and znt-1 with added zinc concentration
Shen et al. 2008 [306]
Caco-2 Differentiation time: 11-13 d 2D
Iron/zinc interaction 0-200 µM ZnCl2 or FeCl3, respectively, (in DMEM) for 2h
Zinc Uptake: 65
Zn
- iron uptake was inhibited dose-dependently by zinc - iron increased cellular zinc uptake - analysis suggests that iron and zinc transport by
DMT-1 is not occurring simultaneously
Iyengar et al. 2009 [309]
![Page 183: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/183.jpg)
Appendix
XXVI
Caco-2 Cultivation time: 14 d 2D
3-100 µM ZnCl2 (in DMEM+ 10%FCS)
for 12 or 24 h
Transcriptomic study: Micro-array
Gene expression: qPCR
- zinc-regulated genes were analyzed with an micro-array
- identification of several genes which are regulated zinc-dependent (such as mt-1h, mt-2a, mt-3, mtf-1)
Jackson et al. 2009 [303]
Caco-2 Cultivation time: 21d 3D Transwell (comparison undifferentiated and differentiated cells)
100-800 µM ZnCl2 (in DMEM + 5% FCS)
apical or basolateral incubation) for 24 h
Gene expression: qPCR
- influence of polarization and differentiation of Caco-2 cells on zinc tolerance
- mRNA expression of znt-1 ↑, znt-5, zip1, zip4, mt-1a ↑, mt-1x ↑, mt-2a ↑ after exposure with higher zinc concentrations (100-800 µM; apical or basolateral, respectively)
- under physiologic zinc concentrations (apical: 100 µM; basolateral: 15 µM zinc) only mt-1a ↑
Zemann et al. 2010 [302]
Caco-2 (1) FHs 74 Int cells (2) Cultivation time (1): Undifferentiated (U) (4 d) Differentiated (D) (12 d) 2D
50 µM ZnSO4 (in serum free medium) for 15 min
Zinc Uptake: 65
Zn
Gene expression: qPCR
Western Blot
Biotinylation of surface proteins
- role of zinc exposure on intestinal cells of varying maturity;
- zinc uptake in fetal intestinal cells and undifferentiated cells was higher than in differentiated cells
- ZnT-1 protein and znt-1, znt-2 as well as mt-1 ↑, while zip-4 ↑ in U and ↓ in D Caco-2 cells
- localization of ZIP-4 and ZnT-1 at the plasma membrane of differentiated Caco-2 cells was significantly changed by zinc exposure
Jou et al. 2010 [308]
Caco-2 confluent cells 2D; 3D
0-100 µM ZnSO4 (DMEM +10% FCS)
for 7 d
Zinc Uptake: FAAS
Western blot
- cellular zinc content increased concentration-
dependent (100 µM: 0.4 µg mg-1
protein)
- expression of TJ protein claudin-2 and tricellulin decreased with added zinc concentration
- TEER increased with added zinc concentration
Wang et al. 2012 [307]
Caco-2 (1) IPEC-J2 (2) Cultivation time (1): Pre-confluent (2-3 d) Post-confluent (19-21 d) 2D
0-200 µM ZnSO4 (in DMEM +10% FCS) for 6 h and 24 h
Zinc uptake: FAAS
Gene expression: qPCR
- cellular zinc uptake increases significantly after incubating with 200 µM zinc for 24 h
- zinc incubation of post-confluent Caco-2 cells did not change zip-4 and only showed a trend in mt1a and znt-1 upregulation
- enterocytes’ zinc homeostasis is maintained by expression of these genes
Gefeller et al. 2015 [304]
![Page 184: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/184.jpg)
Appendix
XXVII
Caco-2 (1) IPEC-J2 (2) Cultivation time (1): 21 d 3D Transwell
0-200 µM ZnSO4 (apical or basolateral side, in DMEM + 10% FCS) for 24 h
Gene expression: qPCR
- znt-1 and mt expression ↑ with higher added zinc concentrations basolaterally
- zip-4 expression did not change
Lodemann et al. 2015 [305]
Caco-2 Cultivation time: 24 h
3 or 150 µM zinc (in serum free DMEM) for 24 h
MTF-1 depletion by transient transfection with siRNA
MT-2a stable transfection
Transiently transfection with ZnT-5 promotor
Gene expression: Microarray qPCR
- zinc-dependent expression of MTF-1 dependent genes in MTF-1 depleted Caco-2 compared to CTR: znt-1 ↓ and mt-1b ↓, mt-1e ↓, mt-1g ↓, mt-1h ↓, mt-1m ↓, mt-2a ↓, mt-1a , mt-2a and mt-x did not change
- in MTF-1 depleted cells, zinc incubation changed mRNA expression of genes that are normally not affected by increased cellular zinc, indicating that MT and ZnT-1 are buffering their expression
- MT-2a overexpressed Caco-2 cells showed higher ZnT-5 promoter activity upon zinc uptake
- MTF-1 is controlling intracellular zinc homeostasis by regulating MT and ZnT-1
Hardyman et al. 2016 [310]
3D, three-dimensional; DMEM, Dulbecco’s Modified Eagles Medium; (F)AAS, (flame) atomic absorption spectrometry; FCS, fetal calf serum; HBSS, Hank's Balanced Salt Solution; ICP-MS, inductively-coupled plasma mass spectrometry; n.a., not available; PC, polycarbonate; TEER, transepithelial electrical resistance; TJ, tight junction; Zn, zinc
![Page 185: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/185.jpg)
Appendix
XXVIII
Table S.6 Application of in vitro Caco-2 monocultures to investigate the effect of dietary factors on zinc bioavailability
Cell model Zinc added Food component or Ligand Zinc Quantification Main Outcome Reference
Caco-2 Differentiation time: 10-12 d 2D and 3D Transwell
ZnSO4
FeCl3
(apical: HEPES buffer, basolateral: DMEM + 15% FCS) for 1 h (uptake), 1-5 h (transport)
- Inositolphosphates (IP) (phytic acid): IP3, IP4, IP5, IP6
65Zn,
55Fe
- inhibition of iron and zinc transport by phytate in Caco-2
- reduction of zinc uptake and transport rate correlated with level phosphorylation (IP3 to IP6)
- cellular uptake was analyzed in 2D, transport with 3D transwell
Han et al. 1994 [298]
Caco-2 Differentiation time: 15-18 d 2D
40.22 µM ZnCl2, 88.24 µM FeCl3 or 823.53 µM CaCl2 respectively (in uptake buffer)
- infant formulas: adapted (milk based) and soy-based
- in vitro digestion model AAS
- lower zinc uptake von soy-based than from milk-based infant formulas
- cellular zinc uptake solely observed from digested infant formulas and not from liquid metal solutions
Jovani et al. 2001 [279]
Caco-2 Differentiation time: 19 – 21 d 3D Transwell (PE membrane)
sample c
(apical: soluble mineral fraction, basolateral: HBSS buffer) for 2 h
- raw legumes: white beans, chickpeas, lentils
- effect on cooking of lentils - in vitro digestion model
AAS
- chickpeas yielded the highest amount of transported zinc
- cooking process negatively affected the mineral content of lentils and the soluble zinc fraction decreased
Viadel et al. 2006 [295]
Caco-2 Differentiation time: 21 d 3D Transwell (PES membrane)
sample c
(apical: soluble mineral fraction; basolateral: HBSS buffer) for 2 h
- school meals - in vitro digestion model
FAAS
- iron, copper, zinc and calcium uptake and transport was analyzed
- protein content of meals had no influence on zinc uptake
- negative mineral interaction of iron and zinc: soluble iron decreased and transported zinc; soluble zinc and iron retention
Camara et al. 2007 [291]
![Page 186: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/186.jpg)
Appendix
XXIX
Caco-2 Differentiation time: 14-12 d 2D
25 µM 65
ZnCl2 (in MEM) for 3 h
- phytic acid, tannic acid, tartaric acid, polyphenols (from tea extract and grape juice), wheat, arginine, methionine, histidine
- molar ratio: zinc/dietary ligands (1:1; 1:5; 1:10)
- in vitro digestion model (use of dialysis membrane for incubation of cells with digested samples)
65Zn
- zinc depletion with TPEN increased zinc uptake, but zinc repletion did not affect uptake
- zinc uptake in Caco-2 cells shows a saturable and non-saturable component depending on added zinc concentration
- tannic acid (1:50) enhanced zinc uptake from wheat- and rice-food-matrix
- histidine, phytate, tartaric acid (1:1) and methionine (1:10) resulted in decreased zinc uptake relative to control cells
Sreeniva- sulu et al. 2008 [288]
Caco-2 Differentiation time: 14-21 d 3D Transwell (PE membrane)
sample c
(in salt buffer) for 2 h
- influence of caseinophosphopeptides (CPPs) and milk on zinc uptake from fruit beverages
- in vitro digestion model
AAS - zinc retention, transport and uptake was
higher for milk-containing fruit beverages than for CPPs-based fruit beverages
García-Nebot et al. 2009 [290]
Caco-2 Differentiation time: 21 d 3D Transwell (PC membrane)
sample c
(apical: HEPES,MES, glucose, basolateral: HBSS) for 3 h
- cereals and dephytinized cereals (phytase)
- in vitro digestion model FAAS
- effect of dephytinization on zinc, iron and calcium bioavailability in Caco-2 cells
- zinc and iron solubility and fractional zinc and iron resorption increased after dephytinization of cereals
Frontela et al. 2009 [299]
Caco-2 Differentiation time: 11-13 d 2D
50 µM 65
ZnCl2 Iron-zinc interactions: Zn:Fe (1:1) (in DMEM) for 2 h
- ascorbic acid (1 mM) and phytic acid, tannic acid, tartaric acid, cysteine, histidine, methionine (each 500 µM)
65Zn
- ascorbic acid, tartaric acid and tannic acid increased zinc uptake
- phytic acid and histidine decreased cellular zinc uptake
- increase of iron uptake in presence of methionine, increased also zinc uptake
- without added ligands, zinc inhibited iron uptake into Caco-2
- ligands can modulate iron : zinc-interaction
Iyengar et al. 2010 [292]
![Page 187: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/187.jpg)
Appendix
XXX
Caco-2 Differentiation time: 12-14 d 2D
25 µM 65
ZnCl2 (in MEM) for 3 h
- polyphenol-rich beverages: red wine, green tea, red grape juice
- tannic acid, quercetin, gallic acid, caffeic acid (each 250µM)
- in vitro digestion model (including a rice matrix)
65Zn
- polyphenol-rich beverages increased cellular zinc uptake from digested rice matrix
- tannic acid and quercetin enhanced zinc uptake
Sreeniva- sulu et al. 2010 [287]
Caco-2 Differentiation time: 21-28 d 3D Transwell (PET-HD membrane)
50 µM zinc (in HEPES buffer) for 1 h
- water soluble vitamins: folic acid, nicotinic acid, ascorbic acid, riboflavin, thiamine, pyridoxine
- effect of oxidative species on vitamin-dependent zinc uptake was analyzed
- phytic acid and histidine
FAAS
- zinc transport was slightly enhanced by nicotinic acid and slightly decreased by thiamine, riboflavin, and pyridoxine
- phytic acid significantly decreased zinc uptake compared to control cells, where histidine resulted in a slight increase of zinc uptake
Tupe et al. 2010 [293]
Caco-2 Differentiation time: 21 d 3D Transwell (PC membrane)
sample c
(in apical and basolateral HBSS) for 1 h
- samples from each stage of processing: wheat flour, whole wheat flour; fermented and final product: white bread, whole wheat bread, muffin
- in vitro digestion model
FAAS
- effect of ‘processing’ of baking products on bioavailability of calcium, iron and zinc in Caco-2 cells
- no differences in zinc uptake from fermented dough and after baking
Frontela et al. 2011 [300]
Caco-2 Differentiation time: 21 d 2D
0 - 25 µM ZnCl2
(in minimum essential medium) for 24 h
- varying Zn: PA ratios - in vitro digestion model (red beans,
fish samples)
ICP-MS
MT quantification a
- MT formation was investigated as a proxy for zinc uptake
- PA significantly decreased zinc uptake and MT formation for Zn:PA ratios < 1:5
Cheng et al. 2011 [289]
Caco-2 Differentiation time: 17 d 3D Transwell (collagen coated)
10 µM 65
ZnCl2
(apical: HBSS buffer, basolateral: DMEM) for 1-3 h
- bioactive dietary polyphenols: epigallocatechin-3-gallate (EGCG), green tea extract (GT), and grape seed extract (GSE) (each 46 mg/L)
- phytate (100 µM)
65Zn
- GSE decreased zinc resorption by inhibiting cellular zinc uptake, similar to phytate
- EGCG and GT did not reduce zinc resorption
Kim et al. 2011 [294]
![Page 188: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/188.jpg)
Appendix
XXXI
Caco-2 Differentiation time:14 d 2D
sample c
(in medium) for 6 h
- different rice varieties and zinc biofortified rice (polished or parboiled samples)
- in vitro digestion model
65Zn
- comparison of zinc uptake from biofortified rice with in vivo rat pups
- biofortified rice yielded significant higher net absorption in vitro and in vivo
- net absorption was smaller in Caco-2 but showed the same correlation between different rice samples
Jou et al. 2012 [301]
Caco-2 Differentiation time: 13 d 2D
sample c
for 2 h followed by additional incubation for 10 h
- biofortified wheat (low-phytate mutants with varying zinc content)
- in vitro digestion model
reporter gene
assay b
- positive and negative correlations for zinc bioavailability dependent on zinc : phytate-ratios
Salunke et al. 2012 [296]
Caco-2 Differentiation time: 2D
sample c
(in MEM + 3% FCS) for 6 h
- reduction of phytate content in sorghum(genetic modification)
- in vitro digestion model
65Zn,
59Fe
- comparison of fractional resorption in Caco-2 and in vivo suckling rat pup model
- phytate reduction significantly increased zinc bioavailability in Caco-2 cells comparable to in vivo analysis
Kruger et al. 2013 [297]
Caco-2 Transwell (PE) Differentiation time: 21 d 3D Transwell (PE membrane)
250 µM ZnSO4
(in DPBS) for 2 h
GPAGPHGPPG peptide (derived from Alaska pollock)
AAS
- influence of GPAGPHGPPG peptide on zinc, iron and calcium transport
- GPAGPHGPPG peptide significantly increased mineral transport.
Chen et al. 2017 [286]
Caco-2 Differentiation time: 10 d 2D
50 µM ZnCl2
(in PBS) for 30 min
- amino acids (AAs): glutamate (Glu), lysine (Lys), methionine (Met)
- ZnAAs complexes: ZnGlu, ZnMet, ZnLys
Fluorescent zinc sensor Zinpyr-1
- ZnAAs are probably absorbed by AAs transporters
- zinc uptake into Caco-2 cells is not enhanced by ZnAAs complexes
- results suggest that ZnAAs represent a more efficient war for zinc supplementation that zinc salts; especially for AE patients
Sauer et al. 2017 [157]
3D, three-dimensional; BSA, bovine serum albumin; DMEM, Dulbecco’s Modified Eagles Medium; FAAS, flame atomic absorption spectrometry; FCS, fetal calf serum; HBSS, Hank's Balanced Salt
Solution; HD, high density; HEPES, 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid; ICP-MS, inductively-coupled plasma mass spectrometry; IP, inositolphosphate; MEM, minimum essential
medium; n.a., not available; PC, polycarbonate; PE, polyethylene; PES, polyester; Zn, zinc; a
MT formation was analyzed using a cadmium/hemoglobin assay; b reporter gene assay based on the
metal response element (MRE)-binding transcription factor-1 (MTF-1) and MRE luciferase, c mineral bioavailability from the sample solely was examined; no extra zinc added.
![Page 189: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/189.jpg)
Appendix
XXXII
G. Author contributions
This thesis is based on three peer-reviewed publications. As stated before, I designed the
concept of the studies with support of my supervisors Prof. Dr. Dr. Hajo Haase and Dr.
Claudia Keil. I performed most of the experiments, conducted the analysis and wrote the
manuscripts. In the following detailed contributions of the other co-authors from the
respective studies are listed in detail.
Chapter 4:
The transfection of Caco-2 cells as well as preparation and verification of purchased peCalwy
plasmids was planned and executed by me. The following selection process was supervised
by me and executed by Susanne Thomsen, our technician who picked the cell clones during
this process. I designed and performed the following examination of proper cellular
differentiation as well as changes in zinc homeostasis compared to Caco-2-WT cells.
Together with Dr. Claudia Keil, I planned the morphological characterization of cell clones,
which was analyzed with TEM and REM, executed at the Electron Microscopy Core Facility,
Charité Universitätsmedizin Berlin. Immunochemical analyses of tight junction proteins were
done in corporation with Prof. Dr. Dorothee Günzel from the Institute of Clinical Physiology,
Charité Universitätsmedizin Berlin. For this, I prepared and analyzed the cell samples at the
Institute of Clinical Physiology according to the protocol of Prof. Dr. Dorothee Günzel. FRET-
measurements, using laser scanning microscopy, were conducted in close cooperation with
Dr. Burkhard Wiesner from the core facility for cellular imaging at the Leibniz
Forschungsinstitut für molekulare Pharmakologie (FmP) in Berlin. Together with Dr.
Burkhard Wiesner, I designed and coordinated the FRET and FLIM analysis. I conducted
FRET-measurements with LSM and multiphoton LSM myself and undertook the subsequent
data analysis together with Prof. Dr. Dr. Hajo Haase. The published manuscript was written
by me and reviewed by Prof. Dr. Dr. Hajo Haase, Prof. Dr. Dorothee Günzel and Dr. Burkhard
Wiesner.
Chapter 5:
Ayşe Duman executed the impact of FCS on long-term zinc uptake in Caco-2 cells as well as
on expression of important proteins of zinc homeostasis as part of her diploma thesis, which
was designed and supervised by me. All other analysis were planned and performed by me.
ICP-MS measurements were conducted by me in close cooperation with Prof. Dr. Tanja
Schwerdtle from the University of Potsdam. The published manuscript was written by me
and reviewed by Prof. Dr. Dr. Hajo Haase, Prof. Dr. Tanja Schwerdtle and Dr. Claudia Keil.
Chapter 6:
Sophia Straubing performed the visualization of extracellular mucins of HT-29-MTX cells with
FITC-dextran and immunochemical detection of these mucins as part of her diploma thesis.
This diploma thesis was planned and supervised by Dr. Claudia Keil and me. Jenny Koza
analyzed the binding capacity of mucins as well as the influence of zinc saturation of mucins
![Page 190: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/190.jpg)
Appendix
XXXIII
on short-time zinc uptake into Caco-2 cells as part of her diploma thesis, which was designed
and supervised by me. All the other analysis were planned and performed by me. I
performed ICP-MS measurements in close cooperation with Prof. Dr. Tanja Schwerdtle from
the University of Potsdam. The published manuscript was written by me and reviewed by
Prof. Dr. Dr. Hajo Haase, Prof. Dr. Tanja Schwerdtle and Dr. Claudia Keil.
![Page 191: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/191.jpg)
List of Publications
XXXIV
List of Publications
Published Peer-Reviewed Articles
Maares, M. and Haase, H. (2016). "Zinc and immunity: An essential interrelation." Archives of
Biochemistry and Biophysics 611(Supplement C): 58-65.
https://doi.org/10.1016/j.abb.2016.03.022
Maares, M., Keil, C., Thomsen, S., Günzel, D., Wiesner, B., Haase, H. (2018).
"Characterization of Caco-2 cells stably expressing the protein-based zinc probe
eCalwy-5 as a model system for investigating intestinal zinc transport." Journal of
Trace Elements in Medicine and Biology 49: 296-304.
https://doi.org/10.1016/j.jtemb.2018.01.004
Bulut, A., Maares, M., Atak, K., Zorlu, Y., Çoşut, B., Zubieta, J., Beckmann, J., Haase, H.,
Yücesan, G. (2018). "Mimicking cellular phospholipid bilayer packing creates
predictable crystalline molecular metal–organophosphonate macrocycles and cages."
CrystEngComm 20(15): 2152-2158.
https://doi.org/10.1039/c8ce00072g
Sumarokova, M., Iturri, J., Weber, A., Maares, M., Keil, C., Haase, H., Toca-Herrera, J. L.
(2018). "Influencing the adhesion properties and wettability of mucin protein films by
variation of the environmental pH." Scientific Reports 8(1): 9660.
https://doi.org/10.1038/s41598-018-28047-z
Maares, M., Duman, A., Keil, C., Schwerdtle, T., Haase, H. (2018). "The impact of apical and
basolateral albumin on intestinal zinc resorption in the Caco-2/HT-29-MTX co-culture
model." Metallomics 10(7): 979-991.
https://doi.org/10.1039/C8MT00064F
Maares, M., Keil, C., Koza, J., Straubing, S., Schwerdtle, T., Haase, H. (2018). "In vitro Studies
on Zinc Binding and Buffering by Intestinal Mucins." International Journal of
Molecular Sciences 19(9): 2662.
https://doi.org/10.3390/ijms19092662
Oral Presentations
Zinc-UK/Zinc-net Conference; 21st-22nd November 2016 in Belfast, United Kingdom
Maares, M., Keil, C., Haase, H.
In vitro-studies to investigate the impact of mucins on intestinal zinc resorption
Biomarker in Prevention and Nutrition; 6thDezember 2016 in Potsdam, Germany
Maares, M., Keil, C., Haase, H.
In vitro-Intestinalmodell zur Untersuchung der Bioverfügbarkeit von Zink
![Page 192: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/192.jpg)
List of Publications
XXXV
Congress of the regional association of German Food Chemists Nord-East (LChG, GdCh);
6th March 2018 in Berlin, Germany
Maares, M, Keil, C., Haase, H.
In vitro-Studien zur Untersuchung der Zink-Bioverfügbarkeit und intestinalen Zink-
Resorption
47th Congress of the German Society of Food Chemists (LChG, GdCh); 17th-19th September
2018 in Berlin, Germany;
Maares, M, Keil, C., Haase, H.
Analytische Ansätze zum Monitoring der intestinalen Zinkaufnahme mit Zink-
Biosonden
Poster Presentations
44th Congress of the German Society of Food Chemists (LChG, GdCh); 14th-16th September
2015 in Karlsruhe, Germany
Maares, M., Keil, C., Haase, H.
In vitro-Enterozytenmodell zur Untersuchung der intestinalen Bioverfügbarkeit von
Zink
32nd Annual Conference of the German Society of Minerals and Trace Elements; 13th – 15th
October 2016 in Berlin, Germany
Maares, M., Duman, A., Keil, C., Haase, H.
Enterocyte vs. goblet cell: Investigation of the intestinal bioavailability of zinc
5th Meeting of the International Society for Zinc in Biology (ISZB), in collaboration with Zinc-
Net, 18th- 22nd June 2017 in Cyprus, Greece
Maares, M., Duman, A., Straubing, S., Keil, C., Haase, H.
Zinc-buffering by intestinal glycoproteins - in vitro-studies to investigate the role of
mucins in zinc-resorption (Poster Prize)
33h Annual Conference of the German Society of Minerals and Trace Elements; 28th – 30th
September 2018 in Aachen, Germany
Maares, M., Thomsen, S., Keil, C., Günzel, D., Wiesner, B., Haase, H.
Stable expression of eCalwy-FRET sensors in Caco-2 cells: a practical tool to monitor
free zinc in enterocytes
34th Annual Conference of the German Society of Minerals and Trace Elements; 7th – 9th June
2018 in Jena, Germany
Maares, M., Duman, A., Keil, C., Schwerdtle, T., Haase, H.
The ambiguous role of albumin on zinc resorption in a human in vitro intestinal cell
model
![Page 193: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/193.jpg)
List of Publications
XXXVI
47th Congress of the German Society of Food Chemists (LChG, GdCh); 17th-19th September
2018 in Berlin, Germany;
Maares, M., Keil, C., Koza, J., Straubing, S., Haase, H.
Relevanz von Muzinen für die intestinale Zinkresorption
47th Congress of the German Society of Food Chemists (LChG, GdCh); 17th-19th September
2018 in Berlin, Germany;
Maares, M., Löher, L., Keil, C., Haase; H., Toca-Herrera, J., Iturri, J.
Strukturelle Untersuchungen von intestinalen Becherzellen mittels
Rasterkraftmikroskopie
11th “Doktorandensymposium”andDRS Seminar for Presentations in Biomedical Sciences;
21th September 2018 in Berlin, Germany
Maares, M.; Keil, C.; Haase, H.
In vitro studies on luminal and basolateral factors influencing intestinal zinc
resorption by Caco-2/HT-29-MTX co-cultures
20th International Congress on In vitro Toxicology; 15th- 18th October in Berlin, Germany
Maares, M., Keil, C., Haase, H.
In vitro intestinal model Caco-2/HT-29-MTX - Investigation of luminal and basolateral
factors influencing intestinal zinc resorption
Grants and Prizes
Zinc Net Travel Grant for the Zinc-UK/Zinc-net Conference2016;
21st-22nd November 2016 in Belfast, United Kingdom
Travel Grant from the Berlin Institute of Technology for the 5th Meeting of the International
Society for Zinc in Biology (ISZB) in collaboration with Zinc-Net;
18th- 22nd June 2017 in Cyprus, Greece
Metallomics Poster Prize
5th Meeting of the International Society for Zinc in Biology (ISZB) in collaboration with
Zinc-Net; 18th- 22nd June 2017 in Cyprus, Greece
Trainee Grant from COST Action TD1304 for the 33th Annual Conference of the German
Society of Minerals and Trace Elements;
28th - 30th September2018 in Aachen, Germany
Travel Grant from the Berlin Institute of Technology for the 20th International Congress on In
Vitro Toxicology;
15th- 18th October in Berlin, Germany
![Page 194: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/194.jpg)
Acknowledgements
XXXVII
Acknowledgements
Ein besonderer Dank geht an Prof. Dr. Dr. Hajo Haase für die Unterstützung und Betreuung
während meiner gesamten Promotionszeit. Danke für die Eröffnung dieses spannenden
Themas, die Möglichkeit in deiner Arbeitsgruppe zu arbeiten und natürlich die vielen
konstruktiven Diskussionen und Ratschläge. Ich durfte in der Zeit als Doktorandin bei dir
einige interessante Tagungen besuchen und Vorträge halten - Vielen Dank für die stetige
Förderung und Motivation!
Ich danke Prof. Dr. Anna Kipp für die Begutachtung dieser Arbeit.
Dr. Claudia Keil möchte ich für die wertvollen Diskussionen, sowie die stetige Hilfe bei
praktischen Fragen und technischen Anwendungen danken. Vielen Dank für deine
motivierenden Worte und die vielen schönen und Schokoladenreichen Stunden in unserem
Büro. Nicht zu vergessen, unsere gemeinsamen Tagungen, bei denen wir einige amüsante
Abende miteinander verbracht haben.
Ich möchte außerdem unseren Kooperationspartnerinnen und -partnern für ihre
Unterstützung und Beteiligung an den jeweiligen Publikationen, auf denen diese Arbeit
beruht, danken. Ich danke Prof. Dr. Dorothee Günzel vom Institut für Klinische Physiologie,
Charité Universitätsmedizin Berlin, für die praktische Hilfe und fachliche Beratung bei den
immunchemischen Analysen der Tight junction Proteine. Prof. Dr. Tanja Schwerdtle danke
ich für die Ermöglichung und das Vertrauen, die ICP-MS-Messungen in ihrem Arbeitskreis an
der Universität Potsdam durchzuführen. Besonderer Dank geht auch an Dr. Talke Marschall
und Dr. Sören Meyer für die technische Unterstützung bei den Messungen. Dr. Burkhard
Wiesner, von der Core Facility für Cellular Imaging am Leibniz Forschungsinstitut für
molekulare Pharmakologie (FmP) in Berlin, möchte ich für die Unterstützung bei der FRET-
Messung des Caco-2-eCalwy Klons und die hilfreichen Diskussionen über die FRET und FLIM-
Analysen danken.
Ich möchte mich an dieser Stelle bei meinen Kolleginnen und Kollegen für das gute
Arbeitsklima, die schöne Zeit und die zahlreichen gemeinsam verspeisten Kuchen bedanken.
Ich denke gerne an die letzten vier Jahre zurück. Conny Richter danke ich für die Hilfe bei
jeglichen elementar-analytischen Fragen, Susanne Thomsen für die Unterstützung bei der
Selektion der Caco-2-eCalwy Klone, Timo Neubert für den verlässlichen Beistand bei kleinen
und großen technischen Problemen. Die lustigen Geschichten von Thomas Bernhardt haben
die Arbeit im Labor erleichtert. Von dir habe ich außerdem gelernt, wie man einen
Autoreifen wechselt! Ein großes Dankeschön geht an Wiebke Alker für die aufheiternden
Gespräche, die emotionale Unterstützung und die stetigen Versuche ein gemeinsames
Mittagessen zu organisieren!
Ich danke außerdem meinen Diplomandinnen, Ayşe Duman, Stefanie Haberecht, Sofia
Straubing, Cathrin Schröder, sowie Diplomanden, Tobias Hensel und Leif Löher, die ich
während meiner Promotionszeit betreuen durfte. Es hat mir unglaublich viel Spaß gemacht,
![Page 195: Investigations on Zinc Resorption usingMaria Maares, Claudia Keil, Susanne Thomsen, Dorothee Günzel, Burkhard Wiesner, Hajo Haase. "Characterization of Caco-2 cells stably expressing](https://reader036.vdocuments.us/reader036/viewer/2022071410/61051ff9fdfc6b2f1701c1a6/html5/thumbnails/195.jpg)
Acknowledgements
XXXVIII
mit euch zusammenzuarbeiten. Danke für die vielen guten Ergebnisse und schönen
Erinnerungen.
Meinen Freundinnen Viktoria Ganß, Olga Wesker und Jessica Dietrich möchte ich für den
emotionalen Rückhalt und die Ablenkung vom Laboralltag in den letzten vier Jahren danken.
Ein besonderer Dank gilt meiner Familie. Meinen Eltern danke ich für die stetige und
bedingungslose Unterstützung, die Ermöglichung meines gesamten Studiums und das viele
Korrekturlesen dieser Arbeit. Ich danke meinen Geschwistern Phoebe und Seymour Maares
für ihren andauernden Glauben in mich und dass sie mich immer zum Lachen bringen.
Meiner Schwester möchte ich außerdem für die vielen (fachlichen) Diskussionen, die Hilfe
beim Korrigieren und Gegenlesen meiner Texte und die gemütliche Herberge während
meiner Zeit in Wien danken. Christoph Leo danke ich für den Beistand, die Rücksichtnahme
und die tägliche Aufheiterung während der Anfertigung dieser Arbeit.