Intronic Splicing Regulatory Elements

Gene Yeo, Salk Institute

Array-based discovery fromneural differentiation of human ES cells

C. Carson

Genome-wide comparative genomics

J. Simon

Nicole Coufal, Christian Carson, Alysson Muotri,

Xiangdong Xu, Tiffany Liang, Rusty Gage

Eric Van Nostrand, Tiffany Liang

Understand the rules to predict (cell-type, signal-induced specific) alternative splicing

AlternativeConstitutive Constitutive Constitutive Constitutive

ACEScan[+] exons on UCSC browser

Yeo, PNAS 05

NMDA receptor 1

Sorek, Sugnet, Yeo

Cell-type specific AS controlled by cis-elements and trans-factors

GGGGG

UAGG

UC-rich; UCUU

UGCAUG

Identification Of Intronic Splicing Regulatory Elements

1. Count conserved kmers and unconserved kmers

2. Derived a chi-square score for significantly enriched and conserved kmers

3. Clustered the kmers into motif families

161,730 exons 24.2 Mbexonic sequence129 Mb intronic sequence

158 downstream motif clusters

156 upstream motif clusters

Example of a downstream motif cluster:

TGCATG ,TGCATGA, ATGCATG, CTGCATG, TGCATGC, TGCATGT, TGCATGG, GTGCATG

What are the properties of these motifs?

•Positional biases?•Near alternatively spliced exons?•Expression biases?•Overlap known elements?

76% of downstream ISREs exhibit significant position biases

80% of upstream ISREs exhibit significant position biases

I. ISREs have strong positional distribution biases

New protocol for computing conserved positional bias, while controlling for background conservation

II. ISREs are enriched near alternative exons 30% downstream ISREs56% upstream ISREs

Some resemble known binding sites

FOX1,2

Enriched near muscle alternative exons (Ares) Nova1,2

MBNL

PTB

CELF

III. Genes containing ISRE-proximal exons are tissue-specific

Expression biases (71% downstream ISREs, 81% upstream ISREs)

IV. ISREs overlap with Exonic Splicing Silencers

ESE Fairbrother WG, Yeh RF, Sharp PA, Burge CB (2002)ESS Wang Z, Rolish ME, Yeo G, Tung V, Mawson M et al. (2004)ISE Yeo G, Hoon S, Venkatesh B, Burge CB (2004) ESE, ESS Zhang XH, Chasin LA (2004)

Like ESS, do ISREs affect Splice Site Choice ?

Competing 5’ss and 3’ss reporter (Wang et al, Mol Cell, July, 2006)

Downstream ISREs suppress intron-proximal 5’ splice sites

Upstream ISREs suppress intron-proximal 3’ splice sites

Applications of ISREs: (1) splicing arrays --tissue specific alternative splicing?

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

Sugnet et al. PLoS Comput Biol, 2006

skip

pe

d

incl

ud

ed

skip

pe

d

incl

ud

ed

TGCATGACTAACTTGGTTTGGTTTGCATGTCATTTTTTTCAT

Enriched ISREs in downstream introns

Enriched

Depleted

musclebrain

Applications of ISREs: (2) predicting RNA binding sites

1. Several proteins have been reported to affect their own alternative splicing (e.g. hnRNP A1, SRP20, SC35, TIA1, TIAR2, FOX2, PTB)

2. Evolutionarily conserved AS exons have high intronic conservation flanking the exon, resulting in algorithms that perform genomic predictions of alternative conserved exons

3. Alternative conserved exons are enriched in genes encoding RNA binding proteins and splicing factors

Applications of ISREs: (2) predicting RNA binding sites

Applications of ISREs: (2) predicting RNA binding sites

ISREs are likely functional

• ISREs identified in mammals via comparative genomics.• ISREs have positional biases, are enriched in tissue-specific

genes, and overlap with ESS.• ISREs alter splice site choice in vitro.• Some ISREs resemble known sites of known alt splicing factors.• A fraction of ISREs are proximal to alternative exons.• ISREs can be utilized to analyze splicing-array data.• ISREs can be utilized to identify autoregulated exons, and has

other implications.

Alternative splicing differences in human embryonic stem cells versus neuronal progenitors

hESC NP from hESC

Endogeneous NP

1. Developed an algorithm to detect AS from exon arrays

(REAP).2. Verify AS events.3. Identify ISREs proximal to AS

events.4. Identify RNA binding protein.

Exon arrays have probesets in every exon

Simple representation Exon array, alternative splicing, gene expression

Tiling arrays

REAP predictions agree with A) EST-verified alternative splicingB) ACEScan[+] exons

Confirming isoforms by RT-PCR

Discovery of ISREs proximal to ES/NP alternative exons

ISREs in ES/NP ongoing…

• REAP algorithm designed for exon array based detection of AS events

• REAP[+] exons correlate with EST-based and ACEScan[+] exons

• ISREs identified specific for ES/NP AS events• FOX1/2 may regulate ES/NP-specific AS events

Alternative ConstitutiveConstitutive

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

Computational Modeling, Integration

Cis-elements

Association of RNA binding proteins to elements

Stem cells, early neuronal differentiation

Alternative splicing at the Crick-Jacobs Center, Salk Institute