INTERNATIONAL JOURNAL OF I , PROSY Volume 70, Number 4Printed in the U.S.A.

(ISSN 0148-916X)

Profiles of the mRNA Expression by MacrophagesInfected with Mycobacterium l and

Mycobacterium avium Complex 1

Toshiaki Shimizu, Haruaki Tomioka, Masanori Matsuoka, and Chiaki Sarno?

Profiles of cytokine (CK) expression inthe hosts infected with Mycobacterium lep-rae have been actively investigated. In par-ticular, Modlin and his colleagues demon-strated that mRNA encoding Th l CKs,including IL-2, IFN-y, and lymphotoxinwere detected at higher levels in tubercu-loid lesions, but virtually absent in lesionsof lepromatous leprosy patients. In contrast,Th2 CKs, such as IL-4, IL-5, and IL-10mRNAs, were present at higher levels in lep-romatous than in tuberculoid lesions ( 15 • 3" t

IL-12 produced by macrophages (M0s) in-fected with M. leprae facilitates a Th 1 re-sponse, which is closely associated withcell-mediated immunity against M. lepraeantigens, acts by activating NK cells to re-lease IFN-y, which in turn activates Th 1cells in collaboration with IL-12 ( 16, 26, 30). Inthe case of the host immune, responseagainst M. leprae, IL-12 and IL-18 pro-duced by M. leprae-infected MOs displaycollaborating effects in eliciting a Th 1 re-sponse ('"-' 3). Moreover, IL-7 and IL-15 pro-duced by infected MOs also facilitate T-cellactivation and expansion in response to M.leprae antigens ( 11 ' 25). On the other hand,IL-10 produced by MOs and IL-4 producedby Th2 cells, NK1.1 +T cells, or CD 19+/B22O+B cells suppress the Th 1 response,but facilitate the Th2 response against M.leprae antigens ( 1s • 24 ). Moreover, MO-

' Received for publication on 18 June 2001. Ac-cepted for publication on 7 October 2002.

T. Shimizu, M.S.; C. Sano, M.D., H. Tomioka,Ph.D., Department of Microbiology and Immunology,Shimane Medical University, Izumo, Shimane 693-8501, Japan. M. Matsuoka, Ph.D., Leprosy ResearchCenter, National Institute of Infectious Diseases,Tokyo, Japan.

Reprint requests to: Dr. H. Tomioka at the above ad-dress or Fax: 81-853-20-2145; E-mail:tomioka@shimane-med.ac.jp

derived IL- 10 and transforming growth fac-tor-(3 (TGF-43) are known to down-regulateM^ antimycobacterial activity ( 7 . 5 ). It is,thus, conceivable that MOs determine thehost immune response against M. leprae in-fection, not only by acting as antigen pro-cessing cells or bactericidal phagocytic ef-fector cells, but also by producing variouskinds of irnrnunoregulatory CKs.

Mycobacterium avium complex (MAC)has been reported to resemble M. lepraeboth taxonomically and biologically as fol-lows. First, MAC and M. leprae are highlyrelated and form a phylogenically tightcluster apart from other mycobacterialspecies, including slow growers and rapidgrowers ( 27). Second, although most M. lep-rae antigens have close homologs in theMycobacterium tuberculosis complex ( 2 '),the homolog of the 35-kDa antigen of M.leprae is found in MAC only C'). Third,electron microscopic studies showed that,after the entry of MAC, as well as M. lep-rae into host cells, including MOs and epi-thelial cells, the electron transparent zone(ETZ) consisting of bacterial mycosidesstarts to form and surrounds these bacilli in-side phagosomes ( 1 S• 2"). The presence of anETZ is considered to play a crucial role inbacterial resistance to the action of bacteri-cidal effectors provided in phagolysosomevesicles ( 19 ). In addition, MAC organismsare frequently isolated from human lepro-mas. It has been reported that co-infectionof MAC with M. leprae increases thepathogenicity of leprosy bacilli and facili-tates the progression of the disease in vivo,presumably enhancing metabolic activity ofthe organisms C 2 ).

These situations encouraged us to inves-tigate profiles of the interaction of M. lep-rae and MAC with host M4s in terms ofCK expression by MOs. In the present study,

250

70, 4 Shimizu, et al.: mRNA Expression by MO 251

we have found some differential modes ofCK mRNA expression of M44s infected withM. leprae or MAC.

MATERIALS AND METHODSMicroorganisms. M. leprae Thai-53

strain was harvested from infected footpadsof BALB/c nude mice, and bacterial sus-pensions were prepared as follows ( 23). Theinfected footpads were homogenized inHanks' balanced salt solution (HBSS) con-taining 5% fetal bovine serum (FBS) andcentrifuged at 200 x ç' for 5 min. The upperlayer was saved and the bacilli were col-lected by recentrifugation at 1500 x g for 15min. The bacterial suspension was againcentrifuged at 200 x g for 5 min, to removebacterial clusters and the upper layer (about90% volume) was harvested. The resultantbacterial suspension was then treated with0.1 N NaOH for I min, neutralized with 0. IN HCI, centrifuged at 1500 x g for 15 min.The resultant sediment was suspended into10 ml of RPMI 1640 medium. pronase-Pwas added at 0.5 mu/ml. incubated at 37°Cfor 2 hr. and the pronase-P reaction wasstopped by the addition of bovine serum al-bumin (BSA) at 0.7%. After washing twicewith phosphate buffered saline (pH 7.2)containing 0.1% BSA by centrifugation, theresultant bacterial pellet was suspended intoRPMI 1640 medium supplemented with10% FBS. The viability of M. leprae organ-isms before and after pronase-P treatmentwas determined by the fluorescein di-acetate/ethidium bromide (FDA/EB) stain-ing according to the method of Tsukiyama,et al. ( 32 ). The percentage of green-stainedviable cells in the M. leprae preparation be-fore and after pronase-P treatment was esti-mated as 87.5 ± 1.2% and 86.2 ± 1.4% (n =3). This indicates that pronase-P treatmentdid not cause severe damage in the cell sur-face of the M. leprae organisms.

Virulent SmT variant of MAC N-260strain, showing smooth, transparent and ir-regularly-shaped colonies and avirulentSmD variant, showing smooth, opaque, anddome-shaped colonies (`') were used. MACN-260 strain was identified as M. intracel-lalare by a DNA probe test, and determinedto belong to serovar 16 by an agglutinationtest. MAC organisms were grown in Mid-dlebrook 7H9 medium and bacterial sus-pensions prepared with 0.1% BSA-PBS

were frozen at —80°C until use. Before use,the bacterial suspension was centrifuged at200 x g for 5 min to remove bacterialclumps.

Expression of cytokine mRNA by M.leprae- or MAC-infected M4s. MO mono-layer cultures prepared by seeding 5 x 106

peritoneal cells of 8- to 12-week-old maleBALB/c mice on 60 mm culture disheswere incubated in 5 ml of 10% FBS-RPMI1640 medium at 37°C for 48 hr in a CO,_in-cubator (5% CO,-95% humidified air). Af-ter washing with Hanks' balanced salt solu-tion (HBSS) containing 2% FBS, the M4swere cultured in 5 nil of the medium con-taining I x 10' bacilli/ml (CFU/ml forMAC) of test organisms at 37°C in a CO,incubator for up to 24 hr.

At intervals, cultured MOs were har-vested and reverse transcription (RT)-PCRanalysis of the mRNAs expression of testCKs (IL-12 p40, TNF-a, IL-10, TGF-(3),inducible nitric oxide synthase (iNOS), andICAM-I in the MOs was performed as de-scribed previously ( 21 ) with slight modifica-tions. Total RNA was isolated from the MOsusing the ISOGEN kit (Nippon Gene Co.,Toyama, Japan). After deoxyribonuclease-I(DNase-I) (GIBCO BRL Co., Rockville,Maryland, U.S.A.) treatment (1 unit DNase-1/.tg of RNA sample) at room temperaturefor 15 min, the resultant RNA samples werereverse transcribed to the first chain ofcDNA using oligo dT primers (GIBCO) and200 units Superscript II reverse transcrip-tase (GIBCO) with the standard reactionmixture (20 !I): 1 x reverse transcriptase(RT) buffer (pH 8.3), 1 mM each dNTP in-cluding dATP, dCTP, dGTP and dTTP(GIBCO), and 2.0 units of ribonuclease in-hibitor (GIBCO). After 1-hr reaction at42°C and subsequent heating at 72°C for ISmin, I pl of aliquots of resultant cDNAwere amplified specifically by PCR in thestandard reaction mixture (50 µl) contain-ing I x PCR buffer (pH 8.3), 0.2 mM ofeach dNTP, I unit of Taq polymerase(Takara Biomedicals Co., Tokyo, Japan),and 20 pmoles of sense and antisenseprimers for test proteins (synthesized byGreiner Labortechnik Co., Tokyo, Japan) asfollows (sense/antisense): iL-12 p40 (CGTGCTCATGGCTGGTGCAAAG/CTTCATCTGCAAGTTCTTG GGC): TNF-a (AGCCCACGTCGTAGCAAACCACCAA/AC

252 International Journal of Leprosy 2002

ACCCATTCCCTTC ACAGAGCAAT); IL-10 (TGACTGGCATGAGGATC AGCAG/ATCCTGAGGGTCTTCAGCTT); TGF431(AGCCCTGGATACCAACTATTGCTTCAGCTCCACAG/AGGGGCGGGGCGGGQCGGGGCTTCAGCTGC); iNOS (CCTGCTCACTCAGCCAAG/AGTCATGGAGCCGCTGCT); and ICAM-1 (CAGGAGAGCACAAACAGCAGTG/AGAGCGGCAGAGCAAAAGAAGC). Reactions were car-ried out in a DNA Thermal Cycler (ASTECCorp., Fukuoka, Japan) for 25 cycles in-cluding denaturing at 94°C for 1 min, an-nealing at 58°C for 2 min,n, and extension at72°C for 2 min for each cycle. PCR prod-ucts were analyzed by electrophoresis onethidium bromide-stained 2% agarose gels.

In some experiments, CK mRNA expres-sion by MOs was measured by the ribonu-clease (RNase) protection assay using Ribo-(pantTM Multi-Probe RNase Protection As-say System (Pharm i ngen Co., San Diego,California, U.S.A.) according to the manu-facturer's instruction manual. In this study,mCK-2b and mCK-3 mouse cytokine multi-probe template sets were used for measure-ment of cytokine mRNAs as follows: mCK-2b: IL-10 and IL-12 p40 mRNAs; mCK-3:TNF-oc and TGF-13 mRNAs.

RESULTSExpression of CK mRNAs by M. lep-

rue-infected MOs. The time-course of theexpression of IL-12, a proinliammatory CKTNF-a, and immunosuppressive CKs (IL-10, TGF-f3) in MOs stimulated with M. lep-rae infection was examined by the RT-PCRassay. Fig. 1 shows the profiles of themRNA expression of these CKs by MOsduring chase cultivation after M. leprae in-fection. IL-12 p40 mRNA expression wasnot observed for MOs at least during 24-hrcultivation after infection. Second, TNF-amRNA expression was remarkably in-creased at 3 hr after infection, and there-after, gradually declined until 24 hr. TheTNF-oc mRNA expression was at a consid-erably high level even at 24 hr. Third, IL-10mRNA expression was somewhat increasedat 3 hr after infection, and, thereafter,rapidly ceased, reaching an undetectablelevel by 12 hr. Fourth, TGF-13 mRNA ex-pression was slightly increased at 3 hr afterinfection, followed by a gradual decreasereaching the normal level at 24 hr. Notably,

0 3 6 12 24hr

(o) (0) (0) (0) (0)

■ ` NO w r

(0.01) (0.90) (0.86) (0.22) (0.56)•(0) (0.34) (0.12) (0.02) (0.03)

r

(0.10) (0.21) (0.16) (0.07) (0.13)

=1010 ill MI asFIG. 1. Expression of IL-12 p40, TNF-a, IL-10,

and TGF-J3 mRNAs by MO infected with M. h' nac.The relative intensities of the RT-PCR bands of indi-vidual cytokines were calculated by normalizing to theintensity of the P-act in hand. The values in parenthesesare cytokine hand/f3-actin hand ratios.

the IFN-y (500 units/ml) treatment yieldedno obvious change in the modes of CKmRNA expression of M. leprae-infectedMOs (unpublished observation).

Expression of CK mRNAs by MAC-infected MOs. Fig. 2 shows MO mRNA ex-pression profiles measured by the RT-PCRassay of IL-12, TNF-a, IL-10, and TGF-f3after infection with MAC organisms withdifferent levels of virulence, a virulent SmTvariant and an avirulent SmD variant. ThemRNA expression of IL-12 p40 was in-creased in MOs infected with MAC SmTvariant as well as in those infected withMAC SmD variant at 3 hr after infection.The mRNA expression, thereafter, graduallydecreased, and almost disappeared at 24 hr.Second, TNF-a mRNA expression wasmarkedly increased at 2 hr after MAC SmTas well as MAC SmD infection, and, there-after, gradually declined until 24 hr. The in-tensities of TNF-a mRNA expression ofMAC SmT- and MAC SmD-infected Mcpswere nearly identical. Notably, intense ex-pression was still seen for the TNF-a

IL-12 p40

TNF-a

L-10

TGF-P

¡3-actin

Time afterinfection (hr)

Relative intensity of mRNA expressionof Mt s infected with:

MAC M. leprae and MAC

Cytokinel4. leprue

036

1224

036

122448

00.301.191.400

0.589.462.710.410.090.05

On1.48000

0.584.604.860.770.250.10

003.0800

0.5900

00.61000

0.586.894.420.590.300.04

02.281.050

TGF-fi 036

122448

0.601.271.380.340.290.12

0.601.361.190.480.060.12

0.601.08I.000.600. 2 30.13

70, 4 Shimizu, et al.: mRNA Expression by MO 253

THE TABLE. Expression of IL-12 p40, TNF-a, IL-10, and TGF-/3 mRNAs by Mksinfected with MAC N-260 or M. leprae alone or co-infected with both organisms.'

IL-12 p40

TNF-a

IL-10 036

12

The relative intensity of each CK mRNA expression in terms of CK/L32 band ratios were estimated from thedata indicated in Fig. 4.

'' Undetectable.

mRNA even at 24 hr. Third, IL-10 mRNAexpression was increased at 3 hr after MACSmT and MAC SmD infection. The mRNAexpression was retained at the same levelsduring 3 to 6 hr, and, thereafter, graduallydeclined until 24 hr. Notably, IL-10 mRNAexpression during 3 to 6 hr was muchstronger in MAC SmD-infected M4s thanin MAC SmT-infected MOs. Fourth, TGF-(3mRNA was constitutively expressed by un-infected MOs. Both MAC SmT and MACSmD infections caused a moderate increasein TGF-f3 mRNA expression at 3 hr, and theincreased level of TGF-43 mRNA expres-sion was retained until 24 hr. In separate ex-periments, the increase in TGF-f3 mRNAexpression lasted at least for 48 hr (data notshown). Similar levels of TGF-f3 mRNAexpression were seen for MOs infected withMAC SmT and those infected with MACSmD. Notably, the IFN-y (500 units/ml)treatment yielded no obvious change in themodes of CK mRNA expression of MACN-260-infected Mks (unpublished observa-tion).

Expression of CK mRNA by MOs co-infected with M. leprae and MAC. It hasbeen reported that co-infection of MACwith M. leprae increases the pathogenicityof leprosy bacilli and facilitates the progres-sion of the disease in vivo ( 14). Thus, it is ofinterest to examine the mode of CK mRNAexpression by MOs co-infected with M. lep-rae and MAC. For this purpose, we mea-sured the expression of IL-12, TNF-a, IL-10 and TGF-13 mRNAs by MOs co-infectedwith both organisms by the RNase protec-tion assay. As shown in Fig. 3 and TheTable, MOs co-infected with both organ-isms showed the mRNA expression of IL-12, TNF-a, and IL-10 in an intermediatemode for those of MOs infected with eitherM. leprae or MAC alone. The levels of IL-12 and 1L-10 mRNA expression seen inMips infected with M. leprae alone were de-creased due to co-infection with MAC,while the opposite phenomenon was ob-served for TNF-a, mRNA expression. Onthe other hand, the level of TGF-13 mRNAexpression was somewhat decreased in M(1)s

(0) (0.16) (0.1) (0.04) (0.02) (0) (0.09) (0.06) (0.03) (0.02) (0)

r►r as Mil -

(0.1) (0.84) (0.8) (0.74) (0.69) (0.63)

(0) (0.23) (0.28) (0.18) (0.17) (0.15) (0.45) (0.43) (0.26) (0.25) (0.20)

01.41M■ eml am or MS OM 41110111 Ins Owe am am.

(0.17) (0.38) (0.33) (0.28) (0.36) (0.33) (0.26) (0.25) (0.26) (0.33) (0.27)

IL-12 p40

TNF-a

IL-10

TGF-B

(0.70) (0.74) (0.71) (0.55) (0.45)

M.leprae MACM.leprae

MAC

254 International Journal of ' Leprosy 2002

MAC SmT MAC SmD0 3 6 12 18 24hr 3 6 12 18 24hr

FIG. 2. Expression of IL-12 p40, TNF-a, IL-10, and TGF-P mRNAs by MOs infected with MAC SmT orSmD colonial variant. The other details are the same as those described in the legend of Fig. I .

IL-12 p40

TNF-a

IL-10

TGF-0

ids- III r

AMP, 0. IMP is sob 111MIL 111111111; f

U S\ I O1 IIIL32 III Mk.;

0 3 6 12 24 48 3 6 12 24 48 3 6 12 24 48

Time after infection (hr)FIG. 3. Expression of IL-12 p40, TNF-a, IL-10, and TGF-P nfRNAs by M4s infected with M. le¡nrue or

MAC alone or co-infected with both organisms. CK mRNA expression by MOs was measured by the RNase pro-tection assay. The rnRNA expression of L32, a housekeeping gene, was measured as the positive control of con-stitutive mRNA expression.

(0) (0) (0) (0) (0) (0,03) (0.43) (0.45) (0.51) (0.43) (0.50) (0.20) (0.26) (0.25) (017) (0.30)

- •• ---- - - ---

(0.10) (0.38) (0.30) (0.11) (0.13) (0.33) (0.55) (0.40) (0.37) (0.48) (0.40) (0.48) (0.47) (0.40) (0.26) (0.23)

GO ell OSOD

iNOS

ICAM-1

13-actin

70, 4 ,S7uii i„u, et al.: inRNA Expression by MO 255

M.leprae MAC SmT MAC SmD0 3 6 12 24hr 0 3 6 12 18 24hr 3 6 12 18 24hr

Flo. 4. Expression of iNOS and ICAM-1 inRNAs by Mks infected with M. leprcre or MAC. The other de-

tails arc the same as those described in the legend of Fig. I.

co-infected with both organisms as com-pared with those of MOs infected with eachorganism alone.

Éxpression of iNOS and ICAM-1mRNA by M. leprae- and MAC-infectedMOS. Fig. 4 shows MO mRNA expressionprofiles of iNOS and an adhesion moleculeICAM-1 measured by the RT-PCR assay,when Mats were infected with either M. lep-roe or MAC. MAC infection caused amarked increase in the iNOS mRNA ex-pression by MOs at 3 hr post infection,whereas M. leprae infection failed to showsuch an effect. The increase in iNOSmRNA expression in MAC-infected MOslasted at least for 24 hr. Notably, MACSmT-infected M4s expressed strongermRNA during 3 hr to 24 hr than did MACSmD-infected MOs. Second, ICAM-1mRNA was constitutively expressed by un-infected MOs. The mRNA expression ofICAM-1 was increased in M0s at 3 hr afterinfection with M. leprae, as well as MACSmT or MAC SmD. and, thereafter, gradu-ally decreased until 24 hr. Similar levels ofICAM-1 mRNA expression were noted forMAC SmT- and MAC StnD-infected MOs.These results on ICAM- I mRNA expres-sion are consistent with our previous find-ings concerning ICAM- I expression in aprotein level by M. leprae- and MAC-infected M4)s ( 23 . 30 ).

DISCUSSIONThe present study revealed some differ-

ences in the profiles of MO expression ofCK and other protein genes between M.leprae- and MAC-infected Mks, as follows.

Although weak but significant increase inthe IL-12 p40 mRNA expression was notedfor MAC-infected MOs in the early-phase(3 hr) after infection, such a phenomenonwas not observed for M. /eprae-infectedMOs. The latter finding is enigmatic, sincethe important role of MO-derived IL-12 inthe establishment of Th I response in M./eprae-infected hosts has been well docu-mented ( 14, '6.20, 20 ). Moreover, in the case ofM. leprae infection in mice without immuno-deficiency, bacterial growth at the sites ofinfection is well controlled due to strongexpression of anti-M. leprae cellular immu-nity that is mediated by host Th I cells inhumans ( 14 .' 0 . 20̀ . 33) and in mice (2 . 4 . 3 ). It ap-pears that this strange situation may be at-tributable to our experimental conditions,particularly that we used marine residentperitoneal MOs. That is, efficient productionof IL-12 by M. /eprae-infected M4)s may re-quired additional stimulatory signals otherthan phagocytosis of the organisms. It islikely that priming of MOs with certainstimulants, that is deficient in resident MOs,may be prerequisite for the gene expressionof IL-12 induced by engulfment of M. lep-rae organisms. Concerning this point, fur-ther studies are needed.

In the case of MAC-infected MOs, the in-creased levels of IL- 10 mRNA expression at3 hr were maintained for long time periodsafter infection (at least until 24 hr). On theother hand, in the case of M. /eprae-infectedM(ps, IL-10 mRNA expression, which wasincreased at 3 hr post infection, rapidly de-clined, reaching the undetectable level by 12hr. However, M. leprae infection caused a

256 International Journal of Leprosy 2002

considerably stable expression of TNF-otand ICAM- l mRNA for 24 hr after infec-tion. The instability of IL- 10 mRNA expres-sion in M. leprae-infected MOs may he dueto rapid down-regulation of the IL-10mRNA transcription after 3 hr, rather thandue to rapid decay of IL-10 mRNA itself.

It has been proposed that immunosup-pressing cytokines, such as IL-10 and TGF-[3,play important roles in the establishment ofpersistent infections by pathogenic myco-bacteria, including MAC and M. leprae, ei-ther by down-regulating MO antimycobac-terial functions (7.8.24,29\ or by attenuatingmycobacteria-induced apoptosis cou-pled with the elimination of intramacro-phage organisms C. ' 7 ). However, as indi-cated in Fig. 1, the mRNA expression ofthese cytokines was not stronger in MOs in-fected with virulent MAC (SmT variant)than in those infected with avirulent MAC(SmD variant). Notably, IL-10 mRNA ex-pression of MAC SmT-infected MOs wasconversely much weaker than that of MACSmD-infected M4s. These findings suggestthe possibility that neither IL-10 nor TGF-f3may play crucial roles in the mechanismsfor bacterial escape from MO antimicrobialmechanisms. However, further in vivo stud-ies are needed to reveal detailed profiles ofthe CK expression in granulomas of M. lep-rae-infected animals before such a conclu-sion is made.

Co-infection of MAC to M. leprae-infected mice is known to increase the patho-genicity of leprosy bacilli and facilitate theprogression of the disease in mice C 2 ). Inthe present study, it was found that MOs co-infected with both M. leprae and MACshowed the CK mRNA expression (exceptfor TGF-f3) in an intermediate mode ofthose of M4s infected with either M. lepraeor MAC alone. This implies that the CK ex-pression of M. /eprae-infected MOs may bemodified by co-infection with MAC. No-tably, the IL-12 mRNA expression of M.leprae-infected MOs at 3 hr after infectionwas reduced to less than half of the originallevel (ca. 60% reduction) due to MAC co-infection. Moreover, Mks co-infected withboth of these organisms failed to showdurable expression of IL-12 mRNA, as ob-served in the case of MOs infected withMAC alone during 3 hr to 12 hr after infec-tion. Thus, it is implicated that anti-M. lep-

rae Th 1 response of host animals may behindered due to co-infection with MAC.This may account for the increase in thepathogenicity of M. leprae, when M. h'p-rae- i n fected mice were further co-infectedwith MAC organisms ( 12 ).

Although MAC-infected MO displayedmarkedly increased iNOS mRNA expres-sion during 3 hr to 24 hr after infection,such all increase in the i NOS gene expres-sion was not noted for M. leprae-infectedMOs. Notably, reactive nitrogen intermedi-ates, including nitric oxide radical producedby iNOS, play crucial roles in MO antimi-crobial nmechanisms against mycobacteria,including M. tuberculosis, MAC, and M.leprae (

' y• 22 • 0 ). It, thus, appears that thedefect of M. leprae in inducing the iNOSexpression by M4s phagocytizing the or-ganisms plays a favorable role for the or-ganisms in escaping from MO antimicrobialmechanisms.

In summary, the present study revealedthat there are noticeable differences in themodes of the mRNA expression of IL-12,IL-10, and iNOS in M. leprae-infectedMOs, as compared to MAC-infected MOs.These findings may suggest differential in-teractions of M. leprae and MAC organ-isms with marine peritoneal NW' in termsof the activation of signal transductionpathways for expression of some kinds ofinimunoregulatory cytokines and imn uno-protective enzymes. Further investigationsare needed to elucidate the precise meaningof these findings, in particular the studiesusing peritoneal M4s, which are givenpriming with various stimulants before my-cobacterial infection, or blood monocyte-derived MOs. On this point, further studiesare currently under way.

SUMMARY'In the present study, we examined pro-

files of the interaction of Mycobacteriumleprae and Mycobacterium avium complex(MAC) with marine peritoneal macro-phages (MO) in terms of up-regulation ofMO expression of proinflaminatory and i m-munosuppressing cytolines (CKs) after in-fection. First, the reverse transcriptionpolymerase chain reaction (RT PCR) assayrevealed that both MAC and M. leprae in-fections up-regulated MO mRNA expres-sion IL-12, TNF-oc, IL- 10, and transform-

70. 4 Shimizu, et al.: ,nRNA Expression by MO 257

ing growth factor-13 (TGF - f3), except thatM. leprae - infected MOs showed no in-crease in the IL-12 mRNA expression. Sec-ond. the RT-PCR assay also showed somedifferences between M. leprae- and MAC-infected MOs with respect to the modes ofIL-IO and inducible nitric oxide synthase(iNOS) mRNA expression. That is MAC,hut not M. leprae, infection caused a pro-longed increase in the expression of IL-10and iNOS mRNAs. Third, a ribonucleaseprotection assay revealed that MOs co-infected with MAC and M. leprae showedthe IL-12, TNF-a and 1L-10 mRNA ex-pression in an intermediate mode of thoseof Mos infected with either M. leprae orMAC alone. This implies that the CK ex-pression of M. leprae-infected Mis may bemodified by co-infection with MAC. Thesefindings may suggest differential interac-tions of M. leprue and MAC organismswith murine peritoneal Mis in terms of theactivation of signal transduction pathwaysfor expression of some kinds of im-munoregulatory cytokines and immuno-protective enzymes.

RESUMENSe infectaron macrófagos peritoneales inurinos con

Mycobacterium lepra' y Mwohacrerii (, rr anuiu com-plejo (MAC). y se examinaron los perfiles de expre-

sión de citocinas (CKs) proinflamatorias e inmuno-supresoras consecuentes a la infección. Primevo, lavcaceión en cadena de la transcriptasa reversa (RT-PCR) reveló que tanto la infección por MAC como porM. leprae, sohreactivaroo la expresión de los mRNAspara 11,-12, TNFa, IL-10, y el factor (3 del crecimientotransformante (TGF-f3). 'lambido se observó, que adiferencia de los macrófagos infectados con MAC. losinfectados con M. leprae no mostraron ningún incre-mento en la expresión del mRNA para IL-12. Se-gundo, el ensayo de RT-PCR nostró algunas diferen-cias entre los macrófagos infectados con M. leprae yMAC con respecto a los modos de expresión de lostiRNAs para IL-I0 e iNOS. Concretamente, la infec-ción por MAC, peto no por M. lepra', causó un incre-mento prolongado en la expresión de los tuRNAs paraIL- 10 e iNOS. Terceto. un ensayo de protecciOn de laribonucleasa reveló que los macrcífagos co-infectadoscon MAC y M. leprae, mostraron un patrón de expre-sión de los mRNA para IL-12. TNFa, e IL-10, inter-medio entre los patrones moscados por los macrófa-gos infectados con los microorganismos por separado.Esto implica que la expresión de CKs por los macrófa-gos infectados con M. lepra', puede ser modificadopor la co-infecciOn con MAC. Los resultados sueierenque M. leprae y MAC interaccionan de ntanera difer-ente con los macráfagos taurinos y que esto se retleja

en la activación de diferentes vias de senalizacicín rela-cionadas con la síntesis de citocinas inmunorreculado-ras e inmunoprotectoras.

RÉSUMÉ

Dans cette étudc, nous aeons examiné les profitsd'expression des cytokines (CKs) pro-inflammatoireset immunosuppressives issus de ('interaction de Mvco-hm'ic/ir au leprae et du complexo de Mycobacteriumaviam (MAC) avec des macrophages morins (M0s), enterme cl'augmentation dc ['expression d'ARNm desCKs des macrophages après infection. Premièrement,l'essai de transcription inverse suivic de reaction depolymérase en amine (R'I'-PCR) a monad que l'infcc-lion rant par MAC et que par M. lepra' au gtnenlait('expression de 1L-12.'l'NF-ct, IL-10 cl du facteur decroissance induisant la transformation de type 13(TGF-f3). sauí que les macrophages infectés par M.leprae n'ont pas montré cl'augmentation de I'expres-sion de I'ARNm de 1'II,-I2. Deuxiemement, l'essai deRT-PCR a aussi niontré quelques différences entre lesMips infectés par M. leprae et les MOs infectes parMAC en ce qui concerne les nodes d'expression deI'ARN-nu de I'IL-10 et de la synthétase inductible dumonoxide d'azote (iNOS). Plus précisément. I'infcc-tion par MAC, mais pas M. lepra', provoque une aug-mentation prolongée des faux d'ARNto de I'IL-10 etde la iNOS. Troisièmement. un essai de protectioncontrc la digestion par les ribonucléases a révélé queles MOs coinfcctés par MAC et M. lepra' montraientun niveau intermédiaire d'expression des ARNm ele1'11.-12. de TNF-a et de l' IL-10 par rapport ìt ccux ex-primés clans les Mips infectés par M. /opta' ou MACsails. Ceci implique que ('expression des CKs desMOs infectés par M. leprae pr a t are nodifide par unecoinfc'iion avec MAC. Ces données suggerent une in-teraction ditfétenticlIe de M. leprae et eles micro-organismes du MAC avec les Mips péritonéaux deSouris au niveau des voies de transduction des signauxintraco1Iulaircs pour ('expression ele Certaimes Cy-tokines immunorégulatrices et d'enzymcs induisantune immunoprotectiov.

Acknowledgments. This study was supported inpart by grants from the Ministry of Education. Culture.Sports, Science and Technology of Japan and the Min-istry of Public I Iealth. labour. and Welfare of Japan.

REFERENCESI. ADAMS. L. B., Jots. C. K. and KRAHENBUnI., J. L.

Role of inducible nitric oxide synthase in resis-tance to Mycobacterium leprae in mice. Infect.Immun. 68 (2000) 5462-5465.

2. ADAMS, L. B.. SCOLLARD, D. M., RAY, N. A..COOPER, A. M., FRANK, A. A.. ORn:, 1. M. andKRAHENButuf,, J. L. The study of Mycobacterium/eprae infection in interferon-gamma gene-disrupted mice as a model to explore the im-nttnwpathologic spectrum of leprosy. J. Infect.Dis. 185 (2002). S I—S8.

258 International Journal of Leprosy 2002

3. AKAKI, T., TOMIOKA, H., SHIMiZU, T., DEKIO, S.and SATO, K. Comparative roles of free fatty acidswith reactive nitrogen intermediates and reactiveoxygen intermediates in expression of the anti-microbial activity of macrophages against Myco-bacterium tuberculosis. Clin. Exp. Immunol. 121(2000) 302-310.

4. BACKSTROM, B. T., HARRIS, D. P., PRESTIDGE, R. I.and WATSON, J. D. Genetic control of immune re-sponses to the 18-kDa protein of Mycobacteriumleprae. Different TH 1 subsets may be involved inproliferative and delayed-type hypersensitivity re-sponses. Cell. Immunol. 142 (1992) 264-274.

5. BALCEWICZ-SABLiNSKA, M. K., GAN, H. and RE-

MOLD, H. G. Interleukin 10 produced by macro-phages inoculated with Mycobacterium aviu/li at-tenuates mycobacteria-induced apoptosis by re-duction of TNF-a activity. J. Infect. Dis. 180(1999) 1230-1237.

6. BELISLE, J. T. and BRENNAN, P. J. Molecular basisof colony morphology in Mycobacterium avium.Res. M icrobiol . 145 (1994) 237-242.

7. BERMUDEZ, L. E. Production of transforminggrowth factor-f3 by Mycobacterium avium-infected human macrophages is associated withunresponsiveness to IFN-y. J. Immunol. 150(1993) 1838-1845.

8. BERMUDEZ, L. E. and CHAMPSI, J. Infection withMycobacterium avium induces production of in-terleukin-10 (IL-10), and administration of anti-IL-10 antibody is associated with enhanced resis-tance to infection in mice. Infect. Immun. 61(1993) 3093-3097.

9. CHAN, J., XING, Y., MAGLIOZZO, R. S. and BLOOM,B. R. Killing of virulent Mycobacterium tubercu-losis by reactive nitrogen intermediates producedby activated murine macrophages. J. Exp. Med.175 (1992) 1 1 1 1-1 122.

10. GARCIA, V. E., UYEMURA, K., SIELING, P. A.,OCHOA, M. T., MORITA, OKAMURA, H., KURIMOTO,M., REA, T. H. and MODLIN, R. L. IL-18 promotestype 1 cytokine production from NK cells and Tcells in human intracellular infection. J. Immunol.162 (1994) 6114-6121.

1 1 . JULLIEN, D., SIELING P. A., UYEMURA, K., MAR, N.D., REA, T. H. and MODLIN, R. L. IL-15, an inl-munomodulator of T cell responses in intracellularinfection. J. Immunol. 158 (1997) 800-806.

12. KAZDA, J., FASSKE, E., KOLK, A., GANAPATI, R. andSCHRODER, K. H. The simultaneous inoculation ofMycobacterium leprae and M. llltracellulare intonude mice: development of cutaneous lepromaand acceleration of footpad swelling. Indian J.Lepr. 59 (1987) 426-343.

13. KOBAYASHI, K., KAI, M., GiDOH, M., NAKATA, N.,ENDOH, M., SINGH, R. R, KASAMA, T. and SAITO,H. The possible role of interleukin (IL)-12 and in-terferon-y-inducing factor/IL-18 in protectionagainst experimental Mycobacterium leprae infec-tion in mice. Clin. immunol. Immunopharmacol.88 (1998) 226-231.

14. MODLIN, R. L. Cytokine responses in leprosy le-sions. Japan. J. Lepr. 64 (1995) 85-88.

15. MODLIN, R. L. and NUTMAN, T. B. Type 2 cy-tokines and negative inmniune regulation in humaninfections. Curr. Oplln. 1lullIlnol. 5 ( l993)551-517.

16. OTTENHOFF, T. H. M. immunology of leprosy:lessons from and for leprosy. Int. J. Lepr. 62(1994) 108-121.

17. PAIS, T. F. and APPELBERG, R. Macrophage controlof Hlycobacterial growth induced by picolinic acidis dependent on host cell apoptosis. J. I11111111Ii01.164 (2000) 389-397.

18. RASTOGI, N. and DAVID, H. L. Phagocytosis ofMycobacterium leprae and M. avium by armadillolung fibroblasts and kidney epithelial cells. ActaLepr. 2 (1984) 267-276.

19. RASTOGI, N. and DAVID, H. L. Mechanisms ofpathogenicity in mycobacteria. Biochimie 70(1988) 1 101-1 120.

20. RYTER, A., FREHEL, C., RASTOGI, N. and DAVID, H.L. Macrophage interaction with mycobacteria in-cluding M. leprae. Acta Lepr. 2 (1984) 21 1-225.

21. SANO, C., SHIMiZU, T., SATO, K., KAWAUCHI. H.and TOMIOKA, H. Effects of secretory leucocyteprotease inhibitor On the production of the anti-inflammatory cytokines, IL-10 and transforminggrowth factor-beta (TGF-P), by lipopolysaccha-ride-stinlulated macrophages. Clin. Exp. Im-munol. 121 (2000) 77-85.

22. SATO, K., AKAKI, T. and TOMIoKA, H. Differentialpotentiation of antimycobacterial activity and re-active nitrogen intermediate-producing ability ofmurine peritoneal macrophages activated by inter-feron-gamma (IFN-y) and tumour necrosis factor-alpha (TNF-a). Clin. Exp. linHluWol. 112 (1998)63-68.

23. SHiMIZU, T., MAW, W. W. and TOMIOKA, H. Rolesof tumor necrosis factor-a and transforminggrowth factor-f3 in regulating intercellular adhe-sion molecule-1 expression on murine peritonealmacrophage infected with M. leprae. Int. J. Lepr.67 (1999) 36-45.

24. SIELING, P. A., AIBRAMS, J. S., YAMAMURA, M.,SALGAME, P., BLOOM, B. R., REA. T. H. and MOD-LIN, R. L. In1Hlunosuppressive roles for inter-leukin-10 and interleukin-4 in human infections:in vitro modulation of T cell responses in leprosy.J. lmmunol. 150 (1993) 5501-5510.

25. SiELING, P. A., SAKIMURA, L., UYEMURA, K., YA-MAMURA, M., OLiVEROS, J. L., NICKOLOFF, B. J.,REA, T. H. and MODi.IN, R. L. IL-7 in the cell-mediated immune response to a human pathogen.J. Immunol. 164 (1995) 2775-2783.

26. SIELING, P. A., WANG, X-H., GATELY, M. K., OLI-VEROS, J. L., McHUGII. T., BARNES, P. F., WOLF, S.F., GOI.KAR, L., YAMAMURA, M.. YOGI, Y., UYE-MURA, K., REA, T. H. and MOULIN, R. L. IL-12regulates T helper type 1 cytokine responses in hu-man infectious disease. J. Immunol. 163 (1994)3639--3647.

70, 4 Shimizu, et al.: mRNA Expression by MO 259

27. SMIDA, J., KAZDA, J. and STACKEBRANDT, E. Molec- 31. TRICCAS, J. E., WINTER, N., ROCHE, P. W., GILPIN,

ular-genetic evidence for the relationship of Myco- P. W., KENDRICK, K. E. and BRITTON, W. J. Molec-bacterium leprae to slow-growing pathogenic my- ular and immunological analyses of the Mycobac-

cobacteria. Int. J. Lepr. 56 (1988) 449-454. teriurn avium homolog of the immunodominant28. TItoLI:, J. E., WIELES, B., CLARK-CURTISS, J. E., Mycobacterium leprae 35-kilodalton protein. In-

OTTENHOFF, T. H. and DE WIT, T. F. Immunologi- feet. Immun. 66 (1998) 2684-2690.

cal and functional characterization of Mvcobacte- 32. TSUKIYAMA, F., KATOH, M., NOMURA, T. and MAT-riwn leprae antigen: an overview. Mol. Microbiol. SLY), Y. Use of the fluorescent staining method for

18 (1995) 791-800. determining the viability of Mycobacterium lep-

29. ToMIOKA, H. Changes in cytokine profiles induced memoriam. Hiroshima J. Med. Sci. 34 (1985)

by the infection with leprosy bacilli. Clin. Im- 161-163.munol. Tokyo 34 (2000) 145-152. 33. YAMAMURA, M., UYEMURA, K., DEANS, R. J.,

30. TOMIOKA, H., SHIMIZU, T., MAW, W. W. and OGA- WEINBERG, K., REA, T. H., BLOOM, B. R. and

SAWARA, K. Roles of tumour necrosis factor-alpha MODLIN, R. L. Defining protective response to

(TNF-a) in the modulation of intercellular adhe- pathogens: cytokine profiles in leprosy lesions.

lion molecule-1 (ICAM-l) expression by macro- Science 254 (1991) 277-279.phages during mycobacterial infection. Clin. Exp.Immunol. 122 (2000) 335-342.