in ovarian cancer · hsp70 inhibition synergistically enhances the effects of magnetic fluid...

HSP70 inhibition synergistically enhances the effects of magnetic fluid hyperthermia in ovarian cancer

Karem A. Court 1, Hiroto Hatakeyama2, 9, Sherry Y. Wu2, Mangala S. Lingegowda 2, Cristian

Rodríguez-Aguayo3, Gabriel López-Berestein3,4, Lee Ju-Seog5, Carlos Rinaldi6,7, Eduardo J.

Juan8, Anil K. Sood2,4 and Madeline Torres-Lugo 1

1 Department of Chemical Engineering, University of Puerto Rico-Mayagüez

2 Department of Gynecologic Oncology, MD Anderson Cancer Center, Houston, Texas

3 Department of Experimental Therapeutics, MD Anderson Cancer Center, Houston, Texas

4 Center for RNA Interference and Non-Coding RNA, MD Anderson Cancer Center,

Houston, Texas

5 Department of Systems Biology, MD Anderson Cancer Center, Houston, Texas

6 J. Crayton Pruitt Family Department of Biomedical Engineering, University of Florida,

Gainesville

7 Department of Chemical Engineering, University of Florida, Gainesville

8 Department of Electrical and Computer Engineering, University of Puerto Rico-Mayagüez

9 Faculty of Pharmaceutical Sciences, Chiba University, Chiba 260-8675, Japan

on June 11, 2020. © 2017 American Association for Cancer Research. mct.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on February 21, 2017; DOI: 10.1158/1535-7163.MCT-16-0519

http://mct.aacrjournals.org/

Running Title: HSP70 inhibition and magnetic fluid hyperthermia in cancer

Keywords: ovarian cancer, magnetic nanoparticles, magnetic fluid hyperthermia, heat shock

proteins and microarray.

Financial support

Source Grant number Authors HHS | National Institutes of Health (NIH) CA 963000/ CA

96297 Madeline Torres-Lugo

PR Institute for Functional Nanomaterials EPS-100241 Madeline Torres-Lugo

Ovarian Cancer Research Fund (OCRF) RP101502/RP Sherry Y. Wu HHS | National Institutes of Health (NIH) P50CA083639 Anil K Sood HHS | National Institutes of Health (NIH) CA016672 Anil K Sood Cancer Prevention and Research Institute of Texas training grants

RP101489 Sherry Y. Wu

Cancer Prevention and Research Institute of Texas training grants

RP110595 Anil K Sood

Cancer Prevention and Research Institute of Texas training grants

RP120214 Anil K Sood

Disclosure: The authors report no conflicts of interest in this work.

Corresponding author: Madeline Torres-Lugo, PO BOX 9000, Mayaguez, PR, 00680,

Phone: 787-832-4040 x2585, Fax 787-834-3655, [email protected]

Word count: 4966 Figures: 5 Tables:1




Abstract

Hyperthermia has been investigated as a potential treatment for cancer. However,

specificity in hyperthermia application remains a significant challenge. Magnetic fluid

hyperthermia (MFH) may be an alternative to surpass such a challenge, but implications of

MFH at the cellular level are not well understood. Therefore, the present work focused on

the examination of gene expression after MFH treatment and using such information to

identify target genes that when inhibited could produce an enhanced therapeutic outcome

after MFH. Genomic analyzes were performed using ovarian cancer cells exposed to MFH

for 30 min at 43°C, which revealed that heat shock protein genes, including HSPA6, were

upregulated. HSPA6 encodes the heat shock protein Hsp70, and its expression was

confirmed by PCR in HeyA8 and A2780cp20 ovarian cancer cells. Two strategies were

investigated to inhibit Hsp70 related genes, siRNA and Hsp70 protein function inhibition by

2-phenylethyenesulfonamide (PES). Both strategies resulted in decreased cell viability

following exposure to MFH. Combination index was calculated for PES treatment reporting

a synergistic effect. In vivo efficacy experiments with HSPA6 siRNA and MFH were

performed using the A2780cp20 and HeyA8 ovarian cancer mouse models. A significantly

reduction in tumor growth rate was observed with combination therapy. PES and MFH

efficacy were also evaluated in the HeyA8 intraperitoneal tumor model, and resulted in

robust antitumor effects. This work demonstrated that HSP70 inhibition combination with

MFH generate a synergistic effect and could be a promising target to enhance MFH

therapeutic outcomes in ovarian cancer.




Introduction

Hyperthermia is the application of heat to tissues as a therapeutic tool using temperatures

between 41 to 47ºC. Hyperthermia has been successfully employed as an adjuvant for the

treatment of several cancers and is known to enhance the effects of chemotherapy and

radiotherapy (1-3). Clinically, heat can be applied locally, regionally or in the whole-body,

but current modalities are not site specific (1,4). Challenges such as temperature

homogeneity during application, achieving an efficient heat dose, patient discomfort, and

hot spots limit the use of this therapy (2,4). The use of nanotechnology could help

overcome such challenges. Magnetic fluid hyperthermia (MFH) is an attractive alternative

as it can deliver heat to the desired area using magnetic nanoparticles under the influence

of a magnetic field (1,2,5).

There is evidence that MFH can deliver heat more efficiently than conventional

hyperthermia (6-12). Aspects such as thermal chemosensitization, membrane

permeabilization, and sensitization of drug-resistant cancer cells have been observed as

responses to MFH in vitro (2,7-9). These findings demonstrate that MFH has potential as an

adjuvant cancer treatment, but there is still a dearth of knowledge in the field regarding the

implications of MFH at the molecular level and how these can be exploited to enhance the

effects of MFH in cancer treatment.

Previous work with conventional hyperthermia demonstrated that molecular and cellular

responses depend on the cell line, thermal dose, and recuperation time (13-16). In the

clinic, intraperitoneal administration of hyperthermia (HIPEC), in combination with

chemotherapeutic drugs, have been investigated for more than three decades as an

attractive adjuvant to cytoreductive surgery in ovarian cancer (17). Currently, there are more

than 30 clinical trials that have recently started or concluded using this technology (18). A




recent meta-analysis of clinical trials performed by Huo et al., demonstrated that the

combination of HIPEC, cytoreductive surgery, and chemotherapy showed significant patient

survival (19). Still, a challenge remains: the ability to reach a therapeutic temperature

without causing toxicity to healthy tissue and risk complications (20-24). Furthermore,

intrinsic biological aspects such as the inherent thermo-tolerance properties of tumors are a

challenging aspect that has been neglected to this point. Nanoscale heat generation

systems such as iron oxide nanoparticles represent an attractive alternative as one could

generate heat within the system, only under high-frequency and moderate amplitude

magnetic fields that can be constrained to the tumor region. Therefore, the goal of this work

was to investigate gene expression profiles after MFH in ovarian cancer cell lines to

elucidate cellular response and select molecular targets to enhance its effect in vitro and in

vivo. It was hypothesized that upregulated genes and proteins resulting from MFH

treatment, when inhibited, could potentially enhance MFH outcome. Results indicated the

upregulation of HSPA6, which encodes for heat shock 70 kDa protein 6 (Hsp70), several

heat shock proteins, and ubiquitin C. Hsp70 related genes and proteins were selected as

potential targets. Two strategies were investigated to inhibit Hsp70 genes and proteins (i)

siRNA-based therapy; and, (ii) HSP70 protein function inhibition by 2-

phenylethyenesulfonamide (PES) (25). Both strategies resulted in enhanced cell death in

various ovarian cancer cell lines in vitro and in vivo.




Materials and Methods

Cell Culture

Ovarian cancer cell lines HeyA8, HeyA8 MDR, A2780, A2780 cp20 and SKOV3 were grown

in RPMI 1640 (Sigma-Aldrich), 15% fetal bovine serum (Life Technologies) and 0.1%

gentamicin sulfate (Sigma-Aldrich). Cells were maintained at 37ºC, 95% relative humidity

and 5% CO2. Cell lines were obtained from the institutional Cell Line Core Laboratory MD

Anderson Cancer Center in 2012. Authentication was performed within 6 months of the

current work by the short tandem repeat method using the Promega Power Plex 16HS kit

(Promega).

Magnetic nanoparticles

Carboxymethyl dextran coated iron oxide nanoparticles (CMDx-IO) were prepared using the

co-precipitation method as previously described (8,26). Briefly, an aqueous solution of ferric

chloride hexahydrate, ferric chloride tetrahydrate, and ammonium hydroxide were mixed at

a pH 8.0 under nitrogen at 80oC. Nanoparticles were peptized with tetramethyl ammonium

hydroxyl and dried. They were functionalized in dimethylsulfoxide, 3-

aminopropyltriethoxysilane, DI water, and acetic acid. Then washed with ethanol and dried.

Later they were exposed to carboxymethyl dextran, N,N-(3-dimethylaminopropyl)-N’-ethyl-

carbodiimide hydrochloride, and N-hydroxysuccinimide, at pH 4.5-5.0. Particles were

centrifuged and washed with ethanol and dried. Particles characterization is presented in

supplementary figure S.1.

In vitro MFH

Attached cells: Cells were seeded in 35 mm cell culture dishes. New culture media and

CMDx-IO nanoparticles (0.5 mgFe/ml) were added the following day. The dish was placed




inside the magnetic induction coil of an Easy Heat 8310 LI (Ambrell) induction heater and

exposed to a magnetic field intensity that ranged between 24-36 kA/m (245 kHz) to achieve

41 or 43°C for 30 min. The copper coil had five turns and an inner diameter 5 cm.

Temperature was measured with an NI-9211 thermocouple signal conditioner and

acquisition board (National Instruments) with type T thermocouples (Omega Engineering).

After 48 hours, cell viability was assessed by Trypan Blue (Sigma-Aldrich). For PES (EMD

Chemicals) treated cells, the concentration was 5uM for A2780cp20 and 10uM for HeyA8

and SKOV3. PES was added to cells 2.5 hours before MFH and not removed until the end

of the treatment. Cells were incubated for 48 hours in the presence of PES.

Suspended Cells: Cells were suspended in 2.5 ml of media in a glass vial with CMDx-IO

nanoparticles (0.5 mgFe/ml). An induction heater (RDO Induction) was used to generate a

magnetic field intensity that ranged between 29-35 kA/m. The copper coil had 4 turns and

an inner diameter of 2 cm. Cells were exposed to MFH for 30 min. After treatment, cells

were seeded in a 25 cm3 flask and placed in an incubator. After 48 hours, cell viability was

assessed with Trypan Blue (Sigma-Aldrich).

Microarray Analysis

Ovarian cancer cells were exposed to MFH for 30 min at 43ºC. RNA was prepared after

treatment using a mirVana RNA isolation labeling kit (Life Technology). Three hundred

nanograms of RNA were used for labeling and hybridization on a Human HT-12 v4

Beadchip (Illumina) following manufacturer’s protocols. The bead chip was scanned with an

Illumina BeadArray Reader (Illumina). Microarray data were normalized using the quantile




normalization method in the Linear Models for Microarray Data (LIMMA) package using R

languague. The expression level of each gene was determined by the fold change in the

untreated control group, and MFH treated group (43ºC and 30 minutes) transformed into a

log2 base for analysis. The original microarray data were uploaded to GEO with accession

number GSE92990

Quantitative Real-Time PCR

RNA was extracted from cells and tumor tissue using Direct-zol RNA MiniPrep (Zymo

Research). cDNA was synthesized from 1000 ng of RNA with Thermo Verso cDNA

Synthesis Kit (Thermo Fisher). Quantitative Real-Time PCR was performed using SYBR

Green (Thermo Fisher) on a 7500 Fast Real-Time PCR System and primers for HSPA6 and

HSPA7 (Integrated DNA Technologies). Specific primers for HSPA6 F-

CGCTGCGAGTCATTGAAATA, R-GAGATCTCGTCCATGGTGCT and HSPA7 F-

CAACCTGCTGGGGCGTTTTGA, R-CCGGCCCTTGTCATTGGTGATCTT, 18s were used

as an endogenous control.

Western Blot

Cells were lysed with RIPA (50 mM Tris-HCl, 150 mM NaCl, 1% Triton X-100, 0.5% sodium

deoxycholate, 0.1% SDS) incorporating the Protease Inhibitor sigmaFAST (Sigma-Aldrich).

Protein concentration was determined with Bradford Reagent (Sigma-Aldrich). Equal

amounts of protein were separated with 4-20% Mini-PROTEAN® TGX™ Gel (Bio-Rad

Laboratories) and transferred to a nitrocellulose membrane (Bio-Rad Laboratories). The

membrane was incubated with HSP70 antibody, 1:1000 (Novus Biological) and β Actin

Rabbit mAb 1:1000 (Cell Signaling) overnight. Primary antibody was detected with anti-




rabbit IgG, HRP-linked Antibody (Cell Signaling) and developed with SuperSignal WestPico

Chemiluminescent Substrate (Thermo Scientific) in Chemidoc XRS (Bio-Rad Laboratories).

PES Cytotoxicity in Ovarian Cancer Cells

Cells were seeded in 96-well plates in 200µL of media and allowed to attach overnight.

Cells were exposed to a concentration of PES between 5-30 µM for 24 and 48 hours. Cell

viability was measured with EZU4 assay (ALPCO) following manufacturer’s protocol.

Determination of Synergism

Combination index (CI) was evaluated using the proposed model of Chou-Talay with the

CompuSyn software (27). CompuSyn uses the median-drug effect analysis. Concentration-

effect curves were assumed to be sigmoidal for the single drug and the combination

treatment. Calculation of doses was performed by the median-effect equation. The

parameters used for the calculation were the fraction affected and PES and MFH exposure

time. Equations are described in the supplementary material.

In vitro siRNA Delivery and MFH

Cells were transfected with Lipofectamine RNAiMax (Invitrogen) at 2.5 µL of the reagent: 1

µg siRNA. HSPA6 siRNA from Rosetta Prediction Human (Sigma-Aldrich) was selected as

target gene, sequence 1: SASI_Hs01_00244829, sequence 2: HSPA7 1 and HSPA7 2,

sequence 3: SASI_Hs01_00244824 and sequence 4: SASI_Hs01_00244827 and

SASI_Hs01_00244829 and control siRNA was MISSION siRNA Universal Control #1




(Sigma-Aldrich) at a concentration 60.2 nmol/L or 100 nmol/L. A total 36 hours of

transfection was performed. MFH was applied, and cell viability was measured following 48

hours of incubation as previously described.

Liposomal Nanoparticle Preparation (siRNA-DOPC)

HSPA6 and control SiRNAs for in vivo delivery were incorporated into 1,2-dioleoyl-sn-

glycero-3-phosphatidylcholine (DOPC) nanoliposomes as previously described (28). DOPC

and siRNA were mixed in the presence of excess tertiary butanol at a ratio of 1:10 (w/w)

siRNA/DOPC. Tween 20 was added to the mixture in a ratio of 1:19 Tween

20:siRNA/DOPC. The mixture was vortexed, frozen in an acetone/dry ice bath and

lyophilized. Before in vivo administration, this preparation was hydrated with PBS.

Subcutaneous MFH and HSPA6 siRNA Delivery

Subcutaneous tumors were generated in an athymic nude mouse model. Studies were

performed according to the protocol approved by the M.D. Anderson Cancer Center

Institutional Animal Care and Use Committee. HeyA8 or A2780cp20 cells (1 x106)

suspended in 50 µl of Hank’s balance salt solution were injected subcutaneously in the

mice right flank on day 0, to obtain subcutaneous tumors on day 7. Tumor volumes were

35-113 mm3. siRNA liposomes injection started on day 7, 5 µg of HSPA6 siRNA or control

siRNA liposomes were injected intraperitoneally. Three MFH treatments and siRNA

deliveries were performed. The first MFH treatment was applied on day 9. Tumor volume

was calculated as (largest diameter)x(smallest diameter) ^2*π/6.




MFH started with iron oxide nanoparticles injected directly into the tumor (5 mgFe/cm3

tumor volume). Nanoparticles were injected for 30 seconds. The tip needle was removed

from the tumor after 5 min. MFH was applied 4 hours after nanoparticle injection to allow

particle distribution (29). Mice were anesthetized and placed inside the magnetic induction

coil of an EasyHeat 8310 LI (Ambrell) induction heater for 30 min at a magnetic field

intensity of 23 kA/m. The tumor was positioned in the center of the coil. The copper coil

consisted of 7.5 turns and an inner diameter of 3.16 cm. Warm water was circulated through

a plastic tubing to maintain the environmental temperature inside the coil at 37°C. Body

temperature was measured in the anus to guarantee mice safety. The external temperature

of the tumor and the surrounding wall was also measured with an NI-9211 thermocouple

signal conditioner and acquisition board (National Instruments) and type T thermocouples

(Omega Engineering).

Intraperitoneal tumor model and MFH

The intraperitoneal tumor was generated in an athymic nude mouse model. Studies were

performed according to the protocol approved by the M.D. Anderson Cancer Center

Institutional Animal Care and Use Committee. 2.5 x10 5 HeyA8 cells suspended in 200 ul of

Hank’s balance salt solution were injected directly into the peritoneal cavity (IP) of mice.

Treatment started 2 weeks later after cells IP injection. PES was injected a 10mg/Kg two

days before the first MFH. CMDx-IO nanoparticles were injected i.p.at 2mg Fe/mouse in

200uL of PBS the night before treatment. Next day mice were anesthetized with ketamine

and MFH applied for 30 minutes, with the same coil configuration previously described. The

temperature was also measured in the mouse belly.




Histology

Tumors were embedded in paraffin and cut (8 µm sections). Slides were deparaffinized,

and rehydrated. Prussian Blue, Iron Stain Kit (Sigma) was used following manufacturer’s

protocol.

Statistical analysis

Statistical analyzes were performed using Student’s t test (two tailed distributions, two

samples with unequal variables). For values that were not normally distributed, the Mann-

Whitney rank sum test was used. A p value of <0.05 was considered statistically significant.




Results

MFH in ovarian cancer cell lines

Four ovarian cancer cell lines, A2780 and HeyA8, and their corresponding drug resistant

sub-lines were exposed to MFH at various temperatures (41, 43, 45°C) and exposure times

(30 or 60 minutes). Cell viability was assessed after 48 hours of recovery (Figure 1A). No

significant change in cell viability was observed at 41°C for all cell lines. However, at 43°C,

a significant decrease in cell viability was observed for most cell lines. At 45°C, further

reduction in cell viability was observed for all cell lines. The thermal dose for each case was

calculated using cumulative equivalent minutes (CEM) as established by Dewey et al. (30).

Supplementary Table S.1 presents the CEM values for all conditions. Temperature and

exposure time affected CEM values and cell viability. Higher CEM values resulted in

enhaced cell death.

Gene expression in MFH in ovarian cancer cell lines

A gene array analyses was carried out to identify genomic changes resulting from exposure

of ovarian cancer cells to MFH. A control group of untreated HeyA8 cells and an

experimental group consisting of cells exposed to MFH for 30 min at 43°C were used. This

temperature was chosen since the aforementioned results indicated a substantial decrease

in cell viability when the temperature was increased from 41 to 43°C. Compared to controls,

60 genes were upregulated (by ≥1.5 fold) in treated cells. The top 20 upregulated genes are

presented Figure 1C. Supplementary table S.2 and S.3 present descriptions of each of the

dominant upregulated and downregulated genes.




Data was further analyzed using the Database for Annotation, Visualization and Integrated

Discovery (DAVID) and enrichment of Gene Ontology (GO) terms for significantly

expressed genes. From this analysis, three main biological functions were found to be

affected by MFH at 43°C, including response to unfolded proteins, response to protein

stimulus, and protein folding (Table 1). Top genes related to the aforementioned functions

affected by MFH were heat shock proteins, Hsp70 (HSPA6/HSPA7, HSPA1A, HSPA1B,

HSPA1L, HSPA4L), Hsp60 (LOC643300), Hsp40 (DNBAJ family), Hsp20 (CRYAB) and

Hsp27 (SERPINH1), and BAG3 (modulator of Hsp70). Besides HSPs, the gene ubiquitin C

(UBC) was also in the top ten upregulated genes after MFH. Figure 1B presents the

connection of HSPA6 with upregulated genes from the microarray.

To validate the results from the microarray, qRT-PCR was performed for HSPA6 and

HSPA7. Hsp70 was selected because it has a critical function in cancer cells and

hyperthermia. Hsp70 is overexpressed in various human cancers, playing different roles as

an inhibitor of apoptosis (31). HSPA6 and HSPA7 expression were confirmed by qRT-PCR,

and expression was measured for up to 8 hours following heat shock treatment (Figure 2A).

A2780cp20 showed significant expression at 1 hour for both genes. In HeyA8 cells, gene

expression was sustained for almost 4 hours at 41°C and 8 hours at 43°C.

Hsp70 protein level was also evaluated according to western blot. At 41°C, the highest

expression level was observed after 6 hours of MFH treatment. At 43°C, protein expression

for A2780cp20 cells increased after 1 hour of recovery time, and the highest expression

was observed at 6 hours after MFH (Figure 2B). HeyA8 cells showed no significant

differences in Hsp70 protein expression via Western blot (Supplementary figure S2.C).

HSPA6 (Hsp70) was selected as the target gene because it was the most upregulated (32).




Two approaches were performed to inhibit Hsp70 including gene silencing by siRNA and

protein function inhibition using PES.

HSPA6 siRNA enhanced the effects of MFH

A2780cp20 and HeyA8 cell lines were selected to further assess the efficacy of HSPA6

inhibition along with MFH (Figure 2). A2780cp20 and HeyA8 were selected according their

capability to create subcutaneous tumor models. First, several siRNA sequences were

investigated to evaluate their capacity to inhibit HSPA6 expression. Two siRNA sequences

per cell line were established for HSPA6 inhibition with 50-60% of gene knock down. For

HeyA8 cell line, seq # 1 at 60.2 nmol/L and seq #2 at 100 nmol/L were able to inhibit

HSPA6. In the case of A2780cp20 cells, seq #3 at 60.2 nmol/L and seq. #4 at 100 nmol/L

(Supplementary Figure S.2A) were also successful in inhibiting HSPA6. The in vitro siRNA

effects were evaluated in each cell line (Figure 2C-D). Combination treatment (HSPA6

siRNA + MFH) resulted in a higher decrease in cell viability when compared to MFH or

HSPA6 siRNA applied independently.

Anti-tumor effects of HSP70 inhibition and MFH in vitro

The effects of HSP70 inhibition using PES inhibitor were tested. PES cytotoxicity was

measured (Figure 3A) and results presented a reduction in cell viability as PES

concentration was increased. Supplementary table S.4 illustrates the IC50 values for PES

when exposed to ovarian cancer cell lines. A270cp20 cells showed lower IC50 values to

PES when compared to HeyA8 and SKOV3 cells. Previous work by Granato et al., revealed

PES affected membrane permeability since HSP70 supports lysosome membrane integrity,

especially in cancer cells (33). To confirm such mechanism in ovarian cancer cells

lysosomal permeabilization was measured. Results indicated that lysosome




permeabilization increased as the concentration of PES increased as depicted by the higher

percentage of pale cells (Supplementary figure S.3A). Lysosome permeabilization was also

investigated by imaging the release of cathepsin B into the cytosol. Cathepsin B in control

cells was located in lysosomes as small red points (Supplementary figure S.3B). In PES-

treated cells a diffuse pattern was observed, indicating the relocation of cathepsin B into the

cytosol confirming lysosome permeabilization (Figure S.3B).

The effect of in vitro combination treatment (MFH + PES) was assessed in ovarian cancer

cells (Figure 3B). PES concentrations were selected as to provide viabilities higher than

90% when used independently (Figure 3A and S.3E), 5uM for A2780cp20 and 10uM for

HeyA8 and SKOV3. Two MFH temperatures were selected, 41°C representative of mild

hyperthermia, and 43°C representative of hyperthermia. Combination treatment decreased

cell viability to approximately 40% at 41°C compared to MFH alone (Figure 3B). Results

indicated that the combination treatment generated a cytotoxic effect on cells, which could

indicate synergy. For this purpose, combination index (CI) (Figure 3C) was calculated using

the Chou-Talalay (27) and CompuSyn methods. Cell viabilities and dose response curves

from PES and MFH (Supplementary figure S.3E) were used to compute CI values. The

median effect principle of the mass-action law was evaluated using parameters described in

Supplementary table S.5. The degree of synergism defined by Chou and Marin was

analyzed (27). According to this analysis, A2780cp20 and HeyA8 cells at 41°C showed

slight synergism with PES treatment. Under similar conditions, SKOV3 cells also

demonstrated synergism. At a higher temperature (43°C), the effect of all cell lines was

synergistic. Further experiments were performed to evaluate synergy at various PES

concentrations and MFH exposure times. For this purpose, HeyA8 cells were exposed to

MFH at 30, 45 or 60 min in combination with 5, 10, and 20 uM. Results are illustrated in




Supplementary figure S.3D and the CIs shown in Supplementary table S.6 for each

experimental condition. Data demonstrated synergism for PES concentrations above 10uM

and all exposure times. These results confirmed that MFH applied in combination with non-

lethal doses of PES produced a synergistic effect.

HSPA6 silencing and MFH reduced tumor growth in vivo

To identify the in vivo effect of HSP70 inhibition during MFH, HSPA6 siRNA was used to

silence HSPA6 in a subcutaneous ovarian tumor model. siRNA was delivered with DOPC

nanoliposomes. Mice were divided into four groups, control siRNA-DOPC, control siRNA-

DOPC and MFH treatment, HSPA6 siRNA-DOPC and combined HSPA6 siRNA-DOPC with

MFH treatment. The efficacy of siRNA delivery and gene silencing was confirmed

(Supplementary figure S.2B). Figure 4A presents the experimental schedule. Research

demonstrated that reduction in tumor growth can be enhanced by the number of MFH

treatments(34,35). For this purpose, three MFH treatments were scheduled 48 hours apart.

CMDx-IO nanoparticles were injected intratumorally, 4 hours before treatment, to allow

them to distribute in the tumor. The siRNA-DOPC was administered according to previous

publications, two times per week and injected intraperitoneally (28). Tumor growth was

slower in groups that were treated with MFH when compared to those not treated with MFH

(Figure 4B and Supplementary figure S.4B). Supplementary table S.7 presents the

statistical values of the firnal tumor weight. By the end of the treatment, relative tumor

volume for the control groups and control siRNA-DOPC with MFH presented a 3-4.4 fold

increase when compared to their initial value whereas HSPA6 siRNA-DOPC was only a 1.4

fold. Final tumor weight for HSPA6 siRNA-DOPC and MFH was 65% lower than control

siRNA-DOPC and MFH (Figure 4C). The temperature profile is exhibited in Supplementary

figure S.4A. Tumor temperatures of 43˚C were reached.




A second tumor model was evaluated using the A2780cp20 cells under a similar treatment

schedule (Figure 4D-E). Tumor volume and weight were measured. Tumor weight for the

combination treatment, HSPA6 siRNA-DOPC and MFH, was ~65% smaller when compared

to MFH and control siRNA-DOPC groups. For the control groups and control siRNA-DOPC

MFH, an increase in relative tumor volume was observed with a fold increase between 2 -

6.6 . HSPA6 siRNA-DOPC and MFH presented a relative 0.7 fold change in volume.

HSPA6 inhibition improved the outcome of MFH treatment in subcutaneous models. The

biological effect of MFH was assessed for apoptosis. Caspase-3 activity was observed in

MFH treated tumors (Supplementary figure S.4B). The distribution of CMDx-IO

nanoparticles was evaluated in both tumors models using Prussian Blue (Figure 4F). Iron

oxide nanoparticles remained in the tumor tissue of both subcutaneous tumor models until

the tumor was collected at the end of the experiment.

MFH was also tested in the HeyA8 intraperitoneal tumor model in combination with PES.

Treatment started when PES was injected IP at day 12 after cells injection (Figure 5A). PES

dose was selected from previous reports where it was administered every 5 days

(25,36,37). The following day, CMDx-IO nanoparticles were injected IP, the technique

allows the internalization of nanoparticles in intraperitoneal tumors as described elsewhere

(38). At day 14 mice were exposed to MFH for 30 minutes. A total of three MFH treatment

and PES injection were performed. Mice were sacrificed when controls appeared moribund.

Tumor weight of PES and MFH treated mice (Figure 5B), was 65% smaller when compared

to control MFH group. Mice were monitored and no sign of sickness or pain were observed

days after MFH. Body weight and feeding habits remained unchanged. Results agreed with

in vitro outcomes of synergy between PES and MFH.




Discussion

The present work investigated the molecular and cellular responses of ovarian cancer cells

to MFH. We and others have attempted to elucidate the cellular and molecular features of

MFH; however, there are still aspects at the molecular level that need to be understood (6-

12). Results described herein indicated that there is overexpression of heat shock proteins,

in particular, Hsp70 as a result of MFH treatment. The resulting genomic analysis provided

the means to design targeted combination therapies using directed nanoscale heat delivery

with magnetic nanoparticles The inhibition of Hsp70 by RNA interference and the novel

Hsp70 inhibitor, PES, enhanced the effect of MFH both in vitro and in vivo in various

ovarian cancer cell lines and tumor models (subcutaneous and intraperitoneal).

Furthermore, in vitro observations with PES demonstrated, for the first time, that the

combined treatment resulted in a synergistic effect at mild hyperthermia temperatures.

Findings of this work also indicated that the intraperitoneal injection of iron oxide

nanoparticles is a feasible alternative to nanoparticle delivery to peritoneal tumors and that

MFH treatment can be successfully administered without damaging healthy tissue.

To further understand such cellular responses, gene expression and pathway analyses

were conducted. An experimental temperature of 43˚C was selected since an inflection

point in cell viability is observed for conventional hyperthermia (1,39). Such behavior was

also observed when MFH was applied as a sole treatment in vitro for various ovarian cancer

cell lines as described herein.

Results are supported by prior work demonstrating that heat shock proteins (HSPs) related

genes including Hsp70, Hsp40, Hsp105, Hsp110, Hsp47 and BAG3 are upregulated when

conventional hyperthermia was applied to cancerous and normal human cells (13,15,16,40-

44). However, such experiments have not been previously conducted for MFH treated




ovarian cancer cells or any other cancer cell line. The genetic analysis of the response of

ovarian cancer cells exposed to MFH revealed that several HSPs were upregulated as well

as ubiquitin C (UBC). These findings demonstrated that MFH upregulated the expression of

HSPs genes in ovarian cancer cell lines similar to conventional hyperthermia. Interestingly,

MFH also overexpressed UBC, which has not been previously reported as a top

overexpressed gene in microarray for conventional hyperthermia in treatments where the

range in thermal dose was between 7.5 to 60 cumulative equivalent minutes (CEM) (15,40-

42). At higher CEM (~300) ubiquitin genes expression have been reported (45,46). In this

particular work MFH treatments with a thermal dose of only 30 cumulative equivalent

minutes significantly upregulated UBC. These results may provide further evidence that the

extent of MFH damage in the cell might be more extensive than conventional hyperthermia

as reported by our group and others (6,7,12).

After studying the gene expression resulting from MFH at 43°C, Hsp70 was selected as it

was the most upregulated gene of the microarray, as confirmed by qPCR and Western Blot.

Additionally, Hsp70 is overexpressed in various cancer models, and high levels are

associated with poor prognosis (31). Hsp70 plays a significant role in cancer, suppressing

apoptosis and participate in tumor development. Under stress conditions, such as

hyperthermia, Hsp70 avoids accumulation of unfolded proteins and refold aggregated

proteins (31,47). Several Hsp70 inhibitors have been designed with favorable results in

vitro, but have failed efficacy in pre-clinical or clinical trials, with limitations as toxicity and

reduced antitumor effect (11,31,48,49). An alternative of two approaches were investigated

in this work, inhibition of Hsp70 by RNA interference and, inhibition of protein function using

PES.




Previous reports have demonstrated that Hsp90 inhibition in combination with MFH therapy

increased cell susceptibility to hyperthermia and in vivo tumor regression (50-52). Hsp90

inhibition is commonly used in hyperthermia because it plays a central role in cancer

signaling molecules, but research established that Hsp90 inhibition also upregulates Hsp70

production (50,51). The goal of this work was to demonstrate that only Hsp70 inhibition will

improve the antitumor effect of MFH.

Hsp70 knockdown with siRNA has been achieved in vitro in human colon cells, prostate and

the ovarian cancer cell line A2780 (37,53,54). The combination of Hsp70 RNA interference

with MFH has not been previously reported in vitro or in vivo. Results demonstrated that

HSPA6 inhibition with siRNA in combination with MFH enhanced treatment outcomes both

in vitro and in vivo. Data confirmed that Hsp70 inhibition and MFH appear as an effective

selective alternative, resulting in enhanced MFH therapeutic effects. The second approach

was to inhibit the Hsp70 protein function. An alternative to this approach was to employ

PES since it has been identified as a novel Hsp70 inhibitor with direct specificity. (25,36). In

this work, PES was able to reduce cell viability in various ovarian cancer cells by similar

mechanisms as those proposed in the literature (55,56). The combination of MFH and PES

resulted in a synergistic effect in ovarian cancer cells. This is the first time that synergy is

demonstrated from the combination treatment between PES and MFH. Sekihara, et al

demonstrated that when PES and conventional hyperthermia were combined in prostate

cancer cells the number of cells in early apoptosis and necrosis and late apoptosis were

increased, concluding that the cell death mechanism of the combination treatment partially

depended on the caspase pathway. Furthermore, they demonstrated that the combination

increased the number of cells in the G2/M phase and decreased the expression of cell cycle

related molecules such as c-Myc and cyclin D1 causing cell growth arrest (37). These




findings validated that Hsp70 protein function inhibition is enough to enhance the

therapeutic outcome of MFH.

Hsp70 inhibition and MFH were further evaluated in intraperitoneal tumor models with

peritoneal administration of nanoparticles. The reason to select this model is that

intratumoral injections are not practical in clinical settings. Besides, other methods such as

nanoparticle targeting for intravenous administration still face significant challenges

achieving the required levels of nanoparticle accumulation in tumors. Administration in the

peritoneal area of antineoplastic agents is currently an alternative for treating small tumors

located in the area. High drug concentrations and longer half-life can be achieved with IP

injections (57). Previous work has reported the IP administration of iron oxide nanoparticles

for MFH treatment in a mouse ovarian cancer model with peritoneal tumors but did not

assess tumor growth, focusing solely on demonstrating cell death through histological

analysis (38). In this work, we administered nanoparticles intraperitoneally to the HeyA8

intraperitoneal model and applied MFH. Results demonstrated that iron oxide nanoparticles

when injected IP in combination with MFH on intraperitoneal ovarian tumors showed an

antitumor effect. We were also able to enhance MFH therapeutic outcome with the

inhibition of HSP70 function using PES.

In summary, this work introduces the use of microarray gene expression to rationally

design targeted combination therapies using directed nanoscale heat delivery with magnetic

nanoparticles. Results demonstrated that MFH gene expression in ovarian cancer was

dominated by HSPs and ubiquitin C. Hsp70 was found to be the most upregulated gene and

its combination enhanced the effect of MFH in vitro and in vivo. In vitro combination

treatments demonstrated for the first time the synergistic behavior between MFH and PES.

The intraperitoneal delivery of iron oxide nanoparticles revealed that tumors were




significantly affected when the combined treatment of MFH and HSP70 inhibition was

applied. Therefore, results presented herein suggested that iron oxide magnetic

nanoparticles under the influence of an alternating magnetic field in combination with heat

response impairment drugs are a significant milestone for the translation of nano-based

adjuvant therapies for ovarian cancer into the clinic.




Acknowledgements

The authors are grateful to Dr Camilo Mora and Dr. Marisel Sánchez for their support in

confocal imaging and flow cytometer.




References

1. Hildebrandt B, Wust P, Ahlers O, Dieing A, Sreenivasa G, Kerner T, et al. The cellular and molecular basis of hyperthermia. Crit Rev Oncol Hematol 2002;43:33-56.

2. Torres-Lugo M, Rinaldi C. Thermal potentiation of chemotherapy by magnetic nanoparticles. Nanomedicine (Lond) 2013;8(10):1689-707 doi 10.2217/nnm.13.146.

3. Toraya-Brown S, Fiering S. Local tumour hyperthermia as immunotherapy for metastatic cancer. Int J Hyperthermia 2014;30:531-9

4. van der Zee J. Heating the patient: a promising approach? Ann Oncol 2002;13:1173-84.

5. Mahmoudi K, Hadjipanayis CG. The application of magnetic nanoparticles for the treatment of brain tumors. Front Chem 2014;2:109

6. Rodríguez-Luccioni HL, Latorre-Esteves M, Méndez-Vega J, Soto O, Rodríguez AR, Rinaldi C, et al. Enhanced reduction in cell viability by hyperthermia induced by magnetic nanoparticles. Int J Nanomedicine 2011;6:373-80

7. Alvarez-Berríos MP, Castillo A, Mendéz J, Soto O, Rinaldi C, Torres-Lugo M. Hyperthermic potentiation of cisplatin by magnetic nanoparticle heaters is correlated with an increase in cell membrane fluidity. Int J Nanomedicine 2013;8:1003-13

8. Alvarez-Berríos MP, Castillo A, Rinaldi C, Torres-Lugo M. Magnetic fluid hyperthermia enhances cytotoxicity of bortezomib in sensitive and resistant cancer cell lines. Int J Nanomedicine 2014;9:145-53

9. Lee JS, Rodríguez-Luccioni HL, Méndez J, Sood AK, Lpez-Berestein G, Rinaldi C, et al. Hyperthermia induced by magnetic nanoparticles improves the effectiveness of the anticancer drug cis-diamminedichloroplatinum. J Nanosci Nanotechnol 2011;11:4153-7.

10. Creixell M, Bohórquez AC, Torres-Lugo M, Rinaldi C. EGFR-targeted magnetic nanoparticle heaters kill cancer cells without a perceptible temperature rise. ACS Nano 2011;5:7124-9.

11. Domenech M, Marrero-Berrios I, Torres-Lugo M, Rinaldi C. Lysosomal membrane permeabilization by targeted magnetic nanoparticles in alternating magnetic fields. ACS Nano 2013;7:5091-101

12. Alvarez-Berrios MP, Castillo A, Merida F, Mendez J, Rinaldi C, Torres-Lugo M. Enhanced proteotoxic stress: one of the contributors for hyperthermic potentiation of the proteasome inhibitor bortezomib using magnetic nanoparticles. Biomater Sci 2015;3:391-400.

13. Tabuchi Y, Wada S, Furusawa Y, Ohtsuka K, Kondo T. Gene networks related to the cell death elicited by hyperthermia in human oral squamous cell carcinoma HSC-3 cells. Int J Mol Med 2012;29:380-6.

14. Walther W, Stein U. Heat-responsive gene expression for gene therapy. Adv Drug Deliv Rev 2009;61:641-9.

15. Tabuchi Y, Takasaki I, Wada S, Zhao QL, Hori T, Nomura T, et al. Genes and genetic networks responsive to mild hyperthermia in human lymphoma U937 cells. Int J Hyperthermia 2008;24:613-22.

16. Tabuchi Y, Furusawa Y, Kariya A, Wada S, Ohtsuka K, Kondo T. Common gene expression patterns responsive to mild temperature hyperthermia in normal human fibroblastic cells. Int J Hyperthermia 2013;29:38-50.




17. Sano T. Is peritoneal carcinomatosis an incurable disease or controllable locoregional condition? Challenge of surgeons with intraperitoneal hyperthermic chemotherapy. Japanese Journal of Clinical Oncology 2001;31:571-2

18. [Internet] Cg. April 2016. National Institutes of Health. Accessed 2016 April 2016. 19. Huo YR, Richards A, Liauw W, Morris DL. Hyperthermic intraperitoneal

chemotherapy (HIPEC) and cytoreductive surgery (CRS) in ovarian cancer: A systematic review and meta-analysis. Eur J Surg Oncol 2015;41:1578-89

20. Mulier S, Claes JP, Dierieck V, Amiel JO, Pahaut JP, Marcelis L, et al. Survival Benefit of Adding Hyperthermic IntraPEritoneal Chemotherapy (HIPEC) at the Different Time-points of Treatment of Ovarian Cancer: Review of Evidence. Current Pharmaceutical Design 2012;18:3793-803.

21. Eskander RN, Cripe J, Bristow RE. Intraperitoneal Chemotherapy from Armstrong to HIPEC: Challenges and Promise. Current Treatment Options in Oncology 2014;15:27-40.

22. Helm CW. Current Status and Future Directions of Cytoreductive Surgery and Hyperthermic Intraperitoneal Chemotherapy in the Treatment of Ovarian Cancer. Surgical Oncology Clinics of North America 2012;21:645.

23. Oyeniyi J, Wu J, Liu D, Yao JC, Green H, Albritton K, et al. Treatment of carcinomatosis using cytoreductive surgery and hyperthermic intraperitoneal chemotherapy in adolescents and young adults. American Journal of Surgery 2015;209:610-5.

24. van Driel WJ, Lok CAR, Verwaal V, Sonke GS. The Role of Hyperthermic Intraperitoneal Intraoperative Chemotherapy in Ovarian Cancer. Current Treatment Options in Oncology 2015;16.

25. Leu JI, Pimkina J, Frank A, Murphy ME, George DL. A small molecule inhibitor of inducible heat shock protein 70. Mol Cell 2009;36:15-27.

26. Herrera AP, Barrera C, Rinaldi C. Synthesis and functionalization of magnetite nanoparticles with aminopropylsilane and carboxymethyldextran. Journal of Materials Chemistry 2008;18:3650-4.

27. Chou TC. Theoretical basis, experimental design, and computerized simulation of synergism and antagonism in drug combination studies. Pharmacol Rev 2006;58:621-81.

28. Landen CN, Chavez-Reyes A, Bucana C, Schmandt R, Deavers MT, Lopez-Berestein G, et al. Therapeutic EphA2 gene targeting in vivo using neutral liposomal small interfering RNA delivery. Cancer Res 2005;65:6910-8.

29. Giustini AJ, Ivkov R, Hoopes PJ. Magnetic nanoparticle biodistribution following intratumoral administration. Nanotechnology 2011;22:345101.

30. Dewey WC. Arrhenius relationships from the molecule and cell to the clinic. Int J Hyperthermia 1994;10:457-83.

31. Sherman MY, Gabai VL. Hsp70 in cancer: back to the future. Oncogene 2015;34:4153-61.

32. Leung TK, Hall C, Rajendran M, Spurr NK, Lim L. The human heat-shock genes HSPA6 and HSPA7 are both expressed and localize to chromosome 1. Genomics 1992;12:74-9.

33. Granato M, Lacconi V, Peddis M, Lotti LV, Di Renzo L, Renzo LD, et al. HSP70 inhibition by 2-phenylethynesulfonamide induces lysosomal cathepsin D release and immunogenic cell death in primary effusion lymphoma. Cell Death Dis 2013;4:e730.




34. Wang G, Xu D, Chai Q, Tan X, Zhang Y, Gu N, et al. Magnetic fluid hyperthermia inhibits the growth of breast carcinoma and downregulates vascular endothelial growth factor expression. Oncol Lett 2014;7:1370-4.

35. Hou CH, Hou SM, Hsueh YS, Lin J, Wu HC, Lin FH. The in vivo performance of biomagnetic hydroxyapatite nanoparticles in cancer hyperthermia therapy. Biomaterials 2009;30:3956-60.

36. Leu JI, Pimkina J, Pandey P, Murphy ME, George DL. HSP70 inhibition by the small-molecule 2-phenylethynesulfonamide impairs protein clearance pathways in tumor cells. Mol Cancer Res 2011;9:936-47.

37. Sekihara K, Harashima N, Tongu M, Tamaki Y, Uchida N, Inomata T, et al. Pifithrin-μ, an inhibitor of heat-shock protein 70, can increase the antitumor effects of hyperthermia against human prostate cancer cells. PLoS One 2013;8:e78772.

38. Toraya-Brown S, Sheen MR, Baird JR, Barry S, Demidenko E, Turk MJ, et al. Phagocytes mediate targeting of iron oxide nanoparticles to tumors for cancer therapy. Integr Biol (Camb) 2013;5:159-71.

39. Dewey WC. Arrhenius relationships from the molecule and cell to the clinic. Int J Hyperthermia 2009;25:3-20.

40. Furusawa Y, Tabuchi Y, Takasaki I, Wada S, Ohtsuka K, Kondo T. Gene networks involved in apoptosis induced by hyperthermia in human lymphoma U937 cells. Cell Biol Int 2009;33:1253-62.

41. Furusawa Y, Tabuchi Y, Wada S, Takasaki I, Ohtsuka K, Kondo T. Identification of biological functions and gene networks regulated by heat stress in U937 human lymphoma cells. Int J Mol Med 2011;28:143-51.

42. Murray JI, Whitfield ML, Trinklein ND, Myers RM, Brown PO, Botstein D. Diverse and specific gene expression responses to stresses in cultured human cells. Mol Biol Cell 2004;15:2361-74.

43. Kariya A, Tabuchi Y, Yunoki T, Kondo T. Identification of common gene networks responsive to mild hyperthermia in human cancer cells. Int J Mol Med 2013;32:195-202.

44. Borkamo ED, Dahl O, Bruland O, Fluge O. Global gene expression analyses reveal changes in biological processes after hyperthermia in a rat glioma model. Int J Hyperthermia 2008;24:425-41.

45. Amaya C, Kurisetty V, Stiles J, Nyakeriga AM, Arumugam A, Lakshmanaswamy R, et al. A genomics approach to identify susceptibilities of breast cancer cells to "fever-range" hyperthermia. BMC Cancer 2014;14:81.

46. Fornace AJ, Alamo I, Hollander MC, Lamoreaux E. Ubiquitin mRNA is a major stress-induced transcript in mammalian cells. Nucleic Acids Res 1989;17:1215-30.

47. Richter K, Haslbeck M, Buchner J. The heat shock response: life on the verge of death. Mol Cell 2010;40:253-66.

48. Murphy ME. The HSP70 family and cancer. Carcinogenesis 2013;34:1181-8. 49. Powers MV, Clarke PA, Workman P. Death by chaperone: HSP90, HSP70 or both?

Cell Cycle 2009;8:518-26. 50. Tatokoro M, Koga F, Yoshida S, Kihara K. Heat shock protein 90 targeting therapy:

state of the art and future perspective. EXCLI J 2015;14:48-58. 51. Ito A, Saito H, Mitobe K, Minamiya Y, Takahashi N, Maruyama K, et al. Inhibition of

heat shock protein 90 sensitizes melanoma cells to thermosensitive ferromagnetic particle-mediated hyperthermia with low Curie temperature. Cancer Sci 2009;100:558-64.




52. Miyagawa T, Saito H, Minamiya Y, Mitobe K, Takashima S, Takahashi N, et al. Inhibition of Hsp90 and 70 sensitizes melanoma cells to hyperthermia using ferromagnetic particles with a low Curie temperature. Int J Clin Oncol 2014;19:722-30.

53. Noonan EJ, Place RF, Giardina C, Hightower LE. Hsp70B' regulation and function. Cell Stress Chaperones 2007;12:393-402.

54. Powers MV, Clarke PA, Workman P. Dual targeting of HSC70 and HSP72 inhibits HSP90 function and induces tumor-specific apoptosis. Cancer Cell 2008;14:250-62.

55. Nylandsted J, Gyrd-Hansen M, Danielewicz A, Fehrenbacher N, Lademann U, Høyer-Hansen M, et al. Heat shock protein 70 promotes cell survival by inhibiting lysosomal membrane permeabilization. J Exp Med 2004;200:425-35.

56. Budina-Kolomets A, Balaburski GM, Bondar A, Beeharry N, Yen T, Murphy ME. Comparison of the activity of three different HSP70 inhibitors on apoptosis, cell cycle arrest, autophagy inhibition, and HSP90 inhibition. Cancer Biol Ther 2014;15:194-9 d.

57. Markman M. Intraperitoneal chemotherapy is appropriate first line therapy for patients with optimally debulked ovarian cancer. Crit Rev Oncol Hematol 2001;38:171-5.




Table

Table 1. Biological functions after MFH treatment of HeyA8 cells (43˚C and 30 min)

Biological function Number of genes P value

Response to unfold proteins 14 9.99E-17

Response to protein

stimulus

15 8.43E-16

Protein folding 14 1.88E-11




Figure Legends

Figure 1. Gene expression after MFH in Ovarian Cancer Cells.

(A) Cell viability when MFH was applied to ovarian cancer cells at 41, 43, 45˚C for 30 and

60 min. (n=3) Error SE. (B) Pathway of up-regulated genes from IPA after MFH was applied

to HeyA8 cell lines for 30 min at 43˚C. (C) Top 20 upregulated genes after MFH was applied

to HeyA8 cell lines for 30 min at 43˚C. Analysis revealed a significant upregulation of

HSP70 related genes (One way ANOVA, n=3, p<0.02).

Figure 2. HSP70 genes are upregulated after MFH andHSPA6 RNA interference and MFH in vitro. (A) Levels of HSP70 genes were confirmed by quantitative real-time PCR after MFH

treatment for 30 min, three temperatures 39, 41, 43 ˚ C and up to 8 hours of recovery time.

Higher expression was observed after 1 hour recovery. (*p<0.05) (n=3). Error SD (B)

Western Blot of HSP70 protein level in A2780cp20 after 30 min MFH heat treatment at 41

and 43˚C, with recovery time of 1, 4 and 6 hours (C) MFH cell viability after HSPA6 gene is

knockdown with HSPA6 siRNA sequence 1 at 41 and 43˚C and sequence 2 at 41 ˚C in

HeyA8 cell line (D) A2780cp20 cell viability for sequence 3 and 4. cells treated with MFH at

41 C for 30 min (* p<0.05)

Figure 3. PES exposure results in significant cell death for ovarian cancer cell lines due to lysosomal damage and combination treatment is synergistic.

(A) Cytotoxicity for A2780cp20, HeyA8, and SKOV3 at 24 and 48h. (B) Combination

Treatment PES and MFH, HeyA8, A2780cp 20 and SKOV3 cell were treated with PES and

MFH at 41˚ C (Up) and 43 ˚ C (Down) for 30 min after 48 hours of recovery (C) Combination

Index of MFH and PES for ovarian cancer cell lines.

Figure 4. HSPA6 RNA interference and MFH decreased subcutaneous HeyA8 and A2780cp20 tumor model growth.

(A) Timeline for MFH in vivo. (B) Relative tumor volume in function of time of HeyA8 tumor

model (C) Ex vivo HeyA8 tumor weight. Number of mice 4-5 per group. (D) Relative tumor

volume of A2780cp20 tumor model (E) Ex vivo A2780cp20 tumor weight (F) Prussian Blue




staining to determine distribution of iron oxide nanoparticles from collected tumor from

A2780cp20 and HeyA8. (* p<0.05, ** p<0.01)

Figure 5. PES and MFH decrease orthotopic HeyA8 tumor model growth.

(A) Timeline for MFH in vivo (B) Ex vivo HeyA8 tumor weight. Number of mice 3-5 per

group




Published OnlineFirst February 21, 2017.Mol Cancer Ther Karem A. Court, Hiroto Hatakeyama, Sherry Y. Wu, et al. magnetic fluid hyperthermia in ovarian cancerHSP70 inhibition synergistically enhances the effects of

Updated version

10.1158/1535-7163.MCT-16-0519doi:

Access the most recent version of this article at:

Material

Supplementary

http://mct.aacrjournals.org/content/suppl/2017/02/21/1535-7163.MCT-16-0519.DC1

Access the most recent supplemental material at:

Manuscript

Authoredited. Author manuscripts have been peer reviewed and accepted for publication but have not yet been

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://mct.aacrjournals.org/content/early/2017/02/21/1535-7163.MCT-16-0519To request permission to re-use all or part of this article, use this link



http://mct.aacrjournals.org/lookup/doi/10.1158/1535-7163.MCT-16-0519

http://mct.aacrjournals.org/content/suppl/2017/02/21/1535-7163.MCT-16-0519.DC1

http://mct.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://mct.aacrjournals.org/content/early/2017/02/21/1535-7163.MCT-16-0519


in ovarian cancer · hsp70 inhibition synergistically enhances the effects of magnetic fluid...

Documents