molecular characterization of yarrowia lipolytica strains...

249

http://journals.tubitak.gov.tr/biology/

Turkish Journal of Biology Turk J Biol(2013) 37: 249-258© TÜBİTAKdoi:10.3906/biy-1201-23

Molecular characterization of Yarrowia lipolytica strains isolated from different environments and lipase profiling

Onur AKPINAR, Füsun Bahriye UÇAR*Biology Department, Basic and Industrial Microbiology Section, Faculty of Science, Ege University, 35100 Bornova, İzmir, Turkey

* Correspondence: [email protected]

1. IntroductionLipases are among the most important classes of industrial enzymes. They are used in the production of detergents, cosmetics, pharmaceuticals, flavor enhancers, and foods (1,2). Lipase enzymes are produced by many microorganisms such as bacteria, yeast, or fungi. Among these, the nonconventional yeast Yarrowia lipolytica has been studied for many years for its aptitude for growing on hydrophobic substrates like oil or fatty acids and thus for its capacity to produce lipid degrading enzymes (3,4). The yeast Y. lipolytica is able to produce several lipases (extracellular, membrane-bound, and intracellular activities), and its lipase production depends on media composition and environmental conditions (2). Due to its high lipase activity, Y. lipolytica (formerly named Mycotorula lipolytica, and then Saccharomycopsis lipolytica and Candida lipolytica) is often used for biotransformation (5).

In order to analyze yeasts that produce industrial compounds, it is essential to identify them accurately. Traditional identification and characterization of yeast species have been based on their morphological traits and physiological capabilities. These methods are laborious and time-consuming, and therefore, these characteristics

are influenced by culture conditions and can produce uncertain results (6–9). Progress in developing molecular techniques with a higher resolving power has led to a more reliable characterization of yeasts, both at the species level and at the strain level (10). Several DNA-based methods such as restriction fragment length polymorphism (RFLP) analysis of 5.8 and 18S rDNA, random amplification of polymorphic DNA polymerase chain reaction (RAPD-PCR), and RFLP analysis of mitochondrial DNA have been used to discriminate wine yeast at strain level (7,11). The noncoding internal transcribed spacer regions (ITS1-5.8S rRNA-ITS2) exhibit greater interspecific differences than do the 18S and 26S rRNA genes, thus allowing the differentiation of closely related species. One of the most successful methods to identify yeast species is based on the RFLP analysis of this 5.8S-ITS region. The importance of this technique to identify yeast isolates of biotechnological interest is evident (12). Currently, one of the most commonly adopted methods is the sequencing of the 26S rDNA D1/D2 region (13,14). Although it has already been demonstrated that some species have significant variability in the D1/D2 domain, sequencing of this region is generally accepted as a means for species delimitation, especially for yeasts with ascomycetic affinity (14). Therefore, a

Abstract: In order to analyze yeasts that produce industrial compounds, it is essential to identify them accurately. Yarrowia lipolytica is one of the most extensively studied “nonconventional” yeasts, being a strictly aerobic microorganism capable of producing important metabolites and having an intense secretory activity, which justifies efforts to use it in industry (as a biocatalyst), in molecular biology, and in studies of genetics. Therefore, in this study, an accurate identification of Y. lipolytica strains was performed using 3 different molecular biological methods (RFLP analysis of ITS1-5.8S rDNA-ITS2 and 18S rDNA regions and sequencing of the D1/D2 domain of the 26S rDNA region). The 26S rRNA gene sequence of the strains showed sequence homology with various Y. lipolytica strains from the National Center for Biotechnology Information. A number of different lipids (tributyrin, olive oil, and fish oil) were screened in terms of the growth of Y. lipolytica strains and lipase production. It was determined that all lipid-related substrates supported lipase production levels ranging from 4.27 U/mL (tributyrin) to 37.08 U/mL (fish oil). Fish oil (1%) showed maximum specific activity in the supernatant (264.85 U/mg of protein) and TEM TAN 46. The Y. lipolytica strain that was produced in the media containing fish oil was found to be the best lipase producer.

Key words: Yarrowia lipolytica, molecular characterization, PCR-RFLP of rDNA, sequencing of D1/D2 domain, extracellular lipase

Received: 17.01.2012 Accepted: 30.06.2012 Published Online: 16.05.2013 Printed: 17.06.2013

Research Article

AKPINAR and UÇAR / Turk J Biol

250

correlation of different molecular identification techniques was made to estimate the potential of both approaches to the identification of yeast isolates from environmental samples.

The objectives of this study were, first, to confirm the identification of 22 Y. lipolytica strains by both RFLP analysis of ITS1-5.8S rDNA-ITS2 and 18S rDNA regions and sequencing of D1/D2 domain of 26S rDNA region, and, secondly, to analyze the effects of 3 different oil sources on lipase profiling for the Y. lipolytica strains.

2. Materials and methods2.1. Yeast strains and growth conditionOf the 22 Y. lipolytica strains used in this study, 10 previously identified with conventional and ITS-PCR and sequencing (TEM YL 3, 5, 6, 9, 10, 17, 18, 19, 20, and 21) were obtained from Akpınar et al. (9), another 10 (strain numbers 2, 3, 4, 9, 10, 11, 12, 13, 17, and 20) from Güngör et al. (15), 1 (isolate number 10) from Öztürk (16), and 1 (isolate number 46) from Yalcin and Ucar (17). The identification of these strains was confirmed by using the ITS-PCR RFLP, 18S rDNA-RFLP, and 26S rDNA D1/D2 domain sequencing methods. Y. lipolytica CBS6124 was obtained from the Centraal Bureau voor Schimmelcultures (CBS) in the Netherlands. All Y. lipolytica strains were stored at 4 °C on YPD agar medium (yeast extract 1%, peptone 2%, glucose 2%, and agar 2%).2.2. Amplification and RFLP analysis of the ITS regionDNA was isolated according to the method of Liu et al. (18). The DNA concentration was spectrophotometrically quantified and brought to a final value of 100 ng/µL.

PCR conditions for ITS1-5.8S rDNA-ITS2 amplification as described previously by Akpınar et al. (9) was carried out under the following conditions: each 50 µL of reaction mixture contained 200 ng of template DNA, 10 mM Tris-HCl, 1.5 mM MgCl2, 0.2 mM of each dNTP, 100 ng of each primer, and 0.25 U Taq DNA polymerase (Vivantis, Malaysia). The primers were ITS1 (5’TCCGTAGGTGAACCTGCGG3’) and ITS4 (5’TCCTCCGCTTATTGATATGC3’) as described by White et al. (19). Amplification was performed in a thermal cycler (Corbett Research PalmCycler) using an initial denaturation during 5 min at 95 °C, followed by 40 cycles consisting of 1 min at 95 °C, 2 min at 58 °C, and 3 min at 72 °C. A final step of 10 min at 72 °C was carried out. Amplification products were separated by electrophoresis in 1% agarose gels and detected by staining with 0.005% SafeView nucleic acid dye (NBS Biologicals, UK).

For RFLP analysis, HaeIII, HinfI, and RsaI restriction endonucleases (Fermentas, Germany) were used separately to digest the amplification products of ITS-PCR. The digestion mixture consisted of 17 µL of water, 10 µL of PCR products, 1 µL of restriction enzyme, and 2 µL of 10X

FastDigest buffer provided by Fermentas. The mixture was incubated for 5 min at 37 °C. The resulting fragments were separated on 2.5% agarose gels in 1X TAE buffer at 90 V for 45 min. The gels were stained with 0.005% SafeView nucleic acid dye (NBS Biologicals). A DNA molecular size marker of 50–1000 bp from Fermentas (GeneRuler 50 bp DNA Ladder) was used to determine the size of the PCR and RFLP products. DNA bands were visualized in a gel documentation system (Vilber Lourmat, France). In addition, size analysis of the bands obtained after a cut with each enzyme was performed with the Vilber Lourmat gel documentation system, the infinity capture program based on the molecular marker.2.3. Amplification and RFLP analysis of the 18S rDNA regionThe 18S rDNA was amplified using the primers P108 (5’-ACCTGGTTGATCCTGCCAGT-3’) and M3989(5’-CTACGGAAACCTCTACGGAAACCTTGTTACGACT-3’) described by Andrade et al. (7). The reaction was performed in a total volume of 50 µL, containing 100 ng of DNA, 10 mM Tris-HCl, 0.2 mM of each dNTP, 2 mM MgCl2, 1 U of Taq polymerase (Vivantis, Malaysia), and 100 ng of the above primers. The reactions were incubated in a thermal cycler (Corbett Research PalmCycler) using an initial denaturation of 3 min at 95 °C, followed by 35 cycles consisting of 40 s at 95 °C, 40 s at 59 °C, and 2 min at 72 °C. A final step of 3 min at 72 °C was carried out. Amplification products were separated by electrophoresis in 1% agarose gels and detected by staining with 0.005% SafeView nucleic acid dye (NBS Biologicals).

The PCR products of the 18S rDNA region were digested with the restriction enzymes HaeIII, RsaI, and TaqI in accordance with the supplier’s instructions (Fermentas). The resulting fragments were separated on 2.5% agarose gels in 1X TAE buffer at 90 V for 45 min. The gels were stained with 0.005% SafeView nucleic acid dye (NBS Biologicals). A DNA molecular size marker of 100–3000 bp from Fermentas (GeneRuler 100 bp DNA Ladder) was used to determine the size of the PCR and RFLP products. DNA bands were visualized in a gel documentation system (Vilber Lourmat). In addition, size analysis of the bands obtained after a cut with each enzyme was performed with the Vilber Lourmat gel documentation system, the infinity capture program based on the molecular marker.2.4. Amplification and sequencing of D1/D2 domain of 26S rDNA regionThe D1/D2 domain of 26S rDNA region was amplified using the primers NL1 (5’-GCATATCAATAAGCGGAGGAAAAG-3’) and NL4 (5’-GGTCCGTGTTTCAAGACGGG -3’) as described by Arias et al. (6), but the annealing temperature was modified. The PCR mixture was performed in a total volume of 50 µL, containing 50 ng of DNA, 10 mM Tris-HCl, 0.2 mM of


251

each dNTP, 2 mM MgCl2, 1 U of Taq polymerase (Vivantis, Malaysia), and 100 ng of the above primers. PCR conditions were as follows: initial denaturating at 94 °C for 5 min, 35 cycles of denaturating at 94 °C for 1 min, annealing at 70 °C for 1 min, and extension at 72 °C for 2 min; and final extension step of 10 min at 72 °C. Amplification products were separated by electrophoresis in 1% agarose gels and detected by staining with 0.005% SafeView nucleic acid dye (NBS Biologicals). Amplification products were visualized in a gel documentation system (Vilber Lourmat).

The partial DNA sequence of 26S rDNA region was investigated using PCR primers described by Arias et al. (6). The following conditions were used for cycle sequencing of the genes: 1 min at 96 °C, and 29 cycles of 10 s at 96 °C, 5 s at 50 °C, and 4 min at 60 °C. Amplified products were purified using Sephadex G-50 and Spin Columns before being sequencing. The DNA sequencing was carried out using the Applied Biosystems 3130xl Genetic Analyzer. Sequence comparisons were performed using the basic local alignment search tool (BLAST) program within the GenBank database. A strain was ascribed to the species showing the highest matched sequence identity. DNA sequences were analyzed using MEGA 5.05 software.2.5. Extracellular lipase production and analytical procedureFor lipase production, the composition of the basal medium with an initial pH value of 7.2 consisted of glucose 0.2% (w/v), peptone 0.5% (w/v), MgSO4 0.01% (w/v), and K2HPO4 0.1% (w/v), supplied with different oils 1% (v/v). Different oils (tributyrin, olive oil, and fish oil) were tested at a concentration of 1% (v/v) as lipid sources. All the media were heat-sterilized (121 °C for 15 min). After cooling, the oils, previously sterilized by dry heat (180 °C for 60 min), were added to the culture medium (20).

Growth experiments were performed in triplicate in 250 mL Erlenmeyer flasks containing 50 mL of sterile basal lipase production medium. The medium was inoculated with 106 cells/mL and the flasks were incubated for 48 h in an orbital shaker operating at 150 rpm at 27 °C.

Lipase activity of culture supernatants was assayed using p-nitrophenyl palmitate (pNPP, Sigma) as substrate (20). Samples (0.1 mL) were mixed with 0.9 mL of substrate solution containing 3 mg of pNPP dissolved in 1 mL of propanol-2-ol diluted in 9 mL of 50 mM Tris-HCl (pH 8.0) containing 40 mg of Triton X-100. After 30 min of incubation at 27 °C, the absorbance was measured spectrophotometrically at 410 nm against an enzyme-free control. One lipase unit (U) was defined as the amount of enzyme that liberated 1 µmol p-nitrophenol/min under the assay conditions described above. All enzyme assays were carried out in triplicate and the average values were calculated. Protein measurements were carried out by the method of Bradford (21), using bovine serum albumin as the standard.

3. Results and discussion3.1. RFLP analysis of the ITS regionIn our study, we used 22 Y. lipolytica strains that were isolated from different environments such as heavy metal-contaminated waters and soils and different cheeses, which were identified using both conventional and ITS-PCR methods in previous studies. The strains studied, and their designations and origin, are listed in Table 1.

The ITS1-5.8S rDNA-ITS2 region was amplified from genomic DNA of the Yarrowia lipolytica strains and the type strain of Y. lipolytica CBS6124 species. The amplified ITS1-5.8S rDNA-ITS2 region was approximately 360 bp long, without any size variation between the strains on 1% agarose gel. Digestion of PCR products with restriction endonuclease HinfI resulted in 2 fragments of 180 and 180 bp from Y. lipolytica strains and the type strain of Y. lipolytica CBS6124 species, and digestion of PCR products with restriction endonuclease RsaI resulted in 2 fragments of 220 and 140 bp from Y. lipolytica strains and the type strain of Y. lipolytica CBS6124 species, but digestion of PCR products with restriction endonuclease HaeIII resulted in only a single fragment of 360 bp from Y. lipolytica strains and the type strain of Y. lipolytica CBS6124 species. No differences were observed among strains of the same species in Y. lipolytica (Figures 1 and 2; Table 2).

Andrade et al. (7), Deak et al. (22), and Polomska et al. (23), who used RFLP analysis of ITS-PCR, reported that this method is a rapid and easy one for the differentiation of many yeast species, including the yeast Y. lipolytica.3.2. RFLP analysis of the 18S rDNA regionAs a result of 18S rDNA amplification, a single fragment with a molecular size of approximately 1629 bp formed for all of the Yarrowia lipolytica strains tested. Digestion of PCR products with restriction endonuclease HaeIII resulted in 5 fragments of 548, 321, 313, 270, and 177 bp from Y. lipolytica strains and the type strain of Y. lipolytica CBS6124 species (Figure 3); digestion of PCR products with restriction endonuclease RsaI resulted in 4 fragments of 574, 467, 449, and 139 bp from Y. lipolytica strains and the type strain of Y. lipolytica CBS6124 species; and digestion of PCR products with restriction endonuclease TaqI resulted in 6 fragments of 1022, 267, 206, 75, 47, and 12 bp from Y. lipolytica strains and the type strain of Y. lipolytica CBS6124 species. However, the presence of the bands not observed in the Figure 3 was virtually confirmed by the presence of fragments that developed after the cutting process at the Nebcutter web site (http://tools.neb.com/NEBcutter2/). No differences were observed among strains of the same species in Y. lipolytica (Table 2). All strains of Yarrowia lipolytica exhibited restriction profiles identical to the type strain of Y. lipolytica CBS6124.


252

Table 1. Yarrowia lipolytica strains analyzed in the present study.

SpeciesStrain designation

Isolation source ReferenceThis study Previous study

Y. lipolytica TEM YL 3 TEM YL 3 Full-fat cheese (9)Y. lipolytica TEM YL 5 TEM YL 5 Semi-fat cheese (9)Y. lipolytica TEM YL 6 TEM YL 6 Semi-fat cheese (9)Y. lipolytica TEM YL 9 TEM YL 9 Full-fat cheese (9)Y. lipolytica TEM YL 10 TEM YL 10 Full-fat cheese (9)Y. lipolytica TEM YL 17 TEM YL 17 Kaşar cheese (9)Y. lipolytica TEM YL 18 TEM YL 18 Kaşar cheese (9)Y. lipolytica TEM YL 19 TEM YL 19 Kaşar cheese (9)Y. lipolytica TEM YL 20 TEM YL 20 Kaşar cheese (9)Y. lipolytica TEM YL 21 TEM YL 21 Low-fat cheese (9)Y. lipolytica TEM ORC 2 Strain Number 2 Waste sludge (15)Y. lipolytica TEM ORC 3 Strain Number 3 Waste water (15)Y. lipolytica TEM ORC 4 Strain Number 4 Soil (15)Y. lipolytica TEM ORC 9 Strain Number 9 Soil (15)Y. lipolytica TEM ORC 10 Strain Number 10 Waste water (15)Y. lipolytica TEM ORC 11 Strain Number 11 Waste water (15)Y. lipolytica TEM ORC 12 Strain Number 12 Waste water (15)Y. lipolytica TEM ORC 13 Strain Number 13 Waste water (15)Y. lipolytica TEM ORC 17 Strain Number 17 Soil (15)Y. lipolytica TEM ORC 20 Strain Number 20 Waste water (15)Y. lipolytica TEM TAN 10 Isolate Number 10 White cheese (16)Y. lipolytica TEM TAN 46 Isolate Number 46 White cheese (17)

M T 3 5 6 9 10 17 18 19 20 21 Or2 Or3 Or4 M

1000 bp900 bp800 bp700 bp600 bp500 bp400 bp300 bp

200 bp

100 bp

1000 bp900 bp800 bp700 bp600 bp500 bp400 bp300 bp

200 bp

100 bp

M T Or9 Or10 Or11 Or12 Or13 Or17 Or20 Ta10 Ta46

Figure 1. Amplification of the ITS region of Yarrowia lipolytica strains. Line 1, M, DNA marker (100 bp); Line 2, T, Yarrowia lipolytica CBS6124 type strain; other lines show Yarrowia lipolytica strains, respectively.


253

Andrade et al. studied the RFLP analysis of 18S rDNA examined to discriminate yeast species usually found in dry-cured meat products, and they found that the RFLP of the 18S rDNA region allowed discrimination of the species Saccharomyces cerevisiae, Rhodotorula mucilaginosa, and Y. lipolytica (7). However, minimal differences at the strain level were found for all of the species tested. Results found in the literature about suitability of RFLP of the 18S rDNA are contradictory. Thus, this method has been also reported as unsuitable for the differentiation of yeasts while it has been proven as a useful technique for discriminating several yeast species such as Candida stellata, Metschnikowia pulcherrima, Kloeckera apiculata, and Schizosaccharomyces pombe (11). Therefore, this method is not used routinely for the discrimination of yeasts species; however, in our study, it was found to be effective in the discrimination of Y. lipolytica strains.

3.3. Amplification and sequencing of D1/D2 domain of 26S rDNA regionAs a result of the amplification of the D1/D2 domain of 26S rDNA region, a single fragment with a molecular size of approximately 550 bp formed for all of the Y. lipolytica strains tested. After sequencing, the sequences obtained were compared with the GenBank database using the BLASTN tool, as presented in Table 3. It was determined that all Y. lipolytica strains tested exhibited a high degree of homology (99% to 100%) with various Y. lipolytica strains present in the National Center for Biotechnology Information, as a result of BLAST analysis of the partial sequence of the 26S rRNA gene. The phylogenetic relationship between the 22 Y. lipolytica strains are shown in the Figure 4. The phylogenetic tree was reconstructed by the neighbor-joining method (24).

D1/D2 domain sequencing of 26S rDNA is being used more and more often to identify yeasts with both

1000 bp900 bp800 bp700 bp600 bp500 bp400 bp

300 bp250 bp200 bp

150 bp

100 bp

50 bp

M T 3 5 6 9 10 17 18 19 20 21 Or2

1000 bp900 bp800 bp700 bp600 bp500 bp400 bp

300 bp250 bp200 bp

150 bp

100 bp

50 bp

M T Or3 Or4 Or9 Or10 Or11 Or12 Or13 Or17 Or20 Ta10 Ta46

Figure 2. Restriction analysis with the endonucleases RsaI of ITS region. Line 1, M, DNA marker (50 bp); Line 2, T, Yarrowia lipolytica CBS6124 type strain; other lines show Yarrowia lipolytica strains, respectively.


254

ascomycetic and basidiomycetic affinities, leading to creation of a comprehensive database (13,25). Strains with more than 1% nucleotide substitutions in this region probably do not belong to the same species, although there are some reports of larger differences within the same species and of different species with identical D1/D2 sequences (25). In our study, when D1/D2 domain sequences of the 26S rDNA gene were compared with the GenBank database, 7 of the 22 strains were found to be 99% identical to the Y. lipolytica type strain, while another 15 strains were found to be 100% identical to the same type species in GenBank. Therefore, these strains were identified as Y. lipolytica strains.

Physiologically, Y. lipolytica strains are said to have biotechnological importance (26). Therefore, accurate

identification of local Y. lipolytica strains isolated from different environments is necessary. In recent years, many researchers have suggested that a polyphasic approach may be the best way to achieve proper microbial identification (6). In our study, accurate identification of Y. lipolytica strains was therefore performed using 3 different molecular biological methods. 3.4. Extracellular lipase production and analytical procedureA range of different lipids were screened for their capacity to support the growth of Y. lipolytica strains and lipase production. As indicated in Table 4, higher biomasses were obtained with tributyrin, olive oil, and fish oil, respectively. All lipid-related substrates supported lipase production

Table 2. Results of amplification and digestion of ITS1-5.8S rDNA-ITS2 region and 18S rDNA region of Yarrowia lipolytica strains. Fragment sizes smaller than 100 bp were not reported.

Yarrowia lipolytica

strains

ITS-PCR RFLP 18S rDNA PCR-RFLP

ITS PCR

Digestion with RE* 18S PCR

Digestion with RE

HaeIII RsaI Hinf I HaeIII RsaI TaqI

TEM YL 3 360 360 220+140 180+180 1629 548+321+313+270+177 574+467+449+139 1022+267+206TEM YL 5 360 360 220+140 180+180 1629 548+321+313+270+177 574+467+449+139 1022+267+206TEM YL 6 360 360 220+140 180+180 1629 548+321+313+270+177 574+467+449+139 1022+267+206TEM YL 9 360 360 220+140 180+180 1629 548+321+313+270+177 574+467+449+139 1022+267+206

TEM YL 10 360 360 220+140 180+180 1629 548+321+313+270+177 574+467+449+139 1022+267+206TEM YL 17 360 360 220+140 180+180 1629 548+321+313+270+177 574+467+449+139 1022+267+206TEM YL 18 360 360 220+140 180+180 1629 548+321+313+270+177 574+467+449+139 1022+267+206TEM YL 19 360 360 220+140 180+180 1629 548+321+313+270+177 574+467+449+139 1022+267+206TEM YL 20 360 360 220+140 180+180 1629 548+321+313+270+177 574+467+449+139 1022+267+206TEM YL 21 360 360 220+140 180+180 1629 548+321+313+270+177 574+467+449+139 1022+267+206TEM ORC 2 360 360 220+140 180+180 1629 548+321+313+270+177 574+467+449+139 1022+267+206TEM ORC 3 360 360 220+140 180+180 1629 548+321+313+270+177 574+467+449+139 1022+267+206TEM ORC 4 360 360 220+140 180+180 1629 548+321+313+270+177 574+467+449+139 1022+267+206TEM ORC 9 360 360 220+140 180+180 1629 548+321+313+270+177 574+467+449+139 1022+267+206

TEM ORC 10 360 360 220+140 180+180 1629 548+321+313+270+177 574+467+449+139 1022+267+206TEM ORC 11 360 360 220+140 180+180 1629 548+321+313+270+177 574+467+449+139 1022+267+206TEM ORC 12 360 360 220+140 180+180 1629 548+321+313+270+177 574+467+449+139 1022+267+206TEM ORC 13 360 360 220+140 180+180 1629 548+321+313+270+177 574+467+449+139 1022+267+206TEM ORC 17 360 360 220+140 180+180 1629 548+321+313+270+177 574+467+449+139 1022+267+206TEM ORC 20 360 360 220+140 180+180 1629 548+321+313+270+177 574+467+449+139 1022+267+206TEM TAN 10 360 360 220+140 180+180 1629 548+321+313+270+177 574+467+449+139 1022+267+206TEM TAN 46 360 360 220+140 180+180 1629 548+321+313+270+177 574+467+449+139 1022+267+206

Y. lipolytica CBS6124 360 360 220+140 180+180 1629 548+321+313+270+177 574+467+449+139 1022+267+206

*RE: restriction endonuclease.


255

levels ranging from 4.27 U/mL (tributyrin) to 37.08 U/mL (fish oil). Total protein of culture supernatants was correlated with extracellular lipase activities, where 1% fish oil exhibited maximum protein production and lipase activity (Table 4). Fish oil (1%) gave maximum specific activity in the supernatant (264.85 U/mg of protein) (Figure 5).

Production of industrial enzymes by local microorganism has contributed to the national economy. Hence, screening of microorganisms for selecting suitable strains is an important preliminary step in the production of desired metabolites (20). One of the most important products secreted by this yeast is lipase, which is an enzyme that attracts the interest of scientists and industrial researchers because it can be exploited for several applications in the detergent, food, pharmaceutical, and environmental industries (27). There are many studies on lipase production by Y. lipolytica (28–30). Kebabçı and

Cihangir (31) studied the effect of carbon and nitrogen sources on lipase production by 3 different Y. lipolytica strains, and the highest lipase activity was detected on the medium with canola oil (6 U/mL).

In conclusion, the results of the present study demonstrated the methods of RFLP analysis of ITS1-5.8S rDNA-ITS2 and 18S rDNA regions and sequencing of the D1/D2 domain of 26S rDNA region, which provide accurate identification for Yarrowia lipolytica strains. Furthermore, in this work, all Y. lipolytica strains isolated from different environments produced extracellular lipase, and the best lipase producer was Y. lipolytica strain TEM TAN 46 on the medium containing fish oils. Since the lipase enzyme obtained from Y. lipolytica strain TEM TAN 46 includes the data obtained from the crude lipase sample, it is thought that activity data of the enzyme biotechnologically promise more hope for pure preparations obtained after purification and characterization.

3000 bp2000 bp1500 bp1200 bp1000 bp900 bp800 bp700 bp600 bp500 bp400 bp

300 bp

200 bp

100 bp

M T 3 5 6 9 10 17 18 19 20 21 Or2

3000 bp2000 bp1500 bp1200 bp1000 bp900 bp800 bp700 bp600 bp500 bp400 bp

300 bp

200 bp

100 bp

M T Or3 Or4 Or9 Or10 Or11 Or12 Or13 Or17 Or20 Ta10 Ta46

Figure 3. Restriction analysis with the endonucleases HaeIII of 18S rDNA region. Line 1, M, DNA marker (100 bp); Line 2, T, Yarrowia lipolytica CBS6124 type strain; other lines show Yarrowia lipolytica strains, respectively.


256

Table 3. Results of partial sequence analysis of 26S rDNA region of Yarrowia lipolytica strains.

Yarrowia lipolyticastrains

Sequencing of D1/D2 domain of 26S rDNA region

26S PCR Accession number HomologyTEM YL 3 550 JN112343 99%TEM YL 5 550 JN112344 99%TEM YL 6 550 JN112345 99%TEM YL 9 550 JN112346 99%

TEM YL 10 550 JN112347 100%TEM YL 17 550 JN112348 100%TEM YL 18 550 JN112349 100%TEM YL 19 550 JN112350 99%TEM YL 20 550 JN112351 100%TEM YL 21 550 JN112352 99%TEM ORC 2 550 JN112353 100%TEM ORC 3 550 JN112354 99%TEM ORC 4 550 JN112355 100%TEM ORC 9 550 JN112356 100%

TEM ORC 10 550 JN112357 100%TEM ORC 11 550 JN112358 100%TEM ORC 12 550 JN112359 100%TEM ORC 13 550 JN112360 100%TEM ORC 17 550 JN112361 100%TEM ORC 20 550 JN112362 100%TEM TAN 10 550 JN112363 100%TEM TAN 46 550 JN112364 100%

Yarrowia lipolytica TEM ORC 3Yarrowia lipolytica TEM ORC 12Yarrowia lipolytica TEM ORC 10Yarrowia lipolytica TEM YL 21Yarrowia lipolytica TEM YL 10Yarrowia lipolytica TEM YL 18Yarrowia lipolytica TEM YL 9Yarrowia lipolytica TEM ORC 4Yarrowia lipolytica TEM YL 17Yarrowia lipolytica TEM YL 6Yarrowia lipolytica TEM ORC 2Yarrowia lipolytica TEM YL 5Yarrowia lipolytica TEM YL 20Yarrowia lipolytica TEM ORC 9Yarrowia lipolytica TEM ORC 11Yarrowia lipolytica TEM ORC 13Yarrowia lipolytica TEM ORC 17Yarrowia lipolytica TEM ORC 20Yarrowia lipolytica TEM TAN 10Yarrowia lipolytica TEM TAN 46Yarrowia lipolytica CBS 6124Yarrowia lipolytica TEM YL 3Yarrowia lipolytica TEM YL 19Candida sake KBP 3997

61

935

00

00

4

0

0

0

3

2

0

0

0

0

0

0

0

0

Figure 4. Phylogenetic relationship among 22 Yarrowia lipolytica strains, with Y. lipolytica CBS6124 type strain and Candida sake KBP 3997 as out-groups. The phylogenetic tree was reconstructed with the neighbor-joining method (23).


257

AcknowledgmentsThis work was financially supported by the Scientific Research Unit of Ege University (Project Number: 11 FEN 012). We would like to extend our thanks to the İzmir Institute of Technology Biotechnology and Bioengineering Central Research Laboratories (BİYOMER) for providing

laboratory facilities for DNA sequencing studies. We also thank Dr Tansel Yalçın and Orçun Güngör, MSc (Ege University) for providing some Y. lipolytica strains. This study was presented at the European Biotechnology Congress (28 September to 1 October 2011) in İstanbul, Turkey.

Table 4. Effect of different lipid sources in the medium on production of lipase by Yarrowia lipolytica strains.

Yarrowia lipolytica

strains

Olive oil Fish oil Tributyrin

Lipase activity(U/mL)

Total protein (mg/mL)

Specific lipase

activity(U/mg)



Specific lipase

activity(U/mg)



Specific lipase

activity(U/mg)

TEM YL 3 10.97 0.20 54.85 20.52 0.15 136.80 12.32 0.22 56.00TEM YL 5 12.48 0.18 69.33 17.28 0.12 144.00 11.48 0.15 76.53TEM YL 6 8.92 0.13 68.62 22.03 0.08 175.38 4.27 0.17 25.11TEM YL 9 16.20 0.22 73.63 15.45 0.45 34.33 11.65 0.10 115.50

TEM YL 10 22.89 0.29 78.93 23.87 0.12 198.13 6.90 0.50 13.80TEM YL 17 22.90 0.10 229.00 15.44 0.10 154.40 5.51 0.04 39.35TEM YL 18 15.93 0.23 69.26 13.78 0.11 125.27 13.22 0.10 132.20TEM YL 19 16.85 0.45 37.44 13.02 0.10 130.20 6.49 0.14 46.36TEM YL 20 20.04 0.26 77.08 12.81 0.25 51.24 12.82 0.24 53.42TEM YL 21 19.01 0.25 76.04 19.44 0.13 149.53 15.63 0.10 156.30TEM ORC 2 18.04 0.40 45.10 20.84 0.13 160.30 12.18 0.27 45.11TEM ORC 3 19.39 0.22 88.14 29.42 0.14 210.14 14.17 0.15 94.46TEM ORC 4 29.15 0.28 104.15 20.30 0.13 156.15 12.28 0.26 47.23TEM ORC 9 34.17 0.30 113.90 16.80 0.65 25.84 12.42 0.18 69.00

TEM ORC 10 12.48 0.15 83.20 14.15 0.13 108.84 12.33 0.57 21.63TEM ORC 11 21.92 0.21 104.38 22.95 0.15 153.00 12.86 0.32 40.18TEM ORC 12 24.62 0.22 111.90 21.11 0.12 175.92 4.38 0.26 16.85TEM ORC 13 22.00 0.18 122.22 31.47 0.15 209.80 6.50 0.13 50.00TEM ORC 17 14.48 0.24 60.33 20.30 0.49 41.43 14.27 0.49 29.12TEM ORC 20 14.48 0.30 48.26 11.24 0.17 66.12 14.24 0.10 142.40TEM TAN 10 13.83 0.28 47.78 19.60 0.15 130.66 15.42 0.17 90.70TEM TAN 46 14.32 0.18 79.55 37.08 0.14 264.85 15.71 0.95 16.54

Y. lipolytica CBS6124 12.89 0.32 40.28 11.03 0.39 28.28 12.74 0.47 27.11

05

10152025303540

Olive oil

a b

Fish oil Tributyrin

Lipa

se ac

tivity

(U/m

L)

Substrate 1% (w/v)

0

50

100

150

200

250

300

Olive oil Fish oil Tributyrin

Spec

ific l

ipas

e act

ivity

(U/m

g)

Substrate 1% (w/v)

Figure 5. Lipase activity and specific lipase activity of Yarrowia lipolytica TEM TAN 46 strain on 3 different oil sources after 48 h at 27 °C.


258

References

1. Cancino M, Bauchart P, Sandoval G et al. A variant of Yarrowia lipolytica lipase with improved activity and enantioselectivity for resolution of 2-bromo-arylacetic acid esters. Tetrahedron-Asymmetr 19: 1608–1612, 2008.

2. Darvishi F, Destain J, Nahvi I et al. High-level production of extracellular lipase by Yarrowia lipolytica mutants from methyl oleate. New Biotechnol 28: 756–760, 2011.

3. Pignede G, Wang H, Fudalej F et al. Characterization of an extracellular lipase encoded by LIP2 in Yarrowia lipolytica. J Bacteriol 182: 2802–2810, 2000.

4. Fickers P, Nicaud JM, Gaillardin C et al. Carbon and nitrogen sources modulate lipase production in the yeast Yarrowia lipolytica. J Appl Microbiol 96: 742–749, 2004.

5. Yu M, Qin S, Tan T. Purification and characterization of the extracellular lipase Lip2 from Yarrowia lipolytica. Process Biochem 42: 384–391, 2007.

6. Arias CR, Burns JK, Friedrich LM et al. Yeast species associated with orange juice: evaluation of different identification methods. Appl Environ Microb 68: 1955–1961, 2002.

7. Andrade MJ, Rodriguez M, Sánchez B et al. DNA typing methods for differentiation of yeasts related to dry-cured meat products. Int J Food Microbiol 107: 48–58, 2006.

8. Senses-Ergul S, Agoston R, Belak A et al. Characterization of some yeasts isolated from foods by traditional and molecular tests. Int J Food Microbiol 108: 120–124, 2006.

9. Akpınar O, Uçar F, Yalçın HT. Screening and regulation of alkaline extracellular protease and ribonuclease production of Yarrowia lipolytica strains isolated and identified from different cheeses in Turkey. Ann Microbiol 61: 907–915, 2011.

10. Lopandic K, Tiefenbrunner W, Gangl H et al. Molecular profiling of yeasts isolated during spontaneous fermentations of Austrian wines. FEMS Yeast Res 8: 1063–1075, 2008.

11. Capece A, Salzano G, Romano P. Molecular typing techniques as a tool to differentiate non-Saccharomyces wine species. Int J Food Microbiol 84: 33–39, 2003.

12. Martorell P, Espinar MT, Querol A. Sequence-based identification of species belonging to the genes Debaromyces. FEMS Yeast Res 5: 1157–1165, 2005.

13. Kurtzman CP, Robnett CJ. Identification and phylogeny of the ascomycetous yeasts from analysis of nuclear large subunit (26S) ribosomal DNA partial sequences. A Van Leeuw 73: 331–371, 1998.

14. Ramos JP, Rosa CA, Carvalho EMM et al. Heteroduplex mobility assay of the 26S rDNA D1⁄D2 region for differentiation of clinically relevant Candida species. A Van Leeuw 89: 39–44, 2006.

15. Güngör O, Uçar F, Yalçın HT et al. Isolation and identification of copper and nickel tolerant ascomycetous yeasts in Turkey. Fresen Environ Bull 20: 190–197, 2011.

16. Öztürk T. Isolation and identification of yeasts which produced extracellular lipases from different sources. MSc, Ege University Institute of Science, 2000.

17. Yalcin HT, Ucar F. Isolation and characterization of cheese spoiler yeast isolated from Turkish white cheeses. Ann Microbiol 59: 477–483, 2006.

18. Liu D, Coloe S, Baird R et al. Rapid mini-preparation of fungal DNA for PCR. J Clin Microbiol 38: 473, 2000.

19. White TJ, Bruns T, Lee S et al. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ et al. ed. PCR protocols: A Guide to Methods and Applications. Academic Press; 1990: pp. 315–322.

20. Silva WOB, Mitidieri S, Schrank A et al. Production and extraction of an extracellular lipase from the entomopathogenic fungus Metarhizium anisopliae. Process Biochem 40: 321–326, 2005.

21. Bradford MA. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 31: 426–428, 1976.

22. Deak T, Chen J, Beuchat LR. Molecular characterization of Yarrowia lipolytica and Candida zeylanoides isolated from poultry. Appl Environ Microb 66: 4340–4344, 2000.

23. Polomska X, Juszczyk P, Cadez N et al. Comparison of physiological and PCR-RFLP rDNA identification of yeast species commonly found in cheese. Pol J Food Nutr Sci 57: 221–226, 2007.

24. Saitou N, Nei M. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 4: 406–425, 1987.

25. Fell JW, Boekhout T, Fonseca A et al. Biodiversity and systematic of basidiomycetous yeasts as determined by large subunit rDNA D1/D2 domain sequence analysis. Int J Syst Bacteriol 50: 1351–1371, 2000.

26. Knutsen AK, Robert V, Poot GA et al. Polyphasic re-examination of Yarrowia lipolytica strains and the description of three novel Candida species: Candida oslonensis sp. nov., Candida alimentaria sp. nov. and Candida hollandica sp. nov. Int J Syst Evol Micr 57: 2426–2435, 2007.

27. Coelho MAZ, Amaral PFF, Belo I. Yarrowia lipolytica: an industrial workhorse. In: Méndez-Vilas A. ed. Current Research, Technology and Education Topics in Applied Microbiology and Microbial Biotechnology. Formatex; 2010: pp. 930–944.

28. Corzo G, Revah S. Production and characteristics of the lipase from Yarrowia lipolytica 681. Bioresource Technol 70: 173–180, 1999.

29. Aloulou A, Rodriguez AJ, Puccinelli D. Purification and biochemical characterization of the LIP2 lipase from Yarrowia lipolytica. Biochim Biophys Acta 1771: 228–237, 2007.

30. Babu IS, Rao GH. Lipase production by Yarrowia lipolytica NCIM 3589 in solid state fermentation using mixed substrate. Res J Microbiol 2: 469–474, 2007.

31. Kebabçı Ö, Cihangir N. Comparison of three Yarrowia lipolytica strains for lipase production: NBRC 1658, IFO 1195, and a local strain. Turk J Biol 36: 15–24, 2012.

molecular characterization of yarrowia lipolytica strains...

Documents