infectious issn 1027-0299 recognised and registered with

ISSN 1027-0299Recognised and registered with thePakistan Medical & Dental CouncilNO.PF.11-F-96 (Infectious Diseases) 2560College of Physicians & Surgeons, PakistanIndexed - WHO EMRO

27

31

26

April - June 2020 Volume 29 Issue 02

INFECTIOUSDISEASESJOURNALPublished by the Medical Microbiology & Infectious Diseases Society of Pakistan

of Pakistan

IDJ

Apr - Jun 2020. 25Volume 29 Issue 02Volume 29 Issue 02

CONTENTS PAGE #

Rights:No part of this issue or associated program may be reproduced, transmitted,transcribed, stored in a retrieval system or translated into language orcomputer language in any form or means, electronic, mechanical, magnetic,optical, chemical, manual or otherwise without the express permission ofthe editor/publisher and author(s) of IDJ.

Disclaimer:Statements and opinions expressed in the articles, news, letters to the editorsand any communications herein are those of the author(s), the editor and thepublisher disclaim any responsibility or liability for such material. Neitherthe editor nor publisher guarantee, warrant, or endorse any product orservice advertised in their publication, nor do they guarantee any claimmade by the manufacturers of such product or service.

Submission:Infectious Diseases Journal (IDJ) is published quarterly. Please submit manuscriptsat [email protected]. See author guidelines.

Designed & Published by:Medishine PublicationsA-452, Ground Floor, Block 7, K.A.E.C.H.S, Karachi.Tel:34555263, E-mail:[email protected]

Proprietor:Medical Microbiology & Infectious Diseases Society of Pakistan21 G /1, Block - 6, P.E.C.H.S., Shahrah-e-Faisal, Karachi. Ph: 0333-3977011E-mail: [email protected]

Infectious Diseases Journal of PakistanOfficial Organ of the

Medical Microbiology & Infectious Diseases Society of Pakistan

President Bushra JamilInternal Medicine, Infectious DiseasesAga Khan University Hospital,Karachi. Pakistan

Gen. Secretary Summiya NizamuddinSection of MicrobiologyShaukat Khanum Memorial Cancer Hsopitaland Research Centre, Lahore, Pakistan.

Treasurer Sunil DodaniDepartment of Infectious Diseases,Sindh Institute of Urology & TransplantationKarachi, Pakistan

Editorial Office

Editor: Ali Faisal Saleem

Associate Editors: Iffat KhanumSonia QureshiMuhammad Idris MazharSunil DodaniNosheen Nasir

Editorial Board: Aamer Ikram Naseem SalahuddinAltaf Ahmed Ejaz A. KhanShehla Baqi Luqman SettiM. Asim Beg Naila Baig Ansari

Rana Muzaffar

36

Manager MMIDSP: Luqman Mahmood42

44

EDITORIAL

Middle East Respiratory Syndrome Corona Virus (MERS-CoV)– A continuous Challenge for Global Health.Mohammad T. Yousafzai

ORIGINAL ARTICLES

Trends in Antimicrobial Resistance Pattern of Klebsiella Bacteremiaover a 6 Years Period (2010-2015) in a Hemodialysis Centre inPakistanSanjay Badlani, Sunil Kumar Dodani, Asma Nasim, ZaheeruddinBabar, Maliha Azmi

Predominance of Genomovar I among Burkholderia cepaciaComplex bacteremia in the Neonatal Population – a study fromKarachi, PakistanTazeen Fatima, Erum Khan, Amna Nasir, Shahnila Alidina, FaisalMalik, Shabina Arif, Seema Irfan, Shahida M Qureshi, Sadia Shakoor

Health Poems Intervention for Awareness of Polioand RoutineImmunization Among Rural Children of PakistanJewat Ram(Jewat Sunder), Satti Jewat, Sirajul Haque Shaikh, FarahAhmed, Hassan Danish

CASE REPORT

Salmonella Paratyphi A infection of a Thyroid CystSalima Qamar, Seema Irfan

INSTRUCTIONS FOR AUTHORS

Courtesy : Ali Faisal Saleem, Associate professor, Paediatric InfectiousDiseases, Aga Khan University, Karachi, Pakistan

7 year/M, with pancytopenia, fever and weight loss. He is known case ofprimary immunodeficiency and T cell defect. On examination there issplenomegaly.CT Abdomen showing Liver is enlarged in size and is measuring 17.2 cm incraniocaudal dimension. No evidence of intrahepatic or extrahepatic biliarydilatation. Portal vein and hepatic veins are normally enhancing. Massivelyenlarged spleen with its lower tip extending towards the right iliac fossa. Atthe point of maximum dimension, the spleen is measuring up to 188 mm incraniocaudal dimensions. Multiple peripherally placed, wedge-shaped low-attenuation areas are identified in the spleen, suggestive of splenic infarctions,which are sequelae of massive splenomegaly. The spleen is causing displacementof the pancreas as as well as of the bowel loops. Bone Marrow examinationreveal Leishmaniasis.

26 . Infectious Diseases Journal of Pakistan

GUEST EDITORIAL

Pandemic COVID-19 affected the global community. Thispose the most devastating and critical challenge to healthcareindustry and teams as the crisis and impact is more than expected.While the whole world is struggling to control COVID-19pandemic, Middle East Respiratory Syndrome Corona Virus(MERS-CoV) is still causing clusters of outbreaks in differentparts of the Middle East and occasionally the virus is exportedto countries outside the Middle East. The virus with a highermortality, hospitalizations, and admissions to intensive careunit is no doubt posing a continuous threat to the global healthsecurity.1 In comparison COVID-19 has lesser hospitalization,mortality and ICU admissions. A major challenge in completecontrol of MERS-CoV infection is the gap in existing knowledgeabout the intermediate animal reservoir. Albeit, few studies inQatar and Saudi Arabia found some association between exposureto camels and MERS-CoV infection, sporadic cases withoutany known exposure are quite common, indicating that reservoirsother than camels are also likely.2 Similarly, the mechanism oftransfer of virus from primary reservoir “Bats” to the secondaryreservoir “Camels” or livestock or any other intermediatereservoir is also unknown. Moreover, the exact route oftransmission between animal-to-human and human-to-humanis also yet unknown.3,4 Besides all these challenges, theimportance of camels in Arabs’ culture, tradition and localpractices such as camel race, and camels an important livestockfor the rural population also pose an important challenge incontrolling the animal-human transmission of MERScoronavirus. Camels are expensive commodity and cannot beculled like other small animals to control the chain of transmissionof the disease. Keeping in view these gaps in the existingknowledge, challenges in destroying the animal reservoir,repeated transmissions of the virus between animal-to-humanresulting in clusters of outbreaks are occurring for the last fewyears, posing significant risk to the health of the globalpopulation.

Vaccines development for human use (which is currently inearly experimental stages) should be expedited. Vaccines foranimals such as camels, goats and other cattle also seems viableoption for the control of the disease. Research on the developmentof MERS-CoV neutralizing antibodies should also be exploredfor prophylactic use among high risk groups.4 More researchfunds should be allocated to carryout research in the area ofMERS-CoV and fill the existing knowledge gaps. Standardprecautions with additional focus on respiratory precautionshave shown promising results during the past outbreaks includingthe current COVID-19 pandemic. Healthcare workers in allover the world especially outside Middle East should be directedto adhere with standard precautions in all times when dealingwith patients with a travel history to the Middle East. Traveladvisory for those travelling to Middle East should be issuedwith clear and specific messages regarding exposure to camels,raw camel milk, meat and earlier seeking of healthcare in caseof any illness. The quick availability of COVID-19 vaccinegiven us a hope to have a MERS vaccine in near future.

References1. Emergencies prepardness, response: Middle East Respiratory syndrome

coronavirus (MERS-CoV) - The Kingdom of Saudi Arabia [press release].World Health Organization2019.

2. Gong S, Bao L. The battle against SARS and MERS coronaviruses:Reservoirs and Animal Models. Animal Model Exp Med. 2018;1:125-33.

3. WHO MERS Global Summary and Assessment of Risk. Geneva: WorldHealth Organization; 2018 August 2018. Contract No.: WHO/MERS/RA/August 2018.

4. Widagdo W, Okba NMA, Raj VS, Haagmans BL. MERS-coronavirus:From discovery to intervention. One Health. 2017;3:11-6.

Mohammad T. YousafzaiLecturer Dept. of Paediatrics & Child Health, Aga KhanUniversity Karachi,PhD Scholar at UNSW, AustraliaEmail: [email protected]

Middle East Respiratory Syndrome Corona Virus (MERS-CoV) – A continuous Challenge forGlobal Health.

Apr - Jun 2020. 27Volume 29 Issue 02

ORIGINAL ARTICLE

cause of death according to a large surveillance study in UnitedStates.2 Patients on hemodialysis are on an increased risk ofblood stream infections, particularly those on temporary venousaccess.3 According to The Joint Commission Report, between2001-2011 catheter-related BSI rates are high, ranging from7.4 to 12.2 per 1000 central line days in low and middle incomecountries as compared to 1.3-2.1 per 1000 central line days inhigh income countries.4

Klebsiella pneumoniae is a major nosocomial organism causingblood stream infections and found to be associated withsignificant mortality.5 In patients on hemodialysis, studiesreported Klebsiella species (spp.) to be one of most commoncausative organism among gram negative bacteremia.6,7,8 Kalamet al from our center, studied gram negative BSIs with 77% ofpatients on hemodialysis, they found Klebsiella spp. as themost frequent organism isolated.9

Along with increasing frequency of Klebsiella infections, thereis a concern of resistance to antimicrobials which may complicatetheir management. In US, the prevalence of multidrug-resistantKlebsiella spp. is between from 0.5%–17%.10 A rising trend ofresistance to most antimicrobials in clinical isolates of Klebsiellaspp. has also been reported from Pakistan.11 Khan et al reportedKlebsiella pneumoniae as the most common organism showingresistance to carbapenems.12

Little is known from our part of the world regarding thefrequency and resistance pattern of Klebsiella spp. bacteremiain patients on hemodialysis. With the emergence of multi-resistant organisms, antimicrobial treatment has become difficultwhereas accurate knowledge of antimicrobial sensitivity isnecessary for timely administration of appropriate empiricaltherapy. This study was conducted to know the trends offrequency and antimicrobial resistance in Klebsiella spp. inpatients on hemodialysis. It will not only help the treatingphysician to choose appropriate empirical antibiotics but alsojudicious use of antimicrobials and better infection controlmeasures can effectively be implemented.

MethodsThis is a retrospective observational study, conducted at SindhInstitute of Urology and Transplantation (SIUT) Karachi,Pakistan. SIUT is a 750 bedded tertiary care hospital mainly

Abstract

BackgroundKlebsiella spp. is the commonest cause of bacteremia in dialysispatients from our center. A rising trend of antimicrobial resistanceamong Klebsiella has been reported from Pakistan. We studiedthe trends of antimicrobial resistance over 6 years in dialysispatients.

MethodsSindh Institute of Urology and Transplantation (SIUT) is a 750bedded tertiary care hospital in Karachi, Pakistan. Around 500patients are offered outpatient dialysis daily.

We did a retrospective data analysis of all blood cultures sentfrom outpatient hemodialysis unit with isolation of Klebsiellaspp. in the years 2010, 2012, 2014 and 2015. The resistancepattern of ceftriaxone, piperacillin-tazobactam, ciprofloxacin,trimethoprim-sulfamethoxazole, amikacin and imipenem werecompared over a 6 years’ period.

ResultsA total of 27,852 blood cultures were received during the studyyears, out of which 19670 (70.6%) were positive for anymicrobial growth. Around 5325 (27%) were Klebsiella spp.There was an increase in percentage of Klebsiella spp bacteremiaover the years, range from 19-35%. The antimicrobial sensitivitypattern changed over years. Resistance was lowest againstimipenem in 2010 around 1%, which increased to 19% in 2015.

ConclusionThere is a gradual rise in Klebsiella bacteremia in dialysis unit.Resistance to broad-spectrum antimicrobials has increasedsignificantly with around twenty-fold increase in imipenemresistance over the last 6 years. We need a robust stewardshipprogram for judicious use of antimicrobials and better infectioncontrol measures to contain increasing resistance.

IntroductionBloodstream infections (BSIs) are among the major causes ofmorbidity and mortality worldwide.1 BSIs are the tenth leading

Corresponding author: Sanjay Kumar,Flat No. 314, Block B, 3rd floor, Hina Palace nearKarachi club, Karachi, Pakistan.Email: [email protected]

Trends in Antimicrobial Resistance Pattern of Klebsiella Bacteremia over a 6 Years Period (2010-2015)in a Hemodialysis Centre in Pakistan

Sanjay Badlani, Sunil Kumar Dodani, Asma Nasim, Zaheeruddin Babar, Maliha Azmi

Department of Infectious Diseases, Sindh Institute of Urology and Transplantation, Karachi, Pakistan.


caters to renal diseases and transplantation. It is the largesthemodialysis center of Pakistan where an average of around500 hemodialysis done per day as outpatient.

The data was retrieved from the microbiology department. Allblood cultures sent from hemodialysis unit which were positivefor Klebsiella species were taken. Cultures were retrieved fromthe following years 2010, 2012, 2014 and 2015 for analysis.

Antibiotic sensitivity of Klebsiella. spp. isolates were determinedon Muller Hunton agar plates by Kirby–Bauer disc diffusionmethod. Isolates were declared as sensitive or resistant on thebasis of the zone of inhibition as determined by the criteria ofClinical Laboratory Standards Institute against the followingantibiotics: ceftriaxone, ciprofloxacin, piperacillin-tazobactam,amikacin, trimethoprim-sulfamethoxazole and imipenem.

ResultsA total of 27,852 blood cultures were received during the studyyears, out of which 19670 (70.6%) were positive for anymicrobial growth. A total of 5325 (27%) blood cultures grewKlebsiella spp. The frequency of Klebsiella spp. bacteremiaover different years ranges from 19.4 to 27% as shown in Table1 and Figure 1. The antimicrobial sensitivity over differentyears is represented in Figure 2. Resistance was lowest againstimipenem in the year 2010 (1.19%) which gradually increasedas 8% and 19% in the years 2012 and 2015 respectively. Forpiperacillin-tazobactam the resistance was around 20-30%between 2010-2014, it surged to reach 40% in 2015. Highresistance was noted to ceftriaxone and ciprofloxacin in rangeof 70-80% through out.

DiscussionKlebsiella bacteremia accounted for 4-15% of all blood streaminfections.11 In our patient cohorts we observed a rising frequencyof Klebsiella BSI from 19 % to 35% over the span of 6 years.Gram negative central line BSI has been increasing in frequencyworldwide. Marcos et al reported a rising trend of gram negativeBSI over an 18 years’ time among patients with central lines.They argued that increasing use of antibiotics and prolonged

hospital stay with resultant colonization may lead to moreinfections with gram negative bacteria.7 Our center caters torenal and urological diseases. It is highly plausible that majorityof infections in our patient population originate from urinarytract, hence it can be concluded that our hospital environmentis colonized with Enterobacteriaceae and other gram negativeorganisms. The patients on hemodialysis have frequent contactwith hospital environment and also get exposed to antibioticsoften due to different infections. These may be the reasonsbehind increasing frequency of gram negative blood stream

Table 1. Year wise breakdown of blood cultures sent and positive along with Klebsiella spp.

Year Total Number Number of No of Klebsiella spp Percentage ofof Isolates Sent Isolates Positive isolates Klebsiella spp

2010 6933 5179 1004 19.4%

2012 6001 4218 940 22.3%

2014 7478 5458 1675 30.6%

2015 7440 4815 1706 35.4%

Total 27852 19670 5325 27%

Fig 1. Frequency of Klebsiella spp. bacteremia in percentagesover 6 years period.

Fig 2. The resistance pattern of Klebsiella spp.bacteremia in percentages over 6 years

Volume 29 Issue 02 Apr - Jun 2020. 29

infections in our patient cohort.

We observed a rising trend of resistance among Klebsiellaisolates which has become a matter of concern worldwide.According to World Health Organization, Enterobacteriaceaeparticularly Klebsiella spp are the organisms which need urgentnew antibiotics due to widespread resistance.12 A study fromKarachi reported 50% of clinical isolates of Klebsiellapneumoniae were extended spectrum beta lactamase (ESBL)producing strains.11 A meta-analysis from 55 studies over thepast nine years showed a very high prevalence of ESBLproducing Enterobacteriaceae (around 40%) from Pakistan.13

Another study by Khan et al showed Klebsiella spp to be themost common organism showing resistance to carbapenems,majority of the isolates produce New Delhi metallo-beta-lactamase 1 (NDM-1) enzyme which make them extensivelydrug resistant.14

In our patient cohort we found a very high resistance (around60-80%) to cephalosporins and ciprofloxacin in Klebsiellaisolates as compared to reports from other tertiary care hospitalof Karachi where it was reported was 30-50%.15 We also foundthat this has remained prevalent over the last 6 years withnegligible change in the pattern. Our patient cohort with renaldiseases may get multiple exposures to both fluoroquinolonesand cephalosporins which are commonly used in urinary tractinfections, this may explain a continuous prevalence of veryhigh resistance of these antibiotics in this population. Secondly,frequent contact with hospital environment is one of the risksfor acquiring repeated infections. Agarwal et al showed thatwith repeated infections among Klebsiella pneumoniae thereis a 1.14 times increase risk of these organisms to becomeresistant to antibiotics.16

It has been observed that Pakistan is considered top amongcountries where carbapenem consumption is high i.e. 1.8 per1000 population in comparison to United States where theconsumption is around 0.3 per 1000 population.17 Studiesshowed that increase antibiotics consumption acceleratedevelopment of resistance.18 We observed that there is analarming rise in piperacillin/tazobactam (from 20% to 40%)and imipenem resistance (from 1% to 19%) in our study over6 years’ time. Kalam et al also reported increase in carbapenemresistance in patients with gram negative bacteremia from ourcenter, with 42% to carbapenems.9

The patients on hemodialysis are at increased risk of infectionsowing to frequent hospital visits, direct access to major vesselsand underlying organ failure, which may render them partiallyimmunocompromised. In addition to multiple antibioticsexposure, biofilm formation around dialysis lines may be oneof the factors leading to acquiring resistant organisms in thispatient population. Lastly but very importantly breach ininfection control practices during handling of dialysis lines orfistula needles may lead to infections with environmental

pathogens of the hospital.

The limitation of our study is that it is a retrospective chartreview where clinical data is not included. Furthermore, bloodcultures sent were only analyzed and we could not extrapolatethem with clinical episodes, that is why there is a high frequencyof positive cultures seen. More studies to look into the clinicalfeatures, risk factors and mortality of Klebsiella bacteremia inhemodialysis population can help us better understand thedisease pattern and its appropriate management. However, itis the first study from Pakistan focusing on the resistance patternof Klebsiella spp. bacteremia in patients on hemodialysis.

In conclusion there is gradual rise in the frequency of Klebsiellaspp. bacteremia over 6 years period in hemodialysis patientswith an alarming rise in carbapenem resistance. Looking at thetrends of resistance pattern we can conclude that carbapenemsshould be the empirical antibiotic of choice, however promptculture retrieval and de-escalation to narrow spectrum antibioticscan prevent rising resistance.

References1. Lillie PJ, Allen J, Hall C, Walsh C, Adams K, Thaker H, et al. Long-term

mortality following bloodstream infection. Clin MicrobiolInfect. 2013 Oct;19(10):955-60. doi: 10.1111/1469-0691.12101. Epub2012 Dec 22. PMID: 23279454.

2. Wisplinghoff H, Bischoff T, Tallent SM, Seifert H, Wenzel RP, EdmondMB. Nosocomial bloodstream infections in US hospitals: analysis of24,179 cases from a prospective nationwide surveillance study. ClinInfect Dis 2004 Aug 01;39(3):309-17.

3. Mohsin B. Pattern of causative micro-organisms in Catheter RelatedBlood stream Infections in Dialysis Patients: experience from SaudiArabia. J Ayub Med Coll Abbottabad 2017; 29(4):635-640.

4. The Joint Commission. Preventing Central Line–Associated BloodstreamInfections: A Global Challenge, a Global Perspective. Oak Brook, IL:Joint Commission Resources, May 2012. [Available from]http://www.PreventingCLABSIs.pdf.

5. Li L, Huang H. Risk factors of mortality in bloodstream infections causedby Klebsiella pneumonia. A single-center retrospective study in China.Medicine 2017; 96:35(e7924)

6. Sahli F, Feidjel R, Laalaoui R. Hemodialysis catheter-related infection:rates, risk factors and pathogens. J Infect Public Health 2017 Jul -Aug;10(4):403-408.

7. Marcos M, Soriano A, In˜ urrieta A et al. Changing epidemiology ofcentral venous catheter-related bloodstream infections: increasingprevalence of Gram-negative pathogens. J Antimicrob chemother 2011Sep;66(9):2119-25

8. E Braun, K Hussein, Y Geffen et al. Predominance of Gram-negativebacilli among patients with catheter-related bloodstream infections. ClinMicrobiol Infect 2014; 20: O627–O629.

9. Kalam K, Qamar F, Kumar S, Ali S, Baqi S. Risk factors for carbapenemresistant bacteraemia and mortality due to gram negative bacteraemia ina developing country. J Pak Med Assoc. 2014 May;64(5):530-6.

10. D'Agata EM. Rapidly rising prevalence of nosocomial multidrug-resistant,Gram-negative bacilli: a 9-year surveillance study. Infection Control andHospital. Epidemiology 2004 Oct;25(10):842-6.

11. Khan E, Ejaz M, Shakoor S, Inayat R, Zafar A, Jabeen K, et al.Increased isolation of ESBL producing Klebsiella pneumoniae withemergence of carbapenem resistant isolates in Pakistan: Report from atertiary care hospital. J Pak Med Assoc Vol. 60, No. 3, March 2010: 186-190.

12. Willyard C. The drug-resistant bacteria that pose the greatest healththreats. Nature News 2017; 543(7643):15.


13. Abrar S, Hussain S, Khan RA, Ul Ain N, Haider H, Riaz S. Prevalenceof extended-spectrum- lactamase-producing Enterobacteriaceae: firstsystematic meta-analysis report from Pakistan. Antimicrob Resist InfectControl. (2018) 7:26

14. Khan E, Irfan S, Sultan BA, Nasir A, Hasan R. Dissemination and spreadof New Delhi Metallo-beta-lactamase-1 Superbugs in hospital settings.J Pak Med Assoc 2016 Aug;66(8):999-1004.

15. Aga Khan University. Antibiotic Susceptibility Report. Karachi: 2017[updated 2017; cited 23 Novmber 2018]; Available from:http://parn.org.pk/wp-content/uploads/2018/05/antibiogram-jul-

dec-17.pdf.16. Agarwal M and Larson EL. Risk of drug resistance in repeat gram

negative infections among patients with multiple hospitalizations. CritCare. 2018 February; 43: 260–264

17. Center for Disease Dynamics, Economics & Policy. 2015. State of theWorld's Antibiotics, 2015. CDDEP: Washington, D.C.

18. Joseph NV, Bhanupriya B, Shewade DG, Harish BN. Relationship betweenAntimicrobial Consumption and the Incidence of Antimicrobial Resistancein Escherichia coli and Klebsiella pneumoniae Isolates. J Clin DiagnRes 2015 Feb; 9(2): DC08–DC12.


ORIGINAL ARTICLE

Corresponding Author: Sadia Shakoor,Assistant professor,Department of Pediatrics & Child Health,Aga Khan University, Stadium Road, Karachi, PakistanE-mail: [email protected]

Predominance of Genomovar I among Burkholderia cepacia Complex bacteremia in the NeonatalPopulation – a study from Karachi, Pakistan

Tazeen Fatima*, Erum Khan*, Amna Nasir*, Shahnila Alidina*, Faisal Malik*, Shabina Arif*, Seema Irfan*,Shahida M Qureshi**, Sadia Shakoor**

*Department of Pathology & Laboratory Medicine, Aga Khan University, Karachi, Pakistan**Department of Pediatrics & Child Health, Aga Khan University, Karachi, Pakistan

Abstract

BackgroundBurkholderia cepacia complex (BCC) has been reported as anemerging cause of healthcare associated neonatal bacteremiaand sepsis. Genomic speciation (genomovar determination) byrecA PCR has been employed to study genetic variability amongdifferent patient populations, but no previous reports havedetermined genomovars within the neonatal population. Theaim of the study was to determine most prevalent genomovarof BCC causing bacteremia among neonates in Karachi, Pakistan,through species-specific PCR for recA gene.

Material and MethodsOf 589 BCC neonatal bacteremic episodes detected from May2015 - September 2016 at the Clinical Microbiology Laboratoryat The Aga Khan University Hospital, 138 isolates wererandomly selected for genomovar determination. recA PCRwas performed on 138 isolates.

ResultsAll isolates were identified as Burkholderia cepacia complexby detection of BCR1 and BCR2 gene. BCC was differentiatedfurther into lineages and B. cepacia genomovar I was found tobe the most prevalent species, being isolated from 129 of 138patients (93.4%). B. cenocepacia which is the predominantspecies in cystic fibrosis patients was found in only 2.9% cases(n=4).

ConclusionsWe confirm the dominance of B. cepacia genomovarI in neonatalpopulation in Karachi, Pakistan. Further studies are requiredto elucidate transmissibility and genetic similarity of B.cepaciagenomovar I isolated from neonatal bacteremia cases.

IntroductionBurkholderia cepacia complex (BCC) is a group of Gram-negative bacteria, widely distributed in natural and hospital

environments.1 These gram-negative rods which were previouslyclassified as Pseudomonas species are non-lactose fermenters,motile, aerobic and often resistant to multiple antibiotics.Although nonpathogenic for healthy individuals, BCC arerecognized pathogens in patients with cystic fibrosis (CF) andchronic granulomatous diseases, where heavy lung colonizationand consequent respiratory infections in these patients havebeen associated with poor outcomes.2 Moreover, it has emergedas an important opportunistic pathogen in hospitalized andimmunocompromised patients, with crude mortality ratesreported as high as 53.8 %.2 BCC have also been reported asa cause of neonatal sepsis.3 Prematurity, very low birth weight,frequent use of broad spectrum antibiotics, and peripheral andcentral intravenous catheters predispose these neonates to BCCsepsis. In neonates, a case fatality rate of 17% has been reported.4

BCC has undergone dramatic taxonomic changes in last fewdecades and now exhibits an extensive diversity of genotypescomposed of at least 17 genetically distinct genomic speciesassociated with different levels of severity and transmissibility,including B. cepacia (genomovarI), B. multivorans(genomovarII), B. cenocepacia (genomovarIII), B.stabilis(genomovarIV), B. vietnamiensis (genomovarV),B. dolosa(genomovarVI), Burkholderia ambifaria (genomovar VII),Burkholderia anthina (genomovar VIII), and Burkholderiapyrrocinia (genomovar IX).5 B. cenocepaciahas been the mostprevalent genomovar in patients with CF in the past and hasbeen replaced by B. multivoranswith passing years, whereas,B. cepacia genomovar I is the least common.6,7,8 B.cenocepaciagenomovar III is also the most common genomovar causingbacteremia in non-CF patients in critical care settings.7,10 Noprevious studies have reported the genomovar distributionamong neonatal sepsis cases.

BCC outbreaks have been reported from a neonatal intensivecare unit (NICU) in Karachi.11 Subsequent to these outbreaks,BCC has become a frequent isolate from bacteremic episodesamong neonates admitted to NICUs in Karachi. However, giventhe variation in genomovar distribution in non-CF populationsand geographical locations, genomovar III cannot be assumedto be the prevalent genomic species in this population. Wereport on neonatal bacteremic episodes cultured at a laboratory


which serves several hospitals in Karachi, and the most prevalentgenomovar of BCC causing neonatal bacteremia in Karachi,Pakistan.

Subjects and MethodsStudy setting, study period, sample size, and bacterial isolates:The Aga Khan University Clinical microbiology laboratoryreceives culture samples from several hospitals across Karachi.On average, the laboratory processes 150 blood cultures permonth obtained from neonates. The laboratory receives neonatalblood cultures from hospitals across the Karachi city, whichare collected in BACTEC Peds Plus/F bottles and analyzedwith the BACTEC 9240 instrument (Becton DickinsonDiagnostic Instrument Systems, Sparks, Md.). Transport to thelaboratory is within 6-18 hours at room temperature and culturesare incubated immediately on receipt, till 5 days or until positive.In this study, we obtained isolates from positive neonatal bloodcultures or bacteremic episodes identified as Burkolderia cepaciacomplex to study the genomic species distribution.

Positive bottles with gram negative bacteria and oxidase positivegrowth of non-fermenters at 18 hours were further identifiedby API 20 NE (bioMérieux®) as BCC. Susceptibility testingwas performed with Kirby Bauer disc diffusion method forceftazidime, meropenem, and cotrimoxazole and with the Vitek2 Compaq system (bioMérieux®) for levofloxacin as per ClinicalLaboratory Standards Institute (CLSI) guidelines.12

All bacterial isolates identified as BCC were labeled with anexclusive lab identification number and archived at -80 °C tillfurther use. Culture samples with mixed organisms and repeatisolate of B. cepacia from same patient were excluded and onlythe initial blood culture was included. Considering the prevalenceof BCC genomovar I bacteremia among the hospitalizedpopulation to be 21%.13 We estimated that 130 episodes ofBCC neonatal bacteremia per year will need to be classifiedinto genomovars to determine the prevalence of BCC genomovarI with 95% confidence and with 7% error rate. Assumptionsand sample size calculation are provided in Supplementary file 1.

Revival of strains and identification by recA species-specificPCR analysis:Bacterial isolates of Burkholderia cepacia complex were furtheridentified to species level by polymerase chain reaction (PCR)method, exploiting sequence differences in the single locus ofthe recA gene (recA is a protein essential for repair andrecombination of DNA). This was achieved by DNA extractionfrom pure isolates followed by PCR using primers specific forthe BCC.

Preparation of bacterial DNA:Archived isolates were thawed, subcultured on MacConkeyagar plates and incubated aerobically at 35-37ºC for 18-24hours to yield isolated bacterial colonies. Bacterial DNA wasextracted using QIA amp DNA mini kit (QIAGEN GmbH,

Germany) as per manufacturer’s protocol for fresh bacterialcolonies (spin protocol).

Polymerase Chain Reaction:Identification of B. cepacia complex was carried out using PCRwith primers which amplify the entire recA gene of bacteriawithin the B. cepacia complex. PCR assays were performed asdescribed by Mahenthiralingam et al.10 The PCR reactionmixture with a final volume of 25ul constituted of, 0.5µl of25mM dNTPs (MOLEQULE-ON/New Zealand, cat# PR-M-002-1000), 5µl of BUFFER 5x, 1.5µl of MgCl2 (25mM), 0.5µlof DNA Taq polymerase (Promega), 1µl of each specific primerat a concentration of 10pmol, 2.5µl. DNA template amplificationwas carried out with following conditions: initial denaturationat 94°C for 60 seconds, followed by 30 cycles of 30 secondsat 94°C at appropriate annealing temperature and at 72°C for60sec and a final elongation at 72°C for 10 minutes. All primersused in the PCR assays are listed in Table1.14 B.cepacia ATCC25416 was used as a control organism.

All isolates were first identified using B. cepacia complex-specific primers BCR1 and BCR2. Genomovar status was thendetermined sequentially by using PCR primer specific forB.cepaciagenomovar I(BCRG11, BCRG12a). Isolates testingnegative for B.cepaciagenomovar I were further tested withprimer specific for B.cenocepacia genomovar IIIA (BCRG3A1BCRG3A2a) and IIIB (BCRG3B1 BCRG3B2a) and thosetesting negative were further tested with primers specific forB.stabilis genomovar IV(BCRG41, BCRG42a).

PCR amplicons were electrophoresed on 1 % agarose gel in 1X TAE (Tris base, acetic acid and EDTA) containing 2µl ofethidium bromide for 60min at 100mV constant voltage. DNAbands were visualized using Gel Doc (Bio-Rad).

The study protocol was reviewed by the ethical review committeeat the Aga Khan University Hospital and permitted to beexempted from patient consent.

ResultsIncidence of BCC among culture-positive episodes of neonatalbacteremia:From May 2015 to September 2016, the laboratory reported2269 episodes of bacteremia in neonates (positive blood cultures),of which 589 were due to BCC, bringing the estimated incidenceto 250 per 1000 episodes of culture-confirmed bacteremia.

Selection of isolates for genomovar determination:Of the 589 isolates, 138 bacterial isolates were randomly selectedfor genomovar determination. Five of the 138 isolates wereselected from cities other than Karachi. The 133 isolates fromKarachi were collected from 13 various hospitals in themetropolis and covered approximately 1600 km2. Figure 1shows location of hospitals and the catchment area covered inthe study.


recA PCR-based identification and differentiation intogenomovars:All 138 isolates were identified as BCC on the basis of recAconserved PCR for BCR1. Of the 138 clinical isolates, 93.4%were identified as BCC genomovar I (B.cepacia) making this

the most prevalent genomovar causing neonatal bacteremia.On sequential testing of the remaining 9 isolates, 4 wereidentified as B.cenocepacia (genomovar III) with 3 testingpositive for recA cluster III- A, and 1 for cluster III- B, and2 tested positive for B.stabilis (genomovar IV). Genomovarsfor 3 isolates remained unresolved on recA PCR testing. Figure2 shows distribution of genomic species and respectivegenomovars among the 138 isolates tested.

Biochemical reactions of BCC on API 20 NE and susceptibility:All isolates were identified as Burkholderia cepacia by APINE. Susceptibilities against tested antibiotics were: ceftazidime92.8%, (n=128), co-trimoxazole 85.5% (n=118), meropenem52.2% (n=72), and levofloxacin 60.3% (n=73 of 121 isolatestested). All isolates non-susceptible to co-trimoxazole were

60OC

62OC

62OC

61OC

65OC

Table 1: PCR primers used for BCC identification and genomovar determination

Genomovar specificity Primer name Sequence 5’ to 3’ PCR annealingtemperature

B.cepacia complex recA BCR 1 TGACCGCCGAGAAGAGCAABCR 2 CTCTTCTTCGTCCATCGCCTC

B.cepacia genomovar I BCRG11 CAGGTCGTCTCCACGGGTBCRG12a CACGCCGATCTTCATACGA

B.cenocepacia genomovar III-A BCRG3A1 GCTCGACGTTCAATATGCCBCRG3A2 TCGAGACGCACCGACGAG

B.cenocepacia genomovar III, RG-B BCRG3B1 GCTGCAAGTCATCGCTGAABCRG3B2a TACGCCATCGGGCATGCT

B.stabilis genomovar IV, RG-4 BCRG41 ACCGGCGAGCAGGCGCTTBCRG42a ACGCCATCGGGCATGGCA

Fig 2. Distribution of BCC genomovars among neonatalbacteremia isolates from Karachi, Pakistan. There ispredominance of genomovar I among prevalent strains.

Fig1. Karachi hospitals and catchment area from whichblood culture isolates of BCC were randomly selected. Eachhospital has a catchment area of ~ 15 km radius. Pink circledemarcates the catchment area. Inset (above) shows Karachidistricts and inset (below) shows the location of Karachiwithin Pakistan. Hospitals are shown as ‘H’.


also non-susceptible to levofloxacin and meropenem, butremained susceptible to ceftazidime.

Biochemical reactions on API NE did not discriminate amonggenomovars. However, as very few isolates belonged togenomovars other than 1, biochemical profiles and phenotypicsusceptibility patterns were not correlated for discriminatorypower.

DiscussionOur analysis of BCC isolates recovered from neonates providesstrong valuation of the relative frequencies with which respectivegenomovars cause neonatal bacteremia and sepsis. We reportthe dominance of BCC genomovar I among neonatal bacteremiaepisodes in Karachi, Pakistan. Despite their genetic similarity,there is great variation in genomovar-specific diseaseepidemiology in different populations, and in different parts ofthe world, for instance, between CF and non-CF patients.8 Thereason for this could be better adaptation of some species toinfection of the CF lung and vice versa.9

B.cenocepacia(genomovar III) was considered the most commonspecies in CF patients but with the changing epidemiology andimproved infection control measures the rates have declined,making environmentally acquired B. multivorans mostcommonly isolated BCC species from CF patients.8,9 SinceB.cepaciagenomovar I is an environmental species, it is likelythat this organism is transmitted to neonates from the healthcareenvironment. In contrast, B.cenocepacia (genomovar III)prevalence among our neonatal bacteremia cases was low,suggesting either low prevalence in the nosocomial environmentin our setting, or low colonization potential of this genomovaramong neonates. A detailed study of hospital microbiome withspecial reference to BCC can resolve these hypotheses.

BCC is an emerging pathogen and source and transmissibilityof strains involved remain questionable. Molecularcharacterization of bacterial isolates is vital for epidemiologicalbreakdown of bacterial pathogens and subspecies. It has beenhypothesized that the transmissibility varies for differentgenomovars of BCC. While transmission characteristics ofB.cenocepacia and B. multivorans15 have been studied, little isknown about the person-to-person transmission potential ofB.cepaciagenomovar I. Our next steps comprise molecularfingerprinting of B.cepacia genomovar I isolates and sequencingin an effort to demonstrate genetic similarity and determineputative transmission chains among neonates.

BCC infections, especially bacteremia and sepsis also havesignificant impact on clinical outcome of patients. Case fatalityrates of 17-28% among infants have been reported frompopulations where CF is a rare condition.4,16 High mortalityrates can be attributed to limited therapeutic options andemerging antimicrobial resistance (AMR) as well as virulencefactors. BCC virulence factors include flagellar motility,

superoxide dismutase, lipopolysaccharide, and siderophoreproduction factors. Genomovar I strains also produce melaninand exopolysaccharide which may contribute to pathogenicityand virulence. BCC phenotypic AMR profiles in our studyshow high resistance rates against meropenem which iscommonly used in neonatal sepsis. Although resistance ratesagainst ceftazidime and cotrimoxazole remain low, continuousmonitoring of AMR rates in BCC remains essential to captureemerging resistance.

Our study has limitations. BCC strains studies are predominantlyfrom one city and cannot be taken to represent genomovardistribution across other areas of Pakistan or low resourcesettings. We were also unable to correlate bacteremia withtreatment details clinical outcomes as medical records werenot available from all hospitals.

We provide preliminary evidence of epidemic spread of BCCgenomovar I among hospitalized neonates in Karachi, Pakistan.Our study is the first to systematically evaluate BCC genomovardistribution in a neonatal population. Larger prospective studiesare required to investigate and understand transmissibility andpathogenic potential of BCC genomovar with special referenceto the neonatal population.

Acknowledgement and FundingThis work was supported by a seed money grant awarded toTazeen Fatima by the Department of Pathology and LaboratoryMedicine of the Aga Khan University.

References1. Tseng SP, Tsai WC, Liang CY, Lin YS, Huang JW, Chang CY, et al. The

contribution of antibiotic resistance mechanisms in clinicalBurkholderia cepacia complex isolates: an emphasis on efflux pumpactivity. PLoS One 2014 Aug 25; 9(8):e104986.

2. Dizbay M, Tunccan OG, Sezer BE, Aktas F, Arman D. NosocomialBurkholderia cepacia infections in a Turkish university hospital: a fiveyear surveillance. J Infect DevCtries 2009 May; 3(04):273-7.

3. Patra S, Bhat R, Lewis LE, Purakayastha J, Sivaramaraju VV, Mishra S.Burkholderia cepacia sepsis among neonates. Indian J Pediatr 2014 Nov1; 81(11):1233-6.

4. Chandrasekaran A, Subburaju N, Mustafa M, Putlibai S. Profile of neonatalsepsis due to Burkholderia cepacia complex. Indian Pediatr 2016; 53:1109 -10.

5. LiPuma JJ, Dulaney BJ, McMenamin JD, Whitby PW, Stull TL, CoenyeT, et al. Development of rRNA-based PCR assays for identificationof Burkholderia cepacia complex isolates recovered from cystic fibrosispatients. J Clin Microbiol1999 Oct; 137(10):3167-70.

6. LiPuma JJ. Update on the Burkholderia cepacia complex. Curr OpinPulm Med 2005 Nov 1; 11(6):528-33.

7. Bressler AM, Kaye KS, LiPuma JJ, Alexander BD, Moore CM, RellerLB, et al. Risk factors for Burkholderia cepacia complex bacteremiaamong intensive care unit patients without cystic fibrosis: a case-controlstudy. Infect Control Hosp Epid 2007 Aug; 128(08):951-8.

8. Pope CE, Short P, Carter PE. Species distribution of Burkholderia cepaciacomplex isolates in cystic fibrosis and non-cystic fibrosis patients in NewZealand. J Cyst Fibros 2010Dec 31; 9(6):442-6.

9. McClean S, Healy ME, Collins C, Carberry S, O'Shaughnessy L, DennehyR, et al. Linocin and OmpW Are Involved in Attachment of the Cystic Fibrosis-Associated Pathogen Burkholderia cepacia Complex to Lung


Epithelial Cells and Protect Mice against Infection. Infect Immun 2016 May1; 84(5):1424-37.

10. Gautam V, Ray P, Puri GD, Sharma K, Vandamme P, Madhup SK, et al.Investigation of Burkholderia cepacia complex in septicaemic patientsin a tertiary care hospital, India. Nepal Med Coll J 2009 Dec 11; (4):222-4.

11. Qamar S, Noman F, Shamim S, Nadeem A, Ansari N, Chohan N, et al.Investigation of Burkholderia cepacia outbreak in a neonatal intensivecare unit. Inf Dis J Pakistan; 2010; 19:167-71

12. Clinical Laboratory Standards Institute.2015. Performance Standards forAntimicrobial Susceptibility Testing.25th ed. CLSI supplementM100S.Wayne, PA: Clinical and Laboratory Standards Institute.

13. Lambiase A, Del Pezzo M, Cerbone D, Raia V, Rossano F, Catania MR.Rapid identification of Burkholderia cepacia complex species recoveredfrom cystic fibrosis patients using matrix-assisted laser desorption

ionization time-of-flight mass spectrometry. J Microbiol Methods2013;92(2):145-9

14. Mahenthiralingam E, Bischof J, Byrne SK, Radomski C, Davies JE, Av-Gay Y, et al. DNA-based diagnostic approaches for identificationof Burkholderia cepacia complex, Burkholderia vietnamiensis, Burkholderiamultivorans, Burkholderia stabilis, and Burkholderia cepacia genomovarsI and III. J Clin Microbiol 2000 Sep 1; 38(9):3165-73.

15. Turton JF, Kaufmann ME, Mustafa N, Kawa S, Clode FE, PittTL. Molecular comparison of isolates of Burkholderia multivorans frompatients with cystic fibrosis in the United Kingdom. J Clin Microbiol2003;41(12):5750-4.

16. Kim KY, Yong D, Lee K, Kim HS, Kim DS. Burkholderia Sepsis inChildren as a Hospital-Acquired Infection.Yonsei Med J 2016 Jan;57(1):97-102. https://doi.org/10.3349/ymj.2016.57.1.97

ORIGINAL ARTICLE


Health Poems Intervention for Awareness of Polioand Routine Immunization Among Rural Childrenof Pakistan

Jewat Ram(Jewat Sunder)*, Satti Jewat*, Sirajul Haque Shaikh**, Farah Ahmed**, Hassan Danish**

*Department of Medical Education, Sindh United(n) Developmental Educational Rural Society, Rotary Club, Khipro,Sunders, Sindh, Pakistan.**Department of Medical Education, College of Physician & Surgeon, Karachi, Pakistan

Correspondence Author: Jewat Ram,Department of Medical Education, Sindh United(n)Developmental Educational Rural Society, Rotary Club, Khipro,Sunders, Sindh, Pakistan,Email: [email protected]

Abstract

ObjectiveTo evaluate the impact of health poems intervention forawareness of polio and routine immunization among ruralchildren at Sethar Pir District Sanghar.

Materials and MethodsThis was a quasi-experimental trial conducted at Sethar PirDistrict Sanghar from August 2017 to December 2018. Twofifty students of primary schools of age 9-15 years of eithergender were included in the study. The students were approachedduring the free period and the questionnaire (study tool) wasfilled by them in 15-20 minutes. After that the educationalintervention i.e. a health poem regarding the importance ofroutine immunization and polio eradication with schedule ofthe vaccination status written was given in syllabus. The threesession of health poem were given after every week for 21 daysto all the students and the printed materials were pasted on thebooks of the students for further memorization. After completionof three sessions the post intervention data from the same studentsthrough the use of study instrument (which was administeredbefore the intervention) was collected to see impact. SPSS version23 was used to analyze the before and after intervention data.

ResultsTotal of 250 primary students were included in the study. Themean age of students was reported as 13.45±1.21 years. Twohundred and five students were males (82%) and 45 studentswere females (18%). The frequency of adequate awarenessshowed statistically significant increase after the health poemintervention as compared to before (p<0.05).

The health poem intervention was an ideal and innovativemethod to increase the awareness &has shown successful resultsamong primary school going children of District Sanghar.

KeywordsHealth poem intervention, Impact of educational intervention, ruralarea, Primary school, Awareness of polio, Routine immunization

IntroductionChildren under the age of five years are mainly influenced bypolio. One out of every two hundred infected patient maysuffered from irreversible paralysis and 10% of those paralyzeddie due to immobilization of breathing muscles.1Prior to thebeginning of Global Polio Eradication Initiative (GPEI) in1988, poliomyelitis (polio)had killed and paralyzedapproximately 200,000individuals every year.2 Since 1988 theincidence of wild poliovirus have reduced by over 99 percentfrom an estimate of 350,000 cases to 33 cases in 20181. In 1955the integration of the “inactivated poliovirus vaccine” (IPV) resultedin a sharp decrease in transmission of polio virus and in USA thecases of polio decreases approximately to 1000 cases in 1960sfrom 20,000 cases per year in the 1950s.3 Hence, the live-attenuated“oral poliovirus immunization” (OPV) produced in 1963 remainsthe fundamental vaccine in developing world because of its simpleoral administration, cost-viability and relatively better acceptanceof intestinal insusceptibility contrasted with the IPV.4

In 2015, four out of six WHO regions were certified as polio-free, hence Pakistan, Nigeria and Afghanistan are the onlyremaining countries where polio is endemic.5 The major factorsassociated with increase in wild polio virus in these countriesare religious misconception, illiteracy, insecurity and conflictwhich have highly affected the vaccination attempts and effortsmade by GPEI.6 Due to these factors the outbreak of thirty sixpolio cases have been reported in Syria and the isolation oftype 1 wild poliovirus, traced to Pakistan, from sewage samplesin Israel towards the end of 2013.7,8 Therefore, the effectiveeradication of wild poliovirus therefore rests on Pakistan’simmunization plan and approach. 9

In Pakistan, the investment on Expanded Programme onImmunizations (EPI) programme is important to attain theeradication of polio. Furthermore, concerns and misconceptionsregarding vaccination and inaccessibility to EPI centers are themain causes of refusal.10-12 The slums of Karachi and northwestPakistan are the high risk regions for poliovirus, however thepolio workers have been attacked by extremist groups andPakistani Taliban to stop and ban polio vaccination activitiesin these areas.13 Therefore Pakistan is facing many challengesin health issues like routine immunization and polio eradication.


The incidence of polio has increased from 58-306 cases during2012 to 201414, and low frequency of immunization coverage(56%) has been observed which is directly related to the highestIMR (infant mortality rate) among South Asian countries.15

The major cause of low immunization coverage & unsuccessfulpolio eradication programme in Pakistan is “awareness deficit”.Educational institutes provide the logical place to intervenehealth education in order to fill the gap and increase awarenessregarding good health status. The school going children areconsidered as primary target audience for health education andpromotion through class room activities, curricula and training.Hence, the innovative educational interventions are of dire needwhich may lead to some improvements in the setup of healthand education in Pakistan especially in rural areas where loweducation is the main reason of inadequate awareness regardingpolio and routine immunization. So, the aim of current researchwas to evaluate the impact of health poems intervention forawareness of polio and routine immunization among rural(desert) children at Sethar Pir, District Sanghar. This innovativeactivity of educational intervention with health poems wouldbe helpful for school children of age 9-15 years in developingbetter understanding for importance of immunization whichwould lead to positive society’s attitude towards immunizationin future generation as well as for community in order to makethem aware and educate, advocate and counsel about theimportance of immunizations and eradication of polio in Pakistan.

Material & MethodsThis was aquasi-experimental trial conducted at Sethar Pir,District Sanghar from August 2017 to December 2018. Total250 students of age 9-15 years of either gender were enrolledin the study. Mentally incapacitate and who didn’t want toparticipate were excluded from the study. The two-stage samplingwas employed. In the first stage of sampling, the list of allpublic primary schools were obtained from union council officeand three public primary schools of Sethar Pir, District Sangharwere selected randomly out of 68 schools through lotterymethod. In the second stage of sampling the registration numbers(Roll no.) of all the students were obtained from the school’sprincipals of those 3 primary schools and 50 students wereselected randomly from five classes [100 students from 2primary schools (4 classes) and 50 from one primary school (1class)] through lottery method. (Fig 1)

Written permission was taken from the principals of participatingschools whereas informed consent and assent were taken fromthe parents and students before the conduct of study.

The students were approached during the free period and thequestionnaire (study instrument) were filled by them in 15-20minutes. The students of same class level and caliber from allthree public primary schools were selected. The principalinvestigator was present at the time of data collection in orderto solve any query. After that the educational intervention i.e.

a health poem regarding the importance of routine immunization(the poem was in Sindhi language) and polio eradication withschedule of the vaccination status written in Sindhi was givenin syllabus. The three session of health poem were given afterevery week for 21 days to all the students and the printedmaterials were pasted on the books of the students for furthermemorization. After completion of three sessions the postintervention data from the same students through the use ofstudy instrument (which was administered before theintervention) was collected to see impact.

Study instrumentThe questionnaire was made after the intensive literature searchand validity of questionnaire was checked (Cronbach’s =0.86).The questionnaire contained two parts. In the first partdemographics details of students such as age and gender werenoted. In the second part 13 questions regarding the awareness ofpolio and routine immunization were asked (Table 1). Every correctresponse was given score as “1”. Impact was deemed positive interms of adequate awareness. Seven or above correct responsesout of 13 responses was labelled as adequate awareness.

SPSS version 23 was used to analyze the data. Frequencies andpercentages were calculated for qualitative variables whereasmean and SD were calculated for quantitative variables.Mcnamer’s test was applied to see the before and afterintervention impact of health poems. P=0.05 was taken asstatistically significant.

ResultsTotal of 250 primary students were included in the study. Themean age of students was reported as 13.45±1.21 years. Twohundred and five students were males (82%) and 45 studentswere females (18%).

The descriptive of all the responses before and after interventionof health poem are summarized in table 1. (Supplement file)Before intervention, almost all the students had inadequateawareness (97.2%) and only 2.8% had adequate awareness.After intervention, about 200 students had adequate awareness(80%) and 20% had inadequate awareness. (Fig 2)

Total 243 students had inadequate awareness pre intervention.

Fig 1. Selection of Students (n=250)


S.No. Questions Responses Correct Response

1 What is polio? A. DiseaseB. Dangerous diseaseC. Simple diseaseD. None of above

2 What happen in polio? A. Mostly disability of armsB. Mostly disability of legsC. Mostly disability of arm & legD. None of above

3 How many drops given? A. OneB. TwoC. ThreeD. Four

4 Up to what age polio drops given? A. Up to-one yearB. Two yearC. Three yearD. Five year

5 Where is mark of identification regarding polio-vaccination? A. On thumbB. On index fingerC. Middle fingerD. Little finger

6 What is routine immunization? A. Vaccination of adultsB. Vaccination of only mothersC. Vaccination of childrenD. None of the above

7 How many diseases covered in routine immunization? A. FiveB. SevenC. NineD. Eleven

8 Name the first vaccine? A. BCG onlyB. BCG+polioC. Only polioD. None of above

9 When first dose routine vaccine given? A. After one monthB. After one & half monthC. After two monthD. After three month

10 When second dose routine vaccine given? A. After one monthB. After one & half monthC. After two monthD. After three month

11 When third dose routine vaccine given? A. After one monthB. After one & half monthC. After two monthD. After three month

12 When first dose of measles given? A. Five monthB. Seven monthC. Nine monthD. Eleven month

13 When second dose of measles given? A. Seven monthB. Nine monthC. Eleven monthD. Fifteen month

B

B

B

D

D

C

B

D

B

D

C

D

C

Table 1: Questionnaire Part 2 (Supplement File)


Out of 243 students, unaware students 80% achieved score foradequate knowledge on polio and immunization. This showsmore positive impact than negative impact of health poems.The proportion of adequate awareness after intervention ofhealth poem showed statistically significant increase as comparedto before (p<0.05). (Table 2)

DiscussionPolio is viral infection which mostly affect sunder 5 years oldchildren.16 According to WHO report Pakistan is one theremaining country where polio is endemic.5The healthprofessionals are still working on eradication of polio inPakistan.17 One of the most adequate and reliable approach foreradication and prevention of polio virus and other infectiousdiseases is immunization.18 However, in Pakistan low frequencyof immunization coverage (56%) has been observed which isdirectly related to the highest IMR (infant mortality rate) amongSouth Asian countries.15 The main cause of low immunizationcoverage & unsuccessful polio eradication programme inPakistan is “awareness deficit”, whereas other causes are falsetraditional and religious beliefs, maternal education, poverty,inaccessibility to EPI centers, lack of political will & securityrisk of health workers.13,19, 20

Certain medicines and treatments are available for polio illnessbut the consequent quantity of information is also importantfor the society, many studies have recorded a lack ofunderstanding of polio virus among the individuals ofPakistan.21It has been observed that schools and other educationalinstitutes provide the logical place to intervene health educationin order to improve their health status. The school going childrenare considered as primary target audience for health educationand promotion through class room activities, curricula andtraining. So, the aim of current research was to evaluate theimpact of health poem interventions regarding polio and routineimmunization among rural (desert) children of Pakistan.In the current research, before intervention the frequency ofinadequate awareness was very high among students as 97.2%,23.2% of them knew that polio is a dangerous disease, 24% ofthem knew about the routine immunization and18.4% of themknew about the target age group for routine immunization and.After health poem intervention the awareness regarding polioand immunization increased and 73.6% of them become aware

that polio is a dangerous disease, 55.2% of them become awareabout routine immunization and 55.6% of them become awarethat the target age group for immunization is up to 5 years.There is lack of literature available regarding interventionamong children however various studies has been conductedto assess the level knowledge of parents and adults regardingpolio and immunization. In the study conducted at Karachiassess the impact of health education messages regardingvaccine and the immunization status of children under five inmothers, study showed significant increased from 60% to 77%in mother’s awareness regarding the target age of first vaccinationafter intervention.20 In the study conducted at the 2 semi-urbanregions of India, showed 90% knew about the purpose of poliovaccine was to eradicate polio, furthermore educational statusshowed positive association with their level of awareness(p<0.05).22 In another study conducted at the Dehli slums,showed 56% of the participants have some information regardingpolio and 82% of them knew that 0-5 years is the target agegroup for oral polio vaccine.23 The study conducted amongPashtun parents residing in Karachi showed 41% had not everheard about polio,11 where as another study conducted at Nigeriashowed 65.4% had good knowledge paralytic poliomyelitisand showed statistical significance with higher educationalstatus (p<0.05).24

The written pamphlets regarding the vaccine uptake, othereducational and informational intervention and social mediacampaigns have been observed as successful strategies toimprove and promote health education regarding polioeradication and routine immunization among different agegroups.25-28 In the study conducted at Malaysia, evaluated theimpact of a short educational intervention on improvingawareness of parents regarding childhood immunization. Thestudy showed significant increase in parent’s awareness postintervention as compared to before (p<0.05).29 In another studyconducted England included a cohort of young individuals anddivided them into three groups i.e. group A received presentation-based intervention, group B received interactive simulation-based intervention and Group C received no intervention andfound both intervention groups have showed slightly positiveshift in attitude and knowledge of vaccination whereas thecontrol group has moved to a more sympathetic position.30 Inthe present research out of 250 students two forty three studentswho were initially unaware regarding the polio and routineimmunization. After giving health poem intervention theirawareness level dramatically shift and 195 students adequatelybecome aware regarding the polio and routine immunization(80.2%) which showed statistically significant increase (p<0.05)as compared to before. This shown that students have learnedhealth poems with interest which brought the change in theirawareness regarding polio and routine immunization.

Hence health poem intervention showed positive impact andit can be an effective methodology in order to change knowledgeof students. Schools should introduce different health programs

Fig 2. Awareness Shift after Health Poem Intervention


S.No. Questions Responses n % n %

1. What is polio? A. Disease 72 28.8 30 12.0B. Dangerous disease 58 23.2 184 73.6C. Simple disease 67 26.8 22 8.8D. None of above 53 21.2 14 5.6

2. What happen in polio? A. Mostly disability of arms 38 15.2 28 11.2B. Mostly disability of legs 96 38.4 149 59.6C. Mostly disability of arm & leg 66 26.4 37 14.8D. None of above 50 20.0 36 14.4

3. How many drops given? A. One 51 20.4 29 11.6B. Two 74 29.6 206 82.4C. Three 72 28.8 3 1.2D. Four 53 21.2 12 4.8

4. Up to what age polio drops given? A. Up to-one year 65 26.0 37 14.8B. Two year 79 31.6 36 14.4C. Three year 60 24.0 38 15.2D. Five year 46 18.4 139 55.6

5. Where is mark of identificationregarding polio-vaccination? A. On thumb 37 14.8 9 3.6

B. On index finger 80 32.0 32 12.8C. Middle finger 75 30.0 31 12.4D. Little finger 58 23.2 178 71.2

6. What is routine immunization? A. Vaccination of adults 50 20.0 24 9.6B. Vaccination of only mothers 83 33.2 52 20.8C. Vaccination of children 60 24.0 138 55.2D. None of the above 57 22.8 36 14.4

7. How many diseases covered inroutine immunization? A. Five 58 23.2 12 4.8

B. Seven 111 44.4 39 15.6C. Nine 35 14.0 35 14.0D. Eleven 46 18.4 164 65.6

8. Name the first vaccine? A. BCG only 32 12.8 27 10.8B. BCG+polio 71 28.4 152 60.8C. Only polio 82 32.8 33 13.2D. None of above 65 26.0 38 15.2

9. When first dose routine vaccine given? A. After one month 61 24.4 28 11.2B. After one & half month 30 12.0 138 55.2C. After two month 87 34.8 44 17.6D. After three month 72 28.8 40 16.0

10. When second dose routine vaccine given? A. After one month 52 20.8 29 11.6B. After one & half month 60 24.0 42 16.8C. After two month 76 30.4 147 58.8D. After three month 62 24.8 32 12.8

11. When third dose routine vaccine given? A. After one month 69 27.6 16 6.4B. After one & half month 94 37.6 23 9.2C. After two month 27 10.8 89 35.6D. After three month 60 24.0 122 48.8

12. When first dose of measles given? A. Five month 58 23.2 21 8.4B. Seven month 88 35.2 32 12.8C. Nine month 41 16.4 170 68.0D. Eleven month 63 25.2 27 10.8

13. When second dose of measles given? A. Seven month 64 25.6 38 15.2B. Nine month 78 31.2 30 12.0C. Eleven month 66 26.4 26 10.4D. Fifteen month 42 16.8 156 62.4

Table 2: Descriptives of Questions Regarding Polio and Immunization Status

AfterIntervention

BeforeIntervention


which can be helpful in improving health status of children andcommunity. Furthermore different comparative studies shouldbe conducted in which different health interventions should becompared between urban and rural primary/secondary schools.In this way we can be able to find out the gaps and barriersregarding the low awareness between urban and rural schoolgoing children.

ConclusionThe health poem intervention was an ideal and innovativemethod to increase awareness and has shown successful resultsamong primary school going children of District Sanghar.

References1. WHO. Poliomyelitis: World Health Organization; 2019 [cited 2019 7-

Jul]. Available from: https://www.who.int/news-room/fact-sheets/detail/poliomyelitis.

2. Bhutta ZA. The last mile in global poliomyelitis eradication. Lancet2011;378(9791):549-52.

3. Orenstein WA. Eradicating polio: how the world's pediatricians can helpstop this crippling illness forever. Pediatrics 2015;135(1):196-202.

4. Salk D. Eradication of poliomyelitis in the United States. II. Experiencewith killed poliovirus vaccine. Rev Infect Dis 1980;2(2):243–57. doi:10.1093/clinids/2.2.243.

5. Nadeem NJ. The Global Polio Eradication Initiative (GPEI) in Pakistan.J Pak Med Assoc 2016;66(11):1466-71.

6. SteelFisher GK, Blendon RJ, Guirguis S, Brule A, Lasala-Blanco N,Coleman M, et al. Threats to polio eradication in high-conflict areas inPakistan and Nigeria: a polling study of caregivers of children youngerthan 5 years. Lancet Infect Dis 2015;15(10):1183-92.

7. Kopel E, Kaliner E, Grotto I. Lessons from a public health emergency-importation of wild poliovirus to Israel. N Engl J Med 2014;371(11):981-3.

8. Bencsko G, Ferenci T. Effective case/infection ratio of poliomyelitis invaccinated populations. Epidemiol Infect 2016;144(9):1933-42.

9. Hussain SF, Boyle P, Patel P, Sullivan R. Eradicating polio in Pakistan:an analysis of the challenges and solutions to this security and healthissue. Globalization and health 2016;12(1):63.

10. Owais A, Khowaja AR, Ali SA, Zaidi AK. Pakistan's expanded programmeon immunization: an overview in the context of polio eradication andstrategies for improving coverage. Vaccine 2013;31(33):3313-9.

11. Khowaja AR, Khan SA, Nizam N, Omer SB, Zaidi A. Parental perceptionssurrounding polio and self-reported non-participation in poliosupplementary immunization activities in Karachi, Pakistan: a mixedmethods study. Bull World Health Organ 2012;90(11):822-30.

12. Siddiqui NT, Owais A, Agha A, Karim MS, Zaidi AK. Ethnic disparitiesin routine immunization coverage: a reason for persistent polioviruscirculation in Karachi, Pakistan? Asia Pacific J Public Health 2014Jan;26(1):67-76.

13. Alexander JP, Jr., Zubair M, Khan M, Abid N, Durry E. Progress andperil: poliomyelitis eradication efforts in Pakistan, 1994-2013. J Infect

Dis 2014;210 Suppl 1:S152-61.14. Habib MA, Soofi S, Cousens S, Anwar S, Haque NU, Ahmed I, et al.

Community engagement and integrated health and polio immunisationcampaigns in conflict-affected areas of Pakistan: a cluster randomisedcontrolled trial. Lancet Glob Health. 2017 Jun;5(6):e593-e603. doi:10.1016/S2214-109X(17)30184-5. Erratum in: Lancet Glob Health. 2017Aug;5(8):e758. Erratum in: Lancet Glob Health. 2017 Sep;5(9):e873.PMID: 28495264; PMCID: PMC5439031.

15. Wazir HK. Low immunisation coverage causes high IMR: Pakistan Today;2017 [cited 2019 10-Jul]. Available from: https://www.pakistantoday.com.pk/2017/04/29/low-immunisation-coverage-causes-high-imr/.

16. Cohen JI: Enteroviruses and retroviruses. Harrison’s principles of internalmedicine 16th edition 1144–1146. Edited by: Kasper DL, Braunwald E,Fauci AS. 2004, McGraw-Hill Professional.

17. EPI. Polio: Expanded Programme on Immunisation; 2018 [cited 2019 10Jul]. Available from: http://www.epi.gov.pk/vaccine-preventable-diseases/polio/.

18. Lucas AO, Gilles HM: Short textbook of Public Health for the Tropics.2003, Malta Book Power, 105-107. 3.

19. Imran H, Raja D, Grassly NC, Wadood MZ, Safdar RM, O'Reilly KM.Routine immunization in Pakistan: comparison of multiple data sourcesand identification of factors associated with vaccination. Int Health. 2018Mar 1;10(2):84-91. doi: 10.1093/inthealth/ihx067. PMID: 29432552;PMCID: PMC5856161.

20. Anjum Q, Omair A, Inam SN, Ahmed Y, Usman Y, Shaikh S. Improvingvaccination status of children under five through health education. J PakMed Assoc 2004;54(12):610-3.

21. Khan MU, Ahmad A, Aqeel T, Akbar N, Salman S, Idress J. A CrossSectional Survey of Healthcare Workers on the Knowledge and Attitudestowards Polio Vaccination in Pakistan. PLoS One 2015;10(11):e0142485.

22. Joseph N, Subba Sh, Nelliyanil M, Kotian S, Haridath A, N K, AttavarS, P P, Rane D, H C, J H. A study of the knowledge and attitude towardspulse polio immunization in semi urban areas of South India. AustralasMed J. 2011;4(2):81-6. doi: 10.4066/AMJ.2011.532. Epub 2011 Feb 28.PMID: 23386884; PMCID: PMC3562928.

23. Misra P, Goswami A, Pandav CS. A study of the perception, communicationand coverage of pulse polio immunization programme in a Delhi slum.Indian J Public Health 2004;48(4):216-7.

24. Ogwumike OO, Kaka B, Adeniyi AF. Children with paralytic poliomyelitis:a cross-sectional study of knowledge, attitudes and beliefs of parents inZamfara state, Nigeria. BMC Public Health 2012;12(1):888.

25. Kaufman J, Synnot A, Ryan R, Hill S, Horey D, Willis N, et al. Face toface interventions for informing or educating parents about early childhoodvaccination. The Cochrane database of systematic reviews. 2013(5):Cd010038.

26. Saeterdal I, Lewin S, Austvoll-Dahlgren A, Glenton C, Munabi-BabigumiraS. Interventions aimed at communities to inform and/or educate aboutearly childhood vaccination. The Cochrane database of systematic reviews.2014(11): Cd010232.

27. Sadaf A, Richards JL, Glanz J, Salmon DA, Omer SB. A systematicreview of interventions for reducing parental vaccine refusal and vaccinehesitancy. Vaccine 2013;31(40):4293-304.

28. Odone A, Ferrari A, Spagnoli F, Visciarelli S, Shefer A, Pasquarella C,et al. Effectiveness of interventions that apply new media to improvevaccine uptake and vaccine coverage. Hum Vaccin Immunother2015;11(1):72-82.

29. Awadh AI, Hassali MA, Al-Lela OQ, Bux SH, Elkalmi RM, Hadi H.Does an educational intervention improve parents' knowledge aboutimmunization? Experience from Malaysia. BMC Pediatr 2014;14:254.

30. Carolan K, Verran J, Crossley M, Redfern J, Whitton N, Amos M. Impactof educational interventions on adolescent attitudes and knowledgeregarding vaccination: A pilot study. PLoS One 2018;13(1):e0190984.

Table 3: Comparison of Adequate Awareness Before andAfter Health Poem Intervention

Before Adequate Inadequate Total

Adequate 5 (71.4%) 2 (28.5%) 7Inadequate 195 (80.2%) 48 (19.8%) 243

After

0.0001

P-value


CASE REPORT

Corresponding Author: Salima Qamar,National Medical Centre, Karachi, PakistanEmail: [email protected]

Salmonella Paratyphi A infection of a Thyroid Cyst

Salima Qamar*, Seema Irfan**

*National Medical Centre, Karachi, Pakistan**Section Microbiology, Aga Khan University Hospital, Karachi, Pakistan

AbstractWe report a case of infected thyroid cyst with SalmonellaParatyphi A in 64 years old patient who presented with shorthistory of fever and neck pain. Ultrasound neck showed thyroidcyst for which fine needle aspiration was done. Culture ofaspirated fluid grew Salmonella Paratyphi A. Patient was treatedsuccessfully with Ceftriaxone. Blood or other site cultures werenot sent so source of origin could not be determined. Suppurativeinfections of thyroid gland are uncommon1 due to high levelsof iodine within the gland however, in rare cases thyroid glandmay get infected in case of underlying thyroid disorders likeneoplastic or autoimmune diseases.2 In current case, nounderlying thyroid related abnormality was found. Based onshort duration of illness found in case history, this case appearsas an example of acute thyroiditis caused by SalmonellaParatyphi A. In conclusion, infectious thyroiditis caused bySalmonella Paratyphi A is rare and may be encountered inpatients with or without prior comorbid or immunosuppression.

IntroductionSalmonella Paratyphi A belongs to genus Salmonellae whichcontains various species associated with a variety of humanand animal infections. In most instances, Salmonella ParatyphiA is associated with enteric fever or gastroenteritis in humanpopulation. However, there are case reports where it has beenisolated in other body sites like splenic and liver abscesses.3

Thyroid gland is usually very resistant to infections due topresence of high levels of iodine present within the gland.1

Thyroid cysts may get infected and present as thyroiditis. Herewe report a case of thyroid cyst which was infected withSalmonella Paratyphi A.

CaseA 64-year-old man, with a background history of hypertensionand Meniere’s disease presented to the emergency department(ED) of a tertiary are hospital with complains of neck pain andfever for few days. Neck examination didn’t reveal any palpableswelling. At the time of presentation, his hemoglobin was10.2g/dl, total leukocyte count of 10.1 with neutrophilicpredominance of 76%. His Thyroid Stimulating hormone (TSH)level was identified as 0.252 ulU/ml. Consideringthe possibilityof one of deep neck space infections, intravenous ceftriaxonewas started in ED. Ultrasound neck showed a cystic nodule

measuring about 3.6 x 5 cm in right lobe of thyroid gland,therefore ultrasound guided aspiration of 33 ml fluid wasperformed and sent for culture and sensitivity. Blood culturesand stool cultures were not sent. He remained in ED for a dayand then got discharged in stable condition.

His thyroid fluid was received in microbiology departmentwhich showed few pus cells, numerous RBCs and few Gramnegative rod (GNR) on Gram stain. After 24 hours of incubation,all three types of culture plates (Sheep blood agar, Chocolateagar and MacConkey’s agar) showed growth of single type ofGNR. On MacConkey’s agar these GNR were grown as non-lactose fermenter. On initial testing this isolate was found motileand its oxidase test was found negative. As a routine laboratoryprotocol, identification conventional biochemical analysis wasused for identification. On triple sugar iron slant, alkaline overacid reaction was observed. This GNR showed no HydrogenSulphide and Indole production. This isolate also did not showCitrate utilization or production of ammonia from hydrolysisof urea slant. Keeping in consideration above reactions, GNRisolate was tested against Salmonella antisera that turned outpositive for Salmonella polyvalent (A-I &Vi Becton, Dickinson)and factor 2 antisera (Becton, Dickinson). Identification ofisolate was further confirmed using API 20E system whichidentified the strain as Salmonella Paratyphi A. Its’ drugsusceptibility was performed by Kirby Bauer disk diffusionmethod on Muller Hinton agar that showed strain to be sensitiveto Ampic i l l in (10ug) , Chloramphenico l (30ug) ,Ceftriaxone(30ug), Cefixime (5ug), Trimethoprim-Sulfamethoxazole (25ug) while intermediate sensitivity toCiprofloxacin (5ug). Susceptibilities to above antibiotics wereconfirmed using Vitek-2 system (BioMerieux, France).

DiscussionUsually, thyroiditis caused by an infectious etiology is associatedwith acute presentation and is known as acute infectiousthyroiditis or suppurative thyroiditis. It is most commonlyencountered in children with pyriform sinus fistula. Etiologicalagents include bacteria such as Staphylococcus aureus, ,Staphylococcus epidermidis, and . Gram negative bacteria likeEnterobacteriacae, Hemophilus species, Ekinella and Kingellaspecies can also cause thyroid infection but not common. Inadults, infection usually follows upper respiratory tract infections,or may be associated with underlying thyroid disorders likeneoplastic thyroid nodule, subacute thyroiditis, Hashimoto’sthyroiditis or penetration of thyroid gland with foreign body.Thyroid gland infection secondary to Salmonella species is


rare. Non typhoidal strains are more common culprits ascompared to typhoidal strains. In 2014, Kuzu et al reportedisolation of non typhoidal Salmonella species in a fifty yearold female with no prior comorbids.4 Similarly, in 2002 Su DHet al reported acute suppurative thyroiditis caused by Salmonellatyphimurium in a 79 year old female which may be secondaryto bacteremia.5 In 2003, Dai MS et al reported Salmonellagroup B thyroiditis in 82 year old male with chronic lymphocyticleukemia.5 Another case report Maraj et al in 2013 reported acase of 48 year old HIV positive woman with Salmonellaspecies suppurative thyroiditis.7

There have been many case reports where Salmonella ParatyphiA had been isolated from other sites like breast abscess, liverabscess and tubo-ovarian abscess.3, 8,9,10 Majority of reportedcases are due to complication of enteric fever caused bySalmonella Paratyphi (Paratyphoid fever). Literature reviewrarely shows acute thyroiditis/abscess caused by SalmonellaParatyphi A, without proven or probable case history of entericfever. Literature review identified only two published cases ofSalmonella Paratyphi thyroid and neck abscess, reported in1989 and 2012 respectively. In both cases authors could notidentified correlation of thyroid infection with enteric fever asboth cases had fever of less than a week duration and bloodcultures yielded nothing.11, 12

In our patient, blood cultures and stool cultures were notrequested. However, based on short duration of fever and currentillness, this case appears as an example of acute thyroiditiscaused by Salmonella Paratyphi A.

ConclusionInfectious thyroiditis caused by Salmonella Paratyphi A is rare

and may be encountered in patients with or without priorcomorbid or immunosuppression.

References1. Tien KJ, Chen TC, Hsieh MC, Hsu SC, Hsiao JY, Shin SJ, Hsin SC.

Acute suppurative thyroiditis with deep neck infection: a case report.Thyroid. 2007 May 1;17(5):467-9.

2. Chaudhry R, Mahajan RK, Diwan A, Khan S, Singhal R, Chandel DS,Hans C. Unusual presentation of enteric fever: three cases of splenic andliver abscesses due to Salmonella typhi and Salmonella paratyphi A.Trop Gastr. 2003;2:198-99

3. De Sousa RF, Amonkar D, Mervyn C. Thyroid Abscess with CutaneousFistula: Case Report and Review of the Literature. Thyroid Science.2008;3(11):CR1–4

4. Kuzu F, Arpaci D, Acar FZ, Tikanak SP, Cakmak GK, Celebi G, Comert F, Uygun SI, Bayraktaroglu T. A case of suppurative thyroiditis caused

by Salmonella presented with thyrotoxicosis. Indian J Med Microbiol2016;34:266-7

5. Su DH, Huang TS. Acute suppurative thyroiditis caused by Salmonellatyphimurium: a case report and review of the literature. Thyroid. 2002Nov 1;12(11):1023-7.

6. Dai MS, Chang H, Peng MY, Ho CL, Chao TY. Suppurative salmonellathyroiditis in a patient with chronic lymphocytic leukemia. Ann Hematol.2003 Oct;82(10):646-8.

7. Maraj A, Kiss A, Luvhengo TE. Case Report: Salmonella thyroiditis: Acase report and review of the literature. S Afr J Surg. 2013;51(4):149-50.

8. Sood S. Breast abscess by Salmonella Paratyphi A: case report andliterature review. J Clin Diagn Res. 2015 Sep;9(9):DD03-4.

9. Leiberman A, Tovi F, Barki Y, Alkan M. Salmonella neck abscessassociated with jugular vein thrombosis. J Laryngol Otol. 1991Nov;105(11):966-7.

10. Farrant M, Bhally H. Salmonella paratyphi A-infected ovarian cyst inreturning traveller-an unusual complication of enteric fever. N Z Med J.2014 Aug 29;127(1401):111-4

11. Behera B, Goud J, Kamlesh A, Thakur YK. Salmonella paratyphi neckabscess. J Glob Infect Dis. 2012 Jan;4(1):89. doi: 10.4103/0974777X.93770. PMID: 22529636; PMCID: PMC3326968.

12. Fule RP, Saoji AM. Isolation of Salmonella paratyphi A from thyroidabscess--a case report. Indian J Med Sci. 1989 Apr; 43(4):95-6.


INSTRUCTIONS FOR AUTHORS

AbstractAbstract should not exceed 250 words and must be structuredin to separate sections headed Background, Methods, Resultsand Conclusions.

Please do not use abbreviations or cite references in the abstract.A short list of four to five key words should be provided tofacilitate.

BackgroundThe section must clearly state the background to the researchand its aims. Controversies in the field should be mentioned.The key aspects of the literature should be reviewed focusingon why the study was necessary and what additional contributionwill it make to the already existing knowledge in that field ofstudy. The section should end with a very brief statement ofthe aims of the article.

Materials and MethodsPlease provide details of subject selection (patients orexperimental animals). Details must be sufficient to allow otherworkers to reproduce the results. The design of study and detailsof interventions used must be clearly described. Identify preciselyall drugs and chemicals used, including generic name(s) androute(s) of administration All research carried out on humansmust be in compliance with the Helsinki Declaration, andanimal studies must follow internationally recognized guidelines.The authors are expected to include a statement to this effectin the Methods section of the manuscript. A description of thesample size calculation and statistical analysis used should beprovided.

ResultsPresent results in logical sequences in the text, tables andillustrations. Articles can have a maximum of 5 illustrations(in a combination of figures and tables) per article. The resultsshould be in past tense and repetition of results presented inthe tables should be avoided. Exact P-values should be reportedalong with reporting of OR and RR with their ConfidenceIntervals where applicable.

DiscussionEmphasize the new and important aspects of the study andconclusions that follow from them. Do not repeat the detailsfrom the results section. Discuss the implications of the findingsand the strengths and limitations of the study. Link theconclusions with the goals of the study but avoid unqualifiedstatements and conclusion not completely supported by yourdata.

AcknowledgmentsAcknowledge any sources of support, in the form of grants,equipment or technical assistance. The source of funding (ifany) for the study should be stated in this section. Please seebelow for format of References, Figures and Tables.

Instructions to Authors

ScopeThe Infectious Diseases Society of Pakistan sponsors theInfectious Disease Journal of Pakistan (IDJ). The Journal acceptsOriginal Articles, Review Articles, Brief Reports, Case Reports,Short Communications, Letter to the Editor and Notes andNews in the fields of microbiology, infectious diseases, publichealth; with laboratory, clinical, or epidemiological aspects.

Criteria for publicationAll articles are peer reviewed by the IDSP panel of reviewers.After that the article is submitted to the Editorial Board. Authorsmay submit names and contact information of 2 persons whopotentially could serve as unbiased and expert reviewers fortheir manuscript, but IDSP reserves the right of final selection.

Submission of the ManuscriptManuscripts must be formatted according to submissionguidelines given below, which are in accordance with the“Uniform Requirements for Manuscripts Submitted toBiomedical Journals” (originally published in N Engl J Med1997;336:309-15). The complete document appears atwww.icmje.org. Please submit one complete copy of themanuscript and all enclosures to The Managing Editors,Infectious Diseases Journal of Pakistan, Department ofPediatrics & Child Health, The Aga Khan University,Stadium Road, P.O. Box 3500, Karachi 74800, Pakistan.An electronic copy of the manuscript must also be sent [email protected]. All manuscripts submitted to IDJP mustbe accompanied by an Authorship Declaration stating that ‘Theauthors confirm that the manuscript, the title of which is given,is original and has not been submitted elsewhere. Each authoracknowledges that he/she has contributed in a substantial wayto the work described in the manuscript and its preparation’.Upon submission a manuscript number will be assigned whichshould be used for all correspondence.

Manuscript Categories

I. Original ArticlesArticles should report original work in the fields of microbiology,infectious disease or public health.The word limit for originalarticles is 2000.

Title pageThis should list the (i) title of the article, (ii) the full names ofeach author with highest academic degree(s), institutionaladdresses and email addresses of all authors. (iii) Thecorresponding author should also be indicated with his/her name,address, telephone, fax number and e-mail address. (iv) A shortrunning title of not more than 40 characters (count letters andspaces) placed at the foot end of the title page.(v) a conflict ofinterest statement should also be included in this section.

II. Review ArticlesAuthoritative and state of the art review articles on topicalissues are also published, with a word limit of 2000. It shouldconsist of critical overview of existing literature along withreference to new developments in that field. These should becomprehensive and fully referenced. Articles should containan Abstract; Main Text divided into sections, Conclusions andReferences.

III. Brief ReportsShort clinical and laboratory observations are included as BriefReports. The text should contain no more than 1000 words,two illustrations or tables and up to 10 references.

IV. Case ReportsInstructive cases with a message are published as case reports.Routine syndromes or rare entities without unusual or newfeatures are invariably rejected. The text should contain nomore than 1000 words, two illustrations or tables and up to 10references. The authorship should not exceed 3-4 persons.

V. Letter to the EditorThese may relate to material published in the IDJP, topic ofinterest pertaining to infectious diseases, and/or unusual clinicalobservations. A letter should not be more than 300 words, onefigure and 3-5 references.

VI. News and ViewsInformative, breaking news updates in infectious diseases fromaround the world (approx. 200 words).

VII. NoticesAnnouncements of conferences, symposia or meetings may besent for publication at least 12 weeks in advance of the meetingdate. Details of programs should not be included.

ReferencesNumber references consecutively in the order in which theyare first mentioned in the text. Identify references in text, tablesand legends by Arabic numerals (in superscript). Referencescited only in tables or in legends to figures should be numberedin accordance with a sequence established by the firstidentification of the particular table or illustration. Bibliographyshould be given in order. Authors, complete title, journal name(Abbr), year, vol, issue, page numbers. According to “Uniform

Requirements of Manuscripts submitted to Biomedical Journals”,as cited in N Engl J Med 1997; 336:309-15.

Tables and FiguresData reported either in a table or in a figure should be illustrativeof information reported in the text, but should not be redundantwith the text. Each table must be presented on a separate sheetof paper and numbered in order of appearance in the text. Tableshould be numbered consecutively in Arabic numerals. Tablesand Figures legends should be self-explanatory with adequateheadings and footnotes.Results which can be described as shortstatements within the text should not be presented as figuresor tables.

IllustrationsIllustrations should be numbered, given suitable legends andmarked lightly on the back with the author’s name and the topedge indicated. Original drawings may be submitted althoughhigh quality glossy photographs are preferable. They shouldbe kept separate from the text. If possible, figures should besubmitted in electronic format as either a TIFF (tagged imagefile format) or JPEG format. Minimum resolution for scannedartwork is:

v Black& white line illustration (e.g. graphs): 600 dpiv Black & white halftone illustrations (e.g. photographs):

300 dpiv Color illustrations: 400 dpi (note that color images should

be split CMYK not RGB)

PlagiarismAuthors should refrain from plagiarism and should doublecheck their work before submitting it for publication. Adequatereferences should be provided for text from other sources.

Authorship criteriaThose who have contributed sufficiently to the conceptualization,design, collection and analysis of data and writing of themanuscript should be granted authorship. Ideally all authorsshould be from the same department except for studies that aremulti center or multispecialty.

Instructions updated - April 2012.Editor IDJ



MEMBERSHIP APPLICATION FORM

Name

Residencial Address

Institute

Section / Department

Phone Res./ Cell Off.

E-mail

Field of Interest

DateSignature

Qualification for Full Membership:

MEMBERSHIPAPPLICATION FORM

DVM

Other

Pharma. D

MBBS

On-line Account No: 0024-20001912322Infectious Diseases Society of Pakistan.Soneri Bank. Aga Khan University Branch, Karachi.

Note: Please attach the Bank deposit slipwith the filled form.

Designation

Qualification for Associate Membership:MScBSc M. Phil Ph. D DCH

Other qualification Speciality

Speciality

Life Time Membership Fee:

Full Member : Rs. 5,000/- for ConsultantsRs. 3,000/- for others

Associate Member : Rs. 3,000/-

Overseas Member: US $. 100/-

MEDICAL MICROBIOLOGY & INFECTIOUS DISEASES SOCIETY OF PAKISTAN21-G/1, Block 6, P.E.C.H.S., Shahrah-e-Faisal, Karachi. Cell: 0333-3977011, Email: [email protected]

For Office Use Only

Membership #

Reference #Signature

Received: Sum of Rs. as cash/online slip no. Full Membership

Associate Membership

for

Date

infectious issn 1027-0299 recognised and registered with

Documents