Intronic Splicing Regulatory Elements
Gene Yeo, Salk Institute
Array-based discovery fromneural differentiation of human ES cells
C. Carson
Genome-wide comparative genomics
J. Simon
Nicole Coufal, Christian Carson, Alysson Muotri,
Xiangdong Xu, Tiffany Liang, Rusty Gage
Eric Van Nostrand, Tiffany Liang
Understand the rules to predict (cell-type, signal-induced specific) alternative splicing
AlternativeConstitutive Constitutive Constitutive Constitutive
Identification Of Intronic Splicing Regulatory Elements
1. Count conserved kmers and unconserved kmers
2. Derived a chi-square score for significantly enriched and conserved kmers
3. Clustered the kmers into motif families
161,730 exons 24.2 Mbexonic sequence129 Mb intronic sequence
158 downstream motif clusters
156 upstream motif clusters
Example of a downstream motif cluster:
TGCATG ,TGCATGA, ATGCATG, CTGCATG, TGCATGC, TGCATGT, TGCATGG, GTGCATG
What are the properties of these motifs?
•Positional biases?•Near alternatively spliced exons?•Expression biases?•Overlap known elements?
76% of downstream ISREs exhibit significant position biases
80% of upstream ISREs exhibit significant position biases
I. ISREs have strong positional distribution biases
New protocol for computing conserved positional bias, while controlling for background conservation
II. ISREs are enriched near alternative exons 30% downstream ISREs56% upstream ISREs
Some resemble known binding sites
FOX1,2
Enriched near muscle alternative exons (Ares) Nova1,2
MBNL
PTB
CELF
III. Genes containing ISRE-proximal exons are tissue-specific
Expression biases (71% downstream ISREs, 81% upstream ISREs)
IV. ISREs overlap with Exonic Splicing Silencers
ESE Fairbrother WG, Yeh RF, Sharp PA, Burge CB (2002)ESS Wang Z, Rolish ME, Yeo G, Tung V, Mawson M et al. (2004)ISE Yeo G, Hoon S, Venkatesh B, Burge CB (2004) ESE, ESS Zhang XH, Chasin LA (2004)
Like ESS, do ISREs affect Splice Site Choice ?
Competing 5’ss and 3’ss reporter (Wang et al, Mol Cell, July, 2006)
Applications of ISREs: (1) splicing arrays --tissue specific alternative splicing?
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
Sugnet et al. PLoS Comput Biol, 2006
skip
pe
d
incl
ud
ed
skip
pe
d
incl
ud
ed
TGCATGACTAACTTGGTTTGGTTTGCATGTCATTTTTTTCAT
Enriched ISREs in downstream introns
Enriched
Depleted
musclebrain
Applications of ISREs: (2) predicting RNA binding sites
1. Several proteins have been reported to affect their own alternative splicing (e.g. hnRNP A1, SRP20, SC35, TIA1, TIAR2, FOX2, PTB)
2. Evolutionarily conserved AS exons have high intronic conservation flanking the exon, resulting in algorithms that perform genomic predictions of alternative conserved exons
3. Alternative conserved exons are enriched in genes encoding RNA binding proteins and splicing factors
ISREs are likely functional
• ISREs identified in mammals via comparative genomics.• ISREs have positional biases, are enriched in tissue-specific
genes, and overlap with ESS.• ISREs alter splice site choice in vitro.• Some ISREs resemble known sites of known alt splicing factors.• A fraction of ISREs are proximal to alternative exons.• ISREs can be utilized to analyze splicing-array data.• ISREs can be utilized to identify autoregulated exons, and has
other implications.
Alternative splicing differences in human embryonic stem cells versus neuronal progenitors
hESC NP from hESC
Endogeneous NP
1. Developed an algorithm to detect AS from exon arrays
(REAP).2. Verify AS events.3. Identify ISREs proximal to AS
events.4. Identify RNA binding protein.
Exon arrays have probesets in every exon
Simple representation Exon array, alternative splicing, gene expression
Tiling arrays
ISREs in ES/NP ongoing…
• REAP algorithm designed for exon array based detection of AS events
• REAP[+] exons correlate with EST-based and ACEScan[+] exons
• ISREs identified specific for ES/NP AS events• FOX1/2 may regulate ES/NP-specific AS events
Alternative ConstitutiveConstitutive
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
Computational Modeling, Integration
Cis-elements
Association of RNA binding proteins to elements
Stem cells, early neuronal differentiation
Alternative splicing at the Crick-Jacobs Center, Salk Institute