inactivation of the p16@4/mts1 gene by a …...size of the amplified fragment was 760 nucleotides....

ICANCERR@EARCH56. 848-854. February15.19961

ABSTRACT

We have reported previously a preliminary study of a t(9;14)(p21â€”22;

qil) In B-cell acute lymphoblastic leukemia. This translocation had rearranged the TCRA/D locus on chromosome band 14q11 and the locusencoding the tumor suppressor gene P16@4/MTS1 (P16) on band 9p21(D. Duro et aL, Oncogene,11: 21â€”29,1995).In the present report, thebreakpoints werepreciselylocalizedon eachchromosomepartner. On the14qâ€”derivative, the sequencederived from chromosome9 was Interrupted at 1.0 kb upstream of the first exon of P16, closeto a consensusrecomblnation heptamer, CACTGTG. In addition, the chromosome 14breakpoint was localized at the end of the TCRD2 (82) segment, and 22residues with unknown origin were present at the translocation junction.On the9p+ derivative,chromosome9 sequenceswerein continuitywiththose displaced onto chromosome 14, and the 14q11 breakpoint waslocated within TCRJA29 segment. These features are consistent withaberrant activity of the TCR gene recombinasecomplex. Although aHthree coding exons of P16 were displaced onto the chromosome 14qâ€”derivative, no P16 transcript wasdetectedIn the leukemic cells.Becausethe regionspanningthe P16 exon1 wasnot inactivatedby methylationand becausethe other P16 allele was deleted,the Implication is that thechromosomebreakpoint was likely to disrupt regulatory elements Involved In the normal expressionof the gene.As a whole, then, our resultsshow that translocationsaffecting band 9p21can partldpate to the mactivation ofPl6, thusjustifying a systematicsurveyof translocationsof the9p21 band In acute lymphoblastic leukemia.

INTRODUCTION

Chromosome band 9p2lâ€”22contains two genes, Pl61@4/MTSland pJ5INK4/jPpf@@@(herein referred to as P16 and P15, respectively),encoding two inhibitors of cyclin-dependent kinases 4 and 6 thatnegatively control cell progression in the G1 phase of the cell cycle(1, 2). This cell cycle inhibitory function and the alterations frequentlyobserved in a numberof tumors (3, 4) are typical featuresof tumorsuppressor genes. Indeed, it has been reported that transfection offull-length P16 cDNA in tumor cells of various types results inmarked growth suppression (5). Furthermore, P16 specifically arrestscell cycle progression in G1, and this ability correlates with inhibitionof cyclin Dl/cyclin-dependent kinase 4 kinase activity (6, 7).

Homozygous or hemizygous deletions of both genesP16 and P15,or only one of them, are frequently observed in a number of humansolid tumors with an overall incidence that is characteristically less inprimary tumors than in cell lines (3, 8, 9). Nevertheless, a number ofprimary cancers, including pancreatic cancer, familial melanoma, andtumors of the central nervous system (astrocytomas and gliomas),appear to be frequently affected by homozygous deletions (10â€”15).This supports the notion that P16 and/or P15 may be selectivelyinactivatedin certaintypes of tumorsandare less likely thanotherstoparticipate directly in the malignant process.

Received 9/13/95; accepted 12/I 1/95.The costsof publicationof this articleweredefrayedin part by thepaymentof page

charges.This article mustthereforebe herebymarkedadvertisementin accordancewith18 U.S.C. Section 1734 solely to indicate this fact.

I This work was supported by Grant 6753 from the Association pour Ia Recherche

contre Ic Cancer, Villejuif, France.2 To whom requests for reprints should be addressed. Phone: (33) 1 42 49 92 75; Fax:

(33) 1 42 06 95 31.

Because loss of heterozygosity of the P16 gene in tumors is rarelyaccompanied by point mutations in the coding region of the remainingallele, several authors have proposed that another gene located in theclose vicinity of P15 and P16 on band 9p2l might be the true targetof the tumorigenic process(for example, seeRef. 16). However, otherways of inactivating P16 appear to exist; a CpG island encompassingthe exon 1 of P16 has been shown to be frequently methylated in theremaining allele of tumors, leading to its functional inactivation (17).Moreover, three groups including ours have simultaneously reportedthe occurrence of a new P16 transcript in which the first P16 exon isreplaced by an alternative one referred to as exon 0. 18 (18) or exonElfJ (19, 20). Becausethe normal ORF@of the P16 product has beenimpaired, this transcript may either encode a new protein totallyunrelated to P16 or give rise to a shorter p16 protein (designated plO)in which 1.5 ankyrin domains have been deleted by alternative splicing. In both cases,since the regular protein is eliminated, conditionsthat favor the occurrence of this transcript are likely to inactivate thegene.

In hematopoietic malignancies, homozygous deletions involvingP16 and P15 or only P16 genes appear to be characteristically foundin acute lymphoblastic leukemia of T- and B-cell types, with frequencies ranging from 15 to 25% of the cases (21â€”24),up to 75% inT-ALL (25â€”27).The origin of this discrepancy is presently unclear. Itis possible that a selective recruitment for high-risk leukemias introduces a bias, in comparison with standard T-ALL recruitment. Incontrast, acute myeloid leukemia, as well as chronic myelogenicleukemia and chronic lymphocytic leukemia, appears to exhibit suchdeletions only rarely (24, 28). The same appearstrue for other malignant lymphoproliferations, including follicular lymphoma and Tcell lymphoma (21â€”24).On the other hand, elimination of P16 andP15 genes appears to be significantly involved in lymphoid but not inmyeloid transformation of chronic myelogenic leukemia (24, 28).

We have recentlyreportedthe presenceof a t(9;14)(p2lâ€”22;ql1) inleukemic cells of a patient with a B-cell ALL ( 18). A chimenctranscript was isolated by reverse transcription-PCR that was com

prised of the constant region (Ca) of the TCRA gene in its 3' end anda 180-nucleotide segmentdesignated 0.18 in its 5' end. In the DNA ofnormal cells, 0.18 is located at approximately 17 kb upstream of P16exon 1 and has been shown to be part of the above-mentionedalternative exon El@ (19, 20).

In this report, we show that, in agreement with the presenceof the0.18-Ca fusion transcript found in leukemic cells with the t(9;l4)translocation, the breakpoint is located close to P16 exon 1 onchromosome 9p2l and within the D6-Ja region on chromosomel4ql 1. We have characterized the joints of the two chromosomepartners of the translocation, analyzed their sequences,and comparedthem to those of their normal counterparts to identify structuralfeatures that might explain the mechanism of the translocation.Finally, the consequencesof the translocation on the inactivation ofP16 are discussed.

3 The abbreviations used are: ORF, open reading frame; ALL, acute lymphoblastic

leukemia;FISH, fluorescencein situ hybridization;YAC, yeastartificial chromosome.

848

Inactivation of the P16@4/MTS1 Gene by a Chromosome Translocationt(9;14)(p21â€”22;qll) in an Acute Lymphoblastic Leukemia of B-Cell Type1

Dominique Duro, Olivier Bernard, VÃ©roniqueDella Valle, Thierry Leblanc, Roland Berger, andChristian-Jacques Larsen2

Unite 301 INSERM and SD! no. 16954 1, Centre National de Ia Recherche Scientifique. Institute of Molecular Genetics, 27 rue J. Dodu, 75010 Paris, France

on May 25, 2020. © 1996 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

http://cancerres.aacrjournals.org/

INACTIVATION OF P16 BY CHROMOSOMETRANSLOCATION

MATERIALS AND METHODS

Case Report. A detailed report of the case was described elsewhere (18).Briefly, the leukemia was diagnosed in a 6-year-old boy admitted in the

HematologyDepartmentof HÃ´pitalSt. Louis in Parisand wasclassifiedasB-cell lineageALL-L2.

Cytogenetics.Chromosomestudieswere performedat diagnosisusing24-h, in vitro culture of bone marrow cells and unstimulated blood cells.

FISH. FISH studieswere performedon metaphasechromosomesfromshort-term cultures of bone marrow cells. The biotinylated probes were prepared from total DNA of YACs 760 C6 and 886 P9, as provided by D. Le

Paslier(Centred'Etudesdu PolymorphismeHumain,Paris,France).TheseYACs havebeenreportedto encompassthe P16-P15locus (29). The FISHtechnique included competitive hybridization according to Romana et a!. (30).

Molecular Probes. P16- and P15-specificprobesused throughoutthiswork, as well as probesrepresentativeof the TCRA/D locus, have beenreported previously (18, 31). Internal probes used for PCR were: oligonucleotide A, 5'-AGTGCCAAGGAAAGGGAAAAAG-3'; and oligonucleotide B,5'-CCTGG1TGAAGATGGGAU-3'.

CloneIsolationfrom a GenomicLibrary of NormalPeripheralBloodLymphocytes. A genomic library was established from total lymphocyte

DNA of a healthydonor.DNA fragments(15â€”20kb), resultingfrom partialdigestion with restriction enzyme Sau 3A, were cloned in Lambda FIX IIvector according to the instructions of the manufacturer (Stratagene, La Jolla,CA). Approximately750,000recombinantphageswerescreenedwith cDNAclone 13 probe that represents the entire P16 alternative transcript (18â€”20).Oneclone(clone3) reactedpositivelywith probesspecificfor P16exon1andP16 exon 2 and was selected. Part of this clone encompassing exon I wassubclonedin plasmid pGEM-3Z (Promega,Madison, WI). This subclonedesignated SC- 10 was used for analysis of the breakpoint on chromosome 9(see text and Fig. 2).

PCR Technique. Appropriateamplimercouples weredefinedby referringto the published P16 cDNA sequences (4, 32) and that of clone SC-b. Allreactions were performed using reagents from Cetus Perkin-Elmer. Reactionswere performedin a final volumeof 50 pJ containing lOX buffer, 1.5mMMgCl2, 1unit of Taqpolymerase,andSng of DNA. For amplificationof the9p+ joint, Taq extender(Stratagene)was used as recommendedby themanufacturer.Onepi of this first reactionwasusedfor nestedPCR.

The following couplesof amplimerswere used: (a) F14-611B9â€”l:5'-TCAGGGGTA11'GTGcIATGG-3'/5'-CCTAGACCAGAAAAAGTGCT-3',for amplificationof the l4qâ€”joint segment.Initial denaturationfor 5 mm at95Â°Cand35cycles,30 sdenaturationat95Â°C,20 sannealingat 56Â°C,and305 elongation at 72Â°C; (b) F9-l/B14a-l: 5'-GAGTCGGAGTCTCATTCTGT

CACC-3'/5'-TCTGAGCCC1TFCCCTCTCAAG-3',for the first amplification roundof the9p+ joint segment.Initial denaturationfor Srainat95Â°C;35cycles:305denaturationat95Â°C,20sannealingat62Â°C,and1mmelongationat 75Â°C;and(c) F9-l'/B14a-l': 5'-TCGAATfCTGTCACCCAGCICTG-3'/5'-AGAACAAGCTfGGAGGCAACTAGG-3', for nestedamplification ofthe previous product. Initial denaturation for S mm at 95Â°C;30 cycles: 30 sdenaturation at 95Â°C,20 s annealing at 52Â°C,and 30 s elongation at 72Â°C.The

size of the amplified fragment was 760 nucleotides. Bold letters in thesequenceof amplimers B 14-al â€˜and F9 â€”1â€˜correspond to one baseaddition ortwo base substitutions to create EcoR I and Hind!!! sites, respectively.

Reaction products were run in 2% agarosegels and probed with 32P-labeledinternal oligonucleotideshomologousto the TCR-AID locus (see internalprobesA andB at thebottomof Fig. 2).

Sequence Determination. All sequencing studies were performed by using

the dideoxy chain termination procedure (33).

RESULTS

CytogeneticStudies. RHG bandingtechniqueswerecarriedoutonmetaphase cells from bone marrow and unstimulated blood cellsincubatedfor 24 h (Fig. 1A). All 38 metaphasesexamined(11 in bonemarrow and 27 in blood cells) displayed an abnormal karyotype:46,XY,t(9;14)(p2l ;ql I).

By using FISH, a single hybridization signal was detected on bonemarrow cells of the patient (Fig. 1B). It was located on a small

A

B

Fig. 1. Cytogenetics.A. partial karyotypeof patient's leukemiccells showing thet(9;l4)(p21;ql 1).Notethat theotherchromosome9 is morphologicallynormal.B, FISHanalysis of a bone marrow cell metaphasewith YAC 760 C6 probe. A single hybridizationsignal is located on chromosome 14qâ€”.

149

. â€œV

acrocentric corresponding to der(l4). No signal was observed on theuntranslocated chromosome 9, indicating the existence of a partialdeletion of this apparently normal chromosome. The absenceof signalon der(9)could be due to the asymmetricallocationof P16-P15 locuswithin the YACs, thus leaving on chromosome 9 a short segment thatescapeddetection by FISH technique. Alternatively, secondary rearrangements occurring during successive cultures of the YACs mayhave introduced internal deletions in the region reacting with sequences left on chromosome 9.

Detection of the BreakpoInts on Chromosomes 9 and 14. Previous Southern blot analysis performed with DNA of leukemic cellsbearing the t(9;14) revealed the presence of rearranged bands uponhybridization with probes encompassing exon 2 of P16 and P15 and

exon 3 of P16, respectively (seeFig. 3, B and C, in Ref. 18). Since the849




1kb 3'@ 5'

B B B BB I

R R/

, R

/ â€œ@RK I

/

exon 1 1'@ O.18/E1@3

sc-b @.

,/

//

/

HR Bg R Sm H

TCRA-J28

B14-al@ F9-1

Fig. 2. Molecularanalysisof the t(9;14) translocation.Top, the germlinestructureof the genomicregion encompassingthe PISINK4B/MTS2geneand PI6'@4/MTSl geneispresented. The localization of the breakpoint (BRK) within a Hindlll-EcoRI segment was deduced from data of Southern blot analysis with a number of restriction enzymes (onlysignificant ones are depicted). B, BamHl; Bg, BgIH; H, HindIII; R, &oRI; S. SmaI; X. XbaI. The B* site is a polymorphic one that has been reported previously (18). Bottom. thediagrammaticstructureof the l4qâ€”and9p+ derivativesis presented(not at scale).The amplified segmentscoveringthejoints andthecorrespondingamplimers(arrowheads)areindicated.Black boxesA andB refer to internaloligonucleotidesusedasprobes.Verticaldashedlines, thebreakpoint.

P16-rearranged bands were also detected by probes representative ofthe TCR-a/&specific locus on chromosome 14q11, these data confirmed the implication of P16 and TCR-aJ@genesin this translocation.Further restriction enzyme analysis allowed us to delineate the regioncontaining the rearrangements on chromosome 9p21 in a HindfflEcoRl fragment located 1 kb upstream of P16 (Fig. 2, top). Twochromosome l4ql 1 breakpoints were identified, basedon the restriction maps published in the literature (31): one at the boundary of theD63 segment and the other one in the TCR-Jct domain, close to theTCRA-JA28/JA29 segments (18).

No germline band was detected by the P16-specific probes (datanot shown), leading to the conclusion that one copy of the P16 genehad been removed, the other one being impaired by the translocation.This confirmed that the normal chromosome 9 observed on thekaryotype was likely to bear a submicroscopic deletion. In addition, aprobe covering the segment 0.18 recognized only BamHI and Hindfflgermline bands in leukemic DNA, in agreement with its location onthe genomic map (approximately at 17 kb upstream of the first exonof P16, see Fig. 2, top).

Sequences of the Breakpoint Regions of Derivative Chromosomes. To locate accurately the chromosomal breakpoint on band9p2l, a recombinant phage encompassing the P16 locus was isolatedfrom a genomic library established from peripheral blood lymphocytes of a normal donor (Fig. 2; see also â€œMaterialsand Methodsâ€•).The Hindffl-EcoRI fragment spanning the breakpoint site was sub

cloned, and its ends were sequencedfor selecting amplimers bordering the fragment. Symmetrically, amplimers bordering the breakpoints on chromosome l4ql 1 were selected from published sequencesof the TCRD region (34) and the TCRA-JA28 region (31). PCRamplification of the recombinant joints of each chromosome denvative was then carried out from leukemic DNA of the patient witht(9;l4) and from normal DNA. The couple of amplimers designed foramplifying the l4qâ€”derivative (amplimers F14-6l/B9â€”l in Fig. 3)generateda 191-bp segment with leukemic DNA (Fig. 3, Lane 9) butnot with normal DNA (Fig. 3, Lane 10). In contrast, a couple ofamplimers (F9â€”l/B9â€”l)designed to amplify a germline EcoRI-SmaIfragment of 610 bp (Fig. 3, Lane 1) generated a band with normalDNA (Fig. 3, Lane 4) but nothing with leukemic DNA (Fig. 3, Lane3), in agreement with the absence ofa germline copy ofthe P16 locus.Similarly, the amplimers specific for the 9p+ derivative (coupleF9â€”l/B14-al) generated a faint 2.0-kb fragment only with leukemicDNA (data not shown). The bona fide origin of this fragment wasascertained by nested PCR (Fig. 3, Lane 6). Starting from the firstPCRproduct,a 76O-bpfragmentwasamplified from leukemicDNA(Fig. 3, Lane 6) but not from normal DNA (Fig. 3, Lane 7), asexpected.

In both cases,specificity of the amplified fragmentswas furtherassertedby positive hybridization with internal probes A and B (datanot shown). Amplified fragments from both derivatives were subcloned and sequenced.

850

I p16/MTS1 I p15 /MTS2

_/@1 E I _

I - 0.18

Bg

R

ex.1 1D82 D81x

B9-1@ F14-Ã¶l

B14-al'@@ F9-1'

â€”probeB@ 9p+

â€” probeA

14q-



II


12

0@

*

Sequence Comparisons. Alignment of the rearranged 14qâ€”chromosome sequences with those of chromosomes 9 and 14germline counterparts (Fig. 4) showed that chromosome 9 wasinterrupted at 1.0 kb 5' to P16 exon 1 (or Ela in the newnomenclature), within a 1.5-kb EcoRI-HindIII fragment (Fig. 2).Interestingly, the breakpoint was very close to a perfect recombination signal heptamer element. The chromosome 14 partnerwascleaved at the end of the coding D@2sequence. In addition, 22nontemplated nucleotides, possibly generated by N-region insertion, were found at the translocation junction.

Inspection of the sequence760-bp fragment of the 9p+ generatedby nested PCR indicated that no loss of chromosome 9 sequencehad

Fig.4. Sequencealignment of the 9p+ andl4qâ€”joint derivatives with their normal counterparts. Only the sequencesencompassing the breakpointsare presented.Arrowheads,the breakpointof each partner. The heptamer/nonamer recombination sequencesare double underlined.Nonparentalextranucleotidesareindicatedby lowercaseletters. Note that the chromosome 9 sequencesfoundon 14qâ€”and9p+ derivativesarein perfectcontinuity relative to the chromosome 9 germlinesequence.

occurred (Fig. 4). On chromosome 14, the breakpoint was located ata Ja (TCRA-J28) segment, as expected. Therefore, it turned out thata deletion had removed all sequencesfrom the D6 segment to the Jcasegment. Again, a stretchof N-like extranucleotideswas insertedatthe junction site.

The Region Encompassing Exon 1 of P16 Is Not Methylated.Recent work has shown that in tumor cell lines and primary tumorswith a monoallelic deletion of P16, inactivation of the remainingallele was insured by a methylation pattern of the CpG island of P16that encompassesexon 1 (17). Because of its location, we reasonedthat this CpG island should not have been greatly impaired by thetranslocation and was likely to have been displaced onto the l4qâ€”

14 GL AGGAAGAGGAGGGTTTTTATACTGATGTGTTTCATTGTGCCTTCCTACCACACAGGTT

9 7 D62 BI@K

AGGAAGAGGAGGG III11ATACTGATGTGTTTCATTGTGCCTTCCTACgaggattcct

14q- ___actcccttttgCAACTCTGCTTCTAGAACACTGAGCACTTlTTCTGGTCTAGGAATTT

9GL BRK @14q-@GGATCACTGTGCAACTCTGCTTCTAGAACAC

7 B@K

9 GL TGAAGGAGAGACAGGACAGTATTTGAAGCTGGTCTTTGGATCACTGTGCAACTCTGCTTC7

9p+ TGAAGGAGAGACAGGACAGTATTTGAAGCTGGTCTTTGGATCACTGTGtggggAGGAAAC

CCAAGGCCAGGCATTCAGGGUIIIIiGTTATGGAGGAATCACTGTGGGAATTÃ§AGGAAAC

14GL TCRA-329 7 BaK ______ACACCTCTTGTCTTTGGAAAGGGCACAAGACTTTCTGTGATTGCAAGTAA@ 9p+

851

1234 5 6 7 8 9 10 11

760

610

191

â€”@-â€”â€”*

Fig. 3. PCRamplification.Lane1.amplificationof cloneSC-b (germlinesequenceof chromosome9) with amplimersF9â€”landB9â€”l.Lane2, molecularweightmarkers.Lane3, same amplimers with leukemic cell DNA. Lane 4, same amplimers with normal DNA. Lane 5, negative control of PCR. Lane 6. nested PCR of leukemic cell DNA with amplimersFl4-al' and B9-l'. Lane 7, same amplimers with normal DNA. Lane 8, negative control of PCR. Lane 9. leukemic cell DNA with amplimers Fl4-al and B9-l. Lane 10, sameamplimerswith normalDNA. Lane 11.negativecontrolof PCR.Lane 12, lOO-bpDNA ladder.

. ___

*



INACI'IVATION OF P16 BY CHROMOSOMETRANSLOCATION

Fig. 5. Methylation status of the CpG islandencompassingP16 exon 1 in leukemiccells withthe t(9;14). Normal donor and leukemic cell DNAs

on theonehandandRaji cell andRPMI 8266cellDNA on theotherhand(in the latter two, theCpGisland is methylated) were hydrolyzed with EcoRI(Lanes c-h) and EcoRI+Sacll (Lanes a-d) andEcoRI+SmaI (Lanes i-I). The blot was hybridizedwith a EcoRl-BglII segmentencompassingexon 1.Becauseof its positionandassumingthat all sitesare unmethylated,this probe recognizesa 4.3-kbEcoRI fragment, three EcoRI-Sacll fragments (3.0,0.5, and 0.3 kb), and three SmaI fragments (0.65,0.4,and0.35kb). All thesefragmentsaredepictedin normal donor DNA. Bars on the right side pointto uncompletely digested methylated fragments.Lanesa, e, andi, normaldonorDNA. Lanesb,f@andj, t(9;l4) DNA. Lanesc, g. and k, Raji cellDNA. Lanesd, h, and I, RPMI 8266 cell DNA.

a-.,

derivative. In this respect, it was interestingto appreciatethe methylation statusof the region in its new location. Restriction analysis wascarriedout usingtwo methylation-sensitiveenzymes.As seenin Fig.5, double digestion with EcoRI and SmaI, EcoRI and SacII, respectively, generatedbandswhose sizes were expected from the locationsof unprotected restriction sites. In contrast, the sameanalysis repeatedon Raji cell DNA and RPM! 8226 cell DNA clearly showed protection of cleavage of the two methylation-sensitive enzymes (in fact, allSmaI sites were not methylated; see Fig. 5, Lanes k and 1). Weconcluded from these data that the absenceof expression of P16 wasnot due to methylation of the 5' CpG island but that it was more likelythe consequenceof the translocation.

The possible presenceof methylated sites around segment0. 18 wasalso examined. Hybridization of the same blot with 0.18 probe appeared not to reveal the presenceof methylation-protected restrictionsites (data not shown).

DISCUSSION

We have reported in this work the first molecular analysis of at(9;14)(p2lâ€”22;ql1) found in an ALL. We have found that thistranslocation had rearranged the locus on band 9p21 containingP16@'â€•/MTS1 and PJ5INK4bft4TS2 genes. As a consequence, P16was inactivated, while the P15 locus appeared not to be impaired.These resultsraise several questions regarding:(a) the consequencesof this translocation on P16 expression; (b) the possible mechanism ofthe translocation; and (c) the importance of this translocation (orrelated events) in the inactivation process of P16 or closely situatedgenes.

Inactivation of the P16 Gene in Leukemic Cells by t(9;14)Translocation. Cytogenetic data as well as Southern blot data reported here and in our previous study (18) support the notion that onecopy of the P16 gene hasbeen deleted in the leukemic cells, while theremaining allele has been rearranged by the t(9;l4) translocation.Becauseof the location of the breakpoint upstream of the P16 exon 1,all three coding exons were displaced from chromosome 9 to the14qâ€”derivative. Since no transcript was detected by Northern blot

analysis or PCR amplification with different primers designed torecognize the P16 transcript comprised of exons 1 to 3 (18), it can beconcluded that, in spite of the colinear conservation of its three codingexons, the remaining copy of P16 had been inactivated by the translocation. This suggeststhat the breakpoint was located within a DNAsegment encompassing a promoter of P16 or regulatory sequencesthat control the expression of the transcript containing P16 exon 1.Currently, there is no information on the nature of this promoter andits regulatory sequences.

Another possible mechanism of inactivation of the remaining allelewas that the CpG island encompassingexon 1 of P16 was methylated.Southern hybridization data of the patient DNA hydrolyzed with twomethylation-sensitive enzymes appeared to exclude this possibility.

In agreement with the orientation of TCRA/D and P16 genes ontheir respectivechromosomes,a compositetranscriptwith a 0.18-Castructure has been produced (18). It reflected the expression of the9p+ chromosome derivative since the 0. 18 exon is located upstreamof the breakpoint on chromosome 9 and the constant region of theTCRA gene was displaced from chromosome 14. Whether this transcript has biological significance is unknown.

Importance of Chromosomal Translocations as an InactivatingProcess of the P16/P15 Locus in Hematopoietic Malignancies. Inthe t(9;l4) analyzedin thepresentwork,the loss of one P16 allele wasaccompanied by inactivation of the remaining one. Whatever thechronology of the inactivating events might be, this situation raisestheinteresting question of how frequently P16 is rearranged in translocations. Regarding ALL, translocations involving band 9p2lâ€”22display an evident heterogeneity as the identity of the chromosome 9partner varies. Although suggestive, these data do not prove theinvolvement of P16 and/or P15 in the translocation. Nevertheless,their finding would support the notion that translocations may constitute a means for inactivating one allele of P16. Furthermore, it isstill possible that other translocations may be undetectable currently atthe cytogenetic level. We note that in all published reports, sequencesof P16 were either established by PCR analysis involving only coding

regions of the gene or assessedby single-strand conformation poly

852

abcd

4.3kbâ€”PIPV3.Okbâ€”@' â€¢@

0.5kbâ€”@@V

O.3kbâ€”@S

e f gh I J

0.65kbâ€˜I. 0.4kb

I@ 0.35kb

Eco R1+Sac H Eco RI Eco RI+Sma I




morphism, taking the same ORF into account. Therefore, in bothcases, the integrity of the gene was not established. This obviously

leaves open the possibility of missing rearrangementsthat mightdisplace the whole gene or parts of it without impairing its primarystructure.

Mechanisms of the Translocation. Examinationof the sequencesof the two derivative l4qâ€”and 9p+ chromosomes generated by thetranslocation as well as those of their parental counterparts illustratesthe involvement of the VDJ recombinase machinery via recognition ofrecombination signal sequences (heptamers) with addition of presumptive N-region between the parental sequences. Closer inspectionshows that the two joints fall into reciprocal (l4qâ€”) or deletional(9p+) categories, as shown for other translocations involving B- orT-cell malignancies (35, 36). The 14qâ€”joint most likely occurred bydirect exchange between l4ql 1 and 9p2l, whereas in the 9p+ joint,a deletion occurred between D@3and Ja (TCRA-J28), concomitantlywith or following the translocation.

In T-ALL, deletions involving the TAL1/SCL gene on chromosomeband lp32 havebeenshownto result from errorsof the recombinasemachinery that recognizes recombination signal heptamers locatedclose to the bordersof the deletion (34, 37). In view of the presenceof an heptamer in the vicinity of the breakpoint on chromosome 9, itis tempting to postulate that this breakpoint-encompassing region is ahot spot for recombination, including those deletions whose bordersare located between P15 and P16. With regard to this possibility, two

cell lines (A375 and SK-Me193) established from solid tumors havebeen reported to contain a deletion with one border located close tothe region containing the t(9;14) breakpoint (see Fig. 2 in Ref. 20).Should this hypothesis be confirmed by analysis of other deletionswith breakpoints between P15 and P16, it would indicate that this9p2l region is, in fact, a recombination hot spot. In addition, it wouldsuggest that the mechanism generating TALJ/SCL deletions and 9p2l

deletions is particularly active in ALL.Is P16 the Actual Target of the Translocation? Although point

mutations are a common means for achieving the inactivation oftumor suppressor genes, P16 appearsnot to obey this rule becauseithas been shown to be rarely mutated in a variety of tumors, with theexception of germline mutations found in melanoma-prone kindredsand in pancreatic carcinoma patients (10, 11, 13). The same situationhas been observed in leukemias (38). This has led some groups topostulate that P16 may not be the real target of the rearrangementsaffecting the locus in different tumors but another gene located closeto it. In this respect, Jen et a!. (16), by carrying out mapping studiesaimed at characterizing the smallest common region of deletion involving P15 and P16 in primary glioblastomas, identified a segmentlying between P15 and P16 as the smallest common target in this

region. Since neither P16 nor P15 exhibited intragenic mutations thatshould exist in the remaining allele, the authors suggested that theactual target is a gene located in between P15 and P16. In the light ofthe finding of the novel E1j3/0.l8 P16 transcript (18â€”20), one attrac

tive possibility is thatalterationsfalling into this regiondisruptpartofP16 that is necessary for the regulation of the gene, thus leading to theshut-off (inactivation) of its normal expression. Alternatively, in viewof the unusual characteristics of the Elf3/0. 18 transcript, i.e., the loss

of the ORF encoding p16 protein, the possibility cannot be excludedthat exon El@/0.l8 is part of a new transcription unit inserted betweenP16 and P/S. In any case, most of the current evidence suggests that,unlike the situationfor othertumorsuppressorgenes, the mechanismsinvolved in the inactivationof P16 in humancancersmostly rely oncomplex organizationand regulationof this region of the 9p2l band.

ACKNOWLEDGMENTS

We are grateful to Dr. A. Bloom for his reading of the manuscript.

Note Added in Proof

Since the submission of this manuscript, we have learned that a protein

encodedby the0.l8/El@3transcripthasbeenfound in mousecells (Quelleeta!., Cell, in press). This protein designated pl9'@'@ as the murine homologueof the human F-l6 protein, the existence of which was postulated previously(18).

REFERENCES

1. Sherr,C.J.,andRoberts,J.M. InhibitorsofmammalianGl cyclin-dependentkinases.Genes & 0ev., 9: 1149â€”1163, 1995.

2. Hirama,T., andKoeffler, H. P. Roleof thecyclin-dependentkinaseinhibitorsin thedevelopment of cancer. Blood, 86: 841â€”854,1995.

3. Kamb, A. Cell cycle regulators and cancer. Trends Genet. 11: 136â€”140,1995.4. Okamoto, A., Demetrick D. J., Spillare, E. A., Hagiwara, K., Perwez-Hussein, S.,

Bennett, W. D., Forrester, K., Gerwin, B., Serrano, M., Beach, D. H., and Harris, C.Mutations and altered expression of pJ6'@Â°â€•in human cancers.Proc. Natl. Acad. Sci.USA, 91: 11045â€”11049, 1994.

5. Amp, W., Nishikawa, R., Fumaii, F. B., Cavenee, W. K., and Huang Su, H-i.Replacementof theP16/CDKN2genesuppresseshumangliomacell growth.CancerRca., 55: 1351â€”1354,1995.

6. Lukas,J.,Parry,i., Aagard,L., Mann,D. J.,Bartkova,i., Strauss,M., Peters,0., andBartek, J. Retinoblastomaprotein-dependentcell cycle inhibition by the tumoursuppressor P16. Nature (Land.), 375: 503â€”506,1995.

7. Koh, i., Enders, 0. H., Dynlacht B. D., and Harlow, E. Tumour-derived P16 alleles

encoding proteins defective in cell-cycle inhibition. Nature (Lond.), 375: 506â€”510,1995.

8. Kamb, A., Gruis, N. A., Weaver-Feldhaus, i., Liu, Q., Harshman, K., Tavtigian, S. V.,Stockert, E., Day, R. S., 111,Johnson, B. E., and Skolnick, M. H. A cell cycle regulatorpotentially involved in genesisof many tumor types. Science (Washington DC), 264:436â€”440,1994.

9. Nobori, N., Miura K., Wu, D. I., Lois, A., Takabayashi,K., and Carson,D. A.Deletions of the cyclin-dependent kinase-4 inhibitor gene in multiple human cancers.Nature(Land.),368: 753â€”756,1994.

10. CaldaS,C.,Hahn,S.A., daCosta,L. T., Redston,M. S.,Schutte,M., Seymour,A. B.,Weinstein, C. L., Hruban, R. H., Yeo, C. i. and Kern, S. E. Frequent somaticmutations and homozygous deletions of the P16 (MTSI ) gene in pancreatic adenocarcinoma. Nat. Genet., 8: 27â€”32,1994.

11. Hussussian,C. I., Struewing,i. P.,Goldstein,A. M., Higgins,P. A. T., Ally, D. S.,Sheahan,M. D., Clark, W. H., Jr., Tucker, M. A., and Dracopoli, N. C. Germline P16mutations in familial melanoma. Nat. Genet., 8: 15â€”21,1994.

12. Liu, L., Lassam, L. I., Slingerland, J. M., Bailey, D., Cole, D., Jenkins, R., and Hogg,D. GermlinepJ6INK4Amutationandproteindysfunctionin a family with inheritedmelanoma.Oncogene,11: 415â€”412,1995.

13. Ranade,K., Hussussian,C. J., Sikorsk@R. S., Varmus, H. E., Goldstein, A. M., Tucker,M. A., Serrano,M., Hannon,G. J.,Beach,D., andDracopoli,N. C. Mutationsassociatedwith familial melanoma impair P16'@'Â°â€•function. Nat. Genet., 10: 114â€”116, 1995.

14. Gruis, N. A., van der Velden, P. A., Sandkuijl, L. A., Prins, D. E., Weaver-Feldhaus,J., and Frants,R. R. Homozygotesfor CDKN2 (P16) germlinemutationin Dutchfamilial melanoma kindreds. Nat. Genet., 10: 351â€”353,1995.

15. Schmidt, E. E., Ichimura K., Reifenberger, G., and Collins, V. P. CDKN2 (P16,'MTSI)gene deletion or CDK4 amplification occurs in the majority of glioblastomas. CancerRes.,54: 6321â€”6324,1994.

16. Jen,J.,WadeHarper,J.,Bigner,S. H., Bigner,D. D., Papadopoulos,N., Markowitz,S., Willson, J. K. V., Kinzler, K. W., and Vogelstein, B. Deletion of p16 and p15genes in brain tumors. Cancer Res.. 54: 6353â€”6358,1994.

17. Merlo, A., Herman, J. G., Li, Mao, Lee, D. J., Gabrielson, E., Burger, P. C., Baylin,S. B., and Sidransky, D. 5' CpG island methylation is associated with transcriptionalsilencing on the tumor suppressorpI6JCDKN2IMTSI in human cancers. Nat. Med.,1: 686â€”692, 1995.

18. Duro, D., Bernard, 0., Della Valle, V., Berger, R., and Larsen, C-i. A new type ofpl6@4/MTSI gene transcript expressed in B-cell malignancies. Oncogene, 11:21â€”29,1995.

19. Mao, L., Merlo, A., Bedi, G., Shapiro,G. I., Edwards,C. D., Rollins, B. J., andSidransky, D. A novel pl6@@'@(4Atranscript. Cancer Res., 55: 2995â€”97,1995.

20. Stone, S., Ping, J., Dayananth, P., Tavtigian, S. V., Katcher, H., Parry, D., Peters,G.,and Kamb, A. Complex structure and regulation of the P16 (MTSJ) locus. CancerRes.,55: 2988â€”2994,1995.

21. Duro, D., Flexor, M-A., Bernard, 0., d'Agay, M-F., Berger, R., and Larsen, C-i.Alterations of the putative tumor suppressorgenepIÃ³(MTSI in human hematologicalmalignancies. C-R. Acad. Sci. Paris, 317: 913â€”919,1994.

22. Ogawa,S.,Hirano,N., Sato,N., Takahashi,T., Hangaishi,A., Tanaka,K., Kurokawa,M., Tanaka, T., Mitani, K., Yazaki, Y., and Hirai, H. Homozygous loss of thecyclin-dependent kinase 4-inhibitor (pitS) gene in human leukemias. Blood, 84:2431â€”2435,1994.

23. Quesnel, B., Preudhomme, C., Philippe N., Vanrumbeke, M., Dervite, I., Lai, J-L,Bauters,F., WaUel,E., andFenaux,P. p16homozygousdeletionsin acutelymphoblastic leukemias. Blood, 85: 657â€”663,1995.

853



INACFIVATION OF P16 BY CHROMOSOME TRANSLOCATION

24. Stranks, 0., Height, S. E., Mitchell, D. P., Jadayel, D., Yuille, M. A. R., De Lord, C.,Clutterbuck,R. D., Treleaven,i. 0., Powles,R. L., Nacheva,E., Oscier,D. 0.,Karpas, A., Lenoir, 0. M., Smith, S. D., Millar, J. L., Catovsky, D., and Dyer, M. J. S.Deletions and rearrangementsof CDKN2 in lymphoid malignancy.Blood, 85:893â€”901,1995.

25. HÃ©bert,J., Cayuela, J-M., Berkeley. J., and Sigaux, F. Candidate tumor suppressorgenesMTSI (pl6Â°'@4)and MTS2 (pl5INK4B) display frequent homozygous deletionsin primary cells from T- but not from B-cell lineage acute lymphoblastic leukemias.

Blood, 88: 4038â€”4044,1994.26. Cayuela, J-M., HÃ©bert,J., and Sigaux, F. Homozygous MiT! (pl6'@4@') deletion in

primary tumor cells of 163 leukemic patients. Blood, 85: 854, 1995.27. Okuda, T., Shurtleff, S. A., Valentine, M. B., Raimondi, S. C., Head D. R., Behm, F.,

Curcio-Brint, A. M.. Liu, Q., Pui, C-H., Sherr,C. P., Beach,D., Look, A. T., andDowning, J. R. Frequent deletion ofpJ6@â€•@'/AfTSJand p15@4@'/MTS2in pediatricacutelymphoblasticleukemia.Blood,85: 2321â€”2330,1995.

28. Sill, H., Goldman, J. M., and Cross, N. C. P. Homozygous deletions of the p16 tumorsuppressorgeneare associatedwith lymphoid transformationof chronic myeloidleukemia. Blood, 85: 2013â€”2016,1995.

29. Weaver-Feldhaus,J., Grois, N. A., Neuhausen,S., La Paslier,D., Stockeil, E., Skolnick,M. H., and Kamb, A. Localizationof a putative tumor suppressorgene by usinghomozygousdeletions in melanomas.Proc. Nail. Acad. Sci. USA. 91: 7563-7567, 1994.

30. Romana,S. P.,Le Coniat,M., andBerger,R. A newrecurrenttranslocationin acutelymphoblastic leukemia. Genes Chromosomes Cancer, 9: 186â€”191,1994.

31. Koop, B. F., Rowen, L., Wang, K., Kuo, C. L., Seto, D., Lenstra, J. A., Howard, S.,

Shan,W.,Deshpande,P.,andHood,L.ThehumanT-cellreceptorTCRAC/TCRDC(Ca/C8) region:organization,sequenceandevolutionof 97.6 kb of DNA. Genomics,19: 478â€”493, 1994.

32. Serrano, M., Hannon, 0. J., and Beach, D. A new regulatory motif in cell-cyclecontrol causing specific inhibition of cyclin D/CDK4. Nature (Lond.), 366: 704â€”707,1993.

33. Sanger, F., Nicklen, S., and Coulson, A. R. DNA sequencing with chain-terminatinginhibitors.Proc.NatI. Acad.Sci. USA, 74: 5463â€”5467,1977.

34. Bernard, 0., Lecointe, N., Jonveaux, P., Souyri, M., MauchauffÃ©,M., Berger, R.,Larsen, C-i., and Mathieu-Mahul, D. Two site-specific deletions and t(l;l4) translocation restricted to human acute T-cell leukemias disrupt the 5' part of the tal.1gene.Oncogene,6: 1477â€”1488,1991.

35. Croce, C. M. Role of chromosome translocations in human neoplasia. Cell, 49:155â€”156,1987.

36. Sanchez Garcia, I., Kaneko, Y., Gonzalez-Sarmiento, R., Campbell, K., White, L,Boehm, T., and Rabbitts, T. H. A study of chromosomeI lpl3 translocationsinvolving TCR@andTCRhin humanT cell leukemia.Oncogene,6: 577â€”582,1991.

37. Brown, L., Cheng, 0. T., Chen, Q., Siciliano, M. J., Crist, W., Buchanan, G., andBaer, R. Site-specific recombination of the tal-1 gene is a common occurrence inhumanT-cell leukemia.EMBO J., 9: 3343â€”3351,1990.

38. Ohnishi, H., Kawamura, M., Ida, K., Sheng, X-M., Nobori, T., Yamamori, S., andHayashi, Y. Homozygous deletions of p16/MTSJ gene are frequent but mutationsinfrequent in childhood T-cell acute lymphoblastic leukemia. Blood, 86: 1269â€”1275,1995.

854



1996;56:848-854. Cancer Res Dominique Duro, Olivier Bernard, Véronique Della Valle, et al. Leukemia of B-Cell Type

22;q11) in an Acute Lymphoblastic−Translocation t(9;14)(p21 Gene by a Chromosome MTS1/INK4P16Inactivation of the

Updated version

http://cancerres.aacrjournals.org/content/56/4/848

Access the most recent version of this article at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/56/4/848To request permission to re-use all or part of this article, use this link



http://cancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]



inactivation of the p16@4/mts1 gene by a …...size of the amplified fragment was 760 nucleotides....

Documents