184

http://journals.tubitak.gov.tr/biology/

Turkish Journal of Biology Turk J Biol(2016) 40: 184-195© TÜBİTAKdoi:10.3906/biy-1501-29

Identification and characterisation of Mlo genes in pea (Pisum sativum L.)vis-à-vis validation of Mlo gene-specific markers

Chinmayee MOHAPATRA1, Ramesh CHAND1,*, Vinay Kumar SINGH2, Anil Kumar SINGH3, Chanda KUSHWAHA4

1Department of Mycology and Plant Pathology, Institute of Agricultural Sciences, Banaras Hindu University, Varanasi, Uttar Pradesh, India2Centre of Bioinformatics, School of Biotechnology, Faculty of Science, Banaras Hindu University, Varanasi, Uttar Pradesh, India

3College of Agriculture and Research Station, Korea, Chhattisgarh, India4Department of Plant Pathology, Bihar Agricultural University, Sabour, Bihar, India

* Correspondence: rc_vns@yahoo.co.in

1. IntroductionPea (Pisum sativum; 2n = 14) is one of the important food legume crops and is affected by several fungal pathogens. Powdery mildew (PM) of pea caused by Erysiphe pisi is one of these devastating fungal pathogens and is reported to cause up to a 50% reduction in yield by affecting the quality and quantity of green pods and dry seeds (Dixon, 1987). The disease is more prevalent at the flowering and pod formation stages and appears in epidemic form almost every year in India and other countries. The initial symptoms appear as white powdery mycelium and spores on leaf and stem surfaces. With the advance of the disease, the entire aerial portion of the pea plant is covered with white floury patches. In general, three closely interrelated environmental factors, temperature, humidity, and light, play an important role in development of the disease (Banyal and Tyagi, 1997). The conidia germinate readily in absence of water at temperatures between 10 and 30 °C; maximum germination occurs at 20–24 °C. According to Banyal and Tyagi (1997), pea powdery mildew speeds up when temperatures exceed 20 °C. Singh et al. (2000)

reported that early development of powdery mildew is not affected by light, but it is affected by the photosynthetic area of the leaf lamina.

The powdery mildew resistance (MLO) genes were first identified in barley (Buschges et al., 1997). Powdery mildew resistance is amenable for breeding owing to its race specific (monogenic) and partial (horizontal) resistance; it is also durable in nature (Jorgensen, 1992). MLO proteins are characterised as an integral plasma membrane protein with seven transmembrane regions (Devoto et al., 1999). It is evident that MLO family members play a key role in modulating defence responses and cell death (Buschges et al., 1997; Piffanelli et al., 2002). In barley, powdery mildew fungi are able to penetrate the host cell wall by using MLO proteins (Panstruga, 2005)—whereas homozygous mutant (Mlo) alleles of the MLO genes confer broad-spectrum disease resistance (Jorgensen, 1992)—and this leads to spontaneous leaf cell death (Wolter et al., 1993).

Earlier studies showed that powdery mildew resistance in pea is governed by a single (monogenic) recessive gene, ‘er1’ (Harland, 1948; Gupta, 1987; Sarala, 1993). Further,

Abstract: Pea is infected by a number of pathogens, and among them powdery mildew (PM) caused by Erysiphe pisi is an important fungal disease. This work was undertaken in silico to characterise the identified PM resistant genes of pea and design specific primers to be used in marker-assisted selection (MAS) of resistant and susceptible pea genotypes. Mlo gene sequences of A. thaliana and O. sativa were retrieved from different databases and used for a homology search of P. sativum EST databases. Each identified gene was used for a similarity search and phylogenetic classification with different crops. Four gene-specific primers were designed from the identified Mlo nucleotides and were amplified in different pea genotypes. Pea Mlo1 analogue of the ‘er’ gene was related to AtMlO2, AtMlO6, AtMlO12, and AtMlO3. Pea Mlo2 was related to AtMlo14 and Pea Mlo4. Pea Mlo3 gene was related to AtMlO15, AtMlO13, AtMlO4, and AtMlO11. The Pea Mlo4 gene was closely related with AtMlO8 and AtMlO7. In phylogenetic classification, two main clusters were formed; the first cluster possessed the 4 identified pea Mlo genes and the core conserved motifs. Validation of pea Mlo primers confirmed the effectiveness of PsMlo2 primer for use in MAS.

Key words: Powdery mildew, MlO, Erysiphe pisi, phylogeny, in silico, er gene, gene-specific primer

Received: 12.01.2015 Accepted/Published Online: 21.06.2015 Final Version: 05.01.2016

Research Article

MOHAPATRA et al. / Turk J Biol

185

Sarala (1993) and Timmerman et al. (1994) placed the ‘er’ gene on pea chromosome VI. Dirlewanger et al. (1994) found the ‘er’ gene at 9.8 cM from RFLP marker ‘p236’, whereas Timmerman et al. (1994) reported a more closely linked RAPD marker, OPD10650, at 2.1 cM from the ‘er’ gene. The RAPD marker (OPD10650) was converted to a SCAR marker (Paran and Michelmore, 1993), which was mapped at a distance of 3.4 cM from er1 (Janila and Sharma, 2004). However, Tiwari et al. (1998) did not find marker OPD10650 useful for marker-assisted selection (MAS) in a progeny derived from a cross between a resistant cultivar, Highlight (er1), and the susceptible cultivar, Radley. In pea, several powdery mildew resistant sources exhibiting monogenic recessive inheritance are available, and a number of molecular markers associated with PM resistance have also been identified. There is a need to either reconfirm the usefulness of these markers or to develop gene-specific markers from the gene itself for use in PM resistance breeding in pea (Ghafoor and McPhee, 2012). The present work was undertaken to identify and characterise the powdery mildew resistant genes of pea in silico. The design of a specific primer for PCR amplification in pea genomic DNA and its validation in powdery mildew resistant and susceptible pea genotypes was also undertaken.

2. Materials and methods2.1. Retrieval of Mlo genes from Mlo gene family in Arabidopsis thaliana and Oryza sativa genomes The 15 Mlo gene sequences of A. thaliana were retrieved from the TAIR website (Chen et al., 2006; Deshmukh et al., 2014). Similarly, annotated Mlo genes from rice genome were retrieved from NCBI databases (Pruitt et al., 2007; Liu and Zhu, 2008). These sequences were then used for a homology search of Pisum sativum EST databases.2.2. Comparative analysis of Mlo proteins in pea genome using Arabidopsis Mlo gene familyThe retrieved gene sequences were subjected to a homology search with the available EST resource at the NCBI database (Pruitt et al., 2007) using BLAST (Altschul et al., 1990; Altschul et al., 1997). Different flavours of BLAST were selected to investigate availability in the EST data set. Further homologue sequences were used for a comparative study of mutants lacking wild-type Mlo proteins with the Arabidopsis genome. 2.3. Evolutionary classification of different identified genes of pea from different crop speciesEach identified gene from pea was used for a similarity search and phylogenetic classification with different crop species (Sorghum bicolor, Hordeum vulgare, Oryza sativa, Linum usitatissimum, Glycine max, Brassica rapa, Lens esculentum, Gossipium hirsutum). All retrieved sequences were aligned by using ClustalW (Thompson et al., 1994),

and phylogenetic inferences were done using MEGA and Dendroscope (Kumar et al., 1994; Huson et al., 2007). 2.4. Three-dimensional analysis of Mlo proteinsThe three-dimensional structure of Mlo proteins and domain was predicted using the iterative assembly refinement algorithm (I-TASSER) package (version 1.1). I-TASSER server was used for protein structure prediction based on multiple-threading alignments by LOMETS and iterative TASSER assembly stimulation (Roy et al., 2010). The rough model generated was subjected to energy minimisation using the steepest decent technique to eliminate bad contacts between protein atoms. Computations were carried out in vacuo with GROMOS96 43B1 parameters set, implemented through Swiss-Pdb Viewer, version 4.0.1 (Guex et al., 1997).2.5. Functional elucidation of hypothetical proteins using motif and domain identification All Mlo proteins from different cereals and millets were used for conserved motif analysis using MEME version 3.5.7 (Bailey et al., 2006) with minimum motif width 50, maximum motif width 100, and maximum produced motif number 30. For functional elucidation of Mlo protein sequences INTERPROSCAN version 4.4 was used (Quevillon et al., 2005). 2.6. DNA extraction and PCR amplificationIdentified Mlo nucleotide sequences were used to design gene-specific primers with Primer3 software (Table 1). These primers were initially used for amplification in four pea genotypes including two powdery mildew susceptible genotypes (HFP8909 and HFP 9707) and two resistant (HUDP 15 and HFP 4) genotypes. The pea seeds were grown in earthen pots in the poly house, and genomic DNA was extracted from 21-day-old seedlings (at 2–4 leaf stage) by modified CTAB method (Murray and Thompson, 1980). The genomic DNA thus obtained was quantified by using a Biophotometer plus spectrophotometer (Eppendorf, Hamburg, Germany).

DNA amplification was carried out in 15 µL of PCR master mix containing 1 µL of genomic DNA (20 ng/µL), 1.5 µL of PCR buffer (10X), 1.2 µL of dNTPs mixture (2.0 mM), 0.5 µL of MgCl2 (1.5 mM), 0.5 µL of Taq polymerase (2 units), and 1.0 µL each of forward and reverse primers (12.5 µM). Finally, the total volume was completed with PCR water. The reactions were carried out in a thermocycler (Eppendorf, Master Cycler Gradient, USA) with a PCR profile that included an initial denaturation at 94 °C for 3 min followed by 40 cycles with a denaturation step at 94 °C for 30 s, primer annealing at optimum temperature (Ta) for 30 s, and extension at 72 °C for 1 min with a final extension step at 72 °C for 7 min. Amplified PCR products were separated by gel electrophoresis on 2.0% agarose gel containing 0.5 µg/mL ethidium bromide using 1X TAE buffer and visualised under UV light and

MOHAPATRA et al. / Turk J Biol

186

photographed using a gel documentation system (Gel Doc TM XR+Biorad Laboratories, USA).

3. Results3.1. Study of Mlo gene family in A. thaliana and O. sativa genome A total of 15 Mlo genes were retrieved from A. thaliana genome, named AtMlo genes, and numbered from 1 to 15 (Table 2). Similarly, 12 Mlo genes were obtained from O. sativa genome, named OsMlo genes, and numbered from 1 to 12 (Table 3).

3.2. Comparative analysis of Mlo proteins in pea genome using Arabidopsis Mlo gene familyComparative analysis using the A. thaliana Mlo genes revealed the presence of four Mlo genes in pea (Table 4). The phylogenetic tree based on UPGMA method was visualised by Dendroscope software and comprised 19 genes from A. thaliana and the pea Mlo genes (Figure 1). The phylogenetic tree depicted the evolutionary relationships between the Mlo genes. The PsMlo1 of pea is related to AtMlo2, AtMlo6, AtMlo12, and AtMlo3. Similarly, PsMlo2 is related to AtMlo14 and PsMlo4. PsMlo3 is related

Table 1. List of the gene-specific primers designed.

Primer name Primer length Primer sequence Expected size (bp)

Mlo1 F 20 ACTTGGCATCCTTGTTCCAC-

Mlo1 R 20 ATGACTCGACACCCGCTATT

Mlo2 F 19 CCAATCACAAGCCTGGAAC412

Mlo2 R 19 GATCCGTGCCCTTGAAGAT

Mlo3 F 20 CTTTCTCTTTCCCCGGAATC-

Mlo3 R 20 TGGGTTTGTCTTGCAGTGAG

Mlo4 F 20 AGCACGGATTGAAGCTAGGA342

Mlo4 R 20 TCGGATGATCTGACCTGACA

Table 2. CDS length and protein length (bp) of different Mlo genes of Arabidopsis thaliana genome.

Accession no. Gene name CDS length (bp) Protein length (bp)

At4g02600 AtMlo1 1581 526

At1g11310 AtMlo2 1722 573

At3g45290 AtMlo3 1527 508

At1g11000 AtMlo4 1722 573

At2g33670 AtMlo5 1506 501

At1g61560 AtMlo6 1752 583

At2g17430 AtMlo7 1629 542

At2g17480 AtMlo8 1782 593

At1g42560 AtMlo9 1383 460

At5g65970 AtMlo10 1710 569

At5g53760 AtMlo11 1722 573

At2g39200 AtMlo12 1731 576

At4g24250 AtMlo13 1437 478

At1g16700 AtMlo14 669 222

At2g44110 AtMlo15 1494 497

MOHAPATRA et al. / Turk J Biol

187

Table 3. CDS length (bp) of different Mlo genes of rice genome.

Accession no. Gene name CDS length (bp)

Os02g0562600 OsMlo1 82

Os04g0444400 OsMlo2 460

Os06g0486300 OsMlo3 526

Os04g0680800 OsMlo4 326

Os02g0197200 OsMLo5 385

Os06g0610500 OsMlo6 50

Os05g0418100 OsMlo7 327

Os05g0183300 OsMlo8 313

Os10g0541000 OsMLo9 542

Os03g0129100 OsMlo10 616

Os01g0888600 OsMlo11 502

Os11g0181400 OsMLo12 133

Table 4. Accession IDs of 4 identified Mlo genes of pea.

Gene identified Accession ID Databases used

PsMlo1 FJ463618 Nucleotide collection (nr/nt)

PsMlo2 CD860393 Expressed sequence tags (est)

PsMlo3 CD860344 Expressed sequence tags (est)

PsMlo4 FG528861 Expressed sequence tags (est)

Figure 1. Phylogenetic tree based on Mlo sequences from Arabidiopsis thaliana and 4 identified pea Mlo using MEGA 4.0 with UPGMA method.

MOHAPATRA et al. / Turk J Biol

188

to AtMlo15, AtMlo13, AtMlo4, and AtMlo11. The multiple sequence alignment file of the pea Mlo genes, along with 15 Mlo genes of A. thaliana, is shown in Figure 2. 3.3. Evolutionary classification of Mlo gene family from different cereals and millets For the phylogenetic classification, PsMlo family members were used for a homology search against different cereal and millet Mlo genes. The phylogenetic tree was constructed by UPGMA method (Figure 3). It revealed that the PsMlo1 of pea is related to AtMlo2, AtMlo3, AtMlo6, AtMlo12,

and Mustard Mlo1. Similarly, PsMlo2 is closely related to Sorghum Mlo4 and Rice Mlo11. The PsMlo3 is related to AtMlo1, AtMlo15, and Cotton Mlo1. The PsMlo4 is closely related to AtMlO8 and AtMlo7.3.4. Functional elucidation of hypothetical proteins using motif and domain identification As per phylogenetic classification, two main clusters were formed and were also represented at motif level; a total of 23 motifs were identified (Figure 4). Motifs 1, 2, 3, 4, and 5 were unique conserved motifs among all the species

Figure 2. Multiple alignment of pea and Arabidopsis Mlo genes.

Figure 3. Unrooted tree based on Mlo sequences from different species and 4 identified pea Mlo using DENDROSCOPE.

MOHAPATRA et al. / Turk J Biol

189

Figure 4. Schematic distribution of respective conserved motifs identified by MEME software.

MOHAPATRA et al. / Turk J Biol

190

studied. Motifs 6, 8, 9, 12, 13, 14, and 15 were classified based on evolutionary pattern. Each motif was represented by different colours. The major cluster contains the 4 Mlo genes identified from pea along with the core conserved motif (signals) across this group (Figure 5). The InterProScan result revealed that the Mlo genes belong to the family of mutants lacking wild-type Mlo proteins and have a Pfam ID of PF03094.3.5 Amplification of gene-specific MLO primers in peaThe gene-specific primers, i.e. Mlo1, Mlo2, Mlo3, and Mlo4, designed from the identified Mlo nucleotide

sequences of pea were used for amplification in four pea genotypes, two powdery mildew susceptible genotypes (HFP8909 and HFP 9707) and two resistant (HUDP 15 and HFP 4). Out of the four gene-specific primers, the primers for PsMlo2 and PsMlo4 showed amplification (Figure 6). PsMlo2 and PsMlo4 primers were further used to amplify 12 selected pea genotypes known to be resistant/susceptible to powdery mildew disease (Table 5). PsMlo2 showed a differential amplification among powdery mildew resistant/susceptible genotypes (Figure 7). PsMlo2 marker amplified a PCR product of approximately 1250

Figure 5. Multilevel consensus sequences for the MEME defined motifs among different species.

Figure 6. Amplification of powdery mildew primers in pea. M = 100 bp DNA size marker; 1–4 are pea genotypes: 1 = HUDP 15, 2 = HFP 4, 3 = HFP 8909, and 4 = HFP 9707.

MOHAPATRA et al. / Turk J Biol

191

bp in all the susceptible/moderately susceptible genotypes. Similarly, an amplification product of approximately 900 bp was observed in all the resistant genotypes; however, two susceptible genotypes, i.e. Kashi Shakti and EC-324108 II, also showed an amplification product of 900 bp (Figure 7; Table 5). However, PsMlo4 primer uniformly produces an amplification product of approximately 340 bp in all twelve selected pea genotypes and failed to distinguish among resistant/susceptible genotypes (Figure 8). 3.6 Sequencing of MLO genes Sequencing of amplified product was used for sequence analysis. After analysis it was observed that putative proteins of amplified sequences showed similarities with MLO proteins with Glycine max, Medicago truncatula, Phaseolus vulgaris, Ricinus communis, Cicer arietinum, Cucumis melo, Arabidopsis thaliana, and Cucumis sativus

organisms (Figures 9a and 9b). Both sequences were deposited in NCBI with accession numbers KM004025 and KM004026.

4. DiscussionComparative genomics provides an effective method to distinguish regulatory motifs from nonfunctional patterns based on their conservation (Sivashankari et al., 2007). In the course of evolution, mutations accumulate in nonfunctional nucleotides, whereas changes in functional nucleotides are detrimental and are eliminated by natural selection. Comparative biology offers valuable insight into divergence at many taxonomic levels; of particular interest is the comparison of members of the two major angiosperm subclasses, monocots and dicots. In plant species the complete catalogue of Mlo proteins is necessary

Table 5. Pea genotypes used for validation of powdery mildew markers specific to PsMlo2 gene.

S. no. Genotype PM reaction# PsMlo2 amplification

1. EC-324705 Resistant +

2. EC- 322745 Susceptible -

3. EC- 324107 Resistant +

4. EC- 313635 I Moderately susceptible -

5. JP-625 Moderately susceptible -

6. KPMR- 642 Resistant +

7. EC- 341753 II Moderately susceptible -

8. Kashi Shakti Susceptible +

9. EC- 324108 II Susceptible +

10. IPF-9728 Resistant +

11. EC- 328747 Susceptible -

12. EC-328752 II Resistant +

#Based on two years of powdery mildew field screening (2011–12 and 2012–13).+Indicates presence of a band of ~900 bp (specific to resistant genotypes); –indicates presence of a band of ~1250 bp (specific to susceptible genotypes).

Figure 7. Validation of PsMLO2 marker in twelve pea genotypes. M = 50 bp DNA size marker; 1–12 (pea genotypes, as listed in Table 5).

MOHAPATRA et al. / Turk J Biol

192

for viewing the structural and functional diversity related to its role in disease resistance (Singh et al., 2012). Multiple sequence alignment of the amino acid sequences of PsMlo with other Mlo genes is useful for examining evolutionary relationships between different Mlo proteins. These hypothetical Mlo proteins are lucine-rich in nature.

Evolutionary classification of the 4 PsMlo genes with 15 A. thaliana genes and the Mlo genes of other species depicted similar classification patterns in the evolution of sequences. The 15 members of A. thaliana are well characterised and mainly function as modulators of plant defence and cell death. The coding region of the 4 PsMlo genes showed substantial sequence homology with the 15

Mlo genes of A. thaliana and Mlo genes of other species. Hence the 4 PsMlo genes are also expected to play a key role in plant defence mechanisms in peas (Chen et al., 2009). In this case, we selected members of the Mlo gene family to study in P. sativum. To date there is no complete genome sequence available for P. sativum; however, the EST datasets are available for different conditions like shoot apical meristem and from different tissues. Through alignment of sequences, 3 cDNA sources, and 1 mRNA source from P. sativum we matched Arabidopsis Mlo query proteins. The largely completed sequence of the dicot Arabidopsis together with the rapidly progressing sequence of the monocot O. sativa (Liu et al., 2008) provides a

Figure 8. Validation of PsMLO4 marker in twelve pea genotypes. M = 50 bp DNA size marker; 1–12 (pea genotypes as listed in Table 5).

Figure 9a. Sequence alignment of P. sativum cultivar JP-625 BHU_MLO-like gene (KM004025) with different organisms.

Figure 9b. Sequence alignment of P. sativum cultivar HUP-5 BHU_MLO-like gene (KM004026) with different organisms.

MOHAPATRA et al. / Turk J Biol

193

natural comparative framework for this work. Based on the dicot pattern the phylogenetic inferences were derived using Arabidopsis and predicted P. sativum Mlo proteins.

Among the 23 obtained motifs motif 1, motif 3, and motif 4 had a highly conserved region found across the sequences. These multilevel consensus motifs were taken as inputs for a functional domain study using motif scan and it was found that these motifs were the core signature part of the MLO protein family. Dendroscope visualised the phylogenetic tree for Mlo sequences from different crop species along with P. sativum, and two clusters were obtained (Dubey et al., 2009). In the minor cluster, the monocots (rice mlo8, barley mlo6, and sorghum mlo10) are closely related. Similarly, the dicots (Arabidopsis Mlo 10, 9, and 5) are closely related. In the major cluster, PsMlo1 is closely related to Atmlo3, AtMlo12, Atmlo6, and AtMlo2. PsMlo2 is closely related to Rice Mlo11 and Sorghum mlo 3. PsMlo3 is related to AtMlo1 and Cotton Mlo1. Similarly, PsMlo4 is closely related to AtMlo8 and AtMlo7. Rispail et al. (2013) identified different Mlo members of model legume M. truncatula by mining the data obtained from JCVI M. truncatula genomic project v 3.5 and the Medicago Gene Index databases. They obtained 14 MtMlo genes distributed within all 6 MLO groups. Moreover, 4 MtMlo sequences, 3 from the group V (MtMlo1, 3, and 11) and 1 from group IV (MtMlo8), were expected to play a crucial role in PM resistance in M. truncatula. Three-dimensional structures (3-D) of Mlo genes were not available in the PDB database (Guex et al., 1997), and an attempt was made in the present study to determine the structure of Mlo1 from P. sativum. Based on the I-TASSER standard parameters, the tertiary structure of Mlo1 from P. sativum was successfully modelled.

The genetics of powdery mildew resistance in pea revealed the involvement of 1–3 genes (er1, er2, and Er3). Resistance exhibited by er1 is complete and durable under field and controlled environments, whereas er2 is unable to provide durable resistance under heavy infection (Ghafoor and McPhee, 2012). A number of DNA-based markers have been linked to er1, er2, and Er3 and are currently being used in PM-resistance breeding programs. However, the distance between different markers reportedly linked with gene er1 is not close enough to be successfully used in MAS. As a result, flanking markers are being used in MAS for powdery mildew resistance in pea. Ek et al. (2005) reported that use of er1 gene flanking markers PSMPSAD60 and PSMPS5 resulted in only 1.6% error in selection of resistant plants (as determined by an estimate of frequency of double recombinants). Recombination between markers and traits of interest may occur if the marker is not close enough to the gene of interest. It is, therefore, desirable to develop markers from the gene itself (Huang and Roder, 2004). In the present study, two gene-

specific primers, PsMlo2 and PsMlo4, were successfully amplified in the pea genomic DNA. Validation of PsMlo2 and PsMlo4 on 12 selected powdery mildew resistant/susceptible lines revealed that PsMlo2 marker was able to clearly differentiate all the resistant genotypes from the susceptible ones used in the present study except two susceptible genotypes, Kashi Shakti and EC-324108 II. PsMlo2 gene-specific marker can be used as a diagnostic DNA marker to identify powdery mildew resistant pea genotypes in MAS.

Conclusively, the comparative phylogenetic analysis of PsMlo genes with respect to the Mlo gene family indicated the proximity of PsMlos with Arabidopsis Mlo genes. The result indicated that the PsMlo1 of pea was related to AtMlo2, AtMlo6, AtMlo12, and AtMlo3. Similarly, PsMlo2 was related to AtMlo14 and PsMlo 4. PsMlo3 was related to AtMlo15, AtMlo13, AtMlo4, and AtMlo11. When alignments of pea Mlo genes were done with different crop species, the Mlo1 of pea was related to AtMlo2, AtMlo3, AtMlo6, AtMlo12, and Mustard Mlo1. Similarly, Pea Mlo2 was closely related to Sorghum Mlo4 and Rice Mlo11. The Pea Mlo3 was related to AtMlo1, AtMlo15, and Cotton Mlo1. Pea Mlo4 was closely related to AtMlo8 and AtMlo7. Phylogenetic classification studies showed two main clusters; the first cluster contained the 4 identified Mlo genes from pea and the core conserved motif (signals) across this group. The predicted 3-D model contained 25 helices, 9 strands, and 68 turns. In-silico comparative phylogenetic classification provides a great opportunity for understanding the behaviour of genes and genomes (Singh et al., 2014). It allows for investigation of coding and noncoding functional elements of the genome and provides information about signature parts at the gene level and syntenic relations at the genome level after deducting the evolutionary relationships between similar genes across plant genera (Goffard and Weiller, 2006).

Out of the four powdery mildew gene-specific primers designed in the present study, PsMlo2 primer was amplified and able to differentiate between powdery mildew resistant/susceptible pea genotypes. PsMlo4 primer amplified but was unable to produce polymorphic PCR products in 12 selected pea genotypes. The remaining two primers, PsMlo1 and PsMlo3, did not amplify as they are cDNA sequences, and it was possible that they contained spliced regions and hence were not amplified in genomic DNA. The validated marker, PsMlo2, could be successfully utilised in MAS of powdery mildew resistant genotypes in pea.

AcknowledgementThe first author is thankful to the University Grants Commission (UGC), India, for providing financial assistance in the form of a research fellowship during the PhD program.

MOHAPATRA et al. / Turk J Biol

194

References

Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990). Basic local alignment search tool. J Mol Biol 215: 403–410.

Altschul SF, Madden TC, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ (1997). Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucl Acids Res 25: 3389–3402.

Bailey TL, Williams N, Misleh C, Li WW (2006). MEME: discovering and analyzing DNA and protein sequence motifs. Nucl Acids Res 34: 369–373.

Banyal DK, Tyagi PD (1997). Role of climatic factors in the development of powdery mildew of pea. Indian Journal of Mycology and Plant Pathology 27: 64–70.

Büschges R, Hollricher K, Panstruga R, Simons G, Wolter M, Frijters A, van Daelen R, van der Lee T, Diergaarde P, Groenendijk J et al. (1997). The barley Mlo gene: a novel control element of plant pathogen resistance. Cell 88: 695–705.

Chen Z, Noir S, Kwaaitaal M, Hartmann HA, Wu M, Mudgil Y, Sukumar P, Muday G, Panstrunga R, Jones AM (2009). Two seven-transmembrane domain MILDEW RESISTANCE LOCUS O proteins cofunction in Arabidopsis root thigmomorphogenesis. Plant Cell 21: 1972–1991.

Deshmukh R, Singh VK, Singh BD (2014). Comparative phylogenetic analysis of genome-wide Mlo gene family members from Glycine max and Arabidopsis thaliana. Mol Genet Genomics 289: 345–359.

Devoto A, Piffanelli P, Nilsson I, Wallin E, Panstruga R, von Heijne G, Schulze-Lefert P (1999). Topology, subcellular localization, and sequence diversity of the Mlo family in plants. J Biol Chem 274: 34993–35004.

Dirlewanger E, Isaac PG, Renade S (1994). Restriction fragment length polymorphism analysis of loci associated with disease resistance genes and developmental traits in Pisum sativum L. Theor Appl Genet 88: 17–27.

Dixon GR (1987). Powdery mildew of vegetables and allied crops. In: Speaure DM, editor. Powdery Mildew. San Diego, CA, USA: Academic Press, pp. 502–506.

Dubey VK, Singh BK (2009). In silico studies on tryparedoxin peroxidase of Leishmania infantum: structural aspects. Curr Pharm Biotechno 10: 626–630.

Ek M, Eklund M, Von Post R, Dayteg C, Henriksson T, Weibull P, Ceplitis A, Isaac P, Tuvesson S (2005). Microsatellite markers for powdery mildew resistance in pea (Pisum sativum L.). Hereditas 142: 86–91.

Ghafoor A, McPhee K (2012). Marker assisted selection (MAS) for developing powdery mildew resistant pea cultivars. Euphytica 186: 593–607.

Goffard N, Weiller G (2006). Extending MapMan: application to legume genome arrays. Bioinformatics J 22: 958–2959.

Guex N, Peitsch MC (1997). SWISS-MODEL and the Swiss-Pdb viewer: an environment for comparative protein modelling. Electrophoresis 18: 2714–2723.

Gupta MD (1987). Inheritance of powdery mildew resistance in pea (Pisum sativum L.). PhD, Indian Agriculture Research Institute (IARI), New Delhi, India.

Harland SC (1948). Inheritance of immunity to powdery mildew in Peruvian forms of Pisum sativum. Heredity 2: 263–269.

Huang XQ, Roder MS (2004). Molecular mapping of powdery mildew resistance genes in wheat: a review. Euphytica 137: 203–223.

Huson DH, Richter DC, Rausch C, Dezulian T, Franz M, Rupp R (2007). Dendroscope: an interactive viewer for large phylogenetic trees. BMC Bioinformatics 8: 460.

Janila P, Sharma B (2004). RAPD and SCAR markers for powdery mildew resistance gene er in pea. Plant Breeding 123: 271–274.

Jorgensen JH (1992). Discovery, characterization and exploitation of Mlo powdery mildew resistance in barley. Euphytica 63: 141–152.

Kumar S, Tamura K, Nei M (1994). MEGA: Molecular Evolutionary Genetics Analysis software for microcomputers. Comput Appl Biosci 10: 189–191.

Liu Q, Zhu H (2008). Molecular evolution of the Mlo gene family in Oryza sativa and their functional divergence. Gene 409: 1–10.

Murray MG, Thompson WF (1980). Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res 8: 4321–4325.

Panstruga R (2005). Serpentine plant MLO proteins as entry portals for powdery mildew fungi. Biochem Soc Trans 33: 389–392.

Paran I, Michelmore RW (1993). Development of reliable PCR based markers linked to downy mildew resistance gene in lettuce. Theor Appl Genet 85: 985–993.

Piffanelli P, Zhou FS, Casais C, Orme J, Jarosch B, Schaffrath U, Collins NC, Panstruga R, Schulze-Lefert P (2002). The barley MLO modulator of defence and cell death is responsive to biotic and abiotic stress stimuli. Plant Physiol 129: 1076–1085.

Pruitt KD, Tatusova T, Maglott DR (2007). NCBI reference sequences (RefSeq): a curated non-redundant sequence database of genomes, transcripts and proteins. Nucl Acids Res 35 (Database issue): D61–D65.

Quevillon E, Silventoinen V, Pillai S, Harte N, Mulder N, Apweiler R, Lopez R (2005). InterProScan: protein domains identifier. Nucl Acids Res 33: W116–W120.

Roy A, Kucukural A, Zhang Y (2010). I-TASSER: a unified platform for automated protein structure and function prediction. Nat Protoc 5: 725–738.

Sarala K (1993). Linkage studies in pea (Pisum sativum L.) with reference to er gene for powdery mildew resistance and other genes. PhD, Indian Agriculture Research Institute (IARI), New Delhi, India.

Singh UP, Prithviraj B, Sarma BK (2000). Development of Erysiphe pisi (powdery mildew) on normal and albino mutants of pea (Pisum sativum). J. Phytopathol 148: 591–596.

MOHAPATRA et al. / Turk J Biol

195

Singh VK, Singh AK, Chand R, Singh BD (2012). Genome wide analysis of disease resistance MLO gene family in sorghum [Sorghum bicolor (L.) Moench]. J Plant Genom 2: 18–27.

Singh VK, Singh AK, Kayastha AM, Singh BD (2014). Advances in bioinformatics research in legumes. In: Gupta S, Gupta DS, Nadrajan N, editors. Legumes in the Omic Era. New York, NY, USA: Springer, pp. 249–275.

Sivashankari S, Shanmughand P (2007). Comparative genomics—a perspective. Bioinformation 1: 376–378.

Thompson JD, Higgins DG, Gibson TJ (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice. Nucl Acids Res 22: 4673–4680.

Timmerman GM, Frew TJ, Weeden NF (1994). Linkage analysis of er-1, a recessive Pisum sativum gene for resistance to powdery mildew fungus (Erysiphe pisi D.C.). Theor Appl Genet 88: 1050–1055.

Tiwari KR, Penner GA, Warkentin TD (1998). Identification of coupling and repulsion phase markers for powdery mildew resistance genes er1 in pea. Genome 41: 440–444.

Wolter M, Hollricher K, Salamini F, Schulze-Lefert P (1993). The Mlo resistance alleles to powdery mildew infection in barley trigger a developmentally controlled defence mimic phenotype. Mol Gen Genet 239: 122–128.